Gajewski, Andrzej; Kolenderski, Piotr L.
2016-10-01
There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the
Three-color Sagnac source of polarization-entangled photon pairs.
Hentschel, Michael; Hübel, Hannes; Poppe, Andreas; Zeilinger, Anton
2009-12-07
We demonstrate a compact and stable source of polarization-entangled pairs of photons, one at 810 nm wavelength for high detection efficiency and the other at 1550 nm for long-distance fiber communication networks. Due to a novel Sagnac-based design of the interferometer no active stabilization is needed. Using only one 30 mm ppKTP bulk crystal the source produces photons with a spectral brightness of 1.13 x 10(6) pairs/s/mW/THz with an entanglement fidelity of 98.2%. Both photons are single-mode fiber coupled and ready to be used in quantum key distribution (QKD) or transmission of photonic quantum states over large distances.
Narrowband polarization entangled telecom photon pair source
Kaiser , Florian; Issautier , Amandine; Alibart , Olivier; Martin , Anthony; Tanzilli , Sébastien
2011-01-01
Contributed Talk; International audience; During the last decade, quantum entanglement has paved the way out to of the lab modern applications such as quantum computation and communication. Today, small scale quantum networks exist already, but they are limited to a few 100 km distance, due to intrinsic fiber transmission losses and non perfect detectors. These networks are typically established using photon pair sources based on spontaneous parametric down conversion (SPDC). Widely used enta...
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Report on Pairing-based Cryptography.
Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily
2015-01-01
This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Directory of Open Access Journals (Sweden)
Michael F Sloma
2017-11-01
Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.
Sloma, Michael F; Mathews, David H
2017-11-01
Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.
mmpdb: An Open-Source Matched Molecular Pair Platform for Large Multiproperty Data Sets.
Dalke, Andrew; Hert, Jérôme; Kramer, Christian
2018-05-29
Matched molecular pair analysis (MMPA) enables the automated and systematic compilation of medicinal chemistry rules from compound/property data sets. Here we present mmpdb, an open-source matched molecular pair (MMP) platform to create, compile, store, retrieve, and use MMP rules. mmpdb is suitable for the large data sets typically found in pharmaceutical and agrochemical companies and provides new algorithms for fragment canonicalization and stereochemistry handling. The platform is written in Python and based on the RDKit toolkit. It is freely available from https://github.com/rdkit/mmpdb .
Qubit entanglement between ring-resonator photon-pair sources on a silicon chip
Silverstone, J. W.; Santagati, R.; Bonneau, D.; Strain, M. J.; Sorel, M.; O'Brien, J. L.; Thompson, M. G.
2015-01-01
Entanglement—one of the most delicate phenomena in nature—is an essential resource for quantum information applications. Scalable photonic quantum devices must generate and control qubit entanglement on-chip, where quantum information is naturally encoded in photon path. Here we report a silicon photonic chip that uses resonant-enhanced photon-pair sources, spectral demultiplexers and reconfigurable optics to generate a path-entangled two-qubit state and analyse its entanglement. We show that ring-resonator-based spontaneous four-wave mixing photon-pair sources can be made highly indistinguishable and that their spectral correlations are small. We use on-chip frequency demultiplexers and reconfigurable optics to perform both quantum state tomography and the strict Bell-CHSH test, both of which confirm a high level of on-chip entanglement. This work demonstrates the integration of high-performance components that will be essential for building quantum devices and systems to harness photonic entanglement on the large scale. PMID:26245267
Energy Technology Data Exchange (ETDEWEB)
Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)
2017-08-15
The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)
Ultrabright, narrow-band photon-pair source for atomic quantum memories
Tsai, Pin-Ju; Chen, Ying-Cheng
2018-06-01
We demonstrate an ultrabright, narrow-band and frequency-tunable photon-pair source based on cavity-enhanced spontaneous parametric down conversion (SPDC) which is compatible with atomic transition of rubidium D 2-line (780 nm) or cesium D 2-line (852 nm). With the pump beam alternating between a high and a low power phase, the output is switching between the optical parametric oscillator (OPO) and photon-pair generation mode. We utilize the OPO output light to lock the cavity length to maintain the double resonances of signal and idler, as well as to lock the signal frequency to cesium atomic transition. With a type-II phase matching and a double-passed pump scheme such that the cluster frequency spacing is larger than the SPDC bandwidth, the photon-pair output is in a nearly single-mode operation as confirmed by a scanning Fabry–Perot interferometer with its output detected by a photomultiplier. The achieved generation and detection rates are 7.24× {10}5 and 6142 s‑1 mW‑1, respectively. The correlation time of the photon pair is 21.6(2.2) ns, corresponding to a bandwidth of 2π × 6.6(6) MHz. The spectral brightness is 1.06× {10}5 s‑1 mW‑1 MHz‑1. This is a relatively high value under a single-mode operation with the cavity-SPDC scheme. The generated single photons can be readily used in experiments related to atomic quantum memories.
Radical-pair based avian magnetoreception
Procopio, Maria; Ritz, Thorsten
2014-03-01
Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.
Remote sensing of a NTC radio source from a Cluster tilted spacecraft pair
Directory of Open Access Journals (Sweden)
P. M. E. Décréau
2013-11-01
Full Text Available The Cluster mission operated a "tilt campaign" during the month of May 2008. Two of the four identical Cluster spacecraft were placed at a close distance (~50 km from each other and the spin axis of one of the spacecraft pair was tilted by an angle of ~46°. This gave the opportunity, for the first time in space, to measure global characteristics of AC electric field, at the sensitivity available with long boom (88 m antennas, simultaneously from the specific configuration of the tilted pair of satellites and from the available base of three satellites placed at a large characteristic separation (~1 RE. This paper describes how global characteristics of radio waves, in this case the configuration of the electric field polarization ellipse in 3-D-space, are identified from in situ measurements of spin modulation features by the tilted pair, validating a novel experimental concept. In the event selected for analysis, non-thermal continuum (NTC waves in the 15–25 kHz frequency range are observed from the Cluster constellation placed above the polar cap. The observed intensity variations with spin angle are those of plane waves, with an electric field polarization close to circular, at an ellipticity ratio e = 0.87. We derive the source position in 3-D by two different methods. The first one uses ray path orientation (measured by the tilted pair combined with spectral signature of magnetic field magnitude at source. The second one is obtained via triangulation from the three spacecraft baseline, using estimation of directivity angles under assumption of circular polarization. The two results are not compatible, placing sources widely apart. We present a general study of the level of systematic errors due to the assumption of circular polarization, linked to the second approach, and show how this approach can lead to poor triangulation and wrong source positioning. The estimation derived from the first method places the NTC source region in the
Sharp corners as sources of spiral pairs
International Nuclear Information System (INIS)
Biton, Y.; Rabinovitch, A.; Braunstein, D.; Friedman, M.; Aviram, I.
2010-01-01
It is demonstrated that using the FitzHugh-Nagumo model, stimulation of excitable media inside a region possessing sharp corners, can lead to the appearance of sources of spiral-pairs of sustained activity. The two conditions for such source creation are: The corners should be less than 120 deg. and the range of stimulating amplitudes should be small, occurring just above the threshold value and decreasing with the corner angle. The basic mechanisms driving the phenomenon are discussed. These include: A. If the corner angle is below 120 deg., the wave generated inside cannot emerge at the corner tip, resulting in the creation of two free edges which start spiraling towards each other. B. Spiraling must be strong enough; otherwise annihilation of the rotating arms would occur too soon to create a viable source. C. The intricacies of the different radii involved are elucidated. Possible applications in heart stimulation and in chemical reactions are considered.
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Effects of Sleep on Word Pair Memory in Children – Separating Item and Source Memory Aspects
Directory of Open Access Journals (Sweden)
Jing-Yi Wang
2017-09-01
Full Text Available Word paired-associate learning is a well-established task to demonstrate sleep-dependent memory consolidation in adults as well as children. Sleep has also been proposed to benefit episodic features of memory, i.e., a memory for an event (item bound into the spatiotemporal context it has been experienced in (source. We aimed to explore if sleep enhances word pair memory in children by strengthening the episodic features of the memory, in particular. Sixty-one children (8–12 years studied two lists of word pairs with 1 h in between. Retrieval testing comprised cued recall of the target word of each word pair (item memory and recalling in which list the word pair had appeared in (source memory. Retrieval was tested either after 1 h (short retention interval or after 11 h, with this long retention interval covering either nocturnal sleep or daytime wakefulness. Compared with the wake interval, sleep enhanced separate recall of both word pairs and the lists per se, while recall of the combination of the word pair and the list it had appeared in remained unaffected by sleep. An additional comparison with adult controls (n = 37 suggested that item-source bound memory (combined recall of word pair and list is generally diminished in children. Our results argue against the view that the sleep-induced enhancement in paired-associate learning in children is a consequence of sleep specifically enhancing the episodic features of the memory representation. On the contrary, sleep in children might strengthen item and source representations in isolation, while leaving the episodic memory representations (item-source binding unaffected.
Wilson, Jeffrey D.; Chaffee, Dalton W.; Wilson, Nathaniel C.; Lekki, John D.; Tokars, Roger P.; Pouch, John J.; Roberts, Tony D.; Battle, Philip; Floyd, Bertram M.; Lind, Alexander J.;
2016-01-01
A high generation rate photon-pair source using a dual element periodically-poled potassium titanyl phosphate (PP KTP) waveguide is described. The fully integrated photon-pair source consists of a 1064-nanometer pump diode laser, fiber-coupled to a dual element waveguide within which a pair of 1064-nanometer photons are up-converted to a single 532-nanometer photon in the first stage. In the second stage, the 532-nanometer photon is down-converted to an entangled photon-pair at 800 nanometer and 1600 nanometer which are fiber-coupled at the waveguide output. The photon-pair source features a high pair generation rate, a compact power-efficient package, and continuous wave (CW) or pulsed operation. This is a significant step towards the long term goal of developing sources for high-rate Quantum Key Distribution (QKD) to enable Earth-space secure communications. Characterization and test results are presented. Details and preliminary results of a laboratory free-space QKD experiment with the B92 protocol are also presented.
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Theoretical study of GC+/GC base pair derivatives
International Nuclear Information System (INIS)
Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu
2005-01-01
The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives
Theoretical analysis of noncanonical base pairing interactions in ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.
Efficient fiber-coupled single-photon sources based on quantum dots
DEFF Research Database (Denmark)
Daveau, Raphaël Sura
refrigeration with coupled quantum wells. Many photonic quantum information processing applications would benet from a highbrightness, ber-coupled source of triggered single photons. This thesis presents a study of such sources based on quantum dots coupled to unidirectional photonic-crystal waveguide devices.......6 %. This latter method opens a promising future for increasing the eciency and reliability of planar chip-based single-photon sources. Refrigeration of a solid-state system with light has potential applications for cooling small-scale electronic and photonic circuits. We show theoretically that two coupled...... semiconductor quantum wells are ecient cooling media because they support long-lived indirect electron-hole pairs. These pairs can be thermally excited to distinct higher-energy states with faster radiative recombination, thereby creating an ecient escape channel to remove thermal energy from the system. From...
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities.
Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi
2018-02-19
It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from http://www.ncRNA.org/RintW .
Learning preferences from paired opposite-based semantics
DEFF Research Database (Denmark)
Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier
2017-01-01
Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Thompson, Cynthia L
2016-05-01
Intraspecific variability in social systems is gaining increased recognition in primatology. Many primate species display variability in pair-living social organizations through incorporating extra adults into the group. While numerous models exist to explain primate pair-living, our tools to assess how and why variation in this trait occurs are currently limited. Here I outline an approach which: (i) utilizes conceptual models to identify the selective forces driving pair-living; (ii) outlines novel possible causes for variability in social organization; and (iii) conducts a holistic species-level analysis of social behavior to determine the factors contributing to variation in pair-living. A case study on white-faced sakis (Pithecia pithecia) is used to exemplify this approach. This species lives in either male-female pairs or groups incorporating "extra" adult males and/or females. Various conceptual models of pair-living suggest that high same-sex aggression toward extra-group individuals is a key component of the white-faced saki social system. Variable pair-living in white-faced sakis likely represents alternative strategies to achieve competency in this competition, in which animals experience conflicting selection pressures between achieving successful group defense and maintaining sole reproductive access to mates. Additionally, independent decisions by individuals may generate social variation by preventing other animals from adopting a social organization that maximizes fitness. White-faced saki inter-individual relationships and demographic patterns also lend conciliatory support to this conclusion. By utilizing both model-level and species-level approaches, with a consideration for potential sources of variation, researchers can gain insight into the factors generating variation in pair-living social organizations. © 2014 The Authors. American Journal of Primatology published by Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Gong, Yan-Xiao; Xie, Zhen-Da; Xu, Ping; Zhu, Shi-Ning; Yu, Xiao-Qiang; Xue, Peng
2011-01-01
We propose a scheme for the generation of counterpropagating polarization-entangled photon pairs from a dual-periodically-poled crystal. Compared with the usual forward-wave-type source, this source, in the backward-wave way, has a much narrower bandwidth. With a 2-cm-long bulk crystal, the bandwidths of the example sources are estimated to be 3.6 GHz, and the spectral brightnesses are more than 100 pairs/(s GHz mW). Two concurrent quasi-phase-matched spontaneous parametric down-conversion processes in a single crystal enable our source to be compact and stable. This scheme does not rely on any state projection and applies to both degenerate and nondegenerate cases, facilitating applications of the entangled photons.
A novel pseudo-complementary PNA G-C base pair
DEFF Research Database (Denmark)
Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn
2011-01-01
Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
Envisaging quantum transport phenomenon in a muddled base pair of DNA
Vohra, Rajan; Sawhney, Ravinder Singh
2018-05-01
The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
2016-01-01
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825
Multi-user distribution of polarization entangled photon pairs
Energy Technology Data Exchange (ETDEWEB)
Trapateau, J.; Orieux, A.; Diamanti, E.; Zaquine, I., E-mail: isabelle.zaquine@telecom-paristech.fr [LTCI, CNRS, Télécom ParisTech, Université Paris-Saclay, 75013 Paris (France); Ghalbouni, J. [Applied Physics Laboratory, Faculty of Sciences 2, Lebanese University, Campus Fanar, BP 90656 Jdeidet (Lebanon)
2015-10-14
We experimentally demonstrate multi-user distribution of polarization entanglement using commercial telecom wavelength division demultiplexers. The entangled photon pairs are generated from a broadband source based on spontaneous parametric down conversion in a periodically poled lithium niobate crystal using a double path setup employing a Michelson interferometer and active phase stabilisation. We test and compare demultiplexers based on various technologies and analyze the effect of their characteristics, such as losses and polarization dependence, on the quality of the distributed entanglement for three channel pairs of each demultiplexer. In all cases, we obtain a Bell inequality violation, whose value depends on the demultiplexer features. This demonstrates that entanglement can be distributed to at least three user pairs of a network from a single source. Additionally, we verify for the best demultiplexer that the violation is maintained when the pairs are distributed over a total channel attenuation corresponding to 20 km of optical fiber. These techniques are therefore suitable for resource-efficient practical implementations of entanglement-based quantum key distribution and other quantum communication network applications.
A study of electron-positron pair equilibria in models of compact X- and gamma-ray sources
International Nuclear Information System (INIS)
Bjoernsson, G.
1990-01-01
Thermal electron-positron pair equilibria in two temperature models of compact x ray and gamma ray sources are studied. The pairs are assumed to be heated by Coulomb interaction with the much hotter protons and cooled by bremsstrahlung emission, Compton scattering, and annihilation. Two parameters, the proton optical depth and the compactness, characterize each equilibrium state. It is shown that a careful account of the energy balance is very important when the stability properties of the pair equilibria in a spherical plasma cloud are determined. The equilibria are found to be unstable in a very limited range of compactness and proton optical depth. This particular instability is unlikely to be the cause of the observed variability of the compact sources and implies that it is possible to build up high pair densities by a thermal mechanism in two temperature environments. The most important result considers the effects of pairs on the structure of geometrically and effectively optically thin accretion disks. A new approach for solving for the equilibrium structure of the disks is presented. In effect, the pair equilibrium states are projected into the space spanned by the disk structure parameters. This allows a direct visualization of all possible disk solutions at once. Each solution profile needs to be calculated only once and a complete disk solution is obtained by a simple radial coordinate transformation. The disk solutions are thus seen to be scale free in terms of the radial coordinate as well as in terms of the mass of the central object and the accretion rate. Two particular disk solutions are given. It is shown that including electron-positron pairs in the disk structure calculations leads to a breakdown of the thin disk assumptions and that more detailed disk modeling is required before electron-positron pairs can be self-consistently included
Scheduling for dual-hop block-fading channels with two source-user pairs sharing one relay
Zafar, Ammar
2013-09-01
In this paper, we maximize the achievable rate region of a dual-hop network with two sources serving two users independently through a single shared relay. We formulate the problem as maximizing the sum of the weighted long term average throughputs of the two users under stability constraints on the long term throughputs of the source-user pairs. In order to solve the problem, we propose a joint user-and-hop scheduling scheme, which schedules the first or second hop opportunistically based on instantaneous channel state information, in order to exploit multiuser diversity and multihop diversity gains. Numerical results show that the proposed joint scheduling scheme enhances the achievable rate region as compared to a scheme that employs multi-user scheduling on the second-hop alone. Copyright © 2013 by the Institute of Electrical and Electronic Engineers, Inc.
Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo
2012-11-01
Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier
Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs
Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.
2011-01-01
We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.
Resource allocation for two source-destination pairs sharing a single relay with a buffer
Zafar, Ammar; Shaqfeh, Mohammad; Alouini, Mohamed-Slim; Alnuweiri, Hussein M.
2014-01-01
In this paper, we obtain the optimal resource allocation scheme in order to maximize the achievable rate region in a dual-hop system that consists of two independent source-destination pairs sharing a single half-duplex relay. The relay decodes
Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA
International Nuclear Information System (INIS)
Mendel, D.; Dervan, P.B.
1987-01-01
Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired
Experimental many-pairs nonlocality
Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian
2017-08-01
Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.
Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers
Directory of Open Access Journals (Sweden)
Karsten Rottwitt
2018-05-01
Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.
Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex
International Nuclear Information System (INIS)
Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.
1989-01-01
The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Prediction of plant promoters based on hexamers and random triplet pair analysis
Directory of Open Access Journals (Sweden)
Noman Nasimul
2011-06-01
Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies
Free-Space Quantum Key Distribution with a High Generation Rate KTP Waveguide Photon-Pair Source
Wilson, J.; Chaffee, D.; Wilson, N.; Lekki, J.; Tokars, R.; Pouch, J.; Lind, A.; Cavin, J.; Helmick, S.; Roberts, T.;
2016-01-01
NASA awarded Small Business Innovative Research (SBIR) contracts to AdvR, Inc to develop a high generation rate source of entangled photons that could be used to explore quantum key distribution (QKD) protocols. The final product, a photon pair source using a dual-element periodically- poled potassium titanyl phosphate (KTP) waveguide, was delivered to NASA Glenn Research Center in June of 2015. This paper describes the source, its characterization, and its performance in a B92 (Bennett, 1992) protocol QKD experiment.
Energy Technology Data Exchange (ETDEWEB)
Zhu, Feng; Zhang, Chun-Hui; Liu, Ai-Ping [Institute of Signal Processing Transmission, Nanjing University of Posts and Telecommunications, Nanjing 210003 (China); Key Lab of Broadband Wireless Communication and Sensor Network Technology, Nanjing University of Posts and Telecommunications, Ministry of Education, Nanjing 210003 (China); Wang, Qin, E-mail: qinw@njupt.edu.cn [Institute of Signal Processing Transmission, Nanjing University of Posts and Telecommunications, Nanjing 210003 (China); Key Lab of Broadband Wireless Communication and Sensor Network Technology, Nanjing University of Posts and Telecommunications, Ministry of Education, Nanjing 210003 (China); Key Laboratory of Quantum Information, University of Science and Technology of China, Hefei 230026 (China)
2016-04-01
In this paper, we propose to implement the heralded pair-coherent source into the measurement-device-independent quantum key distribution. By comparing its performance with other existing schemes, we demonstrate that our new scheme can overcome many shortcomings existing in current schemes, and show excellent behavior in the quantum key distribution. Moreover, even when taking the statistical fluctuation into account, we can still obtain quite high key generation rate at very long transmission distance by using our new scheme. - Highlights: • Implement the heralded pair-coherent source into the measurement-device-independent quantum key distribution. • Overcome many shortcomings existing in current schemes and show excellent behavior. • Obtain quite high key generation rate even when taking statistical fluctuation into account.
Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise
International Nuclear Information System (INIS)
Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael
2009-01-01
The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.
Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma.
Hirao, Ichiro; Kimoto, Michiko
2012-01-01
Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.
Directory of Open Access Journals (Sweden)
Sergei Kuchin
2011-03-01
Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.
Li, Chunhui; Sun, Lian; Jia, Junxiang; Cai, Yanpeng; Wang, Xuan
2016-07-01
Source water areas are facing many potential water pollution risks. Risk assessment is an effective method to evaluate such risks. In this paper an integrated model based on k-means clustering analysis and set pair analysis was established aiming at evaluating the risks associated with water pollution in source water areas, in which the weights of indicators were determined through the entropy weight method. Then the proposed model was applied to assess water pollution risks in the region of Shiyan in which China's key source water area Danjiangkou Reservoir for the water source of the middle route of South-to-North Water Diversion Project is located. The results showed that eleven sources with relative high risk value were identified. At the regional scale, Shiyan City and Danjiangkou City would have a high risk value in term of the industrial discharge. Comparatively, Danjiangkou City and Yunxian County would have a high risk value in terms of agricultural pollution. Overall, the risk values of north regions close to the main stream and reservoir of the region of Shiyan were higher than that in the south. The results of risk level indicated that five sources were in lower risk level (i.e., level II), two in moderate risk level (i.e., level III), one in higher risk level (i.e., level IV) and three in highest risk level (i.e., level V). Also risks of industrial discharge are higher than that of the agricultural sector. It is thus essential to manage the pillar industry of the region of Shiyan and certain agricultural companies in the vicinity of the reservoir to reduce water pollution risks of source water areas. Copyright © 2016 Elsevier B.V. All rights reserved.
Signature scheme based on bilinear pairs
Tong, Rui Y.; Geng, Yong J.
2013-03-01
An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Accurate interaction energies of base pairing and base stacking. The final chapter
Czech Academy of Sciences Publication Activity Database
Šponer, Jiří; Jurečka, Petr; Hobza, Pavel
2005-01-01
Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics
Silva, Jorge; Chau, Tom
2005-09-01
Recent advances in sensor technology for muscle activity monitoring have resulted in the development of a coupled microphone-accelerometer sensor pair for physiological acousti signal recording. This sensor can be used to eliminate interfering sources in practical settings where the contamination of an acoustic signal by ambient noise confounds detection but cannot be easily removed [e.g., mechanomyography (MMG), swallowing sounds, respiration, and heart sounds]. This paper presents a mathematical model for the coupled microphone-accelerometer vibration sensor pair, specifically applied to muscle activity monitoring (i.e., MMG) and noise discrimination in externally powered prostheses for below-elbow amputees. While the model provides a simple and reliable source separation technique for MMG signals, it can also be easily adapted to other aplications where the recording of low-frequency (< 1 kHz) physiological vibration signals is required.
AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis
Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian
2016-01-01
Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...
Beisel, Chase L.; Storz, Gisela
2011-01-01
SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
DFT study on metal-mediated uracil base pair complexes
Directory of Open Access Journals (Sweden)
Ayhan Üngördü
2017-11-01
Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.
Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair
Chawla, Mohit
2018-01-02
The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.
International Nuclear Information System (INIS)
Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.
1988-01-01
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met
Micromechanics of base pair unzipping in the DNA duplex
International Nuclear Information System (INIS)
Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V
2012-01-01
All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)
NOTE TAKING PAIRS TO IMPROVE STUDENTS‟ SENTENCE BASED WRITING ACHIEVEMENT
Directory of Open Access Journals (Sweden)
Testiana Deni Wijayatiningsih
2017-04-01
Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.
AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions.
Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej
2005-05-04
The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.
AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions
International Nuclear Information System (INIS)
Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.
2005-01-01
The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible
Chawla, Mohit
2015-06-27
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi
2015-01-01
Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.
McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F
2015-01-01
Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.
Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae
Lang, Gregory I.; Murray, Andrew W.
2008-01-01
Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.
2015-01-01
Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non
Zhang, Yuetao
2012-01-01
Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-01
The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
Charge transfer in DNA: role of base pairing
Czech Academy of Sciences Publication Activity Database
Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan
2009-01-01
Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009
Positron energy distributions from a hybrid positron source based on channeling radiation
International Nuclear Information System (INIS)
Azadegan, B.; Mahdipour, A.; Dabagov, S.B.; Wagner, W.
2013-01-01
A hybrid positron source which is based on the generation of channeling radiation by relativistic electrons channeled along different crystallographic planes and axes of a tungsten single crystal and subsequent conversion of radiation into e + e − -pairs in an amorphous tungsten target is described. The photon spectra of channeling radiation are calculated using the Doyle–Turner approximation for the continuum potentials and classical equations of motion for channeled particles to obtain their trajectories, velocities and accelerations. The spectral-angular distributions of channeling radiation are found applying classical electrodynamics. Finally, the conversion of radiation into e + e − -pairs and the energy distributions of positrons are simulated using the GEANT4 package
Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L
2012-07-01
Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the
Photochemical selectivity in guanine-cytosine base-pair structures
Czech Academy of Sciences Publication Activity Database
Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.
2005-01-01
Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005
Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs.
Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T
2012-02-15
We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs
Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias
2012-01-01
We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...
Indian Academy of Sciences (India)
The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...
Concealed d-wave pairs in the s± condensate of iron-based superconductors.
Ong, Tzen; Coleman, Piers; Schmalian, Jörg
2016-05-17
A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.
Hybrid TLC-pair meter for the Sphinx Project
Wada, T.; Yamamoto, I.; Takahashi, N.; Misaki, A.
1985-01-01
The chief aims in THE SPHINX PROJECT are research of super lepton physics and new detector experiments. At the second phase of THE SPHINX PROJECT, a hybrid TLC-PAIR METER was designed for measuring high energy neutrino sources (E upsilon * TeV), searching high energy muon sources (E mu TeV) and measuring muon group (E mu 1 TeV). The principle of PAIR METER has been already proposed. In this TLC-PAIR METER, electromagnetic shower induced by cosmic ray muons are detected using TL (Thermoluminescence) sheets with position counters.
Hybrid TLC-pair meter for the Sphinx Project
International Nuclear Information System (INIS)
Wada, T.; Yamamoto, I.; Takahashi, N.; Misaki, A.
1985-01-01
The chief aims in the Sphinx Project are research on super lepton physics and new detector experiments. In the second phase of the Sphinx Project, a hybrid TLC-pair meter was designed for measuring for high energy neutrino sources (E upsilon * TeV), searching high energy muon sources (E mu TeV), and measuring muon groups (E mu 1 TeV). The principle of the pair meter has been already proposed. In this TLC pair meter, electromagnetic showers induced by cosmic ray muons are detected using thermoluminescene sheets with position counters
Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing
Directory of Open Access Journals (Sweden)
Shu-ichi Nakano
2014-08-01
Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Polarization entangled photon pair source for space-based quantum communication, Phase I
National Aeronautics and Space Administration — The overall goal of this NASA effort is to develop and deliver efficient, single-pass quantum optical waveguide sources generating high purity hyper-entangled photon...
An entropy-based improved k-top scoring pairs (TSP) method for ...
African Journals Online (AJOL)
An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Performance of various density functionals for the hydrogen bonds in DNA base pairs
van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.
2006-01-01
We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps
International Nuclear Information System (INIS)
Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas
2012-01-01
We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)
International Nuclear Information System (INIS)
Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo
2012-01-01
Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.
Ultrabright femtosecond source of biphotons based on a spatial mode inverter.
Jarutis, Vygandas; Juodkazis, Saulius; Mizeikis, Vygantas; Sasaki, Keiji; Misawa, Hiroaki
2005-02-01
A method of enhancing the efficiency of entangled biphoton sources based on a type II femtosecond spontaneous parametric downconversion (SPDC) process is proposed and implemented experimentally. Enhancement is obtained by mode inversion of one of the SPDC output beams, which allows the beams to overlap completely, thus maximizing the number of SPDC photon pairs with optimum spatiotemporal overlap. By use of this method, biphoton count rates as high as 16 kHz from a single 0.5-mm-long beta-barium borate crystal pumped by second-harmonic radiation from a Ti:sapphire laser were obtained.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls
Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David
2015-01-01
International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.
Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard
2012-11-01
8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127
Generation of narrow-band polarization-entangled photon pairs at a rubidium D1 line
International Nuclear Information System (INIS)
Tian Long; Li Shujing; Yuan Haoxiang; Wang Hai
2016-01-01
Using the process of cavity-enhanced spontaneous parametric down-conversion (SPDC), we generate a narrow-band polarization-entangled photon pair resonant on the rubidium (Rb) D1 line (795 nm). The degenerate single-mode photon pair is selected by multiple temperature controlled etalons. The linewidth of generated polarization-entangled photon pairs is 15 MHz which matches the typical atomic memory bandwidth. The measured Bell parameter for the polarization-entangled photons S = 2.73 ± 0.04 which violates the Bell-CHSH inequality by ∼18 standard deviations. The presented entangled photon pair source could be utilized in quantum communication and quantum computing based on quantum memories in atomic ensemble. (author)
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Time series regression-based pairs trading in the Korean equities market
Kim, Saejoon; Heo, Jun
2017-07-01
Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.
A rule of seven in Watson-Crick base-pairing of mismatched sequences.
Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip
2012-05-13
Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.
Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding
2013-07-16
Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.
Femtosecond Laser--Pumped Source of Entangled Photons for Quantum Cryptography Applications
International Nuclear Information System (INIS)
Pan, D.; Donaldson, W.; Sobolewski, R.
2007-01-01
We present an experimental setup for generation of entangled-photon pairs via spontaneous parametric down-conversion, based on the femtosecond-pulsed laser. Our entangled-photon source utilizes a 76-MHz-repetition-rate, 100-fs-pulse-width, mode-locked, ultrafast femtosecond laser, which can produce, on average, more photon pairs than a cw laser of an equal pump power. The resulting entangled pairs are counted by a pair of high-quantum-efficiency, single-photon, silicon avalanche photodiodes. Our apparatus s intended as an efficient source/receiver system for the quantum communications and quantum cryptography applications
Moddemeijer, R
In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a
Distributed wireless quantum communication networks with partially entangled pairs
International Nuclear Information System (INIS)
Yu Xu-Tao; Zhang Zai-Chen; Xu Jin
2014-01-01
Wireless quantum communication networks transfer quantum state by teleportation. Existing research focuses on maximal entangled pairs. In this paper, we analyse the distributed wireless quantum communication networks with partially entangled pairs. A quantum routing scheme with multi-hop teleportation is proposed. With the proposed scheme, is not necessary for the quantum path to be consistent with the classical path. The quantum path and its associated classical path are established in a distributed way. Direct multi-hop teleportation is conducted on the selected path to transfer a quantum state from the source to the destination. Based on the feature of multi-hop teleportation using partially entangled pairs, if the node number of the quantum path is even, the destination node will add another teleportation at itself. We simulated the performance of distributed wireless quantum communication networks with a partially entangled state. The probability of transferring the quantum state successfully is statistically analyzed. Our work shows that multi-hop teleportation on distributed wireless quantum networks with partially entangled pairs is feasible. (general)
Clock synchronization by remote detection of correlated photon pairs
Energy Technology Data Exchange (ETDEWEB)
Ho, Caleb; Lamas-Linares, AntIa; Kurtsiefer, Christian [Centre for Quantum Technologies, National University of Singapore, 3 Science Drive 2, 117543 (Singapore)], E-mail: christian.kurtsiefer@gmail.com
2009-04-15
In this study, we present an algorithm to detect the time and frequency differences of independent clocks based on observation of time-correlated photon pairs. This enables remote coincidence identification in entanglement-based quantum key distribution schemes without dedicated coincidence hardware, pulsed sources with a timing structure or very stable reference clocks. We discuss the method for typical operating conditions and show that the requirement for reference clock accuracy can be relaxed by about five orders of magnitude in comparison with previous schemes.
NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex
International Nuclear Information System (INIS)
Li, Ying; Wilson, W.D.; Zon, G.
1991-01-01
1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted
Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes
Directory of Open Access Journals (Sweden)
Ji-Jian Chin
2014-01-01
Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
Efficient and provable secure pairing-free security-mediated identity-based identification schemes.
Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W
2014-01-01
Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.
The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Leszczynski, J.
2001-01-01
Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001
High-speed true random number generation based on paired memristors for security electronics
Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru
2017-11-01
True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.
Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs.
Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei
2017-11-03
Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
DEFF Research Database (Denmark)
Carli, Lorenzo; Genta, G; Cantatore, Angela
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...
Perturbative neutrino pair creation by an external source
International Nuclear Information System (INIS)
Koers, Hylke B.J.
2005-01-01
We consider the rate of fermion-antifermion pair creation by an external field. We derive a rate formula that is valid for a coupling with arbitrary vector and axial vector components to first order in perturbation theory. This is then applied to study the creation of neutrinos by nuclear matter, a problem with astrophysical relevance. We present an estimate for the creation rate per unit volume, compare this to previous results and comment on the role of the neutrino mass
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
Energy Technology Data Exchange (ETDEWEB)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: kurita@cs.tut.ac.jp [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)
2016-02-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.
DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water
International Nuclear Information System (INIS)
Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.
2016-01-01
To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes
Dye-sensitized solar cell with a pair of carbon-based electrodes
International Nuclear Information System (INIS)
Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun
2012-01-01
We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)
Single base pair mutation analysis by PNA directed PCR clamping
DEFF Research Database (Denmark)
Ørum, H.; Nielsen, P.E.; Egholm, M.
1993-01-01
A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....
PandA : pairings and arithmetic
Chuengsatiansup, C.; Naehrig, M.; Ribarski, P.; Schwabe, P.; Cao, Z.; Zhang, F.
2014-01-01
This paper introduces PandA, a software framework for Pairings and Arithmetic. It is designed to bring together advances in the efficient computation of cryptographic pairings and the development and implementation of pairing-based protocols. The intention behind the PandA framework is to give
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
International Nuclear Information System (INIS)
Katsoyiannis, Athanasios; Breivik, Knut
2014-01-01
Polycyclic Aromatic Hydrocarbons (PAHs) molecular diagnostic ratios (MDRs) are unitless concentration ratios of pair-PAHs with the same molecular weight (MW); MDRs have long been used as a tool for PAHs source identification purposes. In the present paper, the efficiency of the MDR methodology is evaluated through the use of a multimedia fate model, the calculation of characteristic travel distances (CTD) and the estimation of air concentrations for individual PAHs as a function of distance from an initial point source. The results show that PAHs with the same MW are sometimes characterized by substantially different CTDs and therefore their air concentrations and hence MDRs are predicted to change as the distance from the original source increases. From the assessed pair-PAHs, the biggest CTD difference is seen for Fluoranthene (107 km) vs. Pyrene (26 km). This study provides a strong indication that MDRs are of limited use as a source identification tool. -- Highlights: • Model-based evaluation of the PAHs molecular diagnostic ratios efficiency. • Individual PAHs are characterized by different characteristic travel distances. • MDRs are proven to be a limited tool for source identification. • Use of MDRs for other environmental media is likely unfeasible. -- PAHs molecular diagnostic ratios which change greatly as a function of distance from the emitting source are improper for source identification purposes
Directory of Open Access Journals (Sweden)
Rie Kawai
2012-03-01
Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
-bonds in the А·Т base pair are cooperative, reinforcing each other, whereas the C2H⋯O2 H-bond in the А(∗)·Т(∗) base pair behaves anticooperatively, in other words it gets weakened while two others get strengthened. From a quantum-mechanical point of view, the A(∗)·T(∗) Löwdin's base pair appeared to be dynamically unstable because the electronic energy of the back-reaction barrier of the A·T → A(∗)·T(∗) tautomerization does not exceed zero-point vibrational energy associated with the mode for which vibrational frequency becomes imaginary in the TS of tautomerization. Additionally, it was demonstrated using the conductor-like polarizable continuum model that the effects of biomolecular environment (ϵ = 4) cannot ensure dynamic stabilization of the A(∗)·T(∗) Löwdin's base pair. These findings, together with data available from the literature, indicate that the tautomerization of the A·T Watson-Crick base pair to the A(∗)·T(∗) Löwdin's base pair through the DPT cannot be a source of spontaneous point errors that occur during DNA replication.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liang, Feng; Lindsay, Stuart; Zhang, Peiming
2012-11-21
With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.
Bremsstrahlung pair-production of positrons with low neutron background
International Nuclear Information System (INIS)
Lessner, E.
1998-01-01
Minimization of component activation is highly desirable at accelerator-based positron sources. Electrons in the 8- to 14-MeV energy range impinging on a target produce photons energetic enough to create electron-positron pairs; however, few of the photons are energetic enough to produce photoneutrons. Slow positron production by low-energy electrons impinging on a multilayer tungsten target with and without electromagnetic extraction between the layers was studied by simulation. The neutron background from 14-MeV electrons is expected to be significantly lower than that encountered with higher-energy electron beams. Numerical results are presented and some ideas for a low-activation slow-positron source are discussed
Paired structures and other opposite-based models
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel
2015-01-01
, that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...
International Nuclear Information System (INIS)
Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun
2017-01-01
Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.
DNA electronic circular dichroism on the inter-base pair scale
DEFF Research Database (Denmark)
Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer
2015-01-01
A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....
Pair creation at large inherent angles
International Nuclear Information System (INIS)
Chen, P.; Tauchi, T.; Schroeder, D.V.
1992-01-01
In the next-generation linear colliders, the low-energy e + e - pairs created during the collision of high-energy e + e - beams would cause potential deleterious background problems to the detectors. At low collider energies, the pairs are made essentially by the incoherent process, where the pair is created by the interaction of beamstrahlung photons on the individual particles in the oncoming beam. This problem was first identified by Zolotarev, et al. At energies where the beamstrahlung parameter Υ lies approximately in the range 0.6 approx-lt Υ approx-lt 100, pair creation from the beamstrahlung photons is dominated by a coherent process, first noted by Chen. The seriousness of this pair creation problem lies in the transverse momenta that the pair particles carry when leaving the interaction point (IP) with large angles. Since the central issue is the transverse momentum for particles with large angles, the authors notice that there is another source for it. Namely, when the pair particles are created at low energies, the intrinsic angles of these pairs when produced may already be large. In this paper they reinvestigate the problem, following essentially the same equivalent photon approach, but with changes in specific details including the virtual photon spectrum. In addition, various assumptions are made more explicit. The formulas derived are then applied to the collider parameters designed by Palmer
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
X-ray flares from runaway pair production in active galactic nuclei
Kirk, J. G.; Mastichiadis, A.
1992-01-01
The hard X-ray spectrum of AGNs is nonthermal, probably arising from an electron-positron pair cascade, with some emission reflected off relatively cold matter. There has been interest in models on which protons are accelerated and create relativistic electrons on interaction with a local radiation field. It is shown here that a sufficient column density of protons can lead to runaway pair production: photons generated by the relativistic pairs are the targets for the protons to produce more pairs. This can produce X-ray fluxes with the characteristics observed in AGN. The model predicts the maximum ratio of luminosity to source size as well as their spectrum in the early phases. The same mechanism may also be able to create the knots of synchrotron-radiating pair plasma seen in sources such as 3C273.
Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J
2012-09-12
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.
Directory of Open Access Journals (Sweden)
Das Tanmoy
2012-03-01
Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.
Non-standard base pairing and stacked structures in methyl xanthine clusters
Czech Academy of Sciences Publication Activity Database
Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.
2008-01-01
Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008
Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie
2017-10-06
In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Complementary b/y fragment ion pairs from post-source decay (PSD) of metastable YahO protein ion were evaluated for use in the calibration of MALDI-TOF-TOF for tandem mass spectrometry (MS/MS). The yahO gene from pathogenic Escherichia coli O157:H7 strain EDL933 was cloned into a pBAD18 plasmid vect...
Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators
International Nuclear Information System (INIS)
Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.
1985-01-01
The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states
International Nuclear Information System (INIS)
Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi
2010-01-01
2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.
2013-01-01
Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596
Efficient Implementation of the Pairing on Mobilephones Using BREW
Yoshitomi, Motoi; Takagi, Tsuyoshi; Kiyomoto, Shinsaku; Tanaka, Toshiaki
Pairing based cryptosystems can accomplish novel security applications such as ID-based cryptosystems, which have not been constructed efficiently without the pairing. The processing speed of the pairing based cryptosystems is relatively slow compared with the other conventional public key cryptosystems. However, several efficient algorithms for computing the pairing have been proposed, namely Duursma-Lee algorithm and its variant ηT pairing. In this paper, we present an efficient implementation of the pairing over some mobilephones. Moreover, we compare the processing speed of the pairing with that of the other standard public key cryptosystems, i. e. RSA cryptosystem and elliptic curve cryptosystem. Indeed the processing speed of our implementation in ARM9 processors on BREW achieves under 100 milliseconds using the supersingular curve over F397. In addition, the pairing is more efficient than the other public key cryptosystems, and the pairing can be achieved enough also on BREW mobilephones. It has become efficient enough to implement security applications, such as short signature, ID-based cryptosystems or broadcast encryption, using the pairing on BREW mobilephones.
Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.
2012-01-01
8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947
Ma, Yongtao; Zhou, Liuji; Liu, Kaihua
2013-01-01
The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Metalophillic attraction in the consecutive T-HgII-T DNA base pairs
Czech Academy of Sciences Publication Activity Database
Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír
2012-01-01
Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry
International Nuclear Information System (INIS)
Hori, Yasuaki; Hirai, Akiko; Minoshima, Kaoru
2011-01-01
A prism-pair interferometer comprising two homodyne interferometers with a common light source was developed for high-precision measurements of the refractive index of optical glasses with an uncertainty of the order of 10 -6 . The two interferometers measure changes in the optical path length in the glass sample and in air, respectively. Uncertainties in the absolute wavelength of the common light source are cancelled out by calculating a ratio between the results from the interferometers. Uncertainties in phase measurement are suppressed by a quadrature detection system. The combined standard uncertainty of the developed system is evaluated as 1.1x10 -6 .
Energy-Tunable Sources of Entangled Photons: A Viable Concept for Solid-State-Based Quantum Relays
Trotta, Rinaldo; Martín-Sánchez, Javier; Daruka, Istvan; Ortix, Carmine; Rastelli, Armando
2015-04-01
We propose a new method of generating triggered entangled photon pairs with wavelength on demand. The method uses a microstructured semiconductor-piezoelectric device capable of dynamically reshaping the electronic properties of self-assembled quantum dots (QDs) via anisotropic strain engineering. Theoretical models based on k .p theory in combination with finite-element calculations show that the energy of the polarization-entangled photons emitted by QDs can be tuned in a range larger than 100 meV without affecting the degree of entanglement of the quantum source. These results pave the way towards the deterministic implementation of QD entanglement resources in all-electrically-controlled solid-state-based quantum relays.
Arhatari, Benedicta D.; Abbey, Brian
2018-01-01
Ross filter pairs have recently been demonstrated as a highly effective means of producing quasi-monoenergetic beams from polychromatic X-ray sources. They have found applications in both X-ray spectroscopy and for elemental separation in X-ray computed tomography (XCT). Here we explore whether they could be applied to the problem of metal artefact reduction (MAR) for applications in medical imaging. Metal artefacts are a common problem in X-ray imaging of metal implants embedded in bone and soft tissue. A number of data post-processing approaches to MAR have been proposed in the literature, however these can be time-consuming and sometimes have limited efficacy. Here we describe and demonstrate an alternative approach based on beam conditioning using Ross filter pairs. This approach obviates the need for any complex post-processing of the data and enables MAR and segmentation from the surrounding tissue by exploiting the absorption edge contrast of the implant.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
Multi-pair states in electron–positron pair creation
Directory of Open Access Journals (Sweden)
Anton Wöllert
2016-09-01
Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
Energy Technology Data Exchange (ETDEWEB)
Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.
2016-09-10
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
Multi-pair states in electron–positron pair creation
International Nuclear Information System (INIS)
Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.
2016-01-01
Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.
International Nuclear Information System (INIS)
Swasey, Steven M; Gwinn, Elisabeth G
2016-01-01
The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)
Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version)
2014-12-11
Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F
2011-01-01
Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
by the weakening of the lower H-bond. At that point, the upper N4H⋯O6 and O6H⋯N4 H-bonds in the G·C and G*·C* base pairs, respectively, remain constant at the changes of the middle and the lower H-bonds at the beginning and at the ending of the G·C ↔ G*·C* tautomerization. Aiming to answer the question posed in the title of the article, we established that the G*·C* Löwdin's base pair satisfies all the requirements necessary to cause point mutations in DNA except its lifetime, which is much less than the period of time required for the replication machinery to forcibly dissociate a base pair into the monomers (several ns) during DNA replication. So, from the physicochemical point of view, the G*·C* Löwdin's base pair cannot be considered as a source of point mutations arising during DNA replication.
Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs
International Nuclear Information System (INIS)
Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie
2015-01-01
Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm
Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs
Directory of Open Access Journals (Sweden)
Ye Zhi-Qiang
2011-08-01
Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.
Accelerator based continuous neutron source.
Shapiro, S M; Ruggiero, A G
2003-01-01
Until the last decade, most neutron experiments have been performed at steady-state, reactor-based sources. Recently, however, pulsed spallation sources have been shown to be very useful in a wide range of neutron studies. A major review of neutron sources in the US was conducted by a committee chaired by Nobel laureate Prof. W. Kohn: ''Neutron Sources for America's Future-BESAC Panel on Neutron Sources 1/93''. This distinguished panel concluded that steady state and pulsed sources are complementary and that the nation has need for both to maintain a balanced neutron research program. The report recommended that both a new reactor and a spallation source be built. This complementarity is recognized worldwide. The conclusion of this report is that a new continuous neutron source is needed for the second decade of the 20 year plan to replace aging US research reactors and close the US neutron gap. it is based on spallation production of neutrons using a high power continuous superconducting linac to generate pr...
International Nuclear Information System (INIS)
Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia
2014-01-01
The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR
International Nuclear Information System (INIS)
Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.
1995-01-01
For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Determination of the pairing-strength constants in the isovector plus isoscalar pairing case
Mokhtari, D.; Fellah, M.; Allal, N. H.
2016-05-01
A method for the determination of the pairing-strength constants, in the neutron-proton (n-p) isovector plus isoscalar pairing case, is proposed in the framework of the BCS theory. It is based on the fitting of these constants to reproduce the experimentally known pairing gap parameters as well as the root-mean-squared (r.m.s) charge radii values. The method is applied to some proton-rich even-even nuclei. The single-particle energies used are those of a deformed Woods-Saxon mean field. It is shown that the obtained value of the ratio GnpT=0/G npT=1 is of the same order as the ones, arbitrary chosen, of some previous works. The effect of the inclusion of the isoscalar n-p pairing in the r.m.s matter radii is then numerically studied for the same nuclei.
Hamann, H.; Jimenez Marianno, F.; Klein, L.; Albrecht, C.; Freitag, M.; Hinds, N.; Lu, S.
2015-12-01
A big data geospatial analytics platform:Physical Analytics Information Repository and Services (PAIRS)Fernando Marianno, Levente Klein, Siyuan Lu, Conrad Albrecht, Marcus Freitag, Nigel Hinds, Hendrik HamannIBM TJ Watson Research Center, Yorktown Heights, NY 10598A major challenge in leveraging big geospatial data sets is the ability to quickly integrate multiple data sources into physical and statistical models and be run these models in real time. A geospatial data platform called Physical Analytics Information and Services (PAIRS) is developed on top of open source hardware and software stack to manage Terabyte of data. A new data interpolation and re gridding is implemented where any geospatial data layers can be associated with a set of global grid where the grid resolutions is doubling for consecutive layers. Each pixel on the PAIRS grid have an index that is a combination of locations and time stamp. The indexing allow quick access to data sets that are part of a global data layers and allowing to retrieve only the data of interest. PAIRS takes advantages of parallel processing framework (Hadoop) in a cloud environment to digest, curate, and analyze the data sets while being very robust and stable. The data is stored on a distributed no-SQL database (Hbase) across multiple server, data upload and retrieval is parallelized where the original analytics task is broken up is smaller areas/volume, analyzed independently, and then reassembled for the original geographical area. The differentiating aspect of PAIRS is the ability to accelerate model development across large geographical regions and spatial resolution ranging from 0.1 m up to hundreds of kilometer. System performance is benchmarked on real time automated data ingestion and retrieval of Modis and Landsat data layers. The data layers are curated for sensor error, verified for correctness, and analyzed statistically to detect local anomalies. Multi-layer query enable PAIRS to filter different data
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Automated gauge block pair length difference calibration and associated uncertainty sources
International Nuclear Information System (INIS)
Oliveira, W Jr; França, R S
2015-01-01
A reduction for interferometric uncertainties in length difference at gauge block pairs is presented. An automated processing designed to compensate geometric fringe visualization effects and four-alternate wringing technique are used to achieve small combined uncertainties for length difference calibrations, maintaining a good compliance with the EAL-G21 determinations. (paper)
Lubow, S.; Budavári, T.
2013-10-01
We have created an initial catalog of objects observed by the WFPC2 and ACS instruments on the Hubble Space Telescope (HST). The catalog is based on observations taken on more than 6000 visits (telescope pointings) of ACS/WFC and more than 25000 visits of WFPC2. The catalog is obtained by cross matching by position in the sky all Hubble Legacy Archive (HLA) Source Extractor source lists for these instruments. The source lists describe properties of source detections within a visit. The calculations are performed on a SQL Server database system. First we collect overlapping images into groups, e.g., Eta Car, and determine nearby (approximately matching) pairs of sources from different images within each group. We then apply a novel algorithm for improving the cross matching of pairs of sources by adjusting the astrometry of the images. Next, we combine pairwise matches into maximal sets of possible multi-source matches. We apply a greedy Bayesian method to split the maximal matches into more reliable matches. We test the accuracy of the matches by comparing the fluxes of the matched sources. The result is a set of information that ties together multiple observations of the same object. A byproduct of the catalog is greatly improved relative astrometry for many of the HST images. We also provide information on nondetections that can be used to determine dropouts. With the catalog, for the first time, one can carry out time domain, multi-wavelength studies across a large set of HST data. The catalog is publicly available. Much more can be done to expand the catalog capabilities.
Progress toward the creation of magnetically confined pair plasmas
Energy Technology Data Exchange (ETDEWEB)
Saitoh, Haruhiko [Max-Planck-Institut fuer Plasmaphysik (Germany); The University of Tokyo (Japan); Hergenhahn, Uwe; Paschkowski, Norbert; Stanja, Juliane; Stenson, Eve V. [Max-Planck-Institut fuer Plasmaphysik (Germany); Niemann, Holger; Sunn Pedersen, Thomas [Max-Planck-Institut fuer Plasmaphysik (Germany); Ernst-Moritz-Arndt-Universitaet Greifswald (Germany); Stoneking, Matthew R. [Max-Planck-Institut fuer Plasmaphysik (Germany); Lawrence University (United States); Hugenschmidt, Christoph; Piochacz, Christian; Vohburger, Sebastian [Technische Universitaet Muenchen (Germany); Schweikhard, Lutz [Ernst-Moritz-Arndt-Universitaet Greifswald (Germany); Danielson, James R.; Surko, Clifford M. [University of California, San Diego (United States)
2016-07-01
The PAX (Positron Accumulation eXperiment) and APEX (A Positron Electron eXperiment) projects aim to experimentally study the unique wave propagation and stability properties of pair plasmas. We plan to accumulate a large number of positrons in a multicell-type trap system (PAX) and to confine them with electrons in APEX, a levitated dipole or stellarator configuration, operated at the NEPOMUC facility, the world's most intense positron source. In this contribution, we report on recent results from PAX and APEX. We have conducted electron experiments with a 2.3 T Penning-Malmberg trap; confinement for more than 1 hour and observation of a collective mode were demonstrated. At NEPOMUC, we have characterized the positron beam for a wide energy range. In a prototype permanent-magnet dipole trap, efficient (38%) injection of the remoderated 5 eV positron beam was realized using E x B drifts. Based on these results, design studies on the confinement of pair-plasmas in a levitated dipole trap are ongoing.
A Silicon-Chip Source of Bright Photon-Pair Comb
2012-10-16
quantum light sources. Nature Photon. 1, 215 (2007). 14 Kwait, P. G., Mattle, K., Weinfurter, H., & Zeilinger , A. New High-Intensity Source of...Jennewein, T., & Zeilinger , A. A wavelength-tunable fiber-coupled 26 source of narrowband entangled photons. Opt. Express 15, 15377 (2007). 18 Chen...Lett. 101, 051108 (2012). 47 Ramelow, S., Ratschbacher, L., Fedrizzi, A., Langford, N. K., & Zeilinger , A. Discrete tunable color entanglement. Phys
Energy Technology Data Exchange (ETDEWEB)
OUYANG,S.; VAIRAVAMURTHY,M.A.
1999-06-13
Determination of low-molecular-weight organic sulfonates (e.g. taurine and cysteic acid) in aqueous solutions is important in many applications of biological, environmental and pharmaceutical sciences. These compounds are difficult to be determined by commonly used reversed-phase liquid chromatographic separation combined with UV-Visible detection because of their high solubility and the lack chromophoric moieties. Here the authors report a method combining ion-pair liquid chromatography and electrospray ionization tandem mass spectrometry (IPLC/ESI-MS/MS)for determining sulfonates. The ability of low-molecular-weight sulfonates to form ion-pairs with quaternary ammonium cations in aqueous solutions allowed LC separation with a C{sub 18} column. Detection of the sulfonates was accomplished with ESI-MS that lends a universal mode of mass detection for polar, water soluble compounds. An in-source collision induced dissociation (CID) was applied to eliminate the adduct peaks in mass spectra. Characteristic marker ions showed in the second stage mass spectra lent a method for identifying sulfonates.
New source review for stationary sources of air pollution
National Research Council Canada - National Science Library
Committee on Changes in New Source Review Programs for Stationary Sources of Air Pollution, National Research Council
2006-01-01
The Clean Air Act established a pair of programsâ€"known as New Source Review (NSR)â€"that regulate large stationary sources of air pollution, such as factories and electricity-generating facilities...
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
CPM Pairs from LSPM so Far Not WDS Listed – Part IV
Knapp, Wilfried; Nanson, John
2018-04-01
The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted – but as we found during research for our report "A New Concept for Counter-Checking of Assumed CPM Pairs" (Knapp and Nanson 2017), there are still many potential CPM pairs indicated in LSPM not listed in the WDS catalog. After our first three reports on about 100 such objects (Knapp and Nanson 2017 - CPM pairs from LSPM so far not WDS listed – Part I/II/III), this report with 30 additional potential common proper motion pairs is presented here.
Investigations into nuclear pairing
International Nuclear Information System (INIS)
Clark, R.M.
2006-01-01
This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)
Czugala, Monika; Gorkin, Robert; Phelan, Thomas; Gaughran, Jennifer; Curto, Vincenzo Fabio; Ducrée, Jens; Diamond, Dermot; Benito-Lopez, Fernando
2012-12-07
This work describes the first use of a wireless paired emitter detector diode device (PEDD) as an optical sensor for water quality monitoring in a lab-on-a-disc device. The microfluidic platform, based on an ionogel sensing area combined with a low-cost optical sensor, is applied for quantitative pH and qualitative turbidity monitoring of water samples at point-of-need. The autonomous capabilities of the PEDD system, combined with the portability and wireless communication of the full device, provide the flexibility needed for on-site water testing. Water samples from local fresh and brackish sources were successfully analysed using the device, showing very good correlation with standard bench-top systems.
Matched molecular pair-based data sets for computer-aided medicinal chemistry
Bajorath, Jürgen
2014-01-01
Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802
Inhomogeneous ensembles of radical pairs in chemical compasses
Procopio, Maria; Ritz, Thorsten
2016-11-01
The biophysical basis for the ability of animals to detect the geomagnetic field and to use it for finding directions remains a mystery of sensory biology. One much debated hypothesis suggests that an ensemble of specialized light-induced radical pair reactions can provide the primary signal for a magnetic compass sensor. The question arises what features of such a radical pair ensemble could be optimized by evolution so as to improve the detection of the direction of weak magnetic fields. Here, we focus on the overlooked aspect of the noise arising from inhomogeneity of copies of biomolecules in a realistic biological environment. Such inhomogeneity leads to variations of the radical pair parameters, thereby deteriorating the signal arising from an ensemble and providing a source of noise. We investigate the effect of variations in hyperfine interactions between different copies of simple radical pairs on the directional response of a compass system. We find that the choice of radical pair parameters greatly influences how strongly the directional response of an ensemble is affected by inhomogeneity.
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J
2013-12-12
The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.
Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing
2017-09-01
Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.
Resource allocation for two source-destination pairs sharing a single relay with a buffer
Zafar, Ammar
2014-05-01
In this paper, we obtain the optimal resource allocation scheme in order to maximize the achievable rate region in a dual-hop system that consists of two independent source-destination pairs sharing a single half-duplex relay. The relay decodes the received information and possesses buffers to enable storing the information temporarily before forwarding it to the respective destination. We consider both non-orthogonal transmission with successive interference cancellation at the receivers and orthogonal transmission. Also, we consider Gaussian block-fading channels and we assume that the channel state information is known and that no delay constraints are required. We show that, with the aid of buffering at the relay, joint user-and-hop scheduling is optimal and can enhance the achievable rate significantly. This is due to the joint exploitation of multiuser diversity and multihop diversity in the system. We provide closed-form expressions to characterize the average achievable rates in a generic form as functions of the statistical model of the channels. Furthermore, we consider sub-optimal schemes that exploit the diversity in the system partially and we provide numerical results to compare the different schemes and demonstrate the gains of the optimal one. © 2014 IEEE.
Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.
2013-01-01
Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer
Generalized quantum interference of correlated photon pairs
Kim, Heonoh; Lee, Sang Min; Moon, Han Seb
2015-01-01
Superposition and indistinguishablility between probability amplitudes have played an essential role in observing quantum interference effects of correlated photons. The Hong-Ou-Mandel interference and interferences of the path-entangled photon number state are of special interest in the field of quantum information technologies. However, a fully generalized two-photon quantum interferometric scheme accounting for the Hong-Ou-Mandel scheme and path-entangled photon number states has not yet been proposed. Here we report the experimental demonstrations of the generalized two-photon interferometry with both the interferometric properties of the Hong-Ou-Mandel effect and the fully unfolded version of the path-entangled photon number state using photon-pair sources, which are independently generated by spontaneous parametric down-conversion. Our experimental scheme explains two-photon interference fringes revealing single- and two-photon coherence properties in a single interferometer setup. Using the proposed interferometric measurement, it is possible to directly estimate the joint spectral intensity of a photon pair source. PMID:25951143
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
International Nuclear Information System (INIS)
Dumas, J.
2011-09-01
The nuclear and high-energy physics communities have shown a growing interest in the availability of high current, highly-polarized positron beams. A sufficiently energetic polarized photon or lepton incident on a target may generate, via Bremsstrahlung and pair creation within a solid target foil, electron-positron pairs that should carry some fraction of the initial polarization. Recent advances in high current (> 1 mA) spin polarized electron sources at Jefferson Lab offer the perspective of creating polarized positrons from a low energy electron beam. This thesis discusses polarization transfer from electrons to positrons in the perspective of the design optimization of a polarized positron source. The PEPPo experiment, aiming at a measurement of the positron polarization from a low energy (< 10 MeV) highly spin polarized electron beam is discussed. A successful demonstration of this technique would provide an alternative scheme for the production of low energy polarized positrons and useful information for the optimization of the design of polarized positron sources in the sub-GeV energy range. (author)
Cooper pair splitter realized in a two-quantum-dot Y-junction.
Hofstetter, L; Csonka, S; Nygård, J; Schönenberger, C
2009-10-15
Non-locality is a fundamental property of quantum mechanics that manifests itself as correlations between spatially separated parts of a quantum system. A fundamental route for the exploration of such phenomena is the generation of Einstein-Podolsky-Rosen (EPR) pairs of quantum-entangled objects for the test of so-called Bell inequalities. Whereas such experimental tests of non-locality have been successfully conducted with pairwise entangled photons, it has not yet been possible to realize an electronic analogue of it in the solid state, where spin-1/2 mobile electrons are the natural quantum objects. The difficulty stems from the fact that electrons are immersed in a macroscopic ground state-the Fermi sea-which prevents the straightforward generation and splitting of entangled pairs of electrons on demand. A superconductor, however, could act as a source of EPR pairs of electrons, because its ground-state is composed of Cooper pairs in a spin-singlet state. These Cooper pairs can be extracted from a superconductor by tunnelling, but, to obtain an efficient EPR source of entangled electrons, the splitting of the Cooper pairs into separate electrons has to be enforced. This can be achieved by having the electrons 'repel' each other by Coulomb interaction. Controlled Cooper pair splitting can thereby be realized by coupling of the superconductor to two normal metal drain contacts by means of individually tunable quantum dots. Here we demonstrate the first experimental realization of such a tunable Cooper pair splitter, which shows a surprisingly high efficiency. Our findings open a route towards a first test of the EPR paradox and Bell inequalities in the solid state.
Neutron area monitor with TLD pairs
International Nuclear Information System (INIS)
Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R.
2011-11-01
The response of a passive neutron area monitor with pairs of thermoluminescent dosimeters has been calculated using the Monte Carlo code MCNP5. The response was calculated for one TLD 600 located at the center of a polyethylene cylinder, as moderator. When neutrons collide with the moderator lose their energy reaching the TLD with thermal energies where the ambient dose equivalent is calculated. The response was calculated for 47 monoenergetic neutron sources ranging from 1E(-9) to 20 MeV. Response was calculated using two irradiation geometries, one with an upper source and another with a lateral source. For both irradiation schemes the response was calculated with the TLDs in two positions, one parallel to the source and another perpendicular to the source. The advantage of this passive neutron monitor area is that can be used in locations with intense, pulsed and mixed radiation fields. (Author)
International Nuclear Information System (INIS)
Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R
2011-01-01
3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively
CPM Pairs from LSPM so far not WDS Listed
Knapp, Wilfried; Nanson, John
2017-04-01
The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted - but as we found during research for our report “A new concept for counter-checking of assumed CPM pairs” (Knapp and Nanson 2016) there are still many potential CPM pairs indicated in LSPM which as of the beginning of 2016 are not listed in the WDS catalog. A first part of about 40 such objects is presented here.
Analysis of the image of pion-emitting sources in the source center-of-mass frame
Energy Technology Data Exchange (ETDEWEB)
Ren, Yanyu; Feng, Qichun; Huo, Lei; Zhang, Jingbo; Liu, Jianli; Tang, Guixin [Harbin Institute of Technology, Department of Physics, Harbin, Heilongjiang (China); Zhang, Weining [Harbin Institute of Technology, Department of Physics, Harbin, Heilongjiang (China); Dalian University of Technology, School of Physics and Optoelectronic Technology, Dalian, Liaoning (China)
2017-08-15
In this paper, we try a method to extract the image of pion-emitting source function in the center-of-mass frame of the source (CMFS). We choose identical pion pairs according to the difference of their energy and use these pion pairs to build the correlation function. The purpose is to reduce the effect of ΔEΔt, thus the corresponding imaging result can tend to the real source function. We examine the effect of this method by comparing its results with real source functions extracted from models directly. (orig.)
Broadband illumination of superconducting pair breaking photon detectors
International Nuclear Information System (INIS)
Guruswamy, T; Goldie, D J; Withington, S
2016-01-01
Understanding the detailed behaviour of superconducting pair breaking photon detectors such as Kinetic Inductance Detectors (KIDs) requires knowledge of the nonequilibrium quasiparticle energy distributions. We have previously calculated the steady state distributions resulting from uniform absorption of monochromatic sub gap and above gap frequency radiation by thin films. In this work, we use the same methods to calculate the effect of illumination by broadband sources, such as thermal radiation from astrophysical phenomena or from the readout system. Absorption of photons at multiple above gap frequencies is shown to leave unchanged the structure of the quasiparticle energy distribution close to the superconducting gap. Hence for typical absorbed powers, we find the effects of absorption of broadband pair breaking radiation can simply be considered as the sum of the effects of absorption of many monochromatic sources. Distribution averaged quantities, like quasiparticle generation efficiency η, match exactly a weighted average over the bandwidth of the source of calculations assuming a monochromatic source. For sub gap frequencies, however, distributing the absorbed power across multiple frequencies does change the low energy quasiparticle distribution. For moderate and high absorbed powers, this results in a significantly larger η–a higher number of excess quasiparticles for a broadband source compared to a monochromatic source of equal total absorbed power. Typically in KIDs the microwave power absorbed has a very narrow bandwidth, but in devices with broad resonance characteristics (low quality factors), this increase in η may be measurable. (paper)
Pair production instabilities as a source of X-ray flares from accreting black holes
Energy Technology Data Exchange (ETDEWEB)
Moskalik, P; Sikora, M
1986-02-20
The paper concerns pair production instability in active galaxies which emit most of their energy at h..gamma..>100 keV. The authors show that the esub(..gamma..)-e-pair production instability leads to cyclic variations of accretion flow, during which high-energy flares are produced. This mechanism can account for the large amplitude luminosity changes observed in several active galactic nuclei. The same scenario may also be responsible for the short-timescale quasiperiodic variability reported in some proposed galactic black holes. (U.K.).
Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen
2016-12-01
The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Anomalous low mass e+e- pair production in 17 GeV/c π-p collisions
International Nuclear Information System (INIS)
Abshire, G.; Adams, M.; Brown, C.
1980-01-01
An experiment was performed at the Multiparticle Spectrometer using 17 GeV/c π - from the BNL AGS, triggering upon inclusive e + e - production. Electron identification was based on two transition radiator detectors and lead-scintillator shower detectors. Good acceptance for the e + e - pair covered the region x/sub F/ > 0.3 for all p/sub T/ and pair masses. Charged particles and photons associated with the e + e - pair are detected over a large solid angle. e + e - pairs of mass up to 1.2 GeV/c 2 were produced. A clear peak due to rho, ω → e + e - is observed. For e + e - masses below the rho, ω, an excess of events is found over those expected from known sources such as eta → e + e - γ and ω → e + e - π 0 . This anomalous excess is more strongly produced at small x/sub F/. The structure of events containing anomalous e + e - pairs is reported in an attempt to elucidate their origin. In particular, effective mass distributions of e + e - γ, e + e - π 0 , e + e - charged hadrons are presented
Quasars Probing Quasars. X. The Quasar Pair Spectral Database
Findlay, Joseph R.; Prochaska, J. Xavier; Hennawi, Joseph F.; Fumagalli, Michele; Myers, Adam D.; Bartle, Stephanie; Chehade, Ben; DiPompeo, Michael A.; Shanks, Tom; Lau, Marie Wingyee; Rubin, Kate H. R.
2018-06-01
The rare close projection of two quasars on the sky provides the opportunity to study the host galaxy environment of a foreground quasar in absorption against the continuum emission of a background quasar. For over a decade the “Quasars probing quasars” series has utilized this technique to further the understanding of galaxy formation and evolution in the presence of a quasar at z > 2, resolving scales as small as a galactic disk and from bound gas in the circumgalactic medium to the diffuse environs of intergalactic space. Presented here is the public release of the quasar pair spectral database utilized in these studies. In addition to projected pairs at z > 2, the database also includes quasar pair members at z useful for small-scale clustering studies. In total, the database catalogs 5627 distinct objects, with 4083 lying within 5‧ of at least one other source. A spectral library contains 3582 optical and near-infrared spectra for 3028 of the cataloged sources. As well as reporting on 54 newly discovered quasar pairs, we outline the key contributions made by this series over the last 10 years, summarize the imaging and spectroscopic data used for target selection, discuss the target selection methodologies, describe the database content, and explore some avenues for future work. Full documentation for the spectral database, including download instructions, is supplied at http://specdb.readthedocs.io/en/latest/.
Positron-Electron Pairs in Astrophysics (Goddard Space Flight Center, 1983)
International Nuclear Information System (INIS)
Burns, M.L.; Harding, A.K.; Ramaty, R.
1983-01-01
A workshop on Position-Electron Pairs in Astrophysics was held in 1983 at the Goddard Space Flight Center. This workshop brought together observers and theorists actively engaged in the study of astrophysical sites, as well as physical processes therein where position-electron pairs have a profound influence on both the overall dynamics of the source region and the properties of the emitted radiation. This volume consists of the workshop proceedings
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
ERP correlates of source memory: unitized source information increases familiarity-based retrieval.
Diana, Rachel A; Van den Boom, Wijnand; Yonelinas, Andrew P; Ranganath, Charan
2011-01-07
Source memory tests typically require subjects to make decisions about the context in which an item was encoded and are thought to depend on recollection of details from the study episode. Although it is generally believed that familiarity does not contribute to source memory, recent behavioral studies have suggested that familiarity may also support source recognition when item and source information are integrated, or "unitized," during study (Diana, Yonelinas, and Ranganath, 2008). However, an alternative explanation of these behavioral findings is that unitization affects the manner in which recollection contributes to performance, rather than increasing familiarity-based source memory. To discriminate between these possibilities, we conducted an event-related potential (ERP) study testing the hypothesis that unitization increases the contribution of familiarity to source recognition. Participants studied associations between words and background colors using tasks that either encouraged or discouraged unitization. ERPs were recorded during a source memory test for background color. The results revealed two distinct neural correlates of source recognition: a frontally distributed positivity that was associated with familiarity-based source memory in the high-unitization condition only and a parietally distributed positivity that was associated with recollection-based source memory in both the high- and low-unitization conditions. The ERP and behavioral findings provide converging evidence for the idea that familiarity can contribute to source recognition, particularly when source information is encoded as an item detail. Copyright © 2010 Elsevier B.V. All rights reserved.
Kumar, Anil; Sevilla, Michael D.
2009-01-01
On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319
A sensitive short read homology search tool for paired-end read sequencing data.
Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai
2017-10-16
Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at https://sourceforge.net/projects/short-pair/ .
Pair distribution function and structure factor of spherical particles
International Nuclear Information System (INIS)
Howell, Rafael C.; Proffen, Thomas; Conradson, Steven D.
2006-01-01
The availability of neutron spallation-source instruments that provide total scattering powder diffraction has led to an increased application of real-space structure analysis using the pair distribution function. Currently, the analytical treatment of finite size effects within pair distribution refinement procedures is limited. To that end, an envelope function is derived which transforms the pair distribution function of an infinite solid into that of a spherical particle with the same crystal structure. Distributions of particle sizes are then considered, and the associated envelope function is used to predict the particle size distribution of an experimental sample of gold nanoparticles from its pair distribution function alone. Finally, complementing the wealth of existing diffraction analysis, the peak broadening for the structure factor of spherical particles, expressed as a convolution derived from the envelope functions, is calculated exactly for all particle size distributions considered, and peak maxima, offsets, and asymmetries are discussed
A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs.
Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens
2013-10-01
A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Electron-positron pair creation in heavy ion collisions
International Nuclear Information System (INIS)
Kienle, P.
1987-01-01
The authors review the status of experiments to study the electron positron pair creation in heavy ion atom collisions at bombarding energies close to the Coulomb barrier. The disentanglement and characterization of various sources of positrons observed in such collisions are described with a focus on the monoenergetic electron positron pairs observed. They seem to originate from the two-body decay of a family of neutral particles with masses of about 3m and lifetimes in the range of 6 x 10 - 14 s, produced by high Coulomb fields. First attempts were made to create these particles by resonant Bhabha scattering
DEFF Research Database (Denmark)
Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel
2015-01-01
In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
An Intelligent Model for Pairs Trading Using Genetic Algorithms.
Huang, Chien-Feng; Hsu, Chi-Jen; Chen, Chi-Chung; Chang, Bao Rong; Li, Chen-An
2015-01-01
Pairs trading is an important and challenging research area in computational finance, in which pairs of stocks are bought and sold in pair combinations for arbitrage opportunities. Traditional methods that solve this set of problems mostly rely on statistical methods such as regression. In contrast to the statistical approaches, recent advances in computational intelligence (CI) are leading to promising opportunities for solving problems in the financial applications more effectively. In this paper, we present a novel methodology for pairs trading using genetic algorithms (GA). Our results showed that the GA-based models are able to significantly outperform the benchmark and our proposed method is capable of generating robust models to tackle the dynamic characteristics in the financial application studied. Based upon the promising results obtained, we expect this GA-based method to advance the research in computational intelligence for finance and provide an effective solution to pairs trading for investment in practice.
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
Massive lepton pairs as a prompt photon surrogate
International Nuclear Information System (INIS)
Berger L, Edmond; Gordon E, Lionel; Klasen, Michael
1998-01-01
The authors discuss the transverse momentum distribution for the production of massive lepton-pairs in hadron reactions at fixed target and collider energies within the context of next-to-leading order perturbative quantum chromodynamics. For values of the transverse momentum Q T greater than the pair mass Q, Q T > Q, they show that the differential cross section is dominated by subprocesses initiated by incident gluons. Massive lepton-pair differential cross sections are an advantageous source of constraints on the gluon density, free from the experimental and theoretical complications of photon isolation that beset studies of prompt photon production. They compare calculations with data and provide predictions for the differential cross section as a function of Q T in proton-antiproton reactions at center-of-mass energies of 1.8 TeV, and in proton-nucleon reactions at fixed target and LHC energies
Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA
International Nuclear Information System (INIS)
Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.
2003-01-01
Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Glucose detection in a highly scattering medium with diffuse photon-pair density wave
Directory of Open Access Journals (Sweden)
Li-Ping Yu
2017-01-01
Full Text Available We propose a novel optical method for glucose measurement based on diffuse photon-pair density wave (DPPDW in a multiple scattering medium (MSM where the light scattering of photon-pair is induced by refractive index mismatch between scatters and phantom solution. Experimentally, the DPPDW propagates in MSM via a two-frequency laser (TFL beam wherein highly correlated pairs of linear polarized photons are generated. The reduced scattering coefficient μ2s′ and absorption coefficient μ2a of DPPDW are measured simultaneously in terms of the amplitude and phase measurements of the detected heterodyne signal under arrangement at different distances between the source and detection fibers in MSM. The results show that the sensitivity of glucose detection via glucose-induced change of reduced scattering coefficient (δμ2s′ is 0.049%mM−1 in a 1% intralipid solution. In addition, the linear range of δμ2s′ vs glucose concentration implies that this DPPDW method can be used to monitor glucose concentration continuously and noninvasively subcutaneously.
High Level Rule Modeling Language for Airline Crew Pairing
Mutlu, Erdal; Birbil, Ş. Ilker; Bülbül, Kerem; Yenigün, Hüsnü
2011-09-01
The crew pairing problem is an airline optimization problem where a set of least costly pairings (consecutive flights to be flown by a single crew) that covers every flight in a given flight network is sought. A pairing is defined by using a very complex set of feasibility rules imposed by international and national regulatory agencies, and also by the airline itself. The cost of a pairing is also defined by using complicated rules. When an optimization engine generates a sequence of flights from a given flight network, it has to check all these feasibility rules to ensure whether the sequence forms a valid pairing. Likewise, the engine needs to calculate the cost of the pairing by using certain rules. However, the rules used for checking the feasibility and calculating the costs are usually not static. Furthermore, the airline companies carry out what-if-type analyses through testing several alternate scenarios in each planning period. Therefore, embedding the implementation of feasibility checking and cost calculation rules into the source code of the optimization engine is not a practical approach. In this work, a high level language called ARUS is introduced for describing the feasibility and cost calculation rules. A compiler for ARUS is also implemented in this work to generate a dynamic link library to be used by crew pairing optimization engines.
Nanomaterial-based x-ray sources
Cole, Matthew T.; Parmee, R. J.; Milne, William I.
2016-02-01
Following the recent global excitement and investment in the emerging, and rapidly growing, classes of one and two-dimensional nanomaterials, we here present a perspective on one of the viable applications of such materials: field electron emission based x-ray sources. These devices, which have a notable history in medicine, security, industry and research, to date have almost exclusively incorporated thermionic electron sources. Since the middle of the last century, field emission based cathodes were demonstrated, but it is only recently that they have become practicable. We outline some of the technological achievements of the past two decades, and describe a number of the seminal contributions. We explore the foremost market hurdles hindering their roll-out and broader industrial adoption and summarise the recent progress in miniaturised, pulsed and multi-source devices.
Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C
2014-07-30
Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.
Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.
Renneberg, Dorte; Dervan, Peter B
2003-05-14
The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.
Fang, Chunliu; Julius, David; Tay, Siok Wei; Hong, Liang; Lee, Jim Yang
2012-06-07
This paper describes the synthesis of ion-pair-reinforced semi-interpenetrating polymer networks (SIPNs) as proton exchange membranes (PEMs) for the direct methanol fuel cells (DMFCs). Specifically, sulfonated poly(2,6-dimethyl-1,4-phenylene oxide) (SPPO), a linear polymer proton source, was immobilized in a brominated PPO (BPPO) network covalently cross-linked by ethylenediamine (EDA). The immobilization of SPPO in the SIPN network was accomplished not only by the usual means of mechanical interlocking but also by ion pair formation between the sulfonic acid groups of SPPO and the amine moieties formed during the cross-linking reaction of BPPO with EDA. Through the ion pair interactions, the immobilization of SPPO polymer in the BPPO network was made more effective, resulting in a greater uniformity of sulfonic acid cluster distribution in the membrane. The hydrophilic amine-containing cross-links also compensated for some of the decrease in proton conductivity caused by ion pair formation. The SIPN membranes prepared as such showed good proton conductivity, low methanol permeability, good mechanical properties, and dimensional stability. Consequently, the PPO based SIPN membranes were able to deliver a higher maximum power density than Nafion, demonstrating the potential of the SIPN structure for PEM designs.
Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey
2014-10-01
Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.
Frequency-bin entanglement of ultra-narrow band non-degenerate photon pairs
Rieländer, Daniel; Lenhard, Andreas; Jime`nez Farìas, Osvaldo; Máttar, Alejandro; Cavalcanti, Daniel; Mazzera, Margherita; Acín, Antonio; de Riedmatten, Hugues
2018-01-01
We demonstrate frequency-bin entanglement between ultra-narrowband photons generated by cavity enhanced spontaneous parametric down conversion. Our source generates photon pairs in widely non-degenerate discrete frequency modes, with one photon resonant with a quantum memory material based on praseodymium doped crystals and the other photon at telecom wavelengths. Correlations between the frequency modes are analyzed using phase modulators and narrowband filters before detection. We show high-visibility two photon interference between the frequency modes, allowing us to infer a coherent superposition of the modes. We develop a model describing the state that we create and use it to estimate optimal measurements to achieve a violation of the Clauser-Horne (CH) Bell inequality under realistic assumptions. With these settings we perform a Bell test and show a significant violation of the CH inequality, thus proving the entanglement of the photons. Finally we demonstrate the compatibility with a quantum memory material by using a spectral hole in the praseodymium (Pr) doped crystal as spectral filter for measuring high-visibility two-photon interference. This demonstrates the feasibility of combining frequency-bin entangled photon pairs with Pr-based solid state quantum memories.
Environmentally benign working pairs for adsorption refrigeration
International Nuclear Information System (INIS)
Cui Qun; Tao Gang; Chen Haijun; Guo Xinyue; Yao Huqing
2005-01-01
This paper begins from adsorption working pairs: water and ethanol were selected as refrigerants; 13x molecular sieve, silica gel, activated carbon, adsorbent NA and NB, proposed by authors, were selected as adsorbents, and the performance of adsorption working pairs in adsorption refrigeration cycle was studied. The adsorption isotherms of adsorbents (NA and NB) were obtained by high-vacuum gravimetric method. Desorption properties of adsorbents were analyzed and compared by thermal analysis method. The performance of adsorption refrigeration was studied on simulation device of adsorption refrigeration cycle. After presentation of adsorption isotherms, the thermodynamic performance for their use in adsorption refrigeration system was calculated. The results show: (1) the maximum adsorption capacity of water on adsorbent NA reaches 0.7 kg/kg, and the maximum adsorption capacity of ethanol on adsorbent NB is 0.68 kg/kg, which is three times that of ethanol on activated carbon, (2) the refrigeration capacity of NA-water working pair is 922 kJ/kg, the refrigeration capacity of NB-ethanol is 2.4 times that of activated carbon-methanol, (3) as environmental friendly and no public hazard adsorption working pair, NA-H 2 O and NB-ethanol can substitute activated carbon-methanol in adsorption refrigeration system using low-grade heat source
An automated multi-scale network-based scheme for detection and location of seismic sources
Poiata, N.; Aden-Antoniow, F.; Satriano, C.; Bernard, P.; Vilotte, J. P.; Obara, K.
2017-12-01
We present a recently developed method - BackTrackBB (Poiata et al. 2016) - allowing to image energy radiation from different seismic sources (e.g., earthquakes, LFEs, tremors) in different tectonic environments using continuous seismic records. The method exploits multi-scale frequency-selective coherence in the wave field, recorded by regional seismic networks or local arrays. The detection and location scheme is based on space-time reconstruction of the seismic sources through an imaging function built from the sum of station-pair time-delay likelihood functions, projected onto theoretical 3D time-delay grids. This imaging function is interpreted as the location likelihood of the seismic source. A signal pre-processing step constructs a multi-band statistical representation of the non stationary signal, i.e. time series, by means of higher-order statistics or energy envelope characteristic functions. Such signal-processing is designed to detect in time signal transients - of different scales and a priori unknown predominant frequency - potentially associated with a variety of sources (e.g., earthquakes, LFE, tremors), and to improve the performance and the robustness of the detection-and-location location step. The initial detection-location, based on a single phase analysis with the P- or S-phase only, can then be improved recursively in a station selection scheme. This scheme - exploiting the 3-component records - makes use of P- and S-phase characteristic functions, extracted after a polarization analysis of the event waveforms, and combines the single phase imaging functions with the S-P differential imaging functions. The performance of the method is demonstrated here in different tectonic environments: (1) analysis of the one year long precursory phase of 2014 Iquique earthquake in Chile; (2) detection and location of tectonic tremor sources and low-frequency earthquakes during the multiple episodes of tectonic tremor activity in southwestern Japan.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Ueguchi, Takashi; Ogihara, Ryota; Yamada, Sachiko
2018-03-21
To investigate the accuracy of dual-energy virtual monochromatic computed tomography (CT) numbers obtained by two typical hardware and software implementations: the single-source projection-based method and the dual-source image-based method. A phantom with different tissue equivalent inserts was scanned with both single-source and dual-source scanners. A fast kVp-switching feature was used on the single-source scanner, whereas a tin filter was used on the dual-source scanner. Virtual monochromatic CT images of the phantom at energy levels of 60, 100, and 140 keV were obtained by both projection-based (on the single-source scanner) and image-based (on the dual-source scanner) methods. The accuracy of virtual monochromatic CT numbers for all inserts was assessed by comparing measured values to their corresponding true values. Linear regression analysis was performed to evaluate the dependency of measured CT numbers on tissue attenuation, method, and their interaction. Root mean square values of systematic error over all inserts at 60, 100, and 140 keV were approximately 53, 21, and 29 Hounsfield unit (HU) with the single-source projection-based method, and 46, 7, and 6 HU with the dual-source image-based method, respectively. Linear regression analysis revealed that the interaction between the attenuation and the method had a statistically significant effect on the measured CT numbers at 100 and 140 keV. There were attenuation-, method-, and energy level-dependent systematic errors in the measured virtual monochromatic CT numbers. CT number reproducibility was comparable between the two scanners, and CT numbers had better accuracy with the dual-source image-based method at 100 and 140 keV. Copyright © 2018 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.
PAIR'14 / PAIR'15 STUDENT CONFERENCES ON PLANNING IN ARTIFICIAL INTELLIGENCE AND ROBOTICS
Directory of Open Access Journals (Sweden)
Editorial Foreword
2015-12-01
Full Text Available Dear Readerthe original idea of the student conference on “Planning in Artificial Intelligence and Robotics” (PAIR is to join young researchers from particular laboratories in Czech Republic, where planning problems are investigated from artificial intelligence (AI or robotics points of view. The first year of PAIR has been organized at the Dept. of Computer Science, Faculty Electrical Engineering, Czech Technical University in 2014.At PAIR 2014, laboratories from Prague and Brno were presented. In particular, students and researchers from Charles University, Czech Technical University in Prague, Brno University of Technology, and Central European Institute of Technology participated at the event. Beside an introduction of the particular research groups and their topics, students presented contributions on their current research results. Ten papers were presented on topics ranging from domain–independent planning, trajectory planning to applications for unmanned aerial and legged robots. This first event provides us an initial experience with the community of young researchers in Czech Republic that are working planning in robotic or AI. Based on the success of PAIR 2014, we decided to continue with our effort to establish a suitable fora for students that are geographically very close, but usually do not meet, because of participation on different Robotics and AI events.The second student conference on Planning in Artificial Intelligence and Robotics (PAIR 2015 successfully continues the tradition of the first year of the conference organized in Prague. This year, the conference was collocated with 10th anniversary of RoboTour contest in Písek. This format enable us to extend the impact of the PAIR conference and improve the visibility of the growing student community. The conference reached a good amount of interesting papers focused on image processing for mobile robots, swarm control, driving simulation, robot control, or domain
International Nuclear Information System (INIS)
Perina, Jan Jr.; Centini, Marco; Sibilia, Concita; Bertolotti, Mario; Scalora, Michael
2006-01-01
We have developed a rigorous quantum model of spontaneous parametric down-conversion in a nonlinear 1D photonic-band-gap structure based upon expansion of the field into monochromatic plane waves. The model provides a two-photon amplitude of a created photon pair. The spectra of the signal and idler fields, their intensity profiles in the time domain, as well as the coincidence-count interference pattern in a Hong-Ou-Mandel interferometer are determined both for cw and pulsed pumping regimes in terms of the two-photon amplitude. A broad range of parameters characterizing the emitted down-converted fields can be used. As an example, a structure composed of 49 layers of GaN/AlN is analyzed as a suitable source of photon pairs having high efficiency
Magnetic Pair Creation Attenuation Altitude Constraints in Gamma-Ray Pulsars
Baring, Matthew; Story, Sarah
The Fermi gamma-ray pulsar database now exceeds 150 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency at and below the turnover energy. Our updated computations span both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. The altitude bounds, typically in the range of 2-5 stellar radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. However, the exceptional case of the Crab pulsar provides an altitude bound of around 20% of the light cylinder radius if pair transparency persists out to 350 GeV, the maximum energy detected by MAGIC. This is an impressive new physics-based constraint on the Crab's gamma-ray emission locale.
Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.
Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M
1997-01-01
RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620
Energy Technology Data Exchange (ETDEWEB)
Sutter, John P., E-mail: john.sutter@diamond.ac.uk; Chater, Philip A.; Hillman, Michael R.; Keeble, Dean S.; Wilhelm, Heribert [Diamond Light Source Ltd, Harwell Science and Innovation Campus, Chilton, Didcot, Oxfordshire OX11 0DE (United Kingdom); Tucker, Matt G. [Diamond Light Source Ltd, Harwell Science and Innovation Campus, Chilton, Didcot, Oxfordshire OX11 0DE (United Kingdom); ISIS Neutron and Muon Source, Science and Technology Facilities Council, Rutherford Appleton Laboratory, Harwell Oxford, Didcot, Oxfordshire OX11 0QX (United Kingdom)
2016-07-27
The I15-1 beamline, the new side station to I15 at the Diamond Light Source, will be dedicated to the collection of atomic pair distribution function data. A Laue monochromator will be used consisting of three silicon crystals diffracting X-rays at a common Bragg angle of 2.83°. The crystals use the (1 1 1), (2 2 0), and (3 1 1) planes to select 40, 65, and 76 keV X-rays, respectively, and will be bent meridionally to horizontally focus the selected X-rays onto the sample. All crystals will be cut to the same optimized asymmetry angle in order to eliminate image broadening from the crystal thickness. Finite element calculations show that the thermal distortion of the crystals will affect the image size and bandpass.
International Nuclear Information System (INIS)
Sutter, John P.; Chater, Philip A.; Hillman, Michael R.; Keeble, Dean S.; Wilhelm, Heribert; Tucker, Matt G.
2016-01-01
The I15-1 beamline, the new side station to I15 at the Diamond Light Source, will be dedicated to the collection of atomic pair distribution function data. A Laue monochromator will be used consisting of three silicon crystals diffracting X-rays at a common Bragg angle of 2.83°. The crystals use the (1 1 1), (2 2 0), and (3 1 1) planes to select 40, 65, and 76 keV X-rays, respectively, and will be bent meridionally to horizontally focus the selected X-rays onto the sample. All crystals will be cut to the same optimized asymmetry angle in order to eliminate image broadening from the crystal thickness. Finite element calculations show that the thermal distortion of the crystals will affect the image size and bandpass.
Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan
2016-01-01
It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...
Czech Academy of Sciences Publication Activity Database
Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír
2016-01-01
Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016
Existence and consequences of Coulomb pairing of electrons in a solid
International Nuclear Information System (INIS)
Mahajan, S.M.; Thyagaraja, A.
1996-11-01
It is shown from first principles that, in the periodic potential of a crystalline solid, short-range (i.e., screened) binary Coulomb interactions can lead to a two-electron bound state. It is further suggested that these composite bosonic states (charge -2e, and typically spin zero) could mediate an effectively attractive interaction between pairs of conduction electrons close to the Fermi level. This necessarily short range attractive interaction, which is crucially dependent on the band structure of the solid, and is complementary to the phonon-mediated one, may provide a source for the existence and properties of short correlation-length electron pairs (analogous to but distinct from Cooper pairs) needed to understand high temperature superconductivity. Several distinctive and observable characteristics of the proposed pairing scheme are discussed
Generalized pairing strategies-a bridge from pairing strategies to colorings
Directory of Open Access Journals (Sweden)
Győrffy Lajos
2016-12-01
Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.
Accelerator-based pulsed cold neutron source
International Nuclear Information System (INIS)
Inoue, Kazuhiko; Iwasa, Hirokatsu; Kiyanagi, Yoshiaki
1979-01-01
An accelerator-based pulsed cold neutron source was constructed. The accelerator is a 35 MeV electron linear accelerator with 1 kW average beam power. The cold neutron beam intensity at a specimen is equivalent to that of a research reactor of 10 14 n/cm 2 .s thermal flux in the case of the quasi-elastic neutron scattering measurements. In spite of some limitations to the universal uses, it has been demonstrated by this facility that the modest capacity accelerator-based pulsed cold neutron source is a highly efficient cold neutron source with low capital investment. Design philosophy, construction details, performance and some operational experiences are described. (author)
Basset, Jean-Marie
2016-06-09
The design of novel heterogeneous catalysts with multiple adjacent functionalities is of high interest for heterogeneous catalysis. Herein, we report a method to obtain a majority bifunctional acid-base pairs on SBA15. Aniline reacts with SBA15 by opening siloxane bridges leading to N-phenylsilanamine-silanol pairs. In contrast with ammonia treated surfaces, the material is stable under air/moisture. Advanced solid state MAS NMR: 2D ¹H-¹H double-quantum, ¹H-¹³C HETCOR experiments and dynamic nuclear polarization enhanced ²⁹Si and ¹⁵N spectra demonstrate both the close proximity between the two moieties and the formation of a covalent Si-N surface bond and confirm the design of vicinal acid-base pairs. This approach was successfully applied to the design of a series of aniline derivatives bifunctional SBA15. A correlation of the substituents effects on the aromatic ring (Hammet parameters) on the kinetics of the model reaction of Knoevenagel is observed.
Discontinuous Galerkin time-domain analysis of power/ground plate pairs with wave port excitation
Li, Ping; Jiang, Li Jun; Bagci, Hakan
2018-01-01
In this work, a discontinuous Galerkin time-domain method is developed to analyze the power/ground plate pairs taking into account arbitrarily shaped antipads. To implement proper source excitations over the antipads, the magnetic surface current expanded by the electric eigen-modes supported by the corresponding antipad is employed as the excitation. For irregularly shaped antipads, the eigen-modes are obtained by numerical approach. Accordingly, the methodology for the S-parameter extraction is derived based on the orthogonal properties of the different modes. Based on the approach, the transformation between different modes can be readily evaluated.
Discontinuous Galerkin time-domain analysis of power/ground plate pairs with wave port excitation
Li, Ping
2018-04-06
In this work, a discontinuous Galerkin time-domain method is developed to analyze the power/ground plate pairs taking into account arbitrarily shaped antipads. To implement proper source excitations over the antipads, the magnetic surface current expanded by the electric eigen-modes supported by the corresponding antipad is employed as the excitation. For irregularly shaped antipads, the eigen-modes are obtained by numerical approach. Accordingly, the methodology for the S-parameter extraction is derived based on the orthogonal properties of the different modes. Based on the approach, the transformation between different modes can be readily evaluated.
Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G
To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.
An Open-Source Based ITS Platform
DEFF Research Database (Denmark)
Andersen, Ove; Krogh, Benjamin Bjerre; Torp, Kristian
2013-01-01
In this paper, a complete platform used to compute travel times from GPS data is described. Two approaches to computing travel time are proposed one based on points and one based on trips. Overall both approaches give reasonable results compared to existing manual estimated travel times. However......, the trip-based approach requires more GPS data and of a higher quality than the point-based approach. The platform has been completely implemented using open-source software. The main conclusion is that large quantity of GPS data can be managed, with a limited budget and that GPS data is a good source...... for estimating travel times, if enough data is available....
Mondal Roy, Sutapa
2018-08-01
The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Energy Technology Data Exchange (ETDEWEB)
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L. [Department of Physics, University of Basel, Klingelbergstrasse 82, 4056 Basel (Switzerland)
2015-07-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2015-03-01
Based on the Bardeen-Cooper-Schrieffer theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the photon pairs produced can be used to violate a Bell inequality, unambiguously demonstrating the entanglement of the split Cooper pairs.
Directory of Open Access Journals (Sweden)
Yidong Xu
2017-10-01
Full Text Available A novel localization method based on multiple signal classification (MUSIC algorithm is proposed for positioning an electric dipole source in a confined underwater environment by using electric dipole-receiving antenna array. In this method, the boundary element method (BEM is introduced to analyze the boundary of the confined region by use of a matrix equation. The voltage of each dipole pair is used as spatial-temporal localization data, and it does not need to obtain the field component in each direction compared with the conventional fields based localization method, which can be easily implemented in practical engineering applications. Then, a global-multiple region-conjugate gradient (CG hybrid search method is used to reduce the computation burden and to improve the operation speed. Two localization simulation models and a physical experiment are conducted. Both the simulation results and physical experiment result provide accurate positioning performance, with the help to verify the effectiveness of the proposed localization method in underwater environments.
Error-correcting pairs for a public-key cryptosystem
International Nuclear Information System (INIS)
Pellikaan, Ruud; Márquez-Corbella, Irene
2017-01-01
Code-based Cryptography (CBC) is a powerful and promising alternative for quantum resistant cryptography. Indeed, together with lattice-based cryptography, multivariate cryptography and hash-based cryptography are the principal available techniques for post-quantum cryptography. CBC was first introduced by McEliece where he designed one of the most efficient Public-Key encryption schemes with exceptionally strong security guarantees and other desirable properties that still resist to attacks based on Quantum Fourier Transform and Amplitude Amplification. The original proposal, which remains unbroken, was based on binary Goppa codes. Later, several families of codes have been proposed in order to reduce the key size. Some of these alternatives have already been broken. One of the main requirements of a code-based cryptosystem is having high performance t -bounded decoding algorithms which is achieved in the case the code has a t -error-correcting pair (ECP). Indeed, those McEliece schemes that use GRS codes, BCH, Goppa and algebraic geometry codes are in fact using an error-correcting pair as a secret key. That is, the security of these Public-Key Cryptosystems is not only based on the inherent intractability of bounded distance decoding but also on the assumption that it is difficult to retrieve efficiently an error-correcting pair. In this paper, the class of codes with a t -ECP is proposed for the McEliece cryptosystem. Moreover, we study the hardness of distinguishing arbitrary codes from those having a t -error correcting pair. (paper)
Directory of Open Access Journals (Sweden)
Mudasir Mudasir
2010-06-01
Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+ most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA Keywords: DNA Binding, mixed-ligand complexes
A Pair Production Telescope for Medium-Energy Gamma-Ray Polarimetry
Hunter, Stanley D.; Bloser, Peter F.; Depaola, Gerardo; Dion, Michael P.; DeNolfo, Georgia A.; Hanu, Andrei; Iparraguirre, Marcos; Legere, Jason; Longo, Francesco; McConnell, Mark L.;
2014-01-01
We describe the science motivation and development of a pair production telescope for medium-energy (approximately 5-200 Mega electron Volts) gamma-ray polarimetry. Our instrument concept, the Advanced Energetic Pair Telescope (AdEPT), takes advantage of the Three-Dimensional Track Imager, a low-density gaseous time projection chamber, to achieve angular resolution within a factor of two of the pair production kinematics limit (approximately 0.6 deg at 70 Mega electron Volts), continuum sensitivity comparable with the Fermi-LAT front detector (is less than 3 x 10(exp -6) Mega electron Volts per square centimeter per second at 70 Mega electron Volts), and minimum detectable polarization less than 10% for a 10 milliCrab source in 10(exp 6) s.
Guo, Xiurong; Seela, Frank
2017-09-04
α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparison of clinical knowledge bases for summarization of electronic health records.
McCoy, Allison B; Sittig, Dean F; Wright, Adam
2013-01-01
Automated summarization tools that create condition-specific displays may improve clinician efficiency. These tools require new kinds of knowledge that is difficult to obtain. We compared five problem-medication pair knowledge bases generated using four previously described knowledge base development approaches. The number of pairs in the resulting mapped knowledge bases varied widely due to differing mapping techniques from the source terminologies, ranging from 2,873 to 63,977,738 pairs. The number of overlapping pairs across knowledge bases was low, with one knowledge base having half of the pairs overlapping with another knowledge base, and most having less than a third overlapping. Further research is necessary to better evaluate the knowledge bases independently in additional settings, and to identify methods to integrate the knowledge bases.
The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA
Czech Academy of Sciences Publication Activity Database
Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.
2002-01-01
Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002
Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi
2013-01-01
of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Fiber-based broadband black-light source
Sylvestre , Thibaut; Lee , Min Won; Ragueh , A. R.; Stiller , Birgit; Fanjoux , Gil; Barviau , B.; Mussot , A.; Kudlinski , A.
2012-01-01
International audience; Black-Light or Wood's lamp refers to sources that emit long-wavelength ultraviolet radiation (UV-A) from 315 nm and little visible light till 410 nm (blue). In this paper, we present a new fibre-based source of "black light", a source that emits broadband ultraviolet radiation but only small amounts of visible light and no infrared light. We made this source by pumping a specially designed silica photonic crystal fibre (PCF) with 355 nm light pulses from a Q-switched f...
CPM Pairs from LSPM so far not WDS Listed â Part II
Knapp, Wilfried; Nanson, John
2017-10-01
The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted â but as we found during research for our report âA new concept for counter-checking of assumed CPM pairsâ (Knapp and Nanson 2017) there are still many poten-tial CPM pairs indicated in LSPM which as of the end of 2016 are not listed in the WDS cata-log. After our first part on about 40 such objects (Knapp and Nanson 2017) the next report with about 30 additional common proper motion pairs is presented here.
English for au pairs the au pair's guide to learning English
Curtis, Lucy
2014-01-01
English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.
Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.
2010-01-01
Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010
Directory of Open Access Journals (Sweden)
Kateřina Klapilová
2014-01-01
Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.
Quantum Communication with a High-Rate Entangled Photon Source
Wilson, Nathaniel C.; Chaffee, Dalton W.; Lekki, John D.; Wilson, Jeffrey D.
2016-01-01
A high generation rate photon-pair source using a dual element periodically-poled potassium titanyl phosphate (PP KTP) waveguide is described. The photon-pair source features a high pair generation rate, a compact power-efficient package, and continuous wave (CW) or pulsed operation. Characterization and test results are presented. Details and preliminary results of a laboratory free-space QKD experiment with the B92 protocol are also presented.
Kuhlmann, Beatrice G; Vaterrodt, Bianca; Bayen, Ute J
2012-09-01
Two experiments examined reliance on schematic knowledge in source monitoring. Based on a probability-matching account of source guessing, a schema bias will only emerge if participants do not have a representation of the source-item contingency in the study list, or if the perceived contingency is consistent with schematic expectations. Thus, the account predicts that encoding conditions that affect contingency detection also affect schema bias. In Experiment 1, the schema bias commonly found when schematic information about the sources is not provided before encoding was diminished by an intentional source-memory instruction. In Experiment 2, the depth of processing of schema-consistent and schema-inconsistent source-item pairings was manipulated. Participants consequently overestimated the occurrence of the pairing type they processed in a deep manner, and their source guessing reflected this biased contingency perception. Results support the probability-matching account of source guessing. PsycINFO Database Record (c) 2012 APA, all rights reserved.
Detecting nonlocal Cooper pair entanglement by optical Bell inequality violation
Nigg, Simon E.; Tiwari, Rakesh P.; Walter, Stefan; Schmidt, Thomas L.
2014-01-01
Based on the Bardeen Cooper Schrieffer (BCS) theory of superconductivity, the coherent splitting of Cooper pairs from a superconductor to two spatially separated quantum dots has been predicted to generate nonlocal pairs of entangled electrons. In order to test this hypothesis, we propose a scheme to transfer the spin state of a split Cooper pair onto the polarization state of a pair of optical photons. We show that the produced photon pairs can be used to violate a Bell inequality, unambiguo...
Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA
International Nuclear Information System (INIS)
Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.
2002-01-01
3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids
Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping
2016-02-22
We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.
McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F
2014-04-01
Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation
Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.
2011-01-01
Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.
Guo, H.; Zhang, H.
2016-12-01
Relocating high-precision earthquakes is a central task for monitoring earthquakes and studying the structure of earth's interior. The most popular location method is the event-pair double-difference (DD) relative location method, which uses the catalog and/or more accurate waveform cross-correlation (WCC) differential times from event pairs with small inter-event separations to the common stations to reduce the effect of the velocity uncertainties outside the source region. Similarly, Zhang et al. [2010] developed a station-pair DD location method which uses the differential times from common events to pairs of stations to reduce the effect of the velocity uncertainties near the source region, to relocate the non-volcanic tremors (NVT) beneath the San Andreas Fault (SAF). To utilize advantages of both DD location methods, we have proposed and developed a new double-pair DD location method to use the differential times from pairs of events to pairs of stations. The new method can remove the event origin time and station correction terms from the inversion system and cancel out the effects of the velocity uncertainties near and outside the source region simultaneously. We tested and applied the new method on the northern California regular earthquakes to validate its performance. In comparison, among three DD location methods, the new double-pair DD method can determine more accurate relative locations and the station-pair DD method can better improve the absolute locations. Thus, we further proposed a new location strategy combining station-pair and double-pair differential times to determine accurate absolute and relative locations at the same time. For NVTs, it is difficult to pick the first arrivals and derive the WCC event-pair differential times, thus the general practice is to measure station-pair envelope WCC differential times. However, station-pair tremor locations are scattered due to the low-precision relative locations. The ability that double-pair data
Thermodynamics of pairing phase transition in nuclei
International Nuclear Information System (INIS)
Karim, Afaque; Ahmad, Shakeb
2014-01-01
The pairing gaps, pairing energy, heat capacity and entropy are calculated within BCS (Bardeen- Cooper-Schrieffer) based quasi particle approach, including thermal fluctuations on pairing field within pairing model for all nuclei (light, medium, heavy and super heavy nuclei). Quasi particles approach in BCS theory was introduced and reformulated to study various properties. For thermodynamic behavior of nuclei at finite temperatures, the anomalous averages of creation and annihilation operators are introduced. It is solved self consistently at finite temperatures to obtain BCS Hamiltonian. After doing unitary transformation, we obtained the Hamiltonian in the diagonal form. Thus, one gets temperature dependence gap parameter and pairing energy for nuclei. Moreover, the energy at finite temperatures is the sum of the condensation energy and the thermal energy of fermionic quasi particles. With the help of BCS Hamiltonian, specific heat, entropy and free energy are calculated for different nuclei. In this paper the gap parameter occupation number and pairing energy as a function of temperature which is important for all the light, medium, heavy and super heavy nuclei is calculated. Moreover, the various thermo dynamical quantities like specific heat, entropy and free energy is also obtained for different nuclei. Thus, the thermodynamics of pairing phase transition in nuclei is studied
Detecting analogical resemblance without retrieving the source analogy.
Kostic, Bogdan; Cleary, Anne M; Severin, Kaye; Miller, Samuel W
2010-06-01
We examined whether people can detect analogical resemblance to an earlier experimental episode without being able to recall the experimental source of the analogical resemblance. We used four-word analogies (e.g., robin-nest/beaver-dam), in a variation of the recognition-without-cued-recall method (Cleary, 2004). Participants studied word pairs (e.g., robin-nest) and were shown new word pairs at test, half of which analogically related to studied word pairs (e.g., beaver-dam) and half of which did not. For each test pair, participants first attempted to recall an analogically similar pair from the study list. Then, regardless of whether successful recall occurred, participants were prompted to rate the familiarity of the test pair, which was said to indicate the likelihood that a pair that was analogically similar to the test pair had been studied. Across three experiments, participants demonstrated an ability to detect analogical resemblance without recalling the source analogy. Findings are discussed in terms of their potential relevance to the study of analogical reasoning and insight, as well as to the study of familiarity and recognition memory.
Ion-pair chromatography of nucleic acid derivatives
International Nuclear Information System (INIS)
Perrone, P.A.; Brown, P.R.
1985-01-01
Little work has been done on the ion-pair chromatography of nucleic acid constituents, although there is a great potential for the use of this technique in the field. Since the classic work in 1949, nucleotides, as well as nucleosides and bases, have been separated by ion-exchange chromatography. However, ion exchange is a difficult mode and most researchers prefer the use of reversed-phase whenever possible. Although reversed-phase is now the method of choice, ionic compounds like nucleotides and some of the more polar bases are not adequately retained by many systems of this type. In addition, it is difficult to analyze simultaneously members of all three classes of nucleic acid compounds (bases, nucleosides, and nucleotides) using a reversed-phase system, even with gradient elution. Ion pairing can be a useful technique because, theoretically, the separation of nonionic bases and nucleosides along with the ionic nucleotides can be achieved. Additionally, each group of compounds may be separated isocratically. In this chapter, they will discuss ion-pair chromatography as applied to nucleic acid constituents. The current theories, advantages and disadvantages, a limited number of applications, and potential for future work are presented
Response of a neutron monitor area with TLDs pairs
Energy Technology Data Exchange (ETDEWEB)
Guzman G, K. A.; Borja H, C. G.; Valero L, C.; Hernandez D, V. M.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Gallego, E.; Lorente, A., E-mail: ing_karen_guzman@yahoo.com.mx [Universidad Politecnica de Madrid, Departamento de Ingenieria Nuclear, Jose Gutierrez Abascal 2, E-28006 Madrid (Spain)
2011-10-15
The response of a passive neutron monitor area has been calculated using the Monte Carlo code MCNP5. The response was the amount of n({sup 6}Li, T){alpha} reactions occurring in a TLD-600 located at the center of a cylindrical polyethylene moderator. Fluence, (n, a) and H*(10) responses were calculated for 47 monoenergetic neutron sources. The H*(10) relative response was compared with responses of commercially available neutron monitors being alike. Due to {sup 6}Li cross section (n, {alpha}) reactions are mainly produced by thermal neutrons, however TLD-600 is sensitive to gamma-rays; to eliminate the signal due to photons monitor area was built to hold 2 pairs of TLD-600 and 2 pairs of TLD-700, thus from the difference between TLD-600 and TLD-700 readouts the net signal due to neutrons is obtained. The monitor area was calibrated at the Universidad Politecnica de Madrid using a {sup 241}AmBe neutron source; net TLD readout was compared with the H*(10) measured with a Bert hold Lb-6411. Performance of the neutron monitor area was determined through two independent experiments, in both cases the H*(10) was statistically equal to H*(10) measured with a Bert hold Lb-6411. Neutron monitor area with TLDs pairs can be used in working areas with intense, mixed and pulsed radiation fields. (Author)
Bastien, Olivier; Ortet, Philippe; Roy, Sylvaine; Maréchal, Eric
2005-03-10
Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic reconstruction. We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space) and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP) allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
Directory of Open Access Journals (Sweden)
Maréchal Eric
2005-03-01
Full Text Available Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons and be the basis for a novel method of consistent and stable phylogenetic reconstruction. Results We have built up a spatial representation of protein sequences using concepts from particle physics (configuration space and respecting a frame of constraints deduced from pair-wise alignment score properties in information theory. The obtained configuration space of homologous proteins (CSHP allows the representation of real and shuffled sequences, and thereupon an expression of the TULIP theorem for Z-score probabilities. Based on the CSHP, we propose a phylogeny reconstruction using Z-scores. Deduced trees, called TULIP trees, are consistent with multiple-alignment based trees. Furthermore, the TULIP tree reconstruction method provides a solution for some previously reported incongruent results, such as the apicomplexan enolase phylogeny. Conclusion The CSHP is a unified model that conserves mutual information between proteins in the way physical models conserve energy. Applications include the reconstruction of evolutionary consistent and robust trees, the topology of which is based on a spatial representation that is not reordered after addition or removal of sequences. The CSHP and its assigned phylogenetic topology, provide a powerful and easily updated representation for massive pair-wise genome comparisons based on Z-score computations.
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
International Nuclear Information System (INIS)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.
2012-01-01
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a
RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts
Energy Technology Data Exchange (ETDEWEB)
Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: eghbalhd@uc.edu [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)
2012-04-15
The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino
International Nuclear Information System (INIS)
Straehle, U.; Klock, G.; Schuetz, G.
1987-01-01
To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same
Full transverse-momentum spectra of low-mass Drell-Yan pairs at LHC energies
Fái, G; Zhang, X; Fai, George; Qiu, Jianwei; Zhang, Xiaofei
2003-01-01
The transverse momentum distribution of low-mass Drell-Yan pairs is calculated in QCD perturbation theory with all-order resummation. We argue that at LHC energies the results should be reliable for the entire transverse momentum range. We demonstrate that the transverse momentum distribution of low-mass Drell-Yan pairs is an advantageous source of constraints on the gluon distribution and its nuclear dependence.
CPM Pairs from LSPM so far not WDS Listed â Part III
Knapp, Wilfried; Nanson, John
2017-10-01
The LSPM catalog (Lepine and Shara 2005) is a rich source for CPM pairs we thought already exhausted â but as we found during research for our report âA new concept for counter-checking of assumed CPM pairsâ (Knapp and Nanson 2017) there are still many poten-tial CPM pairs indicated in LSPM which as of the end of 2016 are not listed in the WDS cata-log. After our first two reports on in total about 70 such objects (Knapp and Nanson 2017) the next paper with about 25 additional potential common proper motion pairs is presented here.
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.
2013-01-01
We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of
Adiabatic pair creation in heavy-ion and laser fields
International Nuclear Information System (INIS)
Pickl, P.; Durr, D.
2008-01-01
The planned generation of lasers and heavy-ion colliders renews the hope to see electron-positron pair creation in strong classical fields. This old prediction is usually referred to as spontaneous pair creation. We observe that both heavy-ion collisions and pair creation in strong laser fields, are instances of the theory of adiabatic pair creation. We shall present the theory, thereby correcting earlier results. We give the momentum distribution of created pairs in overcritical fields. We discuss carefully the proposed experimental verifications and conclude that pure laser-based experiments are highly questionable. We propose a new experiment, joining laser fields and heavy ions, which may be feasible with present-day technology and which may indeed verify the theoretical prediction of adiabatic pair creation. Our presentation relies on recent rigorous works in mathematical physics. (authors)
Sagan, Bruce E.; Savage, Carla D.
2012-01-01
We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...
A Comparison of Source Code Plagiarism Detection Engines
Lancaster, Thomas; Culwin, Fintan
2004-06-01
Automated techniques for finding plagiarism in student source code submissions have been in use for over 20 years and there are many available engines and services. This paper reviews the literature on the major modern detection engines, providing a comparison of them based upon the metrics and techniques they deploy. Generally the most common and effective techniques are seen to involve tokenising student submissions then searching pairs of submissions for long common substrings, an example of what is defined to be a paired structural metric. Computing academics are recommended to use one of the two Web-based detection engines, MOSS and JPlag. It is shown that whilst detection is well established there are still places where further research would be useful, particularly where visual support of the investigation process is possible.
Xu, Peng; Tian, Yin; Lei, Xu; Hu, Xiao; Yao, Dezhong
2008-12-01
How to localize the neural electric activities within brain effectively and precisely from the scalp electroencephalogram (EEG) recordings is a critical issue for current study in clinical neurology and cognitive neuroscience. In this paper, based on the charge source model and the iterative re-weighted strategy, proposed is a new maximum neighbor weight based iterative sparse source imaging method, termed as CMOSS (Charge source model based Maximum neighbOr weight Sparse Solution). Different from the weight used in focal underdetermined system solver (FOCUSS) where the weight for each point in the discrete solution space is independently updated in iterations, the new designed weight for each point in each iteration is determined by the source solution of the last iteration at both the point and its neighbors. Using such a new weight, the next iteration may have a bigger chance to rectify the local source location bias existed in the previous iteration solution. The simulation studies with comparison to FOCUSS and LORETA for various source configurations were conducted on a realistic 3-shell head model, and the results confirmed the validation of CMOSS for sparse EEG source localization. Finally, CMOSS was applied to localize sources elicited in a visual stimuli experiment, and the result was consistent with those source areas involved in visual processing reported in previous studies.
Lax pairs: a novel type of separability
International Nuclear Information System (INIS)
Fokas, A S
2009-01-01
An attempt is made to place into historical context the fundamental concept of Lax pairs. For economy of presentation, emphasis is placed on the effectiveness of Lax pairs for the analysis of integrable nonlinear evolution PDEs. It is argued that Lax pairs provide a deeper type of separability than the classical separation of variables. Indeed, it is shown that: (a) the solution of the Cauchy problem of evolution equations is based on the derivation of a nonlinear Fourier transform pair, and this is achieved by employing the spectral analysis of one of the two eigenvalue equations forming a Lax pair; thus, although this methodology still follows the reverent philosophy of the classical separation of variables and transform methods, it can be applied to a class of nonlinear PDEs. (b) The solution of initial-boundary-value problems of evolution equations is based on the simultaneous spectral analysis of both equations forming a Lax pair and hence, in a sense, it employs the synthesis instead of the separation of variables; this methodology does not have a direct classical analogue, however, it can be considered as the nonlinearization of a method which combines Green's function classical integral representations with an analogue of the method of images, but which are now formulated in the spectral (Fourier) instead of the physical space. In addition to presenting a general methodology for analysing initial- and initial-boundary-value problems for nonlinear integrable evolution equations in one and two spatial variables, recent progress is reviewed for the derivation and the solution of integrable nonlinear evolution PDEs formulated in higher than two spatial dimensions. (topical review)
Noninteractive Verifiable Outsourcing Algorithm for Bilinear Pairing with Improved Checkability
Directory of Open Access Journals (Sweden)
Yanli Ren
2017-01-01
Full Text Available It is well known that the computation of bilinear pairing is the most expensive operation in pairing-based cryptography. In this paper, we propose a noninteractive verifiable outsourcing algorithm of bilinear pairing based on two servers in the one-malicious model. The outsourcer need not execute any expensive operation, such as scalar multiplication and modular exponentiation. Moreover, the outsourcer could detect any failure with a probability close to 1 if one of the servers misbehaves. Therefore, the proposed algorithm improves checkability and decreases communication cost compared with the previous ones. Finally, we utilize the proposed algorithm as a subroutine to achieve an anonymous identity-based encryption (AIBE scheme with outsourced decryption and an identity-based signature (IBS scheme with outsourced verification.
Pair-correlations in swimmer suspensions
Nambiar, Sankalp; Subramanian, Ganesh
2017-11-01
Suspensions of rear-actuated swimming microorganisms, such as E.coli, exhibit several interesting phenomena including spontaneous pattern formation above a critical concentration, novel rheological properties, shear-induced concentration banding etc. Explanations based on mean-field theory are only qualitative, since interactions between swimmers are important for typical experimental concentrations. We analytically characterize the hydrodynamic pair-interactions in a quiescent suspension of slender straight swimmers. The pair-correlation, calculated at leading order by integrating the swimmer velocity disturbances along straight trajectories, decays as 1/r2 for r >> L (L being the swimmer size). This allows us to characterize both polar and nematic correlations in an interacting swimmer suspension. In the absence of correlations, the velocity covariance asymptotes from a constant for r > L, the latter being characteristic of a suspension of non-interacting point force-dipoles. On including correlations, the slow decay of the pair-orientation correlation leads to an additional contribution to the velocity covariance that diverges logarithmically with system size.
National Aeronautics and Space Administration — In this NASA SBIR Phase II effort, AdvR will design and build an efficient, fully integrated, waveguide based, source of spectrally uncorrelated photon pairs that...
Longitudinal spin dependence of massive lepton pair production
International Nuclear Information System (INIS)
Berger, E. L.; Gordon, L. E.; Klasen, M.
2000-01-01
In this paper, the authors summarize recent work in which they demonstrate that the Compton subprocess, q + g -> γ* + q also dominates the Drell-Yan cross section in polarized and unpolarized proton-proton reactions for values of the transverse momentum Q T of the pair that are larger than roughly half of the pair mass Q, Q T > Q/2. The Drell-Yan process is therefore a valuable, heretofore overlooked, independent source of constraints on the spin-averaged and spin-dependent gluon densities. Although the Drell-Yan cross section is smaller than the prompt photon cross section, massive lepton pair production is cleaner theoretically since long-range fragmentation contributions are absent as are the experimental and theoretical complications associated with isolation of the real photon. Moreover, the dynamics of spin-dependence in hard-scattering processes is a sufficiently complex topic, and its understanding at an early stage in its development, that several defensible approaches for extracting polarized parton densities deserve to be pursued with the expectation that consistent results must emerge
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Ponderomotive effects in multiphoton pair production
Kohlfürst, Christian; Alkofer, Reinhard
2018-02-01
The Dirac-Heisenberg-Wigner formalism is employed to investigate electron-positron pair production in cylindrically symmetric but otherwise spatially inhomogeneous, oscillating electric fields. The oscillation frequencies are hereby tuned to obtain multiphoton pair production in the nonperturbative threshold regime. An effective mass, as well as a trajectory-based semiclassical analysis, is introduced in order to interpret the numerical results for the distribution functions as well as for the particle yields and spectra. The results, including the asymptotic particle spectra, display clear signatures of ponderomotive forces.
An accelerator based steady state neutron source
International Nuclear Information System (INIS)
Burke, R.J.; Johnson, D.L.
1985-01-01
Using high current, c.w. linear accelerator technology, a spallation neutron source can achieve much higher average intensities than existing or proposed pulsed spallation sources. With about 100 mA of 300 MeV protons or deuterons, the Accelerator Based Neutron Research Facility (ABNR) would initially achieve the 10 16 n/cm 2 .s thermal flux goal of the advanced steady state neutron source, and upgrading could provide higher steady state fluxes. The relatively low ion energy compared to other spallation sources has an important impact on R and D requirements as well as capital cost, for which a range of $300-450M is estimated by comparison to other accelerator-based neutron source facilities. The source is similar to a reactor source in most respects. It has some higher energy neutrons but fewer gamma rays, and the moderator region is free of many of the design constraints of a reactor, which helps to implement sources for various neutron energy spectra, many beam tubes, etc. With the development of multi-beam concept and the basis for currents greater than 100 mA that is assumed in the R and D plan, the ABNR would serve many additional uses, such as fusion materials development, production of proton-rich isotopes, and other energy and defense program needs
Muranaka, T.; Debu, P.; Dupré, P.; Liszkay, L.; Mansoulie, B.; Pérez, P.; Rey, J. M.; Ruiz, N.; Sacquin, Y.; Crivelli, P.; Gendotti, U.; Rubbia, A.
2010-04-01
We have installed in Saclay a facility for an intense positron source in November 2008. It is based on a compact 5.5 MeV electron linac connected to a reaction chamber with a tungsten target inside to produce positrons via pair production. The expected production rate for fast positrons is 5·1011 per second. The study of moderation of fast positrons and the construction of a slow positron trap are underway. In parallel, we have investigated an efficient positron-positronium convertor using porous silica materials. These studies are parts of a project to produce positively charged antihydrogen ions aiming to demonstrate the feasibility of a free fall antigravity measurement of neutral antihydrogen.
International Nuclear Information System (INIS)
Muranaka, T; Debu, P; Dupre, P; Liszkay, L; Mansoulie, B; Perez, P; Rey, J M; Ruiz, N; Sacquin, Y; Crivelli, P; Gendotti, U; Rubbia, A
2010-01-01
We have installed in Saclay a facility for an intense positron source in November 2008. It is based on a compact 5.5 MeV electron linac connected to a reaction chamber with a tungsten target inside to produce positrons via pair production. The expected production rate for fast positrons is 5·10 11 per second. The study of moderation of fast positrons and the construction of a slow positron trap are underway. In parallel, we have investigated an efficient positron-positronium convertor using porous silica materials. These studies are parts of a project to produce positively charged antihydrogen ions aiming to demonstrate the feasibility of a free fall antigravity measurement of neutral antihydrogen.
Energy Technology Data Exchange (ETDEWEB)
Muranaka, T; Debu, P; Dupre, P; Liszkay, L; Mansoulie, B; Perez, P; Rey, J M; Ruiz, N; Sacquin, Y [Irfu, CEA-Saclay, F-91191 Gif-sur-Yvette Cedex (France); Crivelli, P; Gendotti, U; Rubbia, A, E-mail: tomoko.muranaka@cea.f [Institut fuer TelichenPhysik, ETHZ, CH-8093 Zuerich (Switzerland)
2010-04-01
We have installed in Saclay a facility for an intense positron source in November 2008. It is based on a compact 5.5 MeV electron linac connected to a reaction chamber with a tungsten target inside to produce positrons via pair production. The expected production rate for fast positrons is 5{center_dot}10{sup 11} per second. The study of moderation of fast positrons and the construction of a slow positron trap are underway. In parallel, we have investigated an efficient positron-positronium convertor using porous silica materials. These studies are parts of a project to produce positively charged antihydrogen ions aiming to demonstrate the feasibility of a free fall antigravity measurement of neutral antihydrogen.
Interactions in ion pairs of protic ionic liquids: Comparison with aprotic ionic liquids
International Nuclear Information System (INIS)
Tsuzuki, Seiji; Shinoda, Wataru; Miran, Md. Shah; Kinoshita, Hiroshi; Yasuda, Tomohiro; Watanabe, Masayoshi
2013-01-01
The stabilization energies for the formation (E form ) of 11 ion pairs of protic and aprotic ionic liquids were studied by MP2/6-311G ** level ab initio calculations to elucidate the difference between the interactions of ions in protic ionic liquids and those in aprotic ionic liquids. The interactions in the ion pairs of protic ionic liquids (diethylmethylammonium [dema] and dimethylpropylammonium [dmpa] based ionic liquids) are stronger than those of aprotic ionic liquids (ethyltrimethylammonium [etma] based ionic liquids). The E form for the [dema][CF 3 SO 3 ] and [dmpa][CF 3 SO 3 ] complexes (−95.6 and −96.4 kcal/mol, respectively) are significantly larger (more negative) than that for the [etma][CF 3 SO 3 ] complex (−81.0 kcal/mol). The same trend was observed for the calculations of ion pairs of the three cations with the Cl − , BF 4 − , TFSA − anions. The anion has contact with the N–H bond of the dema + or dmpa + cations in the most stable geometries of the dema + and dmpa + complexes. The optimized geometries, in which the anions locate on the counter side of the cations, are 11.0–18.0 kcal/mol less stable, which shows that the interactions in the ions pairs of protic ionic liquids have strong directionality. The E form for the less stable geometries for the dema + and dmpa + complexes are close to those for the most stable etma + complexes. The electrostatic interaction, which is the major source of the attraction in the ion pairs, is responsible for the directionality of the interactions and determining the magnitude of the interaction energy. Molecular dynamic simulations of the [dema][TFSA] and [dmpa][TFSA] ionic liquids show that the N–H bonds of the cations have contact with the negatively charged (oxygen and nitrogen) atoms of TFSA − anion, while the strong directionality of the interactions was not suggested from the simulation of the [etma][CF 3 SO 3 ] ionic liquid
Pairing States of Spin-3/2 Fermions: Symmetry-Enforced Topological Gap Functions
Venderbos, Jörn W. F.; Savary, Lucile; Ruhman, Jonathan; Lee, Patrick A.; Fu, Liang
2018-01-01
We study the topological properties of superconductors with paired j =3/2 quasiparticles. Higher spin Fermi surfaces can arise, for instance, in strongly spin-orbit coupled band-inverted semimetals. Examples include the Bi-based half-Heusler materials, which have recently been established as low-temperature and low-carrier density superconductors. Motivated by this experimental observation, we obtain a comprehensive symmetry-based classification of topological pairing states in systems with higher angular momentum Cooper pairing. Our study consists of two main parts. First, we develop the phenomenological theory of multicomponent (i.e., higher angular momentum) pairing by classifying the stationary points of the free energy within a Ginzburg-Landau framework. Based on the symmetry classification of stationary pairing states, we then derive the symmetry-imposed constraints on their gap structures. We find that, depending on the symmetry quantum numbers of the Cooper pairs, different types of topological pairing states can occur: fully gapped topological superconductors in class DIII, Dirac superconductors, and superconductors hosting Majorana fermions. Notably, we find a series of nematic fully gapped topological superconductors, as well as double- and triple-Dirac superconductors, with quadratic and cubic dispersion, respectively. Our approach, applied here to the case of j =3/2 Cooper pairing, is rooted in the symmetry properties of pairing states, and can therefore also be applied to other systems with higher angular momentum and high-spin pairing. We conclude by relating our results to experimentally accessible signatures in thermodynamic and dynamic probes.
Open Source Cloud-Based Technologies for Bim
Logothetis, S.; Karachaliou, E.; Valari, E.; Stylianidis, E.
2018-05-01
This paper presents a Cloud-based open source system for storing and processing data from a 3D survey approach. More specifically, we provide an online service for viewing, storing and analysing BIM. Cloud technologies were used to develop a web interface as a BIM data centre, which can handle large BIM data using a server. The server can be accessed by many users through various electronic devices anytime and anywhere so they can view online 3D models using browsers. Nowadays, the Cloud computing is engaged progressively in facilitating BIM-based collaboration between the multiple stakeholders and disciplinary groups for complicated Architectural, Engineering and Construction (AEC) projects. Besides, the development of Open Source Software (OSS) has been rapidly growing and their use tends to be united. Although BIM and Cloud technologies are extensively known and used, there is a lack of integrated open source Cloud-based platforms able to support all stages of BIM processes. The present research aims to create an open source Cloud-based BIM system that is able to handle geospatial data. In this effort, only open source tools will be used; from the starting point of creating the 3D model with FreeCAD to its online presentation through BIMserver. Python plug-ins will be developed to link the two software which will be distributed and freely available to a large community of professional for their use. The research work will be completed by benchmarking four Cloud-based BIM systems: Autodesk BIM 360, BIMserver, Graphisoft BIMcloud and Onuma System, which present remarkable results.
OPEN SOURCE CLOUD-BASED TECHNOLOGIES FOR BIM
Directory of Open Access Journals (Sweden)
S. Logothetis
2018-05-01
Full Text Available This paper presents a Cloud-based open source system for storing and processing data from a 3D survey approach. More specifically, we provide an online service for viewing, storing and analysing BIM. Cloud technologies were used to develop a web interface as a BIM data centre, which can handle large BIM data using a server. The server can be accessed by many users through various electronic devices anytime and anywhere so they can view online 3D models using browsers. Nowadays, the Cloud computing is engaged progressively in facilitating BIM-based collaboration between the multiple stakeholders and disciplinary groups for complicated Architectural, Engineering and Construction (AEC projects. Besides, the development of Open Source Software (OSS has been rapidly growing and their use tends to be united. Although BIM and Cloud technologies are extensively known and used, there is a lack of integrated open source Cloud-based platforms able to support all stages of BIM processes. The present research aims to create an open source Cloud-based BIM system that is able to handle geospatial data. In this effort, only open source tools will be used; from the starting point of creating the 3D model with FreeCAD to its online presentation through BIMserver. Python plug-ins will be developed to link the two software which will be distributed and freely available to a large community of professional for their use. The research work will be completed by benchmarking four Cloud-based BIM systems: Autodesk BIM 360, BIMserver, Graphisoft BIMcloud and Onuma System, which present remarkable results.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
International Nuclear Information System (INIS)
Shimizu, Yoshifumi
2009-01-01
Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)
Magnetic Pair Creation Transparency in Pulsars
Story, Sarah; Baring, M. G.
2013-04-01
The Fermi gamma-ray pulsar database now exceeds 115 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency below the turnover energy. We adopt a semi-analytic approach, spanning both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. Our work clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths. The altitude bounds, typically in the range of 2-6 neutron star radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. For the Crab pulsar, which emits pulsed radiation up to energies of 120 GeV, we obtain a lower bound of around 15 neutron star radii to its emission altitude.
Energy-Based Acoustic Source Localization Methods: A Survey
Directory of Open Access Journals (Sweden)
Wei Meng
2017-02-01
Full Text Available Energy-based source localization is an important problem in wireless sensor networks (WSNs, which has been studied actively in the literature. Numerous localization algorithms, e.g., maximum likelihood estimation (MLE and nonlinear-least-squares (NLS methods, have been reported. In the literature, there are relevant review papers for localization in WSNs, e.g., for distance-based localization. However, not much work related to energy-based source localization is covered in the existing review papers. Energy-based methods are proposed and specially designed for a WSN due to its limited sensor capabilities. This paper aims to give a comprehensive review of these different algorithms for energy-based single and multiple source localization problems, their merits and demerits and to point out possible future research directions.
DEFF Research Database (Denmark)
Dalgas, Karina Märcher
2015-01-01
pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...
Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control
International Nuclear Information System (INIS)
Takeuchi, Shin
2005-01-01
A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures
Transverse Momentum Distributions for Heavy Quark Pairs
Berger, Edmond L.; Meng, Ruibin
1993-01-01
We study the transverse momentum distribution for a $pair$ of heavy quarks produced in hadron-hadron interactions. Predictions for the large transverse momentum region are based on exact order $\\alpha_s^3$ QCD perturbation theory. For the small transverse momentum region, we use techniques for all orders resummation of leading logarithmic contributions associated with initial state soft gluon radiation. The combination provides the transverse momentum distribution of heavy quark pairs for all...
Three-dimensional cloud characterization from paired whole-sky imaging cameras
International Nuclear Information System (INIS)
Allmen, M.; Kegelmeyer, W.P. Jr.
1994-01-01
Three-dimensional (3-D) cloud characterization permits the derivation of important cloud geometry properties such as fractional cloudiness, mean cloud and clear length, aspect ratio, and the morphology of cloud cover. These properties are needed as input to the hierarchical diagnosis (HD) and instantaneous radiative transfer (IRF) models, to validate sub-models for cloud occurrence and formation, and to Central Site radiative flux calculations. A full 3-D characterization will eventually require the integration of disparate Cloud and Radiation Testbed (CART) data sources: whole-sky imagers (WSIs), radar, satellites, ceilometers, volume-imaging lidar, and other sensors. In this paper, we demonstrate how an initial 3-D cloud property, cloud base height, can be determined from fusing paired times series of images from two whole-sky imagers
Isominkowskian theory of Cooper Pairs in superconductors
International Nuclear Information System (INIS)
Animalu, A.O.E.
1993-01-01
Via the use of Santilli's isominkowskian space, the author presents a relativistic extension of the author's recent treatment of the Cooper Pair in superconductivity based on the Lie-isotopic lifting of quantum mechanics known as Hadronic Mechanics. The isominkowskian treatment reduces the solution of the eiganvalue problem for the quasiparticle energy spectrum to a geometric problem of specifying the metric of the isominkowskian space inside the pair in various models of ordinary high T c superconductors. The use of an intriguing realization of the metric due to Dirac reduces the dimensionality of the interior space to two yielding a spin mutation from 1/2 to zero inside a Cooper pair in two-band BCS and Hubbard models. 12 refs
Wearable energy sources based on 2D materials.
Yi, Fang; Ren, Huaying; Shan, Jingyuan; Sun, Xiao; Wei, Di; Liu, Zhongfan
2018-05-08
Wearable energy sources are in urgent demand due to the rapid development of wearable electronics. Besides flexibility and ultrathin thickness, emerging 2D materials present certain extraordinary properties that surpass the properties of conventional materials, which make them advantageous for high-performance wearable energy sources. Here, we provide a comprehensive review of recent advances in 2D material based wearable energy sources including wearable batteries, supercapacitors, and different types of energy harvesters. The crucial roles of 2D materials in the wearable energy sources are highlighted. Based on the current progress, the existing challenges and future prospects are outlined and discussed.
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
The Effects of Reinforcer Pairing and Fading on Preschoolers' Snack Selections
Solberg, Katherine M.; Hanley, Gregory P.; Layer, Stacy A.; Ingvarsson, Einar T.
2007-01-01
The effects of reinforcement pairing and fading on preschoolers' snack selections were evaluated in a multiple baseline design. Baseline preferences for snack options were assessed via repeated paired-item preference assessments. Edible, social, and activity-based reinforcers were then exclusively paired with a less preferred snack option. Once…
DEFF Research Database (Denmark)
Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf
2009-01-01
We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...
Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory
Directory of Open Access Journals (Sweden)
Y. Chen
2015-11-01
Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.
Graph-based surface reconstruction from stereo pairs using image segmentation
Bleyer, Michael; Gelautz, Margrit
2005-01-01
This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.
Single-flavour and two-flavour pairing in three-flavour quark matter
International Nuclear Information System (INIS)
Alford, Mark G; Cowan, Greig A
2006-01-01
We study single-flavour quark pairing ('self-pairing') in colour-superconducting phases of quark matter, paying particular attention to the difference between scenarios where all three flavours undergo single-flavour pairing, and scenarios where two flavours pair with each other ('2SC' pairing) and the remaining flavour self-pairs. We perform our calculations in the mean-field approximation using a pointlike four-fermion interaction based on single gluon exchange. We confirm the result from previous weakly-coupled-QCD calculations that when all three flavours self-pair the favoured channel for each is colour-spin-locked (CSL) pseudoisotropic pairing. However, we find that when the up and down quarks undergo 2SC pairing, they induce a colour chemical potential that disfavours the CSL phase. The strange quarks then self-pair in a 'polar' channel that breaks rotational invariance, although the CSL phase may survive in a narrow range of densities
Asynchronous replication and autosome-pair non-equivalence in human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Devkanya Dutta
Full Text Available A number of mammalian genes exhibit the unusual properties of random monoallelic expression and random asynchronous replication. Such exceptional genes include genes subject to X inactivation and autosomal genes including odorant receptors, immunoglobulins, interleukins, pheromone receptors, and p120 catenin. In differentiated cells, random asynchronous replication of interspersed autosomal genes is coordinated at the whole chromosome level, indicative of chromosome-pair non-equivalence. Here we have investigated the replication pattern of the random asynchronously replicating genes in undifferentiated human embryonic stem cells, using fluorescence in situ hybridization based assay. We show that allele-specific replication of X-linked genes and random monoallelic autosomal genes occur in human embryonic stem cells. The direction of replication is coordinated at the whole chromosome level and can cross the centromere, indicating the existence of autosome-pair non-equivalence in human embryonic stem cells. These results suggest that epigenetic mechanism(s that randomly distinguish between two parental alleles are emerging in the cells of the inner cell mass, the source of human embryonic stem cells.
Simulation-based investigation of the paired-gear method in cod-end selectivity studies
DEFF Research Database (Denmark)
Herrmann, Bent; Frandsen, Rikke; Holst, René
2007-01-01
In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...
Wan, Qian; Zhuo, Ji-Bin; Wang, Xiao-Xue; Lin, Cai-Xia; Yuan, Yao-Feng
2015-03-28
A structurally simple, 2,2-diferrocenylpropane-based ion pair receptor 1 was synthesized and characterized by (1)H NMR, (13)C NMR, HRMS, elemental analyses, and single-crystal X-ray diffraction. The ion pair receptor 1 showed excellent selectivity and sensitivity towards Pb(2+) with multi-channel responses: a fluorescence enhancement (more than 42-fold), a notable color change from yellow to red, redox anodic shift (ΔE1/2 = 151 mV), while HSO4(-) promoted fluorescence enhancement when Pb(2+) or Zn(2+) was bonded to the cation binding-site. (1)H NMR titration and density functional theory were performed to reveal the sensing mechanism based on photo-induced electron transfer (PET).
Guo, Liyuan; Wang, Jing
2018-01-04
Here, we present the updated rSNPBase 3.0 database (http://rsnp3.psych.ac.cn), which provides human SNP-related regulatory elements, element-gene pairs and SNP-based regulatory networks. This database is the updated version of the SNP regulatory annotation database rSNPBase and rVarBase. In comparison to the last two versions, there are both structural and data adjustments in rSNPBase 3.0: (i) The most significant new feature is the expansion of analysis scope from SNP-related regulatory elements to include regulatory element-target gene pairs (E-G pairs), therefore it can provide SNP-based gene regulatory networks. (ii) Web function was modified according to data content and a new network search module is provided in the rSNPBase 3.0 in addition to the previous regulatory SNP (rSNP) search module. The two search modules support data query for detailed information (related-elements, element-gene pairs, and other extended annotations) on specific SNPs and SNP-related graphic networks constructed by interacting transcription factors (TFs), miRNAs and genes. (3) The type of regulatory elements was modified and enriched. To our best knowledge, the updated rSNPBase 3.0 is the first data tool supports SNP functional analysis from a regulatory network prospective, it will provide both a comprehensive understanding and concrete guidance for SNP-related regulatory studies. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sourcing Team Behavior in Project-Based MNE's
DEFF Research Database (Denmark)
Hansen, Anders Peder Lysholm
2014-01-01
across the three cases was characterized by conflict between departments represented in the category teams. This resulted in unfortunate sourcing team behaviour and unaligned performance management, which in turn had a number of adverse effects. Further research on how to create a holistic and balanced......This paper presents and discusses a multiple case study of three cross-functional category teams responsible for sourcing critical components within multi-national, project-based enterprises. The study focused on behaviour and management of the sourcing teams and found that the sourcing process...... team perspective in the sourcing teams is suggested....
QED peripheral mechanism of pair production at colliders
International Nuclear Information System (INIS)
Ahmadov, A. I.; Galynskii, M. V.; Bystritskiy, Yu. M.; Kuraev, E. A.; Shatnev, M. G.
2008-01-01
Cross sections of the processes of production of neutral pions and pairs of charged fermions and bosons in peripheral interaction of leptons and photons are calculated in the main logarithmic approximation. We investigate the phase volumes and differential cross sections. The differential cross sections of production of a few neutral pions and a few pairs are written down explicitly. Considering the academic problem of summation over a number of pairs for massless particles we reproduce the known results obtained in the 1970s. The possibility of constructing the generator for Monte Carlo modeling of these processes based on these results is discussed.
Cyclotron-based neutron source for BNCT
Energy Technology Data Exchange (ETDEWEB)
Mitsumoto, T.; Yajima, S.; Tsutsui, H.; Ogasawara, T.; Fujita, K. [Sumitomo Heavy Industries, Ltd (Japan); Tanaka, H.; Sakurai, Y.; Maruhashi, A. [Kyoto University Research Reactor Institute (Japan)
2013-04-19
Kyoto University Research Reactor Institute (KURRI) and Sumitomo Heavy Industries, Ltd. (SHI) have developed a cyclotron-based neutron source for Boron Neutron Capture Therapy (BNCT). It was installed at KURRI in Osaka prefecture. The neutron source consists of a proton cyclotron named HM-30, a beam transport system and an irradiation and treatment system. In the cyclotron, H- ions are accelerated and extracted as 30 MeV proton beams of 1 mA. The proton beams is transported to the neutron production target made by a beryllium plate. Emitted neutrons are moderated by lead, iron, aluminum and calcium fluoride. The aperture diameter of neutron collimator is in the range from 100 mm to 250 mm. The peak neutron flux in the water phantom is 1.8 Multiplication-Sign 109 neutrons/cm{sup 2}/sec at 20 mm from the surface at 1 mA proton beam. The neutron source have been stably operated for 3 years with 30 kW proton beam. Various pre-clinical tests including animal tests have been done by using the cyclotron-based neutron source with {sup 10}B-p-Borono-phenylalanine. Clinical trials of malignant brain tumors will be started in this year.
Space-Efficient Re-Pair Compression
DEFF Research Database (Denmark)
Bille, Philip; Gørtz, Inge Li; Prezza, Nicola
2017-01-01
Re-Pair [5] is an effective grammar-based compression scheme achieving strong compression rates in practice. Let n, σ, and d be the text length, alphabet size, and dictionary size of the final grammar, respectively. In their original paper, the authors show how to compute the Re-Pair grammar...... in expected linear time and 5n + 4σ2 + 4d + √n words of working space on top of the text. In this work, we propose two algorithms improving on the space of their original solution. Our model assumes a memory word of [log2 n] bits and a re-writable input text composed by n such words. Our first algorithm runs...
The paired-domination and the upper paired-domination numbers of graphs
Directory of Open Access Journals (Sweden)
Włodzimierz Ulatowski
2015-01-01
Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.
Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the
Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D
1984-06-19
The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)
Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul
2012-11-01
Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.
Seniority zero pair coupled cluster doubles theory
International Nuclear Information System (INIS)
Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.
2014-01-01
Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems
Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier
2005-01-01
Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Chella, Federico; Pizzella, Vittorio; Zappasodi, Filippo; Nolte, Guido; Marzetti, Laura
2016-05-01
Brain cognitive functions arise through the coordinated activity of several brain regions, which actually form complex dynamical systems operating at multiple frequencies. These systems often consist of interacting subsystems, whose characterization is of importance for a complete understanding of the brain interaction processes. To address this issue, we present a technique, namely the bispectral pairwise interacting source analysis (biPISA), for analyzing systems of cross-frequency interacting brain sources when multichannel electroencephalographic (EEG) or magnetoencephalographic (MEG) data are available. Specifically, the biPISA makes it possible to identify one or many subsystems of cross-frequency interacting sources by decomposing the antisymmetric components of the cross-bispectra between EEG or MEG signals, based on the assumption that interactions are pairwise. Thanks to the properties of the antisymmetric components of the cross-bispectra, biPISA is also robust to spurious interactions arising from mixing artifacts, i.e., volume conduction or field spread, which always affect EEG or MEG functional connectivity estimates. This method is an extension of the pairwise interacting source analysis (PISA), which was originally introduced for investigating interactions at the same frequency, to the study of cross-frequency interactions. The effectiveness of this approach is demonstrated in simulations for up to three interacting source pairs and for real MEG recordings of spontaneous brain activity. Simulations show that the performances of biPISA in estimating the phase difference between the interacting sources are affected by the increasing level of noise rather than by the number of the interacting subsystems. The analysis of real MEG data reveals an interaction between two pairs of sources of central mu and beta rhythms, localizing in the proximity of the left and right central sulci.
System for selection of radiation source transfer trucks
International Nuclear Information System (INIS)
Tanimoto, Yoshinori; Ito, Kojiro.
1970-01-01
A device for selection of trucks each of which load and transfer a radiation source to an irradiation room above a water pool is installed at the end of a pair of rails fixed to the bottom of the pool. This device is equipped with a number of laterally shiftable rail pairs which may be brought into successive alignment with the fixed rails and is adapted to receive, carry and fix a truck on each rail pair. If one of said trucks is selected for irradiation in a desired irradiation room, the rail pair carrying this truck is shifted to align and couple with the fixed rail pair whereupon the truck is driven and transferred to a position on the fixed rails below the desired room and elevated thereinto. Accordingly, a plurality of trucks can optionally be shunted on a line of fixed rails without unloading the respective radiation sources. (Ohno, Y.)
Energy Technology Data Exchange (ETDEWEB)
Yu, Xiang-Long, E-mail: xlyu@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: zou@theory.issp.ac.cn [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)
2015-12-15
Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.
vProtein: identifying optimal amino acid complements from plant-based foods.
Directory of Open Access Journals (Sweden)
Peter J Woolf
Full Text Available BACKGROUND: Indispensible amino acids (IAAs are used by the body in different proportions. Most animal-based foods provide these IAAs in roughly the needed proportions, but many plant-based foods provide different proportions of IAAs. To explore how these plant-based foods can be better used in human nutrition, we have created the computational tool vProtein to identify optimal food complements to satisfy human protein needs. METHODS: vProtein uses 1251 plant-based foods listed in the United States Department of Agriculture standard release 22 database to determine the quantity of each food or pair of foods required to satisfy human IAA needs as determined by the 2005 daily recommended intake. The quantity of food in a pair is found using a linear programming approach that minimizes total calories, total excess IAAs, or the total weight of the combination. RESULTS: For single foods, vProtein identifies foods with particularly balanced IAA patterns such as wheat germ, quinoa, and cauliflower. vProtein also identifies foods with particularly unbalanced IAA patterns such as macadamia nuts, degermed corn products, and wakame seaweed. Although less useful alone, some unbalanced foods provide unusually good complements, such as Brazil nuts to legumes. Interestingly, vProtein finds no statistically significant bias toward grain/legume pairings for protein complementation. These analyses suggest that pairings of plant-based foods should be based on the individual foods themselves instead of based on broader food group-food group pairings. Overall, the most efficient pairings include sweet corn/tomatoes, apple/coconut, and sweet corn/cherry. The top pairings also highlight the utility of less common protein sources such as the seaweeds laver and spirulina, pumpkin leaves, and lambsquarters. From a public health perspective, many of the food pairings represent novel, low cost food sources to combat malnutrition. Full analysis results are available online
High-brightness electron guns for linac-based light sources
International Nuclear Information System (INIS)
Lewellen, J.W.
2004-01-01
Most proposed linac-based light sources, such as single-pass free-electron lasers and energy-recovery-linacs, require very high-brightness electron beams in order to achieve their design performance. These beam requirements must be achieved not on an occasional basis, but rather must be met by every bunch produced by the source over extended periods of time. It is widely assumed that the beam source will be a photocathode electron gun; the selection of accelerator technique (e.g., dc or rf) for the gun is more dependent on the application.The current state of the art of electron beam production is adequate but not ideal for the first generation of linac-based light sources, such as the Linac Coherent Light Source (LCLS) x-ray free-electron laser (X-FEL). For the next generation of linac-based light sources, an order of magnitude reduction in the transverse electron beam emittance is required to significantly reduce the cost of the facility. This is beyond the present state of the art, given the other beam properties that must be maintained. The requirements for current and future linac-based light source beam sources are presented here, along with a review of the present state of the art. A discussion of potential paths towards meeting future needs is presented at the conclusion.
Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.
Hao, Pei-Yi
This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory
International Nuclear Information System (INIS)
Wang, Y.L.; Xia, Z.H.; Liu, D.; Qiu, W.X.; Duan, X.L.; Wang, R.; Liu, W.J.; Zhang, Y.H.; Wang, D.; Tao, S.; Liu, W.X.
2013-01-01
A steady state Level III fate model was established and applied to quantify source–receptor relationship in a coking industry city in Northern China. The local emission inventory of PAHs, as the model input, was acquired based on energy consumption and emission factors. The model estimations were validated by measured data and indicated remarkable variations in the paired isomeric ratios. When a rectification factor, based on the receptor-to-source ratio, was calculated by the fate model, the quantitatively verified molecular diagnostic ratios provided reasonable results of local PAH emission sources. Due to the local ban and measures on small scale coking activities implemented from the beginning of 2004, the model calculations indicated that the local emission amount of PAHs in 2009 decreased considerably compared to that in 2003. -- Highlights: •A steady-state fate model could well elucidate the multimedia fate of PAHs. •A rectification factor for correcting the paired isomeric ratio was calculated. •The corrected isomeric ratios were successfully applied to source apportionment. -- Based on multimedia model correction, the specific isomeric ratios could provide reasonable apportionments for the local PAHs emission sources
Brilliant positron sources for CLIC and other collider projects
Rinolfi, Louis; Dadoun, Olivier; Kamitani, Takuya; Strakhovenko, Vladimir; Variola, Alessandro
2013-01-01
The CLIC (Compact Linear Collider), as future linear collider, requires an intense positron source. A brief history is given up to the present baseline configuration which assumes unpolarized beams. A conventional scheme, with a single tungsten target as source of e-e+ pairs, has been studied several years ago. But, in order to reduce the beam energy deposition on the e+ target converter, a double-target system has been studied and proposed as baseline for CLIC. With this ‘‘hybrid target’’, the positron production scheme is based on the channeling process. A 5 GeV electron beam impinges on a thin crystal tungsten target aligned along its axis, enhancing the photon production by channeling radiation. A large number of photons are sent to a thick amorphous tungsten target, generating large number of e-e+ pairs, while the charged particles are bent away, reducing the deposited energy and the PEDD (Peak Energy Deposition Density). The targets parameters are optimized for the positron production. Polarize...
LED-based UV source for monitoring spectroradiometer properties
Sildoja, Meelis-Mait; Nevas, Saulius; Kouremeti, Natalia; Gröbner, Julian; Pape, Sven; Pendsa, Stefan; Sperfeld, Peter; Kemus, Fabian
2018-06-01
A compact and stable UV monitoring source based on state-of-the-art commercially available ultraviolet light emitting diodes (UV-LEDs) has been developed. It is designed to trace the radiometric stability—both responsivity and wavelength scale—of array spectroradiometers measuring direct solar irradiance in the wavelength range between 300 nm and 400 nm. The spectral irradiance stability of the UV-LED-based light source observed in the laboratory after seasoning (burning-in) the individual LEDs was better than 0.3% over a 12 h period of continuous operation. The integral irradiance measurements of the source over a period of several months, where the UV-LED source was not operated continuously between the measurements, showed stability within 0.3%. In-field measurements of the source with an array spectroradiometer indicated the stability of the source to be within the standard uncertainty of the spectroradiometer calibration, which was within 1% to 2%.
Directory of Open Access Journals (Sweden)
Jiuqiang Han
2013-03-01
Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.
Electron-positron pair creation in heavy ion collisions
International Nuclear Information System (INIS)
Kienle, P.
1987-08-01
We review here the status of experiments to study the electron positron pair creation in heavy ion atom collisions at bombarding energies close to the Coulomb barrier. The disentanglement and characterisation of various sources of positrons observed in such collisions are described with a focus on the monoenergetic electron positron pairs observed. They seem to originate from the two-body decay of a family of neutral particles with masses of about 3 m e and life times in the range of 6x10 -14 s -10 s, produced by high Coulomb fields. First attempts were made to create these particles by resonant Bhabha scattering. First we present some experimental methods for high efficiency positron spectroscopy in heavy ion collisions. Then we describe the discovery of positron creation induced by strong time changing Coulomb fields. (orig./HSI)
Complementary Cohort Strategy for Multimodal Face Pair Matching
DEFF Research Database (Denmark)
Sun, Yunlian; Nasrollahi, Kamal; Sun, Zhenan
2016-01-01
Face pair matching is the task of determining whether two face images represent the same person. Due to the limited expressive information embedded in the two face images as well as various sources of facial variations, it becomes a quite difficult problem. Towards the issue of few available images...... provided to represent each face, we propose to exploit an extra cohort set (identities in the cohort set are different from those being compared) by a series of cohort list comparisons. Useful cohort coefficients are then extracted from both sorted cohort identities and sorted cohort images...... for complementary information. To augment its robustness to complicated facial variations, we further employ multiple face modalities owing to their complementary value to each other for the face pair matching task. The final decision is made by fusing the extracted cohort coefficients with the direct matching...
Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard
2012-01-01
8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...
Calculations of accelerator-based neutron sources characteristics
International Nuclear Information System (INIS)
Tertytchnyi, R.G.; Shorin, V.S.
2000-01-01
Accelerator-based quasi-monoenergetic neutron sources (T(p,n), D(d;n), T(d;n) and Li (p,n)-reactions) are widely used in experiments on measuring the interaction cross-sections of fast neutrons with nuclei. The present work represents the code for calculation of the yields and spectra of neutrons generated in (p, n)- and ( d; n)-reactions on some targets of light nuclei (D, T; 7 Li). The peculiarities of the stopping processes of charged particles (with incident energy up to 15 MeV) in multilayer and multicomponent targets are taken into account. The code version is made in terms of the 'SOURCE,' a subroutine for the well-known MCNP code. Some calculation results for the most popular accelerator- based neutron sources are given. (authors)
Observing Pair-Work Task in an English Speaking Class
Directory of Open Access Journals (Sweden)
Diana Achmad
2014-01-01
Full Text Available This paper reports on students’ pair-work interactions to develop their speaking skills in an ELT classroom which consisted of international learners. A number of 16 learners of intermediate proficiency with IELTS score band 5.5 were observed. The teacher had paired those he considered among them to be the more competent ones (hereafter, stronger with the less competent ones (hereafter, weaker; therefore, eight pairs were observed during the lesson. The task given to the students was to express ‘Agree and Disagree’ in the context of giving opinions related to social life. Based on the observations, the task was successfully implemented by six pairs; thus, the two others faced some problems. From the first pair, it was seen that the stronger student had intimated the weaker one into speaking during the task. The other pair, who was both of the same native, did not converse in English as expected and mostly used their native language to speak with one another presumably due to respect from the stronger student towards the weaker one. In situations like this, when pair-work becomes unproductive, rotating pairs is recommended to strengthen information sharing and assigning roles to avoid a student from taking over the activity from his or her pair. In conclusion, pairing international learners with mixed speaking proficiency by teachers must be conducted as effectively as possible by initially identifying their ability and learning culture to profoundly expand the students’ language resources.
Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt
1998-01-01
This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668
Abaka, Gamze; Bıyıkoğlu, Türker; Erten, Cesim
2013-07-01
Given a pair of metabolic pathways, an alignment of the pathways corresponds to a mapping between similar substructures of the pair. Successful alignments may provide useful applications in phylogenetic tree reconstruction, drug design and overall may enhance our understanding of cellular metabolism. We consider the problem of providing one-to-many alignments of reactions in a pair of metabolic pathways. We first provide a constrained alignment framework applicable to the problem. We show that the constrained alignment problem even in a primitive setting is computationally intractable, which justifies efforts for designing efficient heuristics. We present our Constrained Alignment of Metabolic Pathways (CAMPways) algorithm designed for this purpose. Through extensive experiments involving a large pathway database, we demonstrate that when compared with a state-of-the-art alternative, the CAMPways algorithm provides better alignment results on metabolic networks as far as measures based on same-pathway inclusion and biochemical significance are concerned. The execution speed of our algorithm constitutes yet another important improvement over alternative algorithms. Open source codes, executable binary, useful scripts, all the experimental data and the results are freely available as part of the Supplementary Material at http://code.google.com/p/campways/. Supplementary data are available at Bioinformatics online.
Independent EEG sources are dipolar.
Directory of Open Access Journals (Sweden)
Arnaud Delorme
Full Text Available Independent component analysis (ICA and blind source separation (BSS methods are increasingly used to separate individual brain and non-brain source signals mixed by volume conduction in electroencephalographic (EEG and other electrophysiological recordings. We compared results of decomposing thirteen 71-channel human scalp EEG datasets by 22 ICA and BSS algorithms, assessing the pairwise mutual information (PMI in scalp channel pairs, the remaining PMI in component pairs, the overall mutual information reduction (MIR effected by each decomposition, and decomposition 'dipolarity' defined as the number of component scalp maps matching the projection of a single equivalent dipole with less than a given residual variance. The least well-performing algorithm was principal component analysis (PCA; best performing were AMICA and other likelihood/mutual information based ICA methods. Though these and other commonly-used decomposition methods returned many similar components, across 18 ICA/BSS algorithms mean dipolarity varied linearly with both MIR and with PMI remaining between the resulting component time courses, a result compatible with an interpretation of many maximally independent EEG components as being volume-conducted projections of partially-synchronous local cortical field activity within single compact cortical domains. To encourage further method comparisons, the data and software used to prepare the results have been made available (http://sccn.ucsd.edu/wiki/BSSComparison.
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Josephson junction analog and quasiparticle-pair current
DEFF Research Database (Denmark)
Bak, Christen Kjeldahl; Pedersen, Niels Falsig
1973-01-01
A close analogy exists between a Josephson junction and a phase-locked loop. A new type of electrical analog based on this principle is presented. It is shown that the inclusion in this analog of a low-pass filter gives rise to a current of the same form as the Josephson quasiparticle-pair current....... A simple picture of the quasiparticle-pair current, which gives the right dependences, is obtained by assuming a junction cutoff frequency to be at the energy gap. ©1973 American Institute of Physics...
International Nuclear Information System (INIS)
Yang Jian; Zhang Han; Peng Chengzhi; Chen Zengbing; Bao Xiaohui; Chen Shuai; Pan Jianwei
2009-01-01
In this paper, we report a realization of synchronization-free quantum teleportation and narrowband three-photon entanglement through interfering narrowband photon sources. Since both the single-photon and the entangled photon pair utilized are completely autonomous, it removes the requirement of high-demanding synchronization techniques in long-distance quantum communication with pulsed spontaneous parametric down-conversion sources. The frequency linewidth of the three-photon entanglement realized is on the order of several MHz, which matches the requirement of atomic ensemble based quantum memories. Such a narrowband multiphoton source will have applications in some advanced quantum communication protocols and linear optical quantum computation.
Designing an ASIP for cryptographic pairings over Barreto-Naehrig curves
Kammler, D.; Zhang, D.; Schwabe, P.; Scharwaechter, H.; Langenberg, M.; Auras, D.; Ascheid, G.; Mathar, R.; Clavier, C.; Gaj, K.
2009-01-01
This paper presents a design-space exploration of an application-specific instruction-set processor (ASIP) for the computation of various cryptographic pairings over Barreto-Naehrig curves (BN curves). Cryptographic pairings are based on elliptic curves over finite fields—in the case of BN curves a
Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs
Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.
2018-02-01
For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.
Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs
Directory of Open Access Journals (Sweden)
Ol'ha O. Brovarets'
2018-02-01
Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.
Pair formation models for sexually transmitted infections: A primer
Directory of Open Access Journals (Sweden)
Mirjam Kretzschmar
2017-08-01
Full Text Available For modelling sexually transmitted infections, duration of partnerships can strongly influence the transmission dynamics of the infection. If partnerships are monogamous, pairs of susceptible individuals are protected from becoming infected, while pairs of infected individuals delay onward transmission of the infection as long as they persist. In addition, for curable infections re-infection from an infected partner may occur. Furthermore, interventions based on contact tracing rely on the possibility of identifying and treating partners of infected individuals. To reflect these features in a mathematical model, pair formation models were introduced to mathematical epidemiology in the 1980's. They have since been developed into a widely used tool in modelling sexually transmitted infections and the impact of interventions. Here we give a basic introduction to the concepts of pair formation models for a susceptible-infected-susceptible (SIS epidemic. We review some results and applications of pair formation models mainly in the context of chlamydia infection. Keywords: Pair formation, Mathematical model, Partnership duration, Sexually transmitted infections, Basic reproduction number
Awakened Oscillations in Coupled Consumer-Resource Pairs
Directory of Open Access Journals (Sweden)
Almaz Mustafin
2014-01-01
Full Text Available The paper concerns two interacting consumer-resource pairs based on chemostat-like equations under the assumption that the dynamics of the resource is considerably slower than that of the consumer. The presence of two different time scales enables to carry out a fairly complete analysis of the problem. This is done by treating consumers and resources in the coupled system as fast-scale and slow-scale variables, respectively, and subsequently considering developments in phase planes of these variables, fast and slow, as if they are independent. When uncoupled, each pair has unique asymptotically stable steady state and no self-sustained oscillatory behavior (although damped oscillations about the equilibrium are admitted. When the consumer-resource pairs are weakly coupled through direct reciprocal inhibition of consumers, the whole system exhibits self-sustained relaxation oscillations with a period that can be significantly longer than intrinsic relaxation time of either pair. It is shown that the model equations adequately describe locally linked consumer-resource systems of quite different nature: living populations under interspecific interference competition and lasers coupled via their cavity losses.
Xu, Rong; Wang, QuanQiu
2015-02-01
Anticancer drug-associated side effect knowledge often exists in multiple heterogeneous and complementary data sources. A comprehensive anticancer drug-side effect (drug-SE) relationship knowledge base is important for computation-based drug target discovery, drug toxicity predication and drug repositioning. In this study, we present a two-step approach by combining table classification and relationship extraction to extract drug-SE pairs from a large number of high-profile oncological full-text articles. The data consists of 31,255 tables downloaded from the Journal of Oncology (JCO). We first trained a statistical classifier to classify tables into SE-related and -unrelated categories. We then extracted drug-SE pairs from SE-related tables. We compared drug side effect knowledge extracted from JCO tables to that derived from FDA drug labels. Finally, we systematically analyzed relationships between anti-cancer drug-associated side effects and drug-associated gene targets, metabolism genes, and disease indications. The statistical table classifier is effective in classifying tables into SE-related and -unrelated (precision: 0.711; recall: 0.941; F1: 0.810). We extracted a total of 26,918 drug-SE pairs from SE-related tables with a precision of 0.605, a recall of 0.460, and a F1 of 0.520. Drug-SE pairs extracted from JCO tables is largely complementary to those derived from FDA drug labels; as many as 84.7% of the pairs extracted from JCO tables have not been included a side effect database constructed from FDA drug labels. Side effects associated with anticancer drugs positively correlate with drug target genes, drug metabolism genes, and disease indications. Copyright © 2014 Elsevier Inc. All rights reserved.
Nanoscale protein diffusion by STED-based pair correlation analysis.
Directory of Open Access Journals (Sweden)
Paolo Bianchini
Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.
International Nuclear Information System (INIS)
Valles, James
2008-01-01
Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Optimal Decisions for Organ Exchanges in a Kidney Paired Donation Program.
Li, Yijiang; Song, Peter X-K; Zhou, Yan; Leichtman, Alan B; Rees, Michael A; Kalbfleisch, John D
2014-05-01
The traditional concept of barter exchange in economics has been extended in the modern era to the area of living-donor kidney transplantation, where one incompatible donor-candidate pair is matched to another pair with a complementary incompatibility, such that the donor from one pair gives an organ to a compatible candidate in the other pair and vice versa. Kidney paired donation (KPD) programs provide a unique and important platform for living incompatible donor-candidate pairs to exchange organs in order to achieve mutual benefit. In this paper, we propose novel organ allocation strategies to arrange kidney exchanges under uncertainties with advantages, including (i) allowance for a general utility-based evaluation of potential kidney transplants and an explicit consideration of stochastic features inherent in a KPD program; and (ii) exploitation of possible alternative exchanges when the originally planned allocation cannot be fully executed. This allocation strategy is implemented using an integer programming (IP) formulation, and its implication is assessed via a data-based simulation system by tracking an evolving KPD program over a series of match runs. Extensive simulation studies are provided to illustrate our proposed approach.
Correlated Photon Pair Generation in Silicon Wire Waveguides at 1.5 μm
International Nuclear Information System (INIS)
Cheng Jie-Rong; Zhang Wei; Zhou Qiang; Feng Xue; Huang Yi-Dong; Peng Jiang-De
2010-01-01
Correlated photon pairs at 1.5μm are generated in a silicon wire waveguide (SWW) with a length of only 1.6mm. Experimental results show that the single-side count rates on both sides increase quadratically with pump light, indicating that photons are generated from the spontaneous four-wave mixing (SFWM) processes. The quantum correlation property of the generated photons is demonstrated by the ratio between coincident and accidental coincident count rates. The highest ratio measured at room temperature is to be about 19, showing that generated photon pairs have strong quantum correlation property and low noise. What is more, the wavelength correlation property of the coincident count is also measured to demonstrate the correlated photon pair generation. The experimental results demonstrate that SWWs have great potential in on-chip integrated low-noise correlated photon pair sources at 1.5 μm. (fundamental areas of phenomenology(including applications))
Energy Technology Data Exchange (ETDEWEB)
Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)
2016-04-19
By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.
White, David J.; Congedo, Marco; Ciorciari, Joseph
2014-01-01
A developing literature explores the use of neurofeedback in the treatment of a range of clinical conditions, particularly ADHD and epilepsy, whilst neurofeedback also provides an experimental tool for studying the functional significance of endogenous brain activity. A critical component of any neurofeedback method is the underlying physiological signal which forms the basis for the feedback. While the past decade has seen the emergence of fMRI-based protocols training spatially confined BOLD activity, traditional neurofeedback has utilized a small number of electrode sites on the scalp. As scalp EEG at a given electrode site reflects a linear mixture of activity from multiple brain sources and artifacts, efforts to successfully acquire some level of control over the signal may be confounded by these extraneous sources. Further, in the event of successful training, these traditional neurofeedback methods are likely influencing multiple brain regions and processes. The present work describes the use of source-based signal processing methods in EEG neurofeedback. The feasibility and potential utility of such methods were explored in an experiment training increased theta oscillatory activity in a source derived from Blind Source Separation (BSS) of EEG data obtained during completion of a complex cognitive task (spatial navigation). Learned increases in theta activity were observed in two of the four participants to complete 20 sessions of neurofeedback targeting this individually defined functional brain source. Source-based EEG neurofeedback methods using BSS may offer important advantages over traditional neurofeedback, by targeting the desired physiological signal in a more functionally and spatially specific manner. Having provided preliminary evidence of the feasibility of these methods, future work may study a range of clinically and experimentally relevant brain processes where individual brain sources may be targeted by source-based EEG neurofeedback. PMID
Understanding Fomalhaut as a Cooper pair
Feng, F.; Jones, H. R. A.
2018-03-01
Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.
Hiding the Source Based on Limited Flooding for Sensor Networks.
Chen, Juan; Lin, Zhengkui; Hu, Ying; Wang, Bailing
2015-11-17
Wireless sensor networks are widely used to monitor valuable objects such as rare animals or armies. Once an object is detected, the source, i.e., the sensor nearest to the object, generates and periodically sends a packet about the object to the base station. Since attackers can capture the object by localizing the source, many protocols have been proposed to protect source location. Instead of transmitting the packet to the base station directly, typical source location protection protocols first transmit packets randomly for a few hops to a phantom location, and then forward the packets to the base station. The problem with these protocols is that the generated phantom locations are usually not only near the true source but also close to each other. As a result, attackers can easily trace a route back to the source from the phantom locations. To address the above problem, we propose a new protocol for source location protection based on limited flooding, named SLP. Compared with existing protocols, SLP can generate phantom locations that are not only far away from the source, but also widely distributed. It improves source location security significantly with low communication cost. We further propose a protocol, namely SLP-E, to protect source location against more powerful attackers with wider fields of vision. The performance of our SLP and SLP-E are validated by both theoretical analysis and simulation results.
[Involvement of cranial pairs as manifestation of prostatic cancer].
Ripa Saldias, L M; Ayuso Blanco, T; Delpon Pérez, E; Sarria Octavio de Toledo, L
1994-10-01
Two cases of prostate cancer (PC) which presented clinically with affectation of the cranial pairs due to skull base metastasis. In both cases, existence of intraparenchimatous brain metastasis was excluded. Initial improvement with hormonal therapy was followed by clinical, analytical and radiological relapse due to spread of process until death, at 11 and 36 months from diagnosis. Although PC's bone metastasis are frequent, their location at the skull base is uncommon. Even more rare are the cases which present with changes in the cranial pairs in the absence of signs and symptoms of prostatism.
Charge Aspects of Composite Pair Superconductivity
Flint, Rebecca
2014-03-01
Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.
Universal quantum gates for Single Cooper Pair Box based quantum computing
Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.
2000-01-01
We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.
Torigoe, Hidetaka; Miyakawa, Yukako; Fukushi, Miyako; Ono, Akira; Kozasa, Tetsuo
2009-01-01
We have already found that Hg(II) cation specifically binds to T:T mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving T:T mismatch base pair by about 4 degrees C. We have also found that Ag(I) cation specifically binds to C:C mismatch base pair in heteroduplex DNA, which increases the melting temperature of heteroduplex DNA involving C:C mismatch base pair by about 4 degrees C. Using the specific interaction, we developed a novel device to trap each of Hg(II) and Ag(I) cation. The device is composed of 5'-biotinylated T-rich or C-rich DNA oligonucleotides, BIO-T20: 5'-Bio-T(20)-3' or BIO-C20: 5'-Bio-C(20)-3' (Bio is a biotin), immobilized on streptavidin-coated polystylene beads. When the BIO-T20-immobilized beads were added to a solution containing Hg(II) cation, and the beads trapping Hg(II) cation were collected by centrifugation, almost all of Hg(II) cation were removed from the solution. Also, when the BIO-C20-immobilized beads were added to a solution containing Ag(I) cation, and the beads trapping Ag(I) cation were collected by centrifugation, almost all of Ag(I) cation were removed from the solution. We conclude that, using the novel device developed in this study, Hg(II) and Ag(I) cation can be effectively removed from the solution.
Statistical deprojection of galaxy pairs
Nottale, Laurent; Chamaraux, Pierre
2018-06-01
Aims: The purpose of the present paper is to provide methods of statistical analysis of the physical properties of galaxy pairs. We perform this study to apply it later to catalogs of isolated pairs of galaxies, especially two new catalogs we recently constructed that contain ≈1000 and ≈13 000 pairs, respectively. We are particularly interested by the dynamics of those pairs, including the determination of their masses. Methods: We could not compute the dynamical parameters directly since the necessary data are incomplete. Indeed, we only have at our disposal one component of the intervelocity between the members, namely along the line of sight, and two components of their interdistance, i.e., the projection on the sky-plane. Moreover, we know only one point of each galaxy orbit. Hence we need statistical methods to find the probability distribution of 3D interdistances and 3D intervelocities from their projections; we designed those methods under the term deprojection. Results: We proceed in two steps to determine and use the deprojection methods. First we derive the probability distributions expected for the various relevant projected quantities, namely intervelocity vz, interdistance rp, their ratio, and the product rp v_z^2, which is involved in mass determination. In a second step, we propose various methods of deprojection of those parameters based on the previous analysis. We start from a histogram of the projected data and we apply inversion formulae to obtain the deprojected distributions; lastly, we test the methods by numerical simulations, which also allow us to determine the uncertainties involved.
Hiding the Source Based on Limited Flooding for Sensor Networks
Directory of Open Access Journals (Sweden)
Juan Chen
2015-11-01
Full Text Available Wireless sensor networks are widely used to monitor valuable objects such as rare animals or armies. Once an object is detected, the source, i.e., the sensor nearest to the object, generates and periodically sends a packet about the object to the base station. Since attackers can capture the object by localizing the source, many protocols have been proposed to protect source location. Instead of transmitting the packet to the base station directly, typical source location protection protocols first transmit packets randomly for a few hops to a phantom location, and then forward the packets to the base station. The problem with these protocols is that the generated phantom locations are usually not only near the true source but also close to each other. As a result, attackers can easily trace a route back to the source from the phantom locations. To address the above problem, we propose a new protocol for source location protection based on limited flooding, named SLP. Compared with existing protocols, SLP can generate phantom locations that are not only far away from the source, but also widely distributed. It improves source location security significantly with low communication cost. We further propose a protocol, namely SLP-E, to protect source location against more powerful attackers with wider fields of vision. The performance of our SLP and SLP-E are validated by both theoretical analysis and simulation results.
Classification between normal and tumor tissues based on the pair-wise gene expression ratio
International Nuclear Information System (INIS)
Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine
2004-01-01
Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested
Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.
2014-01-01
We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,
Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle
2017-05-01
Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie
2013-01-01
This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156
Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.
1994-01-01
The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair
Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors
Allan, Milan P.
2013-03-01
The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple
Near-Field Source Localization by Using Focusing Technique
He, Hongyang; Wang, Yide; Saillard, Joseph
2008-12-01
We discuss two fast algorithms to localize multiple sources in near field. The symmetry-based method proposed by Zhi and Chia (2007) is first improved by implementing a search-free procedure for the reduction of computation cost. We present then a focusing-based method which does not require symmetric array configuration. By using focusing technique, the near-field signal model is transformed into a model possessing the same structure as in the far-field situation, which allows the bearing estimation with the well-studied far-field methods. With the estimated bearing, the range estimation of each source is consequently obtained by using 1D MUSIC method without parameter pairing. The performance of the improved symmetry-based method and the proposed focusing-based method is compared by Monte Carlo simulations and with Crammer-Rao bound as well. Unlike other near-field algorithms, these two approaches require neither high-computation cost nor high-order statistics.
Near-Field Source Localization by Using Focusing Technique
Directory of Open Access Journals (Sweden)
Joseph Saillard
2008-12-01
Full Text Available We discuss two fast algorithms to localize multiple sources in near field. The symmetry-based method proposed by Zhi and Chia (2007 is first improved by implementing a search-free procedure for the reduction of computation cost. We present then a focusing-based method which does not require symmetric array configuration. By using focusing technique, the near-field signal model is transformed into a model possessing the same structure as in the far-field situation, which allows the bearing estimation with the well-studied far-field methods. With the estimated bearing, the range estimation of each source is consequently obtained by using 1D MUSIC method without parameter pairing. The performance of the improved symmetry-based method and the proposed focusing-based method is compared by Monte Carlo simulations and with Crammer-Rao bound as well. Unlike other near-field algorithms, these two approaches require neither high-computation cost nor high-order statistics
AVE bond index in the H-bond of the Watson-Crick pairs
International Nuclear Information System (INIS)
Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.
1981-01-01
The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt
Pair potentials in liquid metals
International Nuclear Information System (INIS)
Faber, T.E.
1980-01-01
The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)
Energy Technology Data Exchange (ETDEWEB)
Moreira, B. D.; Goncalves, V. P.; De Santana Amaral, J. T. [Universidade Federal de Pelotas, Instituto de Fisica e Matematica (Brazil)
2013-03-25
In this contribution we study coherent interactions as a probe of the nonlinear effects in the Quantum Electrodynamics (QED). In particular, we study the multiphoton effects in the production of leptons pairs for proton-nucleus and nucleus-nucleus collisions for heavy nuclei. In the proton-nucleus we assume the ultrarelativistic proton as a source of photons and estimate the photoproduction of lepton pairs on nuclei at RHIC and LHC energies considering the multiphoton effects associated to multiple rescattering of the projectile photon on the proton of the nucleus. In nucleus - nucleus colllisions we consider the two nuclei as a source of photons. As each scattering contributes with a factor {alpha}Z to the cross section, this contribution must be taken into account for heavy nuclei. We consider the Coulomb corrections to calculate themultiple scatterings and estimate the total cross section for muon and tau pair production in proton-nucleus and nucleus-nucleus collisions at RHIC and LHC energies.
VSEARCH: a versatile open source tool for metagenomics.
Rognes, Torbjørn; Flouri, Tomáš; Nichols, Ben; Quince, Christopher; Mahé, Frédéric
2016-01-01
VSEARCH is an open source and free of charge multithreaded 64-bit tool for processing and preparing metagenomics, genomics and population genomics nucleotide sequence data. It is designed as an alternative to the widely used USEARCH tool (Edgar, 2010) for which the source code is not publicly available, algorithm details are only rudimentarily described, and only a memory-confined 32-bit version is freely available for academic use. When searching nucleotide sequences, VSEARCH uses a fast heuristic based on words shared by the query and target sequences in order to quickly identify similar sequences, a similar strategy is probably used in USEARCH. VSEARCH then performs optimal global sequence alignment of the query against potential target sequences, using full dynamic programming instead of the seed-and-extend heuristic used by USEARCH. Pairwise alignments are computed in parallel using vectorisation and multiple threads. VSEARCH includes most commands for analysing nucleotide sequences available in USEARCH version 7 and several of those available in USEARCH version 8, including searching (exact or based on global alignment), clustering by similarity (using length pre-sorting, abundance pre-sorting or a user-defined order), chimera detection (reference-based or de novo ), dereplication (full length or prefix), pairwise alignment, reverse complementation, sorting, and subsampling. VSEARCH also includes commands for FASTQ file processing, i.e., format detection, filtering, read quality statistics, and merging of paired reads. Furthermore, VSEARCH extends functionality with several new commands and improvements, including shuffling, rereplication, masking of low-complexity sequences with the well-known DUST algorithm, a choice among different similarity definitions, and FASTQ file format conversion. VSEARCH is here shown to be more accurate than USEARCH when performing searching, clustering, chimera detection and subsampling, while on a par with USEARCH for paired
Source independence and the EPR paradox
International Nuclear Information System (INIS)
Mould, R.A.
1989-01-01
It is shown that the lines of action between the photon pairs resulting from a positronium decay are not necessarily in line with the original positronium atom. It is also shown why this 'source-independent' effect is not normally observed, although it is observable in principle. Moreover our initial concerns and some conclusions as they bear on the theory of measurement in quantum mechanics are discussed. Source-independence is shown to give a satisfactory response to a special form of the Einstein-Podolsky-Rosen paradox involving pairs of position measurements. It also leads to a nonlocal relationship between position measurements that depends on the width of the position detectors
Pairing correlations in nuclei
International Nuclear Information System (INIS)
Baba, C.V.K.
1988-01-01
There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Kaufman, Lloyd; Williamson, Samuel J.; Costaribeiro, P.
1988-02-01
Recently developed small arrays of SQUID-based magnetic sensors can, if appropriately placed, locate the position of a confined biomagnetic source without moving the array. The authors present a technique with a relative accuracy of about 2 percent for calibrating such sensors having detection coils with the geometry of a second-order gradiometer. The effects of calibration error and magnetic noise on the accuracy of locating an equivalent current dipole source in the human brain are investigated for 5- and 7-sensor probes and for a pair of 7-sensor probes. With a noise level of 5 percent of peak signal, uncertainties of about 20 percent in source strength and depth for a 5-sensor probe are reduced to 8 percent for a pair of 7-sensor probes, and uncertainties of about 15 mm in lateral position are reduced to 1 mm, for the configuration considered.
Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda
2018-05-02
Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact
Czech Academy of Sciences Publication Activity Database
Tanaka, Y.; Kondo, J.; Sychrovský, Vladimír; Šebera, Jakub; Dairaku, T.; Saneyoshi, H.; Urata, H.; Torigoe, H.; Ono, A.
2015-01-01
Roč. 51, č. 98 (2015), s. 17343-17360 ISSN 1359-7345 R&D Projects: GA ČR GAP205/10/0228 Institutional support: RVO:61388963 Keywords : metal-mediated base-pairs * T–Hg–T * C–Ag–C Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.567, year: 2015
Towards Scalable Entangled Photon Sources with Self-Assembled InAs /GaAs Quantum Dots
Wang, Jianping; Gong, Ming; Guo, G.-C.; He, Lixin
2015-08-01
The biexciton cascade process in self-assembled quantum dots (QDs) provides an ideal system for realizing deterministic entangled photon-pair sources, which are essential to quantum information science. The entangled photon pairs have recently been generated in experiments after eliminating the fine-structure splitting (FSS) of excitons using a number of different methods. Thus far, however, QD-based sources of entangled photons have not been scalable because the wavelengths of QDs differ from dot to dot. Here, we propose a wavelength-tunable entangled photon emitter mounted on a three-dimensional stressor, in which the FSS and exciton energy can be tuned independently, thereby enabling photon entanglement between dissimilar QDs. We confirm these results via atomistic pseudopotential calculations. This provides a first step towards future realization of scalable entangled photon generators for quantum information applications.
The coevolution of long-term pair bonds and cooperation.
Song, Z; Feldman, M W
2013-05-01
The evolution of social traits may not only depend on but also change the social structure of the population. In particular, the evolution of pairwise cooperation, such as biparental care, depends on the pair-matching distribution of the population, and the latter often emerges as a collective outcome of individual pair-bonding traits, which are also under selection. Here, we develop an analytical model and individual-based simulations to study the coevolution of long-term pair bonds and cooperation in parental care, where partners play a Snowdrift game in each breeding season. We illustrate that long-term pair bonds may coevolve with cooperation when bonding cost is below a threshold. As long-term pair bonds lead to assortative interactions through pair-matching dynamics, they may promote the prevalence of cooperation. In addition to the pay-off matrix of a single game, the evolutionarily stable equilibrium also depends on bonding cost and accidental divorce rate, and it is determined by a form of balancing selection because the benefit from pair-bond maintenance diminishes as the frequency of cooperators increases. Our findings highlight the importance of ecological factors affecting social bonding cost and stability in understanding the coevolution of social behaviour and social structures, which may lead to the diversity of biological social systems. © 2013 The Authors. Journal of Evolutionary Biology © 2013 European Society For Evolutionary Biology.
Romero, Eduardo E; Hernandez, Florencio E
2018-01-03
Herein we present our results on the study of the double proton transfer (DPT) mechanism in the adenine-thymine (AT) and guanine-cytosine (GC) base pairs, both in gas phase and in solution. The latter was modeled using the polarizable continuum method (PCM) in different solvents. According to our DFT calculations, the DPT may occur for both complexes in a stepwise mechanism in condensate phase. In gas phase only the GC base pair exhibits a concerted DPT mechanism. Using the Wigner's tunneling corrections to the transition state theory we demonstrate that such corrections are important for the prediction of the rate constants of both systems in gas and in condensate phase. We also show that (i) as the polarity of the medium decreases the equilibrium constant of the DPT reaction increases in both complexes, and (ii) that the equilibrium constant in the GC complex is four orders of magnitude larger than in AT. This observation suggests that the spontaneous mutations in DNA base pairs are more probable in GC than in AT.
Capture from pair production as a beam loss mechanism for heavy ions at RHIC
International Nuclear Information System (INIS)
Feinberg, B.; Belkacem, A.; Claytor, N.; Dinneen, T.; Gould, H.
1997-05-01
Electron capture from electron-positron pair production is predicted to be a major source of beam loss for the heaviest ions at RHIC. Achieving the highest luminosity thus requires an understanding of the capture process. The authors report measurements of this process at Brookhaven National Laboratory's AGS using 10.8 GeV/nucleon Au 79+ projectiles on Au targets. Capture from pair production is a process in which the very high electromagnetic field involved in the collision of two relativistic heavy ions results in the production of an electron-positron pair with the capture of the electron by one of the ions. There are many theoretical papers published on capture from pair production with discrepancies between predicted cross sections. The experimental results are compared to theory and to previous experiments at 1 GeV/nucleon. The implications of extrapolations to RHIC energies are presented
A Source Anonymity-Based Lightweight Secure AODV Protocol for Fog-Based MANET.
Fang, Weidong; Zhang, Wuxiong; Xiao, Jinchao; Yang, Yang; Chen, Wei
2017-06-17
Fog-based MANET (Mobile Ad hoc networks) is a novel paradigm of a mobile ad hoc network with the advantages of both mobility and fog computing. Meanwhile, as traditional routing protocol, ad hoc on-demand distance vector (AODV) routing protocol has been applied widely in fog-based MANET. Currently, how to improve the transmission performance and enhance security are the two major aspects in AODV's research field. However, the researches on joint energy efficiency and security seem to be seldom considered. In this paper, we propose a source anonymity-based lightweight secure AODV (SAL-SAODV) routing protocol to meet the above requirements. In SAL-SAODV protocol, source anonymous and secure transmitting schemes are proposed and applied. The scheme involves the following three parts: the source anonymity algorithm is employed to achieve the source node, without being tracked and located; the improved secure scheme based on the polynomial of CRC-4 is applied to substitute the RSA digital signature of SAODV and guarantee the data integrity, in addition to reducing the computation and energy consumption; the random delayed transmitting scheme (RDTM) is implemented to separate the check code and transmitted data, and achieve tamper-proof results. The simulation results show that the comprehensive performance of the proposed SAL-SAODV is a trade-off of the transmission performance, energy efficiency, and security, and better than AODV and SAODV.
DEFF Research Database (Denmark)
Guo, Kai; Christensen, Erik Nicolai; Christensen, Jesper Bjerge
2017-01-01
We demonstrate a very high coincidence-to-accidental ratio of 673 using continuous-wave photon-pair generation in a silicon strip waveguide through spontaneous four-wave mixing. This result is obtained by employing on-chip photonic-crystal-based grating couplers for both low-loss fiber......-to-chip coupling and on-chip suppression of generated spontaneous Raman scattering noise. We measure a minimum heralded second-order correlation of g(H)((2)) (0) = 0.12, demonstrating that our source operates in the single- photon regime with low noise. (C) 2017 The Japan Society of Applied Physics...
Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling
International Nuclear Information System (INIS)
Friedmann, Tamar; Verlinde, Herman
2005-01-01
We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field
Pair Interaction of Catalytical Sphere Dimers in Chemically Active Media
Directory of Open Access Journals (Sweden)
Jing-Min Shi
2018-01-01
Full Text Available We study the pair dynamics of two self-propelled sphere dimers in the chemically active medium in which a cubic autocatalytic chemical reaction takes place. Concentration gradient around the dimer, created by reactions occurring on the catalytic sphere surface and responsible for the self-propulsion, is greatly influenced by the chemical activities of the environment. Consequently, the pair dynamics of two dimers mediated by the concentration field are affected. In the particle-based mesoscopic simulation, we combine molecular dynamics (MD for potential interactions and reactive multiparticle collision dynamics (RMPC for solvent flow and bulk reactions. Our results indicate three different configurations between a pair of dimers after the collision, i.e., two possible scenarios of bound dimer pairs and one unbound dimer pair. A phase diagram is sketched as a function of the rate coefficients of the environment reactions. Since the pair interactions are the basic elements of larger scale systems, we believe the results may shed light on the understanding of the collective dynamics.
Au Pair and Trafficked? - Recruitment, Residence in Denmark and Dreams for the Future
DEFF Research Database (Denmark)
Korsby, Trine Mygind
Report on the prevalence and risk of human trafficking in the situations and experiences of a group of au pairs in Denmark. The report is based on a qualitative study with interviews with 27 au pairs living in Denmark. The au pairs come from the Philippines, Belarus, Ukraine, Serbia, Nepal and Ke...
Energy Technology Data Exchange (ETDEWEB)
Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)
2001-02-01
Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es
Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing
Directory of Open Access Journals (Sweden)
Michal Petřík
2016-01-01
Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.
Molecular electrostatics for probing lone pair-π interactions.
Mohan, Neetha; Suresh, Cherumuttathu H; Kumar, Anmol; Gadre, Shridhar R
2013-11-14
An electrostatics-based approach has been proposed for probing the weak interactions between lone pair containing molecules and π deficient molecular systems. For electron-rich molecules, the negative minima in molecular electrostatic potential (MESP) topography give the location of electron localization and the MESP value at the minimum (Vmin) quantifies the electron-rich character of that region. Interactive behavior of a lone pair bearing molecule with electron deficient π-systems, such as hexafluorobenzene, 1,3,5-trinitrobenzene, 2,4,6-trifluoro-1,3,5-triazine and 1,2,4,5-tetracyanobenzene explored within DFT brings out good correlation of the lone pair-π interaction energy (E(int)) with the Vmin value of the electron-rich system. Such interaction is found to be portrayed well with the Electrostatic Potential for Intermolecular Complexation (EPIC) model. On the basis of the precise location of MESP minimum, a prediction for the orientation of a lone pair bearing molecule with an electron deficient π-system is possible in the majority of the cases studied.
Mesoscopic pairing without superconductivity
Hofmann, Johannes
2017-12-01
We discuss pairing signatures in mesoscopic nanowires with a variable attractive pairing interaction. Depending on the wire length, density, and interaction strength, these systems realize a simultaneous bulk-to-mesoscopic and BCS-BEC crossover, which we describe in terms of the parity parameter that quantifies the odd-even energy difference and generalizes the bulk Cooper pair binding energy to mesoscopic systems. We show that the parity parameter can be extracted from recent measurements of conductance oscillations in SrTiO3 nanowires by Cheng et al. [Nature (London) 521, 196 (2015), 10.1038/nature14398], where it marks the critical magnetic field that separates pair and single-particle currents. Our results place the experiment in the fluctuation-dominated mesoscopic regime on the BCS side of the crossover.
Pairing field and moments of inertia of superdeformed nuclei
International Nuclear Information System (INIS)
Chen Yongjing; Chen Yongshou; Xu Fuxin
2002-01-01
The authors have systematically analysed the dynamic moments of inertia of the experimental superdeformed (SD) bands observed in the A = 190, 150 and 60-80 mass regions as functions of rotational frequency. By combining the different mass regions, the dramatic features of the dynamic moments of inertia were found and explained based on the calculations of the pairing fields of SD nuclei with the anisotropic harmonic oscillator quadrupole pairing Hartree-Fock-Bogoliubov model
Studding the phenomenon of pair production of tracks on plastic detectors during radon measurements
International Nuclear Information System (INIS)
Shweikani, R.; Jourbi, B.
2011-06-01
Previous studies showed the appearance of many pairs of alpha tracks on the surface of the solid state nuclear track detectors (CR39) when exposed to radon. So the aim of this study was to judge whether this is a statistical or a physical phenomenon. Therefore, a theoretical function representing the probability of forming pairs of tracks on the detector was developed. A statistical studying was done for two sets of (1) mm thickness of CR39 detectors, the first set was exposed in the radon calibration chamber (RCC) with stable radon concentration (170 kBq/m 3 ) for different detectors positions inside and outside the exposure chamber (EC). While the second set was exposed to 241 Am source (1667 Bq) for different exposure times. The results show that the concentration of the single tracks on the detectors in case of covered EC was lower than the same situation without cover. In addition, the concentrations of the single tracks in various exposure situations inside and outside the EC were associated to the effective volumes that each detector sees. Finally, no considerable deference was found between pairs concentration in the two exposure cases (Radon chamber and 241 Am source), and both were lower than the theoretical values which calculated using the theoretical function. This means that pairs formation phenomena is a statistical phenomenon and there is no physical parameters related to radon gas or its daughter's behavior. (author)
Grekova, A. D.; Gordeeva, L. G.
2018-04-01
Adsorption heat transformation is an energy and environment saving technology for cooling/heating driven by renewable energy sources. Each specific cycle of adsorption heat transformer (AHT) makes particular requirements to the properties of the sorption material, depending on the climatic zone in which the AHT is used, the type of application (cooling, heating and heat storage), and energy source used for regenerating the sorbent. Therefore, the effective operation of AHT can be realized only if the working pair "adsorbent-adsorbate" is intelligently selected in accordance with the requirements of a particular working cycle. One of the most important factors influencing the choice of a working pair is the climatic conditions in which the AHT will operate. In this paper, the climatic conditions of various regions of Russian Federation (RF) were analyzed. For each considered zone, the boundary potentials of Polanyi corresponding to different AHT cycles are calculated. The sorption equilibrium data of various sorbents with water and methanol presented in the literature are summarized, and characteristic sorption curves are plotted in coordinates "sorption - the Polanyi potential". The characteristic adsorption curves found are approximated by analytic expressions, which allow the analysis of working pairs applicability for different AHT cycles. The recommendations of using the discussed sorption pairs under conditions of determined climatic zones are given for the AHT applications.
Pair production of scalar dyons in Kerr-Newman black holes
Chen, Chiang-Mei; Kim, Sang Pyo; Sun, Jia-Rui; Tang, Fu-Yi
2018-06-01
We study the spontaneous pair production of scalar dyons in the near extremal dyonic Kerr-Newman (KN) black hole, which contains a warped AdS3 structure in the near horizon region. The leading term contribution of the pair production rate and the absorption cross section ratio are also calculated using the Hamilton-Jacobi approach and the thermal interpretation is given. In addition, the holographic dual conformal field theories (CFTs) descriptions of the pair production rate and absorption cross section ratios are analyzed both in the J-, Q- and P-pictures respectively based on the threefold dyonic KN/CFTs dualities.
A Scaffold Analysis Tool Using Mate-Pair Information in Genome Sequencing
Directory of Open Access Journals (Sweden)
Pan-Gyu Kim
2008-01-01
Full Text Available We have developed a Windows-based program, ConPath, as a scaffold analyzer. ConPath constructs scaffolds by ordering and orienting separate sequence contigs by exploiting the mate-pair information between contig-pairs. Our algorithm builds directed graphs from link information and traverses them to find the longest acyclic graphs. Using end read pairs of fixed-sized mate-pair libraries, ConPath determines relative orientations of all contigs, estimates the gap size of each adjacent contig pair, and reports wrong assembly information by validating orientations and gap sizes. We have utilized ConPath in more than 10 microbial genome projects, including Mannheimia succiniciproducens and Vibro vulnificus, where we verified contig assembly and identified several erroneous contigs using the four types of error defined in ConPath. Also, ConPath supports some convenient features and viewers that permit investigation of each contig in detail; these include contig viewer, scaffold viewer, edge information list, mate-pair list, and the printing of complex scaffold structures.
LiCl+CaCl/sub 2//H/sub 2/O pair
Energy Technology Data Exchange (ETDEWEB)
Isshiki, N; Kamoshida, J
1985-01-01
Absorption heat pump is very useful for the utilization of new energy of low temperature difference by the following four view points. (a) possibility of using any kind of heat source of low temperature difference natural energy and industrial waste heat. (b) Possibility of being used for either of both generation of heat and power (co-generation), (c) good for long term storage and distance transportation of energy. (d) Possibility of applying any kind of chemical pair which have reversible thermo-chemical reaction with a lot of varieties. Among many thermo-chemical pairs, the pair of LiCl + CaCl/sub 2//H/sub 2/O has been selected and investigated in the R and D of developing power generation system. The reason of this selection is that this pair have been thought to be most practical, inexpensive, and powerful for our purpose. The system of heat and power cogeneration system has been selected as the object of application of the absorption system, and especially power generation has been studied. Then, in order to inquire the possibility of power generation and energy storage, a four wheeled vehicle driven by the power of the pair of L1Cl = CaCl/sub 2//H/sub 2/O has been assembled and tested with success. In this paper the general aspects of this study is reported briefly, and the future possibility of the absorption heat pump and power generation is discussed.
Augmenting Think-Pair-Share with Simulations
Lee, Kevin M.; Siedell, C. M.; Prather, E. E.; CATS
2009-01-01
Computer simulations are valuable tools for the teaching and learning of introductory astronomy. They enable students to link together small pieces of information into mental models of complex physical systems that are far beyond their everyday experience. They can also be used to authentically test a student's conceptual understanding of a physical system by asking the student to make predictions regarding its behavior. Students receive formative feedback by testing their predictions in simulations. Think-Pair-Share - the posing of conceptual questions to students and having them vote on the answer before and after discussion with their peers - can benefit considerably from the incorporation of simulations. Simulations can be used for delivering content that precedes Think-Pair-Share, as the prompt the questions is based upon, or as a feedback tool to illustrate the answer to a question. These techniques are utilized in ClassAction - a collection of materials designed to enhance the metacognitive skills of Astro 101 students by promoting interactive engagement and providing rapid feedback. The main focus is dynamic conceptual questions largely based upon graphics that can be projected in the classroom. Many questions are available in a Flash computer database and instructors have the capability to recast these questions into alternate permutations based on their own preferences and student responses. Outlines, graphics, and simulations are included which instructors can use to provide feedback. This poster provides examples of simulation usage in Think-Pair-Share related to sky motions, lunar phases, and stellar properties. A multi-institutional classroom validation study of ClassAction is currently underway as a Collaboration of Astronomy Teaching Scholars (CATS) research project. All materials are publicly available at http://astro.unl.edu. We would like to thank the NSF for funding under Grant Nos. 0404988 and 0715517, a CCLI Phase III Grant for the
Neese, Frank; Wennmohs, Frank; Hansen, Andreas
2009-03-21
Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500
ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.
Directory of Open Access Journals (Sweden)
Alexandra Peacock-Villada
Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.
Qu, Cheng; Tang, Yu-Ping; Shi, Xu-Qin; Zhou, Gui-Sheng; Shang, Er-Xin; Shang, Li-Li; Guo, Jian-Ming; Liu, Pei; Zhao, Jing; Zhao, Bu-Chang; Duan, Jin-Ao
2017-08-01
To evaluate the promoting blood circulation and removing blood stasis effects of Danshen-Honghua(DH) herb pair with different preparations (alcohol, 50% alcohol and water) on blood rheology and coagulation functions in acute blood stasis rats, and optimize the best preparation method of DH based on principal component analysis(PCA), hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods. Ice water bath and subcutaneous injection of adrenaline were both used to establish the acute blood stasis rat model. Then the blood stasis rats were administrated intragastrically with DH (alcohol, 50% alcohol and water) extracts. The whole blood viscosity(WBV), plasma viscosity(PV), erythrocyte sedimentation rate(ESR) and haematocrit(HCT) were tested to observe the effects of DH herb pair with different preparations and doses on hemorheology of blood stasis rats; the activated partial thromboplastin time(APTT), thrombin time(TT), prothrombin time(PT), and plasma fibrinogen(FIB) were tested to observe the effects of DH herb pair with different preparations on blood coagulation function and platelet aggregation of blood stasis rats. Then PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods were all used to comprehensively evaluate the total promoting blood circulation and removing blood stasis effects of DH herb pair with different preparations. The hemorheological indexes and coagulation parameters of model group had significant differences with normal blank group. As compared with the model group, the DH herb pair with different preparations at low, middle and high doses could improve the blood hemorheology indexes and coagulation parameters in acute blood stasis rats with dose-effect relation. Based on the PCA, hierarchical cluster heatmap analysis and multi-attribute comprehensive index methods, the high dose group of 50% alcohol extract had the best effect of promoting blood circulation and removing blood
Accelerator based neutron source for neutron capture therapy
International Nuclear Information System (INIS)
Salimov, R.; Bayanov, B.; Belchenko, Yu.; Belov, V.; Davydenko, V.; Donin, A.; Dranichnikov, A.; Ivanov, A.; Kandaurov, I; Kraynov, G.; Krivenko, A.; Kudryavtsev, A.; Kursanov, N.; Savkin, V.; Shirokov, V.; Sorokin, I.; Taskaev, S.; Tiunov, M.
2004-01-01
Full text: The Budker Institute of Nuclear Physics (Novosibirsk) and the Institute of Physics and Power Engineering (Obninsk) have proposed an accelerator based neutron source for neutron capture and fast neutron therapy for hospital. Innovative approach is based upon vacuum insulation tandem accelerator (VITA) and near threshold 7 Li(p,n) 7 Be neutron generation. Pilot accelerator based neutron source for neutron capture therapy is under construction now at the Budker Institute of Nuclear Physics, Novosibirsk, Russia. In the present report, the pilot facility design is presented and discussed. Design features of facility components are discussed. Results of experiments and simulations are presented. Complete experimental tests are planned by the end of the year 2005
DEFF Research Database (Denmark)
Dalgas, Karina Märcher
2016-01-01
Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial interdep......Most Filipina au pairs in Denmark send remittances back home, and for many, au pairing forms part of longer-term migration trajectories. This article explores how Filipina au pairs try to carve out a future for themselves abroad. It shows that they navigate within tight webs of financial...
MR-based source localization for MR-guided HDR brachytherapy
Beld, E.; Moerland, M. A.; Zijlstra, F.; Viergever, M. A.; Lagendijk, J. J. W.; Seevinck, P. R.
2018-04-01
For the purpose of MR-guided high-dose-rate (HDR) brachytherapy, a method for real-time localization of an HDR brachytherapy source was developed, which requires high spatial and temporal resolutions. MR-based localization of an HDR source serves two main aims. First, it enables real-time treatment verification by determination of the HDR source positions during treatment. Second, when using a dummy source, MR-based source localization provides an automatic detection of the source dwell positions after catheter insertion, allowing elimination of the catheter reconstruction procedure. Localization of the HDR source was conducted by simulation of the MR artifacts, followed by a phase correlation localization algorithm applied to the MR images and the simulated images, to determine the position of the HDR source in the MR images. To increase the temporal resolution of the MR acquisition, the spatial resolution was decreased, and a subpixel localization operation was introduced. Furthermore, parallel imaging (sensitivity encoding) was applied to further decrease the MR scan time. The localization method was validated by a comparison with CT, and the accuracy and precision were investigated. The results demonstrated that the described method could be used to determine the HDR source position with a high accuracy (0.4–0.6 mm) and a high precision (⩽0.1 mm), at high temporal resolutions (0.15–1.2 s per slice). This would enable real-time treatment verification as well as an automatic detection of the source dwell positions.
Paired split-plot designs of multireader multicase studies.
Chen, Weijie; Gong, Qi; Gallas, Brandon D
2018-07-01
The widely used multireader multicase ROC study design for comparing imaging modalities is the fully crossed (FC) design: every reader reads every case of both modalities. We investigate paired split-plot (PSP) designs that may allow for reduced cost and increased flexibility compared with the FC design. In the PSP design, case images from two modalities are read by the same readers, thereby the readings are paired across modalities. However, within each modality, not every reader reads every case. Instead, both the readers and the cases are partitioned into a fixed number of groups and each group of readers reads its own group of cases-a split-plot design. Using a [Formula: see text]-statistic based variance analysis for AUC (i.e., area under the ROC curve), we show analytically that precision can be gained by the PSP design as compared with the FC design with the same number of readers and readings. Equivalently, we show that the PSP design can achieve the same statistical power as the FC design with a reduced number of readings. The trade-off for the increased precision in the PSP design is the cost of collecting a larger number of truth-verified patient cases than the FC design. This means that one can trade-off between different sources of cost and choose a least burdensome design. We provide a validation study to show the iMRMC software can be reliably used for analyzing data from both FC and PSP designs. Finally, we demonstrate the advantages of the PSP design with a reader study comparing full-field digital mammography with screen-film mammography.
Six transformer based asymmetrical embedded Z-source inverters
DEFF Research Database (Denmark)
Wei, Mo; Poh Chiang, Loh; Chi, Jin
2013-01-01
Embedded/Asymmetrical embedded Z-source inverters were proposed to maintain smooth input current/voltage across the dc source and within the impedance network, remain the shoot-through feature used to boost up the dc-link voltage without adding bulky filter at input side. This paper introduces a ...... a class of transformer based asymmetrical embedded Z-source inverters which keep the smooth input current and voltage while achieving enhanced voltage boost capability. The presented inverters are verified by laboratory prototypes experimentally....
Preliminary design of GDT-based 14 MeV neutron source
International Nuclear Information System (INIS)
Du Hongfei; Chen Dehong; Wang Hui; Wang Fuqiong; Jiang Jieqiong; Wu Yican; Chen Yiping
2012-01-01
To meet the need of D-T fusion neutron source for fusion material testing, design goals were presented in this paper according to the international requirements of neutron source for fusion material testing. A preliminary design scheme of GDT-based 14 MeV neutron source was proposed, and a physics model of the neutron source was built based on progress of GDT experiments. Two preliminary design schemes (i. e. FDS-GDT1, FDS-GDT2) were designed; among which FDS-GDT2 can be used for fusion material testing with neutron first wall loading of 2 MW/m 2 . (authors)
Paired peer review of university classroom teaching in a school of nursing and midwifery.
Bennett, Paul N; Parker, Steve; Smigiel, Heather
2012-08-01
Peer review of university classroom teaching can increase the quality of teaching but is not universally practiced in Australian universities. To report an evaluation of paired peer-review process using both paper and web based teaching evaluation tools. Twenty university teachers in one metropolitan Australian School of Nursing and Midwifery were randomly paired and then randomly assigned to a paper based or web-based peer review tool. Each teacher reviewed each other's classroom teaching as part of a peer review program. The participants then completed an 18 question survey evaluating the peer review tool and paired evaluation process. Responses were analyzed using frequencies and percentages. Regardless of the tool used, participants found this process of peer review positive (75%), collegial (78%), supportive (61%) and non-threatening (71%). Participants reported that the peer review will improve their own classroom delivery (61%), teaching evaluation (61%) and planning (53%). The web-based tool was found to be easier to use and allowed more space than the paper-based tool. Implementation of a web-based paired peer review system can be a positive method of peer review of university classroom teaching. Pairing of teachers to review each other's classroom teaching is a promising strategy and has the potential to improve teaching in teaching universities. Copyright © 2011 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.
2016-01-01
Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.
Plasma analog of particle-pair production
International Nuclear Information System (INIS)
Tsidulko, Yu.A.; Berk, H.L.
1996-09-01
It is shown that the plasma axial shear flow instability satisfies the Klein-Gordon equation. The plasma instability is then shown to be analogous to spontaneous particle-pair production when a potential energy is present that is greater than twice the particle rest mass energy. Stability criteria can be inferred based on field theoretical conservation laws
Collective neutrino-pair emission due to Cooper pairing of protons in superconducting neutron stars
International Nuclear Information System (INIS)
Leinson, L.B.
2001-01-01
The neutrino emission due to formation and breaking of Cooper pairs of protons in superconducting cores of neutron stars is considered with taking into account the electromagnetic coupling of protons to ambient electrons. It is shown that collective response of electrons to the proton quantum transition contributes coherently to the complete interaction with a neutrino field and enhances the neutrino-pair production. Our calculation shows that the contribution of the vector weak current to the ννbar emissivity of protons is much larger than that calculated by different authors without taking into account the plasma effects. Partial contribution of the pairing protons to the total neutrino radiation from the neutron star core is very sensitive to the critical temperatures for the proton and neutron pairing. We show domains of these parameters where the neutrino radiation, caused by a singlet-state pairing of protons is dominating
QSO Pairs across Active Galaxies
Indian Academy of Sciences (India)
2016-01-27
Jan 27, 2016 ... Several QSO pairs have been reported and their redshifts determined, where the two objects in each pair are located across an active galaxy. The usually accepted explanation of such occurrences is that the pair is ejected from the parent galaxy. Currently interpreted redshifted spectra for both the QSOs ...
Parallel Factor-Based Model for Two-Dimensional Direction Estimation
Directory of Open Access Journals (Sweden)
Nizar Tayem
2017-01-01
Full Text Available Two-dimensional (2D Direction-of-Arrivals (DOA estimation for elevation and azimuth angles assuming noncoherent, mixture of coherent and noncoherent, and coherent sources using extended three parallel uniform linear arrays (ULAs is proposed. Most of the existing schemes have drawbacks in estimating 2D DOA for multiple narrowband incident sources as follows: use of large number of snapshots, estimation failure problem for elevation and azimuth angles in the range of typical mobile communication, and estimation of coherent sources. Moreover, the DOA estimation for multiple sources requires complex pair-matching methods. The algorithm proposed in this paper is based on first-order data matrix to overcome these problems. The main contributions of the proposed method are as follows: (1 it avoids estimation failure problem using a new antenna configuration and estimates elevation and azimuth angles for coherent sources; (2 it reduces the estimation complexity by constructing Toeplitz data matrices, which are based on a single or few snapshots; (3 it derives parallel factor (PARAFAC model to avoid pair-matching problems between multiple sources. Simulation results demonstrate the effectiveness of the proposed algorithm.
Near quantum limited amplification from inelastic Cooper-pair tunneling
Hofheinz, Max; Jebari, Salha; Blanchet, Florian; Grimm, Alexander; Hazra, Dibyendu; Albert, Romain; Portier, Fabien
Josephson parametric amplifiers approach quantum-limited noise performance but require strong external microwave pump tones which make them more difficult to use than DC powered amplifiers: The pump tone can affect the device under test and requires expensive room-temperature equipment. Inelastic Cooper pair tunneling processes through a small DC voltage-biased Josephson junction, where a tunneling Cooper pair dissipates its energy 2 eV in the form of two photons are reminiscent of parametric down conversion. We show that these processes can be used to provide amplification near the quantum limit without external microwave pump tone. We explain the measured gain and noise based on the P (E) theory of inelastic Cooper pair tunneling and general fluctuation-dissipation relations.
Multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games
Energy Technology Data Exchange (ETDEWEB)
Jiang, Luo-Luo, E-mail: jiangluoluo@gmail.com [College of Physics and Electronic Information Engineering, Wenzhou University, Wenzhou 325035 (China); College of Physics and Technology, Guangxi Normal University, Guilin, Guangxi 541004 (China); Wang, Wen-Xu [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States); Department of Physics, Beijing Normal University, Beijing 100875 (China); Lai, Ying-Cheng [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States); Department of Physics, Arizona State University, Tempe, AZ 85287 (United States); Ni, Xuan [School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, AZ 85287 (United States)
2012-07-09
We study the formation of multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games with mobile individuals. We discover a set of seed distributions of species, which is able to produce multi-armed spirals and multi-pairs antispirals with a finite number of arms and pairs based on stochastic processes. The joint spiral waves are also predicted by a theoretical model based on partial differential equations associated with specific initial conditions. The spatial entropy of patterns is introduced to differentiate the multi-armed spirals and multi-pairs antispirals. For the given mobility, the spatial entropy of multi-armed spirals is higher than that of single armed spirals. The stability of the waves is explored with respect to individual mobility. Particularly, we find that both two armed spirals and one pair antispirals transform to the single armed spirals. Furthermore, multi-armed spirals and multi-pairs antispirals are relatively stable for intermediate mobility. The joint spirals with lower numbers of arms and pairs are relatively more stable than those with higher numbers of arms and pairs. In addition, comparing to large amount of previous work, we employ the no flux boundary conditions which enables quantitative studies of pattern formation and stability in the system of stochastic interactions in the absence of excitable media. -- Highlights: ► Multi-armed spirals and multi-pairs antispirals are observed. ► Patterns are predicted by computer simulations and partial differential equations. ► The spatial entropy of patterns is introduced. ► Patterns are relatively stable for intermediate mobility. ► The joint spirals with lower numbers of arms and pairs are relatively more stable.
Multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games
International Nuclear Information System (INIS)
Jiang, Luo-Luo; Wang, Wen-Xu; Lai, Ying-Cheng; Ni, Xuan
2012-01-01
We study the formation of multi-armed spirals and multi-pairs antispirals in spatial rock–paper–scissors games with mobile individuals. We discover a set of seed distributions of species, which is able to produce multi-armed spirals and multi-pairs antispirals with a finite number of arms and pairs based on stochastic processes. The joint spiral waves are also predicted by a theoretical model based on partial differential equations associated with specific initial conditions. The spatial entropy of patterns is introduced to differentiate the multi-armed spirals and multi-pairs antispirals. For the given mobility, the spatial entropy of multi-armed spirals is higher than that of single armed spirals. The stability of the waves is explored with respect to individual mobility. Particularly, we find that both two armed spirals and one pair antispirals transform to the single armed spirals. Furthermore, multi-armed spirals and multi-pairs antispirals are relatively stable for intermediate mobility. The joint spirals with lower numbers of arms and pairs are relatively more stable than those with higher numbers of arms and pairs. In addition, comparing to large amount of previous work, we employ the no flux boundary conditions which enables quantitative studies of pattern formation and stability in the system of stochastic interactions in the absence of excitable media. -- Highlights: ► Multi-armed spirals and multi-pairs antispirals are observed. ► Patterns are predicted by computer simulations and partial differential equations. ► The spatial entropy of patterns is introduced. ► Patterns are relatively stable for intermediate mobility. ► The joint spirals with lower numbers of arms and pairs are relatively more stable.
DEFF Research Database (Denmark)
Dalgas, Karina Märcher
2016-01-01
Ethnographers are increasingly making use of Facebook to acquire access and general acquaintance with their field of study. However, little has been written on how Facebook is used methodologically in research that does not have social media sites as the main focus of interest. This article argues...... the au pairs resist and embrace such dominant representations, and on how such representations are ascribed different meanings in the transnational social fields of which the migrant are a part. The article is based on ethnographic fieldwork conducted between 2010 and 2014 in Denmark, the Philippines...
Preparation and Microbiological Evaluation of Amphiphilic Kanamycin-Lipoamino Acid Ion-Pairs
Directory of Open Access Journals (Sweden)
Rosario Pignatello
2014-05-01
Full Text Available Amphiphilic ion-pairs of kanamycin (KAN were prepared by evaporation of a water-ethanol co-solution of KAN base and a lipoamino acid bearing a 12-carbon atoms alkyl side chain (LAA12, at different molar ratios. Infrared spectroscopy confirmed the structure of ion-pairs, while differential scanning calorimetry (DSC and powder X-ray diffractometry (PXRD studies supported the formation of new saline species with a different crystalline structure than the starting components. The solubility pattern shown in a range of both aqueous and organic solvents confirmed that the ion-pairs possess an amphiphilic character. The LAA12 counter-ion showed not to improve the antibacterial activity of KAN, suggesting that such chemical strategy is not able to favor the penetration of this drug inside the bacteria cells. Nevertheless, a slight improving, i.e., a one-fold dilution, was observed in E. coli. The present study can also serve as the basis for a further evaluation of LAA ion-pairing of antibiotics, as a means to improve the loading of hydrophilic drugs into lipid-based nanocarriers.
Source memory in the absence of successful cued recall.
Cook, Gabriel I; Marsh, Richard L; Hicks, Jason L
2006-07-01
Five experiments were conducted to address the question of whether source information could be accessed in the absence of being able to recall an item. The authors used a paired-associate learning paradigm in which cue-target word pairs were studied, and target recall was requested in the presence of the cue. When target recall failed, participants were asked to make a source judgment of whether a man or woman spoke the unrecalled item. In 3 of the 5 experiments, source accuracy was at or very close to chance. By contrast, if cue-target pairs were studied multiple times or participants knew in advance of learning that a predictive judgment would be required, then predictive source accuracy was well above chance. These data are suggestive that context information may not play a very large role in metacognitive judgments such as feeling-of-knowing ratings or putting one into a tip-of-the-tongue state without strong and specific encoding procedures. These same results also highlight the important role that item memory plays in retrieving information about the context in which an item was experienced. Copyright 2006 APA, all rights reserved.
Inclusive top-pair production phenomenology with TOPIXS
Beneke, M.; Falgari, P|info:eu-repo/dai/nl/339938897; Klein, Sebastian; Piclum, J.; Schwinn, C.; Ubiali, M.; Yan, F.
2012-01-01
We discuss various aspects of inclusive top-quark pair production based on Topixs, a new, flexible program that computes the production cross section at the Tevatron and LHC at next-to-next-to-leading logarithmic accuracy in soft and Coulomb resummation, including bound-state effects and the
Agent-based power sharing scheme for active hybrid power sources
Jiang, Zhenhua
The active hybridization technique provides an effective approach to combining the best properties of a heterogeneous set of power sources to achieve higher energy density, power density and fuel efficiency. Active hybrid power sources can be used to power hybrid electric vehicles with selected combinations of internal combustion engines, fuel cells, batteries, and/or supercapacitors. They can be deployed in all-electric ships to build a distributed electric power system. They can also be used in a bulk power system to construct an autonomous distributed energy system. An important aspect in designing an active hybrid power source is to find a suitable control strategy that can manage the active power sharing and take advantage of the inherent scalability and robustness benefits of the hybrid system. This paper presents an agent-based power sharing scheme for active hybrid power sources. To demonstrate the effectiveness of the proposed agent-based power sharing scheme, simulation studies are performed for a hybrid power source that can be used in a solar car as the main propulsion power module. Simulation results clearly indicate that the agent-based control framework is effective to coordinate the various energy sources and manage the power/voltage profiles.
Wada, Yoshio; Satoh, Takumi; Higashi, Yasuhiro; Urata, Yoshiharu
2017-12-01
We demonstrate a high-average-power, single longitudinal-mode, and tunable terahertz (THz)-wave source based on difference frequency generation (DFG) in a MgO:LiNbO3 (MgO:LN) crystal. The waves for DFG are generated using a pair of Yb-doped pulsed fiber lasers with a master oscillator power fiber amplifier configuration. The average power of the THz-wave output reaches 450 μW at 1.07 THz (280 μm) at a linewidth of 7.2 GHz, and the tunability ranges from 0.35 to 1.07 THz under the pulse repetition frequency of 500 kHz. A short burn-in test of the THz wave is also carried out, and the output power stability is within ± 5% of the averaged power without any active stabilizing technique. The combination of MgO:LN-DFG and stable and robust fiber laser sources is highly promising for the development of high-average-power THz-wave sources, particularly in the high transmission sub-THz region. This approach may enable new applications of THz-wave spectroscopy in imaging and remote sensing.
Parietal lesion effects on cued recall following pair associate learning.
Ben-Zvi, Shir; Soroker, Nachum; Levy, Daniel A
2015-07-01
We investigated the involvement of the posterior parietal cortex in episodic memory in a lesion-effects study of cued recall following pair-associate learning. Groups of patients who had experienced first-incident stroke, generally in middle cerebral artery territory, and exhibited damage that included lateral posterior parietal regions, were tested within an early post-stroke time window. In three experiments, patients and matched healthy comparison groups executed repeated study and cued recall test blocks of pairs of words (Experiment 1), pairs of object pictures (Experiment 2), or pairs of object pictures and environmental sounds (Experiment 3). Patients' brain CT scans were subjected to quantitative analysis of lesion volumes. Behavioral and lesion data were used to compute correlations between area lesion extent and memory deficits, and to conduct voxel-based lesion-symptom mapping. These analyses implicated lateral ventral parietal cortex, especially the angular gyrus, in cued recall deficits, most pronouncedly in the cross-modal picture-sound pairs task, though significant parietal lesion effects were also found in the unimodal word pairs and picture pairs tasks. In contrast to an earlier study in which comparable parietal lesions did not cause deficits in item recognition, these results indicate that lateral posterior parietal areas make a substantive contribution to demanding forms of recollective retrieval as represented by cued recall, especially for complex associative representations. Copyright © 2015 Elsevier Ltd. All rights reserved.
Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components
Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik
2015-03-01
We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.
Galactic Pairs in the Early Universe
Kohler, Susanna
2018-02-01
,000 objects. They find that roughly 50 have a redshift of z 7, and 22 have a redshift of z 8. None of the galaxies at z 7 are in pairs, but the sample at z 8 includes three groups for which the distance between galaxies is less than 1 arcsecond.But are these three pairs actual merging galaxies?Conclusions from StatisticsTop: Gas density at z 7.7 in the authors simulation output. Bottom: Mock observations of this output withHubbles WFC3 (left) and JWSTs NIRCam (right). [Adapted from Chaikin et al. 2018]To answer this question, the authors next perform numerical simulations of galaxy formation and produce mock observations showing what the simulatedfield would look like in an equivalent deep Hubble exposure.Based on their simulation statistics, Chaikin and collaborators argue that the three pairs at z 8 do represent an unusually high merger fraction but projection coincidences or lensing are far less likely scenarios to account for all three pairs. If the three pairs are indeed all merging galaxies, it could indicate that this Hubble field corresponds to a local overdensity at a redshift of z 8.Looking AheadThe best way to improve on these measurements is to repeat this study with more advanced telescopes. Chaikin and collaborators demonstrate the superiority of the observations that the upcoming James Webb Space Telescope (JWST) will provide. They also point out the potential power of the Wide Field Infrared Survey Telescope (WFIRST) currently under threat under the proposed 2019 federal budget to extend the observational horizon well into the epoch of reionization.Continued studies backed by the power of these future telescopes are sure to discover a wealth of additional distant galactic duos, helping us to characterize the universe in its early stages.CitationEvgenii A. Chaikin et al 2018 ApJ 853 81. doi:10.3847/1538-4357/aaa196
Integrating source-language context into phrase-based statistical machine translation
Haque, R.; Kumar Naskar, S.; Bosch, A.P.J. van den; Way, A.
2011-01-01
The translation features typically used in Phrase-Based Statistical Machine Translation (PB-SMT) model dependencies between the source and target phrases, but not among the phrases in the source language themselves. A swathe of research has demonstrated that integrating source context modelling
Furtado, H.; Steiner, E.; Stock, M.; Georg, D.; Birkfellner, W.
2014-03-01
Intra-fractional respiratorymotion during radiotherapy is one of themain sources of uncertainty in dose application creating the need to extend themargins of the planning target volume (PTV). Real-time tumormotion tracking by 2D/3D registration using on-board kilo-voltage (kV) imaging can lead to a reduction of the PTV. One limitation of this technique when using one projection image, is the inability to resolve motion along the imaging beam axis. We present a retrospective patient study to investigate the impact of paired portal mega-voltage (MV) and kV images, on registration accuracy. We used data from eighteen patients suffering from non small cell lung cancer undergoing regular treatment at our center. For each patient we acquired a planning CT and sequences of kV and MV images during treatment. Our evaluation consisted of comparing the accuracy of motion tracking in 6 degrees-of-freedom(DOF) using the anterior-posterior (AP) kV sequence or the sequence of kV-MV image pairs. We use graphics processing unit rendering for real-time performance. Motion along cranial-caudal direction could accurately be extracted when using only the kV sequence but in AP direction we obtained large errors. When using kV-MV pairs, the average error was reduced from 3.3 mm to 1.8 mm and the motion along AP was successfully extracted. The mean registration time was of 190+/-35ms. Our evaluation shows that using kVMV image pairs leads to improved motion extraction in 6 DOF. Therefore, this approach is suitable for accurate, real-time tumor motion tracking with a conventional LINAC.
Polarized positron sources for the future linear colliders
International Nuclear Information System (INIS)
Chaikovska, I.
2012-01-01
This thesis introduces the polarized positron source as one of the key element of the future Linear Collider (LC). In this context, the different schemes of the polarized positron source are described highlighting the main issues in this technology. In particular, the main focus is on the Compton based positron source adopted by the CLIC as a preferred option for the future positron source upgrade. In this case, the circularly polarized high energy gamma rays resulting from Compton scattering are directed to a production target where an electromagnetic cascade gives rise to the production of positrons by e + -e - pair conversion. To increase the efficiency of the gamma ray production stage, a multiple collision point line integrated in energy recovery linac is proposed. The simulations of the positron production, capture and primary acceleration allow to estimate the positron production efficiency and provide a simple parametrization of the Compton based polarized positron source in the view of the future LC requirements. The storage ring based Compton source option, so-called Compton ring, is also described. The main constraint of this scheme is given by the beam dynamics resulting in the large energy spread and increased bunch length affecting the gamma ray production rate. An original theoretical contribution is shown to calculate the energy spread induced by Compton scattering. Moreover, an experiment to test the gamma ray production by Compton scattering using a state-of-art laser system developed at LAL has been conducted in the framework of the 'Mighty Laser' project at the ATF, KEK. The experimental layout as well as the main results obtained are discussed in details. The studies carried out in this thesis show that the polarized positron source based on Compton scattering is a promising candidate for the future LC polarized positron source. (author)
Adatom pair distribution up to half coverage: O-Pd(100)
Kappus, Wolfgang
2017-01-01
Using substrate mediated elastic interactions fitted previously to first principles (FP) calculations, adatom pair distributions are derived for O-Pd(100) evaluating a statistical BGY based integral equation. The evaluation method utilizes the superposition approximation, a temperature scaling scheme, and for one variant the particle-hole symmetry of a pair interaction lattice gas Hamiltonian. The elastic Hamiltonian is taken from a previous 3 parameter analytical model. The resulting adatom ...
Majorana edge States in atomic wires coupled by pair hopping.
Kraus, Christina V; Dalmonte, Marcello; Baranov, Mikhail A; Läuchli, Andreas M; Zoller, P
2013-10-25
We present evidence for Majorana edge states in a number conserving theory describing a system of spinless fermions on two wires that are coupled by pair hopping. Our analysis is based on a combination of a qualitative low energy approach and numerical techniques using the density matrix renormalization group. In addition, we discuss an experimental realization of pair-hopping interactions in cold atom gases confined in optical lattices.
Energy Technology Data Exchange (ETDEWEB)
Savanier, Marc, E-mail: msavanier@eng.ucsd.edu; Mookherjea, Shayan, E-mail: smookherjea@eng.ucsd.edu [Department of Electrical and Computer Engineering, University of California, San Diego, La Jolla, California 92093 (United States)
2016-06-20
Generation of photon pairs from compact, manufacturable, and inexpensive silicon (Si) photonic devices at room temperature may help develop practical applications of quantum photonics. An important characteristic of photon-pair generation is the two-photon joint spectral intensity, which describes the frequency correlations of the photon pair. Recent attempts to generate a factorizable photon-pair state suitable for heralding have used short optical pump pulses from mode-locked lasers, which are much more expensive and bigger table-top or rack-sized instruments compared with the Si microchip used for generating photon pairs, and thus dominate the cost and inhibit the miniaturization of the source. Here, we generate photon pairs from an Si microring resonator by using an electronic step-recovery diode to drive an electro-optic modulator which carves the pump light from a continuous-wave laser diode into pulses of the appropriate width, thus potentially eliminating the need for optical mode-locked lasers.
Asymmetrically cut crystal pair as x-ray magnifier for imaging at high intensity laser facilities
Energy Technology Data Exchange (ETDEWEB)
Szabo, C. I.; Feldman, U. [Artep Inc., 2922 Excelsior Spring Circle, Ellicott City, Maryland 21042 (United States); Seely, J. F. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Curry, J. J.; Hudson, L. T.; Henins, A. [National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States)
2010-10-15
The potential of an x-ray magnifier prepared from a pair of asymmetrically cut crystals is studied to explore high energy x-ray imaging capabilities at high intensity laser facilities. OMEGA-EP and NIF when irradiating mid and high Z targets can be a source of high-energy x-rays whose production mechanisms and use as backlighters are a subject of active research. This paper studies the properties and potential of existing asymmetric cut crystal pairs from the National Institute of Standards and Technology (NIST) built in a new enclosure for imaging x-ray sources. The technique of the x-ray magnifier has been described previously. This new approach is aimed to find a design that could be used at laser facilities by magnifying the x-ray source into a screen far away from the target chamber center, with fixed magnification defined by the crystals' lattice spacing and the asymmetry angles. The magnified image is monochromatic and the imaging wavelength is set by crystal asymmetry and incidence angles. First laboratory results are presented and discussed.
A GIS-based time-dependent seismic source modeling of Northern Iran
Hashemi, Mahdi; Alesheikh, Ali Asghar; Zolfaghari, Mohammad Reza
2017-01-01
The first step in any seismic hazard study is the definition of seismogenic sources and the estimation of magnitude-frequency relationships for each source. There is as yet no standard methodology for source modeling and many researchers have worked on this topic. This study is an effort to define linear and area seismic sources for Northern Iran. The linear or fault sources are developed based on tectonic features and characteristic earthquakes while the area sources are developed based on spatial distribution of small to moderate earthquakes. Time-dependent recurrence relationships are developed for fault sources using renewal approach while time-independent frequency-magnitude relationships are proposed for area sources based on Poisson process. GIS functionalities are used in this study to introduce and incorporate spatial-temporal and geostatistical indices in delineating area seismic sources. The proposed methodology is used to model seismic sources for an area of about 500 by 400 square kilometers around Tehran. Previous researches and reports are studied to compile an earthquake/fault catalog that is as complete as possible. All events are transformed to uniform magnitude scale; duplicate events and dependent shocks are removed. Completeness and time distribution of the compiled catalog is taken into account. The proposed area and linear seismic sources in conjunction with defined recurrence relationships can be used to develop time-dependent probabilistic seismic hazard analysis of Northern Iran.
Open Source GIS based integrated watershed management
Byrne, J. M.; Lindsay, J.; Berg, A. A.
2013-12-01
Optimal land and water management to address future and current resource stresses and allocation challenges requires the development of state-of-the-art geomatics and hydrological modelling tools. Future hydrological modelling tools should be of high resolution, process based with real-time capability to assess changing resource issues critical to short, medium and long-term enviromental management. The objective here is to merge two renowned, well published resource modeling programs to create an source toolbox for integrated land and water management applications. This work will facilitate a much increased efficiency in land and water resource security, management and planning. Following an 'open-source' philosophy, the tools will be computer platform independent with source code freely available, maximizing knowledge transfer and the global value of the proposed research. The envisioned set of water resource management tools will be housed within 'Whitebox Geospatial Analysis Tools'. Whitebox, is an open-source geographical information system (GIS) developed by Dr. John Lindsay at the University of Guelph. The emphasis of the Whitebox project has been to develop a user-friendly interface for advanced spatial analysis in environmental applications. The plugin architecture of the software is ideal for the tight-integration of spatially distributed models and spatial analysis algorithms such as those contained within the GENESYS suite. Open-source development extends knowledge and technology transfer to a broad range of end-users and builds Canadian capability to address complex resource management problems with better tools and expertise for managers in Canada and around the world. GENESYS (Generate Earth Systems Science input) is an innovative, efficient, high-resolution hydro- and agro-meteorological model for complex terrain watersheds developed under the direction of Dr. James Byrne. GENESYS is an outstanding research and applications tool to address
Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.
2011-01-01
Pairings on elliptic curves are being used in an increasing number of cryptographic applications on many different devices and platforms, but few performance numbers for cryptographic pairings have been reported on embedded and mobile devices. In this paper we give performance numbers for affine and
International Nuclear Information System (INIS)
Balantekin, A. B.; Pehlivan, Y.
2007-01-01
We give the exact solution of orbit dependent nuclear pairing problem between two nondegenerate energy levels using the Bethe ansatz technique. Our solution reduces to previously solved cases in the appropriate limits including Richardson's treatment of reduced pairing in terms of rational Gaudin algebra operators
The Peak Pairs algorithm for strain mapping from HRTEM images
Energy Technology Data Exchange (ETDEWEB)
Galindo, Pedro L. [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)], E-mail: pedro.galindo@uca.es; Kret, Slawomir [Institute of Physics, PAS, AL. Lotnikow 32/46, 02-668 Warsaw (Poland); Sanchez, Ana M. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Laval, Jean-Yves [Laboratoire de Physique du Solide, UPR5 CNRS-ESPCI, Paris (France); Yanez, Andres; Pizarro, Joaquin; Guerrero, Elisa [Departamento de Lenguajes y Sistemas Informaticos, CASEM, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain); Ben, Teresa; Molina, Sergio I. [Departamento de Ciencia de los Materiales e Ing. Metalurgica y Q. Inorganica, Facultad de Ciencias, Universidad de Cadiz, Pol. Rio San Pedro s/n. 11510, Puerto Real, Cadiz (Spain)
2007-11-15
Strain mapping is defined as a numerical image-processing technique that measures the local shifts of image details around a crystal defect with respect to the ideal, defect-free, positions in the bulk. Algorithms to map elastic strains from high-resolution transmission electron microscopy (HRTEM) images may be classified into two categories: those based on the detection of peaks of intensity in real space and the Geometric Phase approach, calculated in Fourier space. In this paper, we discuss both categories and propose an alternative real space algorithm (Peak Pairs) based on the detection of pairs of intensity maxima in an affine transformed space dependent on the reference area. In spite of the fact that it is a real space approach, the Peak Pairs algorithm exhibits good behaviour at heavily distorted defect cores, e.g. interfaces and dislocations. Quantitative results are reported from experiments to determine local strain in different types of semiconductor heterostructures.
DEFF Research Database (Denmark)
Kristensen, Marlene Dahlwad; Bendsen, Nathalie Tommerup; Christensen, Sheena M
2016-01-01
BACKGROUND: Recent nutrition recommendations advocate a reduction in protein from animal sources (pork, beef) because of environmental concerns. Instead, protein from vegetable sources (beans, peas) should be increased. However, little is known about the effect of these vegetable protein sources...... on appetite regulation. OBJECTIVE: To examine whether meals based on vegetable protein sources (beans/peas) are comparable to meals based on animal protein sources (veal/pork) regarding meal-induced appetite sensations. DESIGN: In total, 43 healthy, normal-weight, young men completed this randomized, double......-Legume compared to HP-Meat or LP-Legume (pVegetable-based meals (beans/peas) influenced appetite sensations favorably compared to animal-based meals (pork/veal) with similar energy and protein content, but lower fiber content. Interestingly, a vegetable-based meal with low protein content...
VSEARCH: a versatile open source tool for metagenomics
Directory of Open Access Journals (Sweden)
Torbjørn Rognes
2016-10-01
Full Text Available Background VSEARCH is an open source and free of charge multithreaded 64-bit tool for processing and preparing metagenomics, genomics and population genomics nucleotide sequence data. It is designed as an alternative to the widely used USEARCH tool (Edgar, 2010 for which the source code is not publicly available, algorithm details are only rudimentarily described, and only a memory-confined 32-bit version is freely available for academic use. Methods When searching nucleotide sequences, VSEARCH uses a fast heuristic based on words shared by the query and target sequences in order to quickly identify similar sequences, a similar strategy is probably used in USEARCH. VSEARCH then performs optimal global sequence alignment of the query against potential target sequences, using full dynamic programming instead of the seed-and-extend heuristic used by USEARCH. Pairwise alignments are computed in parallel using vectorisation and multiple threads. Results VSEARCH includes most commands for analysing nucleotide sequences available in USEARCH version 7 and several of those available in USEARCH version 8, including searching (exact or based on global alignment, clustering by similarity (using length pre-sorting, abundance pre-sorting or a user-defined order, chimera detection (reference-based or de novo, dereplication (full length or prefix, pairwise alignment, reverse complementation, sorting, and subsampling. VSEARCH also includes commands for FASTQ file processing, i.e., format detection, filtering, read quality statistics, and merging of paired reads. Furthermore, VSEARCH extends functionality with several new commands and improvements, including shuffling, rereplication, masking of low-complexity sequences with the well-known DUST algorithm, a choice among different similarity definitions, and FASTQ file format conversion. VSEARCH is here shown to be more accurate than USEARCH when performing searching, clustering, chimera detection and subsampling
Quantifying inbreeding avoidance through extra-pair reproduction.
Reid, Jane M; Arcese, Peter; Keller, Lukas F; Germain, Ryan R; Duthie, A Bradley; Losdat, Sylvain; Wolak, Matthew E; Nietlisbach, Pirmin
2015-01-01
Extra-pair reproduction is widely hypothesized to allow females to avoid inbreeding with related socially paired males. Consequently, numerous field studies have tested the key predictions that extra-pair offspring are less inbred than females' alternative within-pair offspring, and that the probability of extra-pair reproduction increases with a female's relatedness to her socially paired male. However, such studies rarely measure inbreeding or relatedness sufficiently precisely to detect subtle effects, or consider biases stemming from failure to observe inbred offspring that die during early development. Analyses of multigenerational song sparrow (Melospiza melodia) pedigree data showed that most females had opportunity to increase or decrease the coefficient of inbreeding of their offspring through extra-pair reproduction with neighboring males. In practice, observed extra-pair offspring had lower inbreeding coefficients than females' within-pair offspring on average, while the probability of extra-pair reproduction increased substantially with the coefficient of kinship between a female and her socially paired male. However, simulations showed that such effects could simply reflect bias stemming from inbreeding depression in early offspring survival. The null hypothesis that extra-pair reproduction is random with respect to kinship therefore cannot be definitively rejected in song sparrows, and existing general evidence that females avoid inbreeding through extra-pair reproduction requires reevaluation given such biases. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.
Measuring Modularity in Open Source Code Bases
Directory of Open Access Journals (Sweden)
Roberto Milev
2009-03-01
Full Text Available Modularity of an open source software code base has been associated with growth of the software development community, the incentives for voluntary code contribution, and a reduction in the number of users who take code without contributing back to the community. As a theoretical construct, modularity links OSS to other domains of research, including organization theory, the economics of industry structure, and new product development. However, measuring the modularity of an OSS design has proven difficult, especially for large and complex systems. In this article, we describe some preliminary results of recent research at Carleton University that examines the evolving modularity of large-scale software systems. We describe a measurement method and a new modularity metric for comparing code bases of different size, introduce an open source toolkit that implements this method and metric, and provide an analysis of the evolution of the Apache Tomcat application server as an illustrative example of the insights gained from this approach. Although these results are preliminary, they open the door to further cross-discipline research that quantitatively links the concerns of business managers, entrepreneurs, policy-makers, and open source software developers.
Synchrotron based spallation neutron source concepts
International Nuclear Information System (INIS)
Cho, Y.
1998-01-01
During the past 20 years, rapid-cycling synchrotrons (RCS) have been used very productively to generate short-pulse thermal neutron beams for neutron scattering research by materials science communities in Japan (KENS), the UK (ISIS) and the US (IPNS). The most powerful source in existence, ISIS in the UK, delivers a 160-kW proton beam to a neutron-generating target. Several recently proposed facilities require proton beams in the MW range to produce intense short-pulse neutron beams. In some proposals, a linear accelerator provides the beam power and an accumulator ring compresses the pulse length to the required ∼ 1 micros. In others, RCS technology provides the bulk of the beam power and compresses the pulse length. Some synchrotron-based proposals achieve the desired beam power by combining two or more synchrotrons of the same energy, and others propose a combination of lower and higher energy synchrotrons. This paper presents the rationale for using RCS technology, and a discussion of the advantages and disadvantages of synchrotron-based spallation sources
Synergy between pair coupled cluster doubles and pair density functional theory
Energy Technology Data Exchange (ETDEWEB)
Garza, Alejandro J.; Bulik, Ireneusz W. [Department of Chemistry, Rice University, Houston, Texas 77251-1892 (United States); Henderson, Thomas M. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Scuseria, Gustavo E. [Department of Chemistry and Department of Physics and Astronomy, Rice University, Houston, Texas 77251-1892 (United States); Chemistry Department, Faculty of Science, King Abdulaziz University, Jeddah 21589 (Saudi Arabia)
2015-01-28
Pair coupled cluster doubles (pCCD) has been recently studied as a method capable of accounting for static correlation with low polynomial cost. We present three combinations of pCCD with Kohn–Sham functionals of the density and on-top pair density (the probability of finding two electrons on top of each other) to add dynamic correlation to pCCD without double counting. With a negligible increase in computational cost, these pCCD+DFT blends greatly improve upon pCCD in the description of typical problems where static and dynamic correlations are both important. We argue that—as a black-box method with low scaling, size-extensivity, size-consistency, and a simple quasidiagonal two-particle density matrix—pCCD is an excellent match for pair density functionals in this type of fusion of multireference wavefunctions with DFT.
Secure pairing with biometrics
Buhan, I.R.; Boom, B.J.; Doumen, J.M.; Hartel, Pieter H.; Veldhuis, Raymond N.J.
Secure pairing enables two devices that share no prior context with each other to agree upon a security association, which they can use to protect their subsequent communication. Secure pairing offers guarantees of the association partner identity and it should be resistant to eavesdropping and to a
Bolt, Sarah L; Boyland, Natasha K; Mlynski, David T; James, Richard; Croft, Darren P
2017-01-01
The early social environment can influence the health and behaviour of animals, with effects lasting into adulthood. In Europe, around 60% of dairy calves are reared individually during their first eight weeks of life, while others may be housed in pairs or small groups. This study assessed the effects of varying degrees of social contact on weaning stress, health and production during pen rearing, and on the social networks that calves later formed when grouped. Forty female Holstein-Friesian calves were allocated to one of three treatments: individually housed (I, n = 8), pair-housed from day five (P5, n = 8 pairs), and pair-housed from day 28 (P28, n = 8 pairs). From day 48, calves were weaned by gradual reduction of milk over three days, and vocalisations were recorded as a measure of stress for three days before, during and after weaning. Health and production (growth rate and concentrate intakes) were not affected by treatment during the weaning period or over the whole study. Vocalisations were highest post-weaning, and were significantly higher in I calves than pair-reared calves. Furthermore, P28 calves vocalised significantly more than P5 calves. The social network of calves was measured for one month after all calves were grouped in a barn, using association data from spatial proximity loggers. We tested for week-week stability, social differentiation and assortment in the calf network. Additionally, we tested for treatment differences in: coefficient of variation (CV) in association strength, percentage of time spent with ex-penmate (P5 and P28 calves only) and weighted degree centrality (the sum of the strength of an individual's associations). The network was relatively stable from weeks one to four and was significantly differentiated, with individuals assorting based on prior familiarity. P5 calves had significantly higher CV in association strength than I calves in week one (indicating more heterogeneous social associations) but there were no
Liu, Y.; Arntsen, B.; Wapenaar, C.P.A.; Van der Neut, J.R.
2014-01-01
The virtual source method has been applied successfully to retrieve the impulse response between pairs of receivers in the subsurface. This method is further improved by an updown separation prior to the crosscorrelation to suppress the reflections from the overburden and the free surface. In a
Weston-Sementelli, Jennifer L.; Allen, Laura K.; McNamara, Danielle S.
2018-01-01
Source-based essays are evaluated both on the quality of the writing and the content appropriate interpretation and use of source material. Hence, composing a high-quality source-based essay (an essay written based on source material) relies on skills related to both reading (the sources) and writing (the essay) skills. As such, source-based…
International Nuclear Information System (INIS)
Shirbisheh, Vahid
2012-01-01
As the first step towards developing noncommutative geometry over Hecke C ∗ -algebras, we study property (RD) (Rapid Decay) for Hecke pairs. When the subgroup H in a Hecke pair (G, H) is finite, we show that the Hecke pair (G, H) has (RD) if and only if G has (RD). This provides us with a family of examples of Hecke pairs with property (RD). We also adapt Paul Jolissant’s works in Jolissaint (J K-Theory 2:723–735, 1989; Trans Amer Math Soc 317(1):167–196, 1990) to the setting of Hecke C ∗ -algebras and show that when a Hecke pair (G, H) has property (RD), the algebra of rapidly decreasing functions on the set of double cosets is closed under holomorphic functional calculus of the associated (reduced) Hecke C ∗ -algebra. Hence they have the same K 0 -groups.
Standard Practice for Conducting Irradiations at Accelerator-Based Neutron Sources
American Society for Testing and Materials. Philadelphia
1996-01-01
1.1 This practice covers procedures for irradiations at accelerator-based neutron sources. The discussion focuses on two types of sources, namely nearly monoenergetic 14-MeV neutrons from the deuterium-tritium T(d,n) interaction, and broad spectrum neutrons from stopping deuterium beams in thick beryllium or lithium targets. However, most of the recommendations also apply to other types of accelerator-based sources, including spallation neutron sources (1). Interest in spallation sources has increased recently due to their proposed use for transmutation of fission reactor waste (2). 1.2 Many of the experiments conducted using such neutron sources are intended to simulate irradiation in another neutron spectrum, for example, that from a DT fusion reaction. The word simulation is used here in a broad sense to imply an approximation of the relevant neutron irradiation environment. The degree of conformity can range from poor to nearly exact. In general, the intent of these simulations is to establish the fundam...
Using Dictionary Pair Learning for Seizure Detection.
Ma, Xin; Yu, Nana; Zhou, Weidong
2018-02-13
Automatic seizure detection is extremely important in the monitoring and diagnosis of epilepsy. The paper presents a novel method based on dictionary pair learning (DPL) for seizure detection in the long-term intracranial electroencephalogram (EEG) recordings. First, for the EEG data, wavelet filtering and differential filtering are applied, and the kernel function is performed to make the signal linearly separable. In DPL, the synthesis dictionary and analysis dictionary are learned jointly from original training samples with alternating minimization method, and sparse coefficients are obtained by using of linear projection instead of costly [Formula: see text]-norm or [Formula: see text]-norm optimization. At last, the reconstructed residuals associated with seizure and nonseizure sub-dictionary pairs are calculated as the decision values, and the postprocessing is performed for improving the recognition rate and reducing the false detection rate of the system. A total of 530[Formula: see text]h from 20 patients with 81 seizures were used to evaluate the system. Our proposed method has achieved an average segment-based sensitivity of 93.39%, specificity of 98.51%, and event-based sensitivity of 96.36% with false detection rate of 0.236/h.
A New Spin on Teaching Vocabulary: A Source-Based Approach.
Nilsen, Alleen Pace; Nilsen, Don L. F.
2003-01-01
Suggests that teachers should try to use a source-based approach to teaching vocabulary. Explains that a source-based approach starts with basic concepts of human languages and then works with lexical and metaphorical extensions of these basic words. Notes that the purpose of this approach is to find groups of words that can be taught as webs and…
Pairing versus phase coherence of doped holes in distinct quantum spin backgrounds
Zhu, Zheng; Sheng, D. N.; Weng, Zheng-Yu
2018-03-01
We examine the pairing structure of holes injected into two distinct spin backgrounds: a short-range antiferromagnetic phase versus a symmetry protected topological phase. Based on density matrix renormalization group (DMRG) simulation, we find that although there is a strong binding between two holes in both phases, phase fluctuations can significantly influence the pair-pair correlation depending on the spin-spin correlation in the background. Here the phase fluctuation is identified as an intrinsic string operator nonlocally controlled by the spins. We show that while the pairing amplitude is generally large, the coherent Cooper pairing can be substantially weakened by the phase fluctuation in the symmetry-protected topological phase, in contrast to the short-range antiferromagnetic phase. It provides an example of a non-BCS mechanism for pairing, in which the paring phase coherence is determined by the underlying spin state self-consistently, bearing an interesting resemblance to the pseudogap physics in the cuprate.
Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S
2018-04-01
Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.
Energy Technology Data Exchange (ETDEWEB)
He, Qing; Peters, Gretchen Marie; Lynch, Vincent M.; Sessler, Jonathan L. [Department of Chemistry, University of Texas, Austin, TX (United States)
2017-10-16
Current approaches to lowering the pH of basic media rely on the addition of a proton source. An alternative approach is described herein that involves the liquid-liquid extraction-based removal of cesium salts, specifically CsOH and Cs{sub 2}CO{sub 3}, from highly basic media. A multitopic ion-pair receptor (2) is used that can recognize and extract the hydroxide and carbonate anions as their cesium salts, as confirmed by {sup 1}H NMR spectroscopic titrations, ICP-MS, single-crystal structural analyses, and theoretical calculations. A sharp increase in the pH and cesium concentrations in the receiving phase is observed when receptor 2 is employed as a carrier in U-tube experiments involving the transport of CsOH through an intervening chloroform layer. The pH of the source phase likewise decreases. (copyright 2017 Wiley-VCH Verlag GmbH and Co. KGaA, Weinheim)
Olfactory interference during inhibitory backward pairing in honey bees.
Directory of Open Access Journals (Sweden)
Matthieu Dacher
Full Text Available Restrained worker honey bees are a valuable model for studying the behavioral and neural bases of olfactory plasticity. The proboscis extension response (PER; the proboscis is the mouthpart of honey bees is released in response to sucrose stimulation. If sucrose stimulation is preceded one or a few times by an odor (forward pairing, the bee will form a memory for this association, and subsequent presentations of the odor alone are sufficient to elicit the PER. However, backward pairing between the two stimuli (sucrose, then odor has not been studied to any great extent in bees, although the vertebrate literature indicates that it elicits a form of inhibitory plasticity.If hungry bees are fed with sucrose, they will release a long lasting PER; however, this PER can be interrupted if an odor is presented 15 seconds (but not 7 or 30 seconds after the sucrose (backward pairing. We refer to this previously unreported process as olfactory interference. Bees receiving this 15 second backward pairing show reduced performance after a subsequent single forward pairing (excitatory conditioning trial. Analysis of the results supported a relationship between olfactory interference and a form of backward pairing-induced inhibitory learning/memory. Injecting the drug cimetidine into the deutocerebrum impaired olfactory interference.Olfactory interference depends on the associative link between odor and PER, rather than between odor and sucrose. Furthermore, pairing an odor with sucrose can lead either to association of this odor to PER or to the inhibition of PER by this odor. Olfactory interference may provide insight into processes that gate how excitatory and inhibitory memories for odor-PER associations are formed.
He, Jianghua
2014-11-25
A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.
Role of pn-pairs in nuclear structure
International Nuclear Information System (INIS)
Nie, G.K.
2003-01-01
An α-cluster model of nuclear structure based on power of proton + neutron (pn)-pairs to bind themselves to α-clusters is proposed. The α-cluster is taken as the perfect condition of coupling of 2 pn- pairs, reminding complete electron shell in atomic physics. Pn-pairs create 2 other types of coupling of considerably less power between pn-pairs of nearby α-clusters ε α c and between pn-pair not bound into α-cluster with pn-pairs of nearby cluster ε pn c . Last two types of coupling are called covalent because of reminding similar electron coupling in chemistry. According the model nucleus is a liquid drop consisting of molecules, which are α-clusters, tied by covalent coupling with those ones which are in close vicinity. Then in case of even-even nuclei spin of the nucleus has to be zero I=0 + as sum of spinless particles. In case of nucleus has some nucleons (i) in intermolecular space, I=Σj i ; with taking into account that there is coupling of p and n in pn-pair. Therefore for 6 Li (1=0)I=2·1/2=1 + . The values ε α c , ε pn c and binding energy of the pn-pair itself ε pn have been estimated from analysis of binding energy of nuclei 6 Li, 10 B and 12 C. With the values the binding energy of the other nuclei with N=Z up to 58 Cu have been described with difference between experimental values and model ones in average less than 0.4 MeV. The structure reveals some regular forms, in which every cluster has reduced amount of covalent coupling, 3 or 4, and free pn-pair has 6 covalent coupling with 3 nearby clusters pn-pairs. Then the magic numbers are supposed to be the matter of geometry, when total amount of covalent couplings is optimal (minimal for the amount of clusters), α- clusters are placed in the same fixed distant from center of mass. It means that protons of the clusters can be considered as belonging to one shell. In the cluster model single particle effects have to be considered as single particle binding in one of the surface
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Multiple electromagnetic pair production in ultrarelativistic heavy ion collisions
International Nuclear Information System (INIS)
Best, C.
1992-04-01
The problem of the unitary violation in the pair production in ultrarelativistic heavy ion collisions was studied by a consideration of the field-theoretical foundations. The quantum electrodynamics in an external field were thereby reduced to a Dirac-sea model, the equivalence of which to the non-radiative QED resulted from the equality of the generating functionals. The latter can both be expressed explicitely by means of the complet set of the solutions of the Dirac equation in an external field. This method is based solely on the path-integral approach, which makes it possible to discriminate clearly between the physically given correlation functions and their generating functional at the one hand and at the other hand between the models constructed to their interpretation. From the model expression for the pair production amplitudes and multiplicities could be calculated, for which only the knowledge of the one-particle S matrix is necessary. For the calculation of the multiplicities different forms of the perturbation theory were discussed. Finally an impact-parameter dependent Weizsaecker-Williams approximation for the calculation of arbitrary two-photon graphs was constructed and applied to the given problem. The results indicate that at small distances very high pair multiplicities are to be expected. Finally a new approach to the pair production in an external field was discussed, which is not based on the canonical field theory, but on the formalism of the Wigner functions. (orig./HSI) [de
Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria
2008-07-15
Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.
Instability of vortex pair leapfrogging
DEFF Research Database (Denmark)
Tophøj, Laust; Aref, Hassan
2013-01-01
Leapfrogging is a periodic solution of the four-vortex problem with two positive and two negative point vortices all of the same absolute circulation arranged as co-axial vortex pairs. The set of co-axial motions can be parameterized by the ratio 0 vortex pair sizes at the time when one...... pair passes through the other. Leapfrogging occurs for α > σ2, where is the silver ratio. The motion is known in full analytical detail since the 1877 thesis of Gröbli and a well known 1894 paper by Love. Acheson ["Instability of vortex leapfrogging," Eur. J. Phys.21, 269-273 (2000...... pairs fly off to infinity, and a "walkabout" mode, where the vortices depart from leapfrogging but still remain within a finite distance of one another. We show numerically that this transition is more gradual, a result that we relate to earlier investigations of chaotic scattering of vortex pairs [L...
Pairing induced superconductivity in holography
Bagrov, Andrey; Meszena, Balazs; Schalm, Koenraad
2014-09-01
We study pairing induced superconductivity in large N strongly coupled systems at finite density using holography. In the weakly coupled dual gravitational theory the mechanism is conventional BCS theory. An IR hard wall cut-off is included to ensure that we can controllably address the dynamics of a single confined Fermi surface. We address in detail the interplay between the scalar order parameter field and fermion pairing. Adding an explicitly dynamical scalar operator with the same quantum numbers as the fermion-pair, the theory experiences a BCS/BEC crossover controlled by the relative scaling dimensions. We find the novel result that this BCS/BEC crossover exposes resonances in the canonical expectation value of the scalar operator. This occurs not only when the scaling dimension is degenerate with the Cooper pair, but also with that of higher derivative paired operators. We speculate that a proper definition of the order parameter which takes mixing with these operators into account stays finite nevertheless.
Energy Technology Data Exchange (ETDEWEB)
Perrin, A
2007-11-15
In this thesis, we report on the observation of pairs of correlated atoms produced in the collision of two Bose-Einstein condensates of metastable helium. Three laser beams perform a Raman transfer which extracts the condensate from the magnetic trap and separates it into two parts with opposite mean momenta. While the condensates propagate, elastic scattering of pairs of atoms occurs, whose momenta satisfy energy and momentum conservation laws. Metastable helium atoms large internal energy allows the use of a position-sensitive, single-atom detector which permits a three-dimensional reconstruction of the scattered atoms'momenta. The statistics of these momenta show correlations for atoms with opposite momenta. The measured correlation volume can be understood from the uncertainty-limited momentum spread of the colliding condensates. This interpretation is confirmed by the observation of the momentum correlation function for two atoms scattered in the same direction. This latter effect is a manifestation of the Hanbury Brown-Twiss effect for indistinguishable bosons. Such a correlated-atom-pair source is a first step towards experiments in which one would like to confirm the pairs'entanglement. (author)
Bright nanoscale source of deterministic entangled photon pairs violating Bell's inequality
Jöns, K.D.; Schweickert, L.S.; Versteegh, M.A.M.; Dalacu, Dan; Poole, Philip J.; Gulinatti, Angelo; Giudice, Andrea; Zwiller, V.G.; Reimer, M.E.
2017-01-01
Global, secure quantum channels will require efficient distribution of entangled photons. Long distance, low-loss interconnects can only be realized using photons as quantum information carriers. However, a quantum light source combining both high qubit fidelity and on-demand bright emission has
CP violation in top pair production at an e^+e^- collider
Chang, Darwin; Phillips, Ivan
1992-01-01
We investigate a possible CP violating effect in $e^+e^-$ annihilation into $t\\bar t$ top quark pairs. As an illustrative example, we assume the source of the CP nonconservation is in the Yukawa couplings of a neutral Higgs boson which contain both scalar and pseudoscalar pieces. One of the interesting observable effects is the difference in production rates between the two CP conjugate polarized $t\\bar t$ states.
[Paired kidneys in transplant].
Regueiro López, Juan C; Leva Vallejo, Manuel; Prieto Castro, Rafael; Anglada Curado, Francisco; Vela Jiménez, Francisco; Ruiz García, Jesús
2009-02-01
Many factors affect the graft and patient survival on the renal transplant outcome. These factors depend so much of the recipient and donor. We accomplished a study trying to circumvent factors that depend on the donor. We checked the paired kidneys originating of a same donor cadaver. We examined the risk factors in the evolution and follow-up in 278 couples of kidney transplant. We describe their differences, significance, the graft and patient survival, their functionality in 3 and 5 years and the risk factors implicated in their function. We study immunogenic and no immunogenic variables, trying to explain the inferior results in the grafts that are established secondly. We regroup the paired kidneys in those that they did not show paired initial function within the same couple. The results yield a discreet deterioration in the graft and patient survival for second group establish, superior creatinina concentration, without obtaining statistical significance. The Cox regression study establishes the early rejection (inferior to three months) and DR incompatibility values like risk factors. This model of paired kidneys would be able to get close to best-suited form for risk factors analysis in kidney transplant from cadaver donors, if more patients examine themselves in the same way. The paired kidneys originating from the same donor do not show the same function in spite of sharing the same conditions of the donor and perioperative management.
Dual origin of pairing in nuclei
Energy Technology Data Exchange (ETDEWEB)
Idini, A. [University of Jyvaskyla, Department of Physics (Finland); Potel, G. [Michigan State University, National Superconducting Cyclotron Laboratory (United States); Barranco, F. [Escuela Superior de Ingenieros, Universidad de Sevilla, Departamento de Fìsica Aplicada III (Spain); Vigezzi, E., E-mail: enrico.vigezzi@mi.infn.it [INFN Sezione di Milano (Italy); Broglia, R. A. [Università di Milano, Dipartimento di Fisica (Italy)
2016-11-15
The pairing correlations of the nucleus {sup 120}Sn are calculated by solving the Nambu–Gor’kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong {sup 1}S{sub 0} short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- (v{sub p}{sup bare}) and long-range (v{sub p}{sup ind}) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.
Dual origin of pairing in nuclei
Idini, A.; Potel, G.; Barranco, F.; Vigezzi, E.; Broglia, R. A.
2016-11-01
The pairing correlations of the nucleus 120Sn are calculated by solving the Nambu-Gor'kov equations, including medium polarization effects resulting from the interweaving of quasiparticles, spin and density vibrations, taking into account, within the framework of nuclear field theory (NFT), processes leading to self-energy and vertex corrections and to the induced pairing interaction. From these results one can not only demonstrate the inevitability of the dual origin of pairing in nuclei, but also extract information which can be used at profit to quantitatively disentangle the contributions to the pairing gap Δ arising from the bare and from the induced pairing interaction. The first is the strong 1 S 0 short-range NN potential resulting from meson exchange between nucleons moving in time reversal states within an energy range of hundreds of MeV from the Fermi energy. The second results from the exchange of vibrational modes between nucleons moving within few MeV from the Fermi energy. Short- ( v p bare) and long-range ( v p ind) pairing interactions contribute essentially equally to nuclear Cooper pair stability. That is to the breaking of gauge invariance in open-shell superfluid nuclei and thus to the order parameter, namely to the ground state expectation value of the pair creation operator. In other words, to the emergent property of generalized rigidity in gauge space, and associated rotational bands and Cooper pair tunneling between members of these bands.