WorldWideScience

Sample records for pair fragment spanning

  1. L-fuzzy/span> fixed points theorems for L-fuzzy/span> mappings via βℱL-admissible pair.

    Science.gov (United States)

    Rashid, Maliha; Azam, Akbar; Mehmood, Nayyar

    2014-01-01

    We define the concept of βℱL-admissible for a pair of L-fuzzy/span> mappings and establish the existence of common L-fuzzy/span> fixed point theorem. Our result generalizes some useful results in the literature. We provide an example to support our result.

  2. Fast local fragment chaining using sum-of-pair gap costs

    DEFF Research Database (Denmark)

    Otto, Christian; Hoffmann, Steve; Gorodkin, Jan

    2011-01-01

    , and rank the fragments to improve the specificity. Results: Here we present a fast and flexible fragment chainer that for the first time also supports a sum-of-pair gap cost model. This model has proven to achieve a higher accuracy and sensitivity in its own field of application. Due to a highly time...... alignment heuristics alone. By providing both the linear and the sum-of-pair gap cost model, a wider range of application can be covered. The software clasp is available at http://www.bioinf.uni-leipzig.de/Software/clasp/....

  3. Yields of correlated fragment pairs and neutron multiplicity in spontaneous fission of {sup 242}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Veselsky, M.; Kliman, J.; Morhaccaron, M. [Institute of Physics of Slovak Academy of Sciences, Dubravska 9, 84228 Bratislava (Slovakia); Ramayya, A.V.; Kormicki, J.; Daniel, A.V. [Physics Department, Vanderbilt University, Nashville (United States)] Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Berkeley (United States)] Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore (United States); Daniel, A.V.; Popeko, G.S.; Oganessian, Yu. Ts. [Joint Institute for Nuclear Research, Dubna (Russia)] Greiner, W. [Institut fur Theoretische Physik, J. W. Goethe Universitaet, Frankfurt a. M. (Germany); Aryaeinejad, R. [Idaho National Engineering Laboratory, Idaho Falls (United States)

    1998-10-01

    Yields of correlated fragment pairs were obtained in spontaneous fission of {sup 242}Pu. Charge, mass and neutron multiplicity distributions of fragment pairs were determined and compared to available data. The yield of cold fission without neutron emission was determined to about 10{percent} for the set of observed correlated fragment pairs. {copyright} {ital 1998 American Institute of Physics.}

  4. Thermionic detection of the ionic fragments of continiuum-state pair absorption systems

    International Nuclear Information System (INIS)

    Hotop, R.; Niemax, K.; Richter, J.; Weber, K.H.

    1981-01-01

    Using a thermionic diode we have detected the ionic fragments formed by associative ionization and dissociation after continuum-state pair absorption processes in Cs-Cs and Cs-K systems. Assuming an ionization probability of unity of the excited species and calibrating the pair absorption bands by taking into account the known photoionization cross section of the atoms we found excellent agreement with data from classical absorption measurements. (orig.)

  5. Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf

    International Nuclear Information System (INIS)

    Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.

    1999-01-01

    A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society

  6. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  7. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Variation in yield ratios of fragment ions and of ion-pairs from CF2Cl2 following monochromatic soft X-ray absorption

    International Nuclear Information System (INIS)

    Suzuki, I.H.; Saito, N.; Bozek, J.D.

    1995-01-01

    Fragment ions produced from CF 2 Cl 2 have been measured from 44 to 1200eV using a time-of-flight mass spectrometer and monochromatized synchrotron radiation. Positively charged ion pairs from this molecule were observed in the inner-shell excitation regions using a Selected photoion-photoion coincidence technique. Obtained yield ratios of fragment ions indicate that the atomic chlorine ion, Cl + , has the greatest intensity at all photon energies above 60eV and exhibits a steep increase at the Cl L 2,3 -edges. Some fragment ions, in particular CF 2 + , have a clear intensity increase at the transitions of inner-shell electrons to unoccupied molecular orbitals. The ion pair F + - Cl + exhibits the highest yield at most photon energies, and some of the branching ratios for ion-pair production changed significantly near the Cl L 2,3 -edges. (author)

  9. Large scale meta-analysis of fragment-based screening campaigns: privileged fragments and complementary technologies.

    Science.gov (United States)

    Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir

    2015-06-01

    A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.

  10. Fragment profiling of low molecular weight heparins using reversed phase ion pair liquid chromatography-electrospray mass spectrometry.

    Science.gov (United States)

    Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli

    2015-04-30

    Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  12. Fragmentation, Fusion, and Genetic Homogeneity in a Calcareous Sponge (Porifera, Calcarea).

    Science.gov (United States)

    Padua, André; Leocorny, Pedro; Custódio, Márcio Reis; Klautau, Michelle

    2016-06-01

    Sessile marine invertebrates living on hard substrata usually present strategies such as size variations, longer life spans, fragmentation and fusion to occupy and compete for space. Calcareous sponges are usually small and short-lived, and some species are known to undergo frequent fragmentation and fusion events. However, whether fusion occurs only between genetically identical individuals remains unclear. We investigated the occurrence of chimaeras in the calcareous sponge Clathrina aurea by following the dynamics of fragmentation and fusion of 66 individuals in the field for up to 18 months and determined size variations and the life span of each individual. Microsatellites were used to determine whether fusion events occur among genetically different individuals. Growth and shrinkage of individuals were frequently observed, showing that size cannot be associated with age in C. aurea. The life span of the species ranged from 1 to 16 months (mean: 4.7 months). Short life spans and variable growth rates have been observed in other species of the class Calcarea. Fragmentation and fusion events were observed, but fusion events always occurred between genetically identical individuals, as has been suggested by graft experiments in adult Demospongiae and other Calcarea. These results suggest that at least C. aurea adults may have some mechanism to avoid chimaerism. © 2016 Wiley Periodicals, Inc.

  13. Complementary b/y fragment ion pairs from post-source decay of metastable YahO for calibration of MALDI-TOF-TOF-MS/MS

    Science.gov (United States)

    Complementary b/y fragment ion pairs from post-source decay (PSD) of metastable YahO protein ion were evaluated for use in the calibration of MALDI-TOF-TOF for tandem mass spectrometry (MS/MS). The yahO gene from pathogenic Escherichia coli O157:H7 strain EDL933 was cloned into a pBAD18 plasmid vect...

  14. Evolution of fragment-fragment correlations in reactions of 197Au and 107,109Ag with 40Ar from 7A to 34A MeV

    International Nuclear Information System (INIS)

    Ethvignot, T.; Ajitanand, N.N.; Alexander, J.M.; Bauge, E.; Elmaani, A.; Kowalski, L.; Lopez, M.; Magda, M.T.; Desesquelles, P.; Elhage, H.; Giorni, A.; Heuer, D.; Kox, S.; Lleres, A.; Merchez, F.; Morand, C.; Rebreyend, D.; Stassi, P.; Viano, J.B.; Benrachi, F.; Chambon, B.; Cheynis, B.; Drain, D.; Pastor, C.

    1992-01-01

    In-plane and out-of-plane angular correlations have been measured between fragments of Z>3, Li fragments, 3,4 He, and 1,2,3 H. The changing patterns for 40 Ar induced reactions of 7A, 17A, 27A, and 34A MeV give an overview of the decreasing importance of mass-symmetric fissionlike reactions at the expense of a broad range of more mass-asymmetric breakups. Evidence is given that these fragments come from a central collision group of reactions that have similar violence and from which many combinations of fragments and particles are ejected. Very similar azimuthal angular correlations are observed for particles with a Li fragment and for particles with a pair of heavier fragments (Z>3). This similarity suggests comparable strengths of association with the reaction plane for single Li fragments and for fragment pairs of Z>3. Azimuthal angular correlations for Li-Li pairs exhibit distinct asymmetries; their interpretation via trajectory-model calculations indicates mean delay times of ∼5x10 -22 s

  15. PEAR: a fast and accurate Illumina Paired-End reAd mergeR.

    Science.gov (United States)

    Zhang, Jiajie; Kobert, Kassian; Flouri, Tomáš; Stamatakis, Alexandros

    2014-03-01

    The Illumina paired-end sequencing technology can generate reads from both ends of target DNA fragments, which can subsequently be merged to increase the overall read length. There already exist tools for merging these paired-end reads when the target fragments are equally long. However, when fragment lengths vary and, in particular, when either the fragment size is shorter than a single-end read, or longer than twice the size of a single-end read, most state-of-the-art mergers fail to generate reliable results. Therefore, a robust tool is needed to merge paired-end reads that exhibit varying overlap lengths because of varying target fragment lengths. We present the PEAR software for merging raw Illumina paired-end reads from target fragments of varying length. The program evaluates all possible paired-end read overlaps and does not require the target fragment size as input. It also implements a statistical test for minimizing false-positive results. Tests on simulated and empirical data show that PEAR consistently generates highly accurate merged paired-end reads. A highly optimized implementation allows for merging millions of paired-end reads within a few minutes on a standard desktop computer. On multi-core architectures, the parallel version of PEAR shows linear speedups compared with the sequential version of PEAR. PEAR is implemented in C and uses POSIX threads. It is freely available at http://www.exelixis-lab.org/web/software/pear.

  16. Kinetics of fragmentation-annihilation processes

    OpenAIRE

    Filipe, JAN; Rodgers, GJ

    1996-01-01

    We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

  17. Update on a Solar Magnetic Catalog Spanning Four Solar Cycles

    Science.gov (United States)

    Vargas-Acosta, Juan Pablo; Munoz-Jaramillo, Andres; Vargas Dominguez, Santiago; Werginz, Zachary; DeLuca, Michael D.; Longcope, Dana; Harvey, J. W.; Windmueller, John; Zhang, Jie; Martens, Petrus C.

    2017-08-01

    Bipolar magnetic regions (BMRs) are the cornerstone of solar cycle propagation, the building blocks that give structure to the solar atmosphere, and the origin of the majority of space weather events. However, in spite of their importance, there is no homogeneous BMR catalog spanning the era of systematic solar magnetic field measurements. Here we present the results of an ongoing project to address this deficiency applying the Bipolar Active Region Detection (BARD) code to magnetograms from the 512 Channel of the Kitt Peak Vaccum Telescope, SOHO/MDI, and SDO/HMI.The BARD code automatically identifies BMRs and tracks them as they are rotated by differential rotation. The output of the automatic detection is supervised by a human observer to correct possible mistakes made by the automatic algorithm (like incorrect pairings and tracking mislabels). Extra passes are made to integrate fragmented regions as well as to balance the flux between BMR polarities. At the moment, our BMR database includes nearly 10,000 unique objects (detected and tracked) belonging to four separate solar cycles (21-24).

  18. Quark fragmentation functions in NJL-jet model

    Science.gov (United States)

    Bentz, Wolfgang; Matevosyan, Hrayr; Thomas, Anthony

    2014-09-01

    We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. We report on our studies of quark fragmentation functions in the Nambu-Jona-Lasinio (NJL) - jet model. The results of Monte-Carlo simulations for the fragmentation functions to mesons and nucleons, as well as to pion and kaon pairs (dihadron fragmentation functions) are presented. The important role of intermediate vector meson resonances for those semi-inclusive deep inelastic production processes is emphasized. Our studies are very relevant for the extraction of transverse momentum dependent quark distribution functions from measured scattering cross sections. Supported by Grant in Aid for Scientific Research, Japanese Ministry of Education, Culture, Sports, Science and Technology, Project No. 20168769.

  19. Scission configurations and their implication in fission-fragment angular momenta

    International Nuclear Information System (INIS)

    Bonneau, L.; Quentin, P.; Mikhailov, I. N.

    2007-01-01

    The generation of sizable angular momenta in fragments formed in low-energy nuclear fission is described microscopically within the general quantum-mechanical framework of orientation pumping due to the Heisenberg uncertainty principle. Within this framework, we make use of the results of Skyrme-Hartree-Fock plus BCS-pairing calculations of fragment deformabilities to deduce a distribution of fission-fragment spins as a function of the fragment total excitation energy. We consider a fragmentation corresponding to a pair of deformed fragments and for which fission data are available. The properties of the scission configurations determine to a large extent the fission-fragment spins. This is why we pay particular attention to quantitatively defining the scission configurations and to studying the various implications of such a specific choice. A fair qualitative agreement with data is demonstrated and discussed within the limits of the simple scission-configuration model used here

  20. Evolution equations for extended dihadron fragmentation functions

    International Nuclear Information System (INIS)

    Ceccopieri, F.A.; Bacchetta, A.

    2007-03-01

    We consider dihadron fragmentation functions, describing the fragmentation of a parton in two unpolarized hadrons, and in particular extended dihadron fragmentation functions, explicitly dependent on the invariant mass, M h , of the hadron pair. We first rederive the known results on M h -integrated functions using Jet Calculus techniques, and then we present the evolution equations for extended dihadron fragmentation functions. Our results are relevant for the analysis of experimental measurements of two-particle-inclusive processes at different energies. (orig.)

  1. Suture spanning augmentation of single-row rotator cuff repair: a biomechanical analysis.

    Science.gov (United States)

    Early, Nicholas A; Elias, John J; Lippitt, Steven B; Filipkowski, Danielle E; Pedowitz, Robert A; Ciccone, William J

    2017-02-01

    This in vitro study evaluated the biomechanical benefit of adding spanning sutures to single-row rotator cuff repair. Mechanical testing was performed to evaluate 9 pairs of cadaveric shoulders with complete rotator cuff repairs, with a single-row technique used on one side and the suture spanning technique on the other. The spanning technique included sutures from 2 lateral anchors securing tendon near the musculotendinous junction, spanning the same anchor placement from single-row repair. The supraspinatus muscle was loaded to 100 N at 0.25 Hz for 100 cycles, followed by a ramp to failure. Markers and a video tracking system measured anterior and posterior gap formation across the repair at 25-cycle intervals. The force at which the stiffness decreased by 50% and 75% was determined. Data were compared using paired t-tests. One single-row repair failed at row repairs than for the suture spanning technique. The difference was statistically significant at all cycles for the posterior gap formation (P ≤ .02). The trends were not significant for the anterior gap (P ≥ .13). The loads at which the stiffness decreased by 50% and 75% did not differ significantly between the 2 types of repair (P ≥ .10). The suture spanning technique primarily improved posterior gap formation. Decreased posterior gap formation could reduce failure rates for rotator cuff repair. Copyright © 2017 Journal of Shoulder and Elbow Surgery Board of Trustees. Published by Elsevier Inc. All rights reserved.

  2. Pairing correlations around scission

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    2001-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler-box potential with a δ-function diaphragm to mimic scission

  3. Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

    Science.gov (United States)

    Cao, Hu; Lu, Yonggang

    2017-01-01

    With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

  4. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  5. Comparison of jet fragmentation for isolated-photon+jet pairs in PbPb and pp collisions at $\\sqrt{s_{\\mathrm{NN}}} = 5.02~\\mathrm{TeV}$

    CERN Document Server

    CMS Collaboration

    2017-01-01

    Measurements of fragmentation functions for jets paired with an isolated photon in pp and, for the first time, PbPb collisions are presented. The analysis uses data from the CMS detector at the CERN LHC, with both systems at a nucleon-nucleon center-of-mass energy of $5.02\\,\\mathrm{TeV}$. Fragmentation functions are constructed using charged particles with transverse momentum $p_{\\mathrm{T}}^{\\mathrm{trk}} > 1\\,\\mathrm{GeV}/c$ inside jets with transverse momentum $p_{\\mathrm{T}}^{\\mathrm{jet}} > 30\\,\\mathrm{GeV}/c$ for events containing an isolated photon with $p_{\\mathrm{T}}^{\\gamma} > 60\\,\\mathrm{GeV}/c$. For central PbPb collisions, modifications of the jet fragmentation function with respect to that found for pp collisions are observed, while no significant differences are found in the 50\\% most peripheral collisions. The modifications seen in central events indicate an enhancement for particles at low $p_{\\mathrm{T}}$ and a depletion at high $p_{\\mathrm{T}}$, with a transition around $3\\,\\mathrm{GeV}/c$....

  6. Habitat fragmentation and its lasting impact on Earth’s ecosystems

    Science.gov (United States)

    Haddad, Nick M.; Brudvig, Lars A.; Clobert, Jean; Davies, Kendi F.; Gonzalez, Andrew; Holt, Robert D.; Lovejoy, Thomas E.; Sexton, Joseph O.; Austin, Mike P.; Collins, Cathy D.; Cook, William M.; Damschen, Ellen I.; Ewers, Robert M.; Foster, Bryan L.; Jenkins, Clinton N.; King, Andrew J.; Laurance, William F.; Levey, Douglas J.; Margules, Chris R.; Melbourne, Brett A.; Nicholls, A. O.; Orrock, John L.; Song, Dan-Xia; Townshend, John R.

    2015-01-01

    We conducted an analysis of global forest cover to reveal that 70% of remaining forest is within 1 km of the forest’s edge, subject to the degrading effects of fragmentation. A synthesis of fragmentation experiments spanning multiple biomes and scales, five continents, and 35 years demonstrates that habitat fragmentation reduces biodiversity by 13 to 75% and impairs key ecosystem functions by decreasing biomass and altering nutrient cycles. Effects are greatest in the smallest and most isolated fragments, and they magnify with the passage of time. These findings indicate an urgent need for conservation and restoration measures to improve landscape connectivity, which will reduce extinction rates and help maintain ecosystem services. PMID:26601154

  7. Role of the Band Gap for the Interaction Energy of Coadsorbed Fragments

    DEFF Research Database (Denmark)

    Castelli, Ivano Eligio; Man, Isabela-Costinela; Soriga, Stefan-Gabriel

    2017-01-01

    on semiconductors. We propose here a correlation between the cooperative interaction energy, i.e., the energy difference between the adsorption energies of coadsorbed electron donor–acceptor pair and isolated fragments and the band gap of the clean oxide surface. We demonstrate this effect for a number of oxides...... and donor–acceptor pairs and explain it with the shift in the Fermi level before and after the adsorption. The conclusion is that the adsorption of acceptor–donor pairs is considerably more favorable compared to unpaired fragments,and this energy difference is approximately equal to the value of the band...

  8. Dynamics of fragments and associated phenomena in heavy-ion collisions using a modified secondary algorithm

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Rohit [Department of Physics, Panjab University, Chandigarh-160014 (India)

    2016-05-06

    We discuss the stability of fragments identified by secondary algorithms used to construct fragments within quantum molecular dynamics model. For this purpose we employ three different algorithms for fragment identification. 1) The conventional minimum spanning tree (MST) method based on the spatial correlations, 2) an improved version of MST with additional binding energy constraints of cold nuclear matter, 3) and that of hot matter. We find significant role of thermal binding energies over cold matter binding energies. Significant role is observed for fragment multiplicities and stopping of fragments. Whereas insignificant effect is observed on fragment’s flow.

  9. Pairing correlations in a fissioning potential well

    International Nuclear Information System (INIS)

    Krappe, H.J.; Fadeev, S.

    1999-01-01

    To describe pairing correlations in a fissioning system one commonly projects the BCS wave function separately onto good particle numbers in each fragment in the exit channel, but only onto the total number of particles in the parent system. We propose to interpolate between these limiting situations by the generator-coordinate method with the particle-number difference between the nascent fragments as the generator coordinate. Model calculations are presented for the Hill-Wheeler box potential with a δ-function diaphragm to mimic scission

  10. Drell-Yan lepton pair photoproduction

    International Nuclear Information System (INIS)

    Badalyan, R.G.; Grabskij, V.O.; Matinyan, S.G.

    1989-01-01

    The study of photon structure functions by spectra of massive lepton pairs (M l + l - ≥ 2 GeV) in photon fragmentation region in γp-interactions at high energies is suggested. In calculations of Drell-Yan lepton pair inclusive spectra in γp-interactions for photon structure functions there are used results obtained within QCD, data on γγ-interactions in e + e - → e + e - X on colliders as well as results from the analysis of vector meson non-diffractive photoproduction at high energies. It is shown that there exists a sufficienly wide kinematic region over variables X l + l - and M l + l - , wherein photon structure functions can be studied by spectra of Grell-Yan lepton pairs in the processes of their photoproduction. 31 refs.; 6 figs.; 1 tab

  11. Extraction of Phrase-Structure Fragments with a Linear Average Time Tree-Kernel

    NARCIS (Netherlands)

    van Cranenburgh, Andreas

    2014-01-01

    We present an algorithm and implementation for extracting recurring fragments from treebanks. Using a tree-kernel method the largest common fragments are extracted from each pair of trees. The algorithm presented achieves a thirty-fold speedup over the previously available method on the Wall Street

  12. Fourier analysis of the cell shape of paired human urothelial cell lines of the same origin but of different grades of transformation.

    Science.gov (United States)

    Ostrowski, K; Dziedzic-Goclawska, A; Strojny, P; Grzesik, W; Kieler, J; Christensen, B; Mareel, M

    1986-01-01

    The rationale of the present investigation is the observations made by many authors of changes in the molecular structure of the cell surface during the multistep process of malignant transformation. These changes may influence cell-matrix and cell-cell interactions and thereby cause changes in cell adhesiveness and cell shape. The aim of the present work was to investigate whether the development of various grades of transformation in vivo and in vitro of human urothelial cells is accompanied by significant changes in cell shape as measured by Fourier analysis. The following transformation grades (TGr) have been defined (Christensen et al. 1984; Kieler 1984): TGr I = nonmalignant, mortal cell lines that grow independently of fibroblasts and have a prolonged life span. TGr II = nonmalignant cell lines with an infinite life span. TGr III = malignant and immortal cell lines that grow invasively in co-cultures with embryonic chick heart fragments and possess tumorigenic properties after s.c. injection into nude mice. Comparisons of 4 pairs of cell lines were performed; each pair was of the same origin. Two pairs--each including a TGr I cell line (Hu 961b and Hu 1703S) compared to a TGr III cell line (Hu 961a or Hu 1703He)--were derived from two transitional cell carcinomas (TCC) containing a heterogeneous cell population. Two additional cell lines classified as TGr II (HCV-29 and Hu 609) were compared to two TGr III sublines (HCV-29T and Hu 609T, respectively) which arose by "spontaneous" transformation during propagation in vitro of the respective maternal TGr II-cell lines.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  14. Recursive model for the fragmentation of polarized quarks

    Science.gov (United States)

    Kerbizi, A.; Artru, X.; Belghobsi, Z.; Bradamante, F.; Martin, A.

    2018-04-01

    We present a model for Monte Carlo simulation of the fragmentation of a polarized quark. The model is based on string dynamics and the 3P0 mechanism of quark pair creation at string breaking. The fragmentation is treated as a recursive process, where the splitting function of the subprocess q →h +q' depends on the spin density matrix of the quark q . The 3P0 mechanism is parametrized by a complex mass parameter μ , the imaginary part of which is responsible for single spin asymmetries. The model has been implemented in a Monte Carlo program to simulate jets made of pseudoscalar mesons. Results for single hadron and hadron pair transverse-spin asymmetries are found to be in agreement with experimental data from SIDIS and e+e- annihilation. The model predictions on the jet-handedness are also discussed.

  15. Kinematics of current region fragmentation in semi-inclusive deeply inelastic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Boglione, M., E-mail: elena.boglione@to.infn.it [Dipartimento di Fisica, Università di Torino, INFN - Sezione Torino, Via P. Giuria 1, 10125 Torino (Italy); Collins, J., E-mail: jcc8@psu.edu [Department of Physics, Penn State University, University Park, PA 16802 (United States); Gamberg, L., E-mail: lpg10@psu.edu [Science Division, Penn State University Berks, Reading, PA 19610 (United States); Gonzalez-Hernandez, J.O., E-mail: jogh@jlab.org [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Rogers, T.C., E-mail: trogers@odu.edu [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Sato, N., E-mail: nsato@jlab.org [Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States)

    2017-03-10

    Different kinematical regions of semi-inclusive deeply inelastic scattering (SIDIS) processes correspond to different underlying partonic pictures, and it is important to understand the transition between them. We find criteria in semi-inclusive deeply inelastic scattering (SIDIS) for identifying the current fragmentation region — the kinematical region where a factorization picture with fragmentation functions is appropriate, especially for studies of transverse-momentum-dependent (TMD) functions. This region is distinguished from the central (soft) and target fragmentation regions. The basis of our argument is in the errors in approximations used in deriving factorization. As compared with previous work, we show that it is essential to take account of the transverse momentum of the detected hadron, and we find a much more restricted range for genuine current fragmentation. We show that it is important to develop an extended factorization formulation to treat hadronization in the central region, as well as the current and target fragmentation regions, and to obtain a unified formalism spanning all rapidities for the detected hadron.

  16. Multiplicity distributions in the binary fragmenting with inhibition at the transition line

    Energy Technology Data Exchange (ETDEWEB)

    Botet, R. [Paris-11 Univ., 91 - Orsay (France); Ploszajczak, M. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France)

    1996-03-01

    Properties of the fragment multiplicity distribution obtained in the sequential binary fragmentation process at the transition line are investigated. It is shown that the multifragment cumulant correlation functions have the hierarchical, linked-pair structure. Several distinct classes of multiplicity domains are clearly identified, and the asymptotic appearance of the Koba - Nielsen - Olesen scaling is discussed. (author). 36 refs.

  17. Multiplicity distributions in the binary fragmenting with inhibition at the transition line

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1996-03-01

    Properties of the fragment multiplicity distribution obtained in the sequential binary fragmentation process at the transition line are investigated. It is shown that the multifragment cumulant correlation functions have the hierarchical, linked-pair structure. Several distinct classes of multiplicity domains are clearly identified, and the asymptotic appearance of the Koba - Nielsen - Olesen scaling is discussed. (author)

  18. Restoring speech perception with cochlear implants by spanning defective electrode contacts.

    Science.gov (United States)

    Frijns, Johan H M; Snel-Bongers, Jorien; Vellinga, Dirk; Schrage, Erik; Vanpoucke, Filiep J; Briaire, Jeroen J

    2013-04-01

    Even with six defective contacts, spanning can largely restore speech perception with the HiRes 120 speech processing strategy to the level supported by an intact electrode array. Moreover, the sound quality is not degraded. Previous studies have demonstrated reduced speech perception scores (SPS) with defective contacts in HiRes 120. This study investigated whether replacing defective contacts by spanning, i.e. current steering on non-adjacent contacts, is able to restore speech recognition to the level supported by an intact electrode array. Ten adult cochlear implant recipients (HiRes90K, HiFocus1J) with experience with HiRes 120 participated in this study. Three different defective electrode arrays were simulated (six separate defective contacts, three pairs or two triplets). The participants received three take-home strategies and were asked to evaluate the sound quality in five predefined listening conditions. After 3 weeks, SPS were evaluated with monosyllabic words in quiet and in speech-shaped background noise. The participants rated the sound quality equal for all take-home strategies. SPS with background noise were equal for all conditions tested. However, SPS in quiet (85% phonemes correct on average with the full array) decreased significantly with increasing spanning distance, with a 3% decrease for each spanned contact.

  19. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  20. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    Science.gov (United States)

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  1. Lagrangian statistics of particle pairs in homogeneous isotropic turbulence

    NARCIS (Netherlands)

    Biferale, L.; Boffeta, G.; Celani, A.; Devenish, B.J.; Lanotte, A.; Toschi, F.

    2005-01-01

    We present a detailed investigation of the particle pair separation process in homogeneous isotropic turbulence. We use data from direct numerical simulations up to R????280 following the evolution of about two million passive tracers advected by the flow over a time span of about three decades. We

  2. Reconstruction of Banknote Fragments Based on Keypoint Matching Method.

    Science.gov (United States)

    Gwo, Chih-Ying; Wei, Chia-Hung; Li, Yue; Chiu, Nan-Hsing

    2015-07-01

    Banknotes may be shredded by a scrap machine, ripped up by hand, or damaged in accidents. This study proposes an image registration method for reconstruction of multiple sheets of banknotes. The proposed method first constructs different scale spaces to identify keypoints in the underlying banknote fragments. Next, the features of those keypoints are extracted to represent their local patterns around keypoints. Then, similarity is computed to find the keypoint pairs between the fragment and the reference banknote. The banknote fragments can determine the coordinate and amend the orientation. Finally, an assembly strategy is proposed to piece multiple sheets of banknote fragments together. Experimental results show that the proposed method causes, on average, a deviation of 0.12457 ± 0.12810° for each fragment while the SIFT method deviates 1.16893 ± 2.35254° on average. The proposed method not only reconstructs the banknotes but also decreases the computing cost. Furthermore, the proposed method can estimate relatively precisely the orientation of the banknote fragments to assemble. © 2015 American Academy of Forensic Sciences.

  3. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  4. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  5. Quark fragmentation function and the nonlinear chiral quark model

    International Nuclear Information System (INIS)

    Zhu, Z.K.

    1993-01-01

    The scaling law of the fragmentation function has been proved in this paper. With that, we show that low-P T quark fragmentation function can be studied as a low energy physocs in the light-cone coordinate frame. We therefore use the nonlinear chiral quark model which is able to study the low energy physics under scale Λ CSB to study such a function. Meanwhile the formalism for studying the quark fragmentation function has been established. The nonlinear chiral quark model is quantized on the light-front. We then use old-fashioned perturbation theory to study the quark fragmentation function. Our first order result for such a function shows in agreement with the phenomenological model study of e + e - jet. The probability for u,d pair formation in the e + e - jet from our calculation is also in agreement with the phenomenological model results

  6. Emotional Egocentricity Bias across the life-span

    Directory of Open Access Journals (Sweden)

    Federica eRiva

    2016-04-01

    Full Text Available In our daily lives, we often have to quickly estimate the emotions of our conspecifics in order to have successful social interactions. While this estimation process seems quite easy when we are ourselves in a neutral or equivalent emotional state, it has recently been shown that in case of incongruent emotional states between ourselves and the others, our judgments can be biased. This phenomenon, introduced to the literature with the term Emotional Egocentricity Bias (EEB, has been found to occur in young adults and, to a greater extent, in children. However, how EEB changes across the life-span from adolescence to old age has been largely unexplored. In this study, we recruited 114 female participants subdivided in four cohorts (adolescents, young adults, middle-aged adults, older adults to examine EEB age-related changes. Participants were administered with a paradigm which, by making use of visuo-tactile stimulation that elicits conflicting feelings in paired participants, allows the valid and reliable exploration of EEB. Results highlighted a U-shaped relation between age and EEB, revealing higher emotional egocentricity in adolescents and older adults compared to young and middle-aged adults. These results are in line with the neuroscientific literature which has recently shown that overcoming EEB is associated with a greater activation of a portion of the parietal lobe, namely the right Supramarginal Gyrus (rSMG. This is an area that reaches full maturation only by the end of adolescence, and displays an early decay in older age. Thus, the age-related changes of the EEB could be possibly due to the life-span development of the rSMG. This study is the first one to show the quadratic relation between age and the EEB and set a milestone for further research exploring the neural correlates of the life-span development of the EEB. Future studies are needed in order to generalize these results to the male population and to explore gender

  7. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael

    2009-01-01

    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  8. Direct determination of recoil ion detection efficiency for coincidence time-of-flight studies of molecular fragmentation

    International Nuclear Information System (INIS)

    Ben-Itzhak, I.; Carnes, K.D.; Ginther, S.G.; Johnson, D.T.; Norris, P.J.; Weaver, O.L.

    1993-01-01

    Molecular fragmentation of diatomic and small polyatomic molecules caused by fast ion impact has been studied. The evaluation of the cross sections of the different fragmentation channels depends strongly on the recoil ion detection efficiency, ε r (single ions proportional to ε r , and ion pairs to ε 2 r , etc.). A method is suggested for the direct determination of this detection efficiency. This method is based on the fact that fast H + + CH 4 collisions produce C 2+ fragments only in coincidence with H + and H + 2 fragments, that is, there is a negligible number of C 2+ singles, if any. The measured yield of C 2+ singles is therefore due to events in which the H + m of the H + m + C 2+ ion pair was not detected and thus is proportional to 1 - ε r . Methane fragmentation caused by 1 MeV proton impact is used to evaluate directly the recoil ion detection efficiency and to demonstrate the method of deriving the cross sections of all breakup channels. (orig.)

  9. Span of control matters.

    Science.gov (United States)

    Cathcart, Deb; Jeska, Susan; Karnas, Joan; Miller, Sue E; Pechacek, Judy; Rheault, Lolita

    2004-09-01

    Prompted by manager concerns about span of control, a large, integrated health system set out to determine if span of control really mattered. Was there something to it, or was it just an excuse for poor performance? A team of middle managers studied the problem and ultimately demonstrated a strong relationship between span of control and employee engagement. Consequently, it was decided to add 4 management positions to note the effect. One year later, positive changes were observed in employee engagement scores in all 4 areas. This study suggests careful review of manager spans of control to address the untoward effects of large spans of control on employee engagement.

  10. Does tropical forest fragmentation increase long-term variability of butterfly communities?

    Directory of Open Access Journals (Sweden)

    Allison K Leidner

    2010-03-01

    Full Text Available Habitat fragmentation is a major driver of biodiversity loss. Yet, the overall effects of fragmentation on biodiversity may be obscured by differences in responses among species. These opposing responses to fragmentation may be manifest in higher variability in species richness and abundance (termed hyperdynamism, and in predictable changes in community composition. We tested whether forest fragmentation causes long-term hyperdynamism in butterfly communities, a taxon that naturally displays large variations in species richness and community composition. Using a dataset from an experimentally fragmented landscape in the central Amazon that spanned 11 years, we evaluated the effect of fragmentation on changes in species richness and community composition through time. Overall, adjusted species richness (adjusted for survey duration did not differ between fragmented forest and intact forest. However, spatial and temporal variation of adjusted species richness was significantly higher in fragmented forests relative to intact forest. This variation was associated with changes in butterfly community composition, specifically lower proportions of understory shade species and higher proportions of edge species in fragmented forest. Analysis of rarefied species richness, estimated using indices of butterfly abundance, showed no differences between fragmented and intact forest plots in spatial or temporal variation. These results do not contradict the results from adjusted species richness, but rather suggest that higher variability in butterfly adjusted species richness may be explained by changes in butterfly abundance. Combined, these results indicate that butterfly communities in fragmented tropical forests are more variable than in intact forest, and that the natural variability of butterflies was not a buffer against the effects of fragmentation on community dynamics.

  11. Does Tropical Forest Fragmentation Increase Long-Term Variability of Butterfly Communities?

    Science.gov (United States)

    Leidner, Allison K.; Haddad, Nick M.; Lovejoy, Thomas E.

    2010-01-01

    Habitat fragmentation is a major driver of biodiversity loss. Yet, the overall effects of fragmentation on biodiversity may be obscured by differences in responses among species. These opposing responses to fragmentation may be manifest in higher variability in species richness and abundance (termed hyperdynamism), and in predictable changes in community composition. We tested whether forest fragmentation causes long-term hyperdynamism in butterfly communities, a taxon that naturally displays large variations in species richness and community composition. Using a dataset from an experimentally fragmented landscape in the central Amazon that spanned 11 years, we evaluated the effect of fragmentation on changes in species richness and community composition through time. Overall, adjusted species richness (adjusted for survey duration) did not differ between fragmented forest and intact forest. However, spatial and temporal variation of adjusted species richness was significantly higher in fragmented forests relative to intact forest. This variation was associated with changes in butterfly community composition, specifically lower proportions of understory shade species and higher proportions of edge species in fragmented forest. Analysis of rarefied species richness, estimated using indices of butterfly abundance, showed no differences between fragmented and intact forest plots in spatial or temporal variation. These results do not contradict the results from adjusted species richness, but rather suggest that higher variability in butterfly adjusted species richness may be explained by changes in butterfly abundance. Combined, these results indicate that butterfly communities in fragmented tropical forests are more variable than in intact forest, and that the natural variability of butterflies was not a buffer against the effects of fragmentation on community dynamics. PMID:20224772

  12. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  13. A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library.

    Science.gov (United States)

    Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S

    2018-04-01

    Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

  14. Comparison and combination of "direct" and fragment based local correlation methods: Cluster in molecules and domain based local pair natural orbital perturbation and coupled cluster theories

    Science.gov (United States)

    Guo, Yang; Becker, Ute; Neese, Frank

    2018-03-01

    Local correlation theories have been developed in two main flavors: (1) "direct" local correlation methods apply local approximation to the canonical equations and (2) fragment based methods reconstruct the correlation energy from a series of smaller calculations on subsystems. The present work serves two purposes. First, we investigate the relative efficiencies of the two approaches using the domain-based local pair natural orbital (DLPNO) approach as the "direct" method and the cluster in molecule (CIM) approach as the fragment based approach. Both approaches are applied in conjunction with second-order many-body perturbation theory (MP2) as well as coupled-cluster theory with single-, double- and perturbative triple excitations [CCSD(T)]. Second, we have investigated the possible merits of combining the two approaches by performing CIM calculations with DLPNO methods serving as the method of choice for performing the subsystem calculations. Our cluster-in-molecule approach is closely related to but slightly deviates from approaches in the literature since we have avoided real space cutoffs. Moreover, the neglected distant pair correlations in the previous CIM approach are considered approximately. Six very large molecules (503-2380 atoms) were studied. At both MP2 and CCSD(T) levels of theory, the CIM and DLPNO methods show similar efficiency. However, DLPNO methods are more accurate for 3-dimensional systems. While we have found only little incentive for the combination of CIM with DLPNO-MP2, the situation is different for CIM-DLPNO-CCSD(T). This combination is attractive because (1) the better parallelization opportunities offered by CIM; (2) the methodology is less memory intensive than the genuine DLPNO-CCSD(T) method and, hence, allows for large calculations on more modest hardware; and (3) the methodology is applicable and efficient in the frequently met cases, where the largest subsystem calculation is too large for the canonical CCSD(T) method.

  15. Fragmentation functions of polarized heavy quarkonium

    International Nuclear Information System (INIS)

    Ma, Yan-Qing; Qiu, Jian-Wei; Zhang, Hong

    2015-01-01

    Investigating the production of polarized heavy quarkonia in terms of recently proposed QCD factorization formalism requires the knowledge of a large number of input fragmentation functions (FFs) from a single parton or a heavy quark-antiquark pair to a polarized heavy quarkonium. We study these universal FFs at the input factorization scale μ 0 ≳2m Q , with heavy quark mass m Q , in the framework of nonrelativistic QCD (NRQCD) factorization. We express these FFs in terms of perturbatively calculable coefficients for producing a heavy quark-antiquark pair in all possible NRQCD states, multiplied by corresponding NRQCD long-distance matrix elements for the pair to transmute into a polarized heavy quarkonium. We derive all relevant NRQCD operators for the long-distance matrix elements based on symmetries, and introduce a self-consistent scheme to define them in arbitrary d-dimensions. We compute, up to the first non-trivial order in α s , the perturbative coefficients for producing a heavy quark pair in all possible S-wave and P-wave NRQCD states. We also discuss the role of the polarized FFs in generating QCD predictions for the polarization of J/ψ produced at collider energies.

  16. Associative-memory representations emerge as shared spatial patterns of theta activity spanning the primate temporal cortex.

    Science.gov (United States)

    Nakahara, Kiyoshi; Adachi, Ken; Kawasaki, Keisuke; Matsuo, Takeshi; Sawahata, Hirohito; Majima, Kei; Takeda, Masaki; Sugiyama, Sayaka; Nakata, Ryota; Iijima, Atsuhiko; Tanigawa, Hisashi; Suzuki, Takafumi; Kamitani, Yukiyasu; Hasegawa, Isao

    2016-06-10

    Highly localized neuronal spikes in primate temporal cortex can encode associative memory; however, whether memory formation involves area-wide reorganization of ensemble activity, which often accompanies rhythmicity, or just local microcircuit-level plasticity, remains elusive. Using high-density electrocorticography, we capture local-field potentials spanning the monkey temporal lobes, and show that the visual pair-association (PA) memory is encoded in spatial patterns of theta activity in areas TE, 36, and, partially, in the parahippocampal cortex, but not in the entorhinal cortex. The theta patterns elicited by learned paired associates are distinct between pairs, but similar within pairs. This pattern similarity, emerging through novel PA learning, allows a machine-learning decoder trained on theta patterns elicited by a particular visual item to correctly predict the identity of those elicited by its paired associate. Our results suggest that the formation and sharing of widespread cortical theta patterns via learning-induced reorganization are involved in the mechanisms of associative memory representation.

  17. Strong Neutron Pairing in core+4n Nuclei.

    Science.gov (United States)

    Revel, A; Marqués, F M; Sorlin, O; Aumann, T; Caesar, C; Holl, M; Panin, V; Vandebrouck, M; Wamers, F; Alvarez-Pol, H; Atar, L; Avdeichikov, V; Beceiro-Novo, S; Bemmerer, D; Benlliure, J; Bertulani, C A; Boillos, J M; Boretzky, K; Borge, M J G; Caamaño, M; Casarejos, E; Catford, W N; Cederkäll, J; Chartier, M; Chulkov, L; Cortina-Gil, D; Cravo, E; Crespo, R; Datta Pramanik, U; Díaz Fernández, P; Dillmann, I; Elekes, Z; Enders, J; Ershova, O; Estradé, A; Farinon, F; Fraile, L M; Freer, M; Galaviz, D; Geissel, H; Gernhäuser, R; Golubev, P; Göbel, K; Hagdahl, J; Heftrich, T; Heil, M; Heine, M; Heinz, A; Henriques, A; Ignatov, A; Johansson, H T; Jonson, B; Kahlbow, J; Kalantar-Nayestanaki, N; Kanungo, R; Kelic-Heil, A; Knyazev, A; Kröll, T; Kurz, N; Labiche, M; Langer, C; Le Bleis, T; Lemmon, R; Lindberg, S; Machado, J; Marganiec, J; Movsesyan, A; Nacher, E; Najafi, M; Nilsson, T; Nociforo, C; Paschalis, S; Perea, A; Petri, M; Pietri, S; Plag, R; Reifarth, R; Ribeiro, G; Rigollet, C; Röder, M; Rossi, D; Savran, D; Scheit, H; Simon, H; Syndikus, I; Taylor, J T; Tengblad, O; Thies, R; Togano, Y; Velho, P; Volkov, V; Wagner, A; Weick, H; Wheldon, C; Wilson, G; Winfield, J S; Woods, P; Yakorev, D; Zhukov, M; Zilges, A; Zuber, K

    2018-04-13

    The emission of neutron pairs from the neutron-rich N=12 isotones ^{18}C and ^{20}O has been studied by high-energy nucleon knockout from ^{19}N and ^{21}O secondary beams, populating unbound states of the two isotones up to 15 MeV above their two-neutron emission thresholds. The analysis of triple fragment-n-n correlations shows that the decay ^{19}N(-1p)^{18}C^{*}→^{16}C+n+n is clearly dominated by direct pair emission. The two-neutron correlation strength, the largest ever observed, suggests the predominance of a ^{14}C core surrounded by four valence neutrons arranged in strongly correlated pairs. On the other hand, a significant competition of a sequential branch is found in the decay ^{21}O(-1n)^{20}O^{*}→^{18}O+n+n, attributed to its formation through the knockout of a deeply bound neutron that breaks the ^{16}O core and reduces the number of pairs.

  18. Boundary Spanning

    DEFF Research Database (Denmark)

    Zølner, Mette

    The paper explores how locals span boundaries between corporate and local levels. The aim is to better comprehend potentialities and challenges when MNCs draws on locals’ culture specific knowledge. The study is based on an in-depth, interpretive case study of boundary spanning by local actors in...... approach with pattern matching is a way to shed light on the tacit local knowledge that organizational actors cannot articulate and that an exclusively inductive research is not likely to unveil....

  19. Long Span Bridges in Scandinavia

    DEFF Research Database (Denmark)

    Gimsing, Niels Jørgen

    1998-01-01

    The first Scandinavian bridge with a span of more than 500 m was the Lillebælt Suspension Bridge opened to traffic in 1970.Art the end of the 20th century the longest span of any European bridge is found in the Storebælt East Bridge with a main span of 1624 m. Also the third longest span in Europe...... is found in Scandinavia - the 1210 m span of the Höga Kusten Bridge in Sweden.The Kvarnsund Bridge in Norway was at the completion in 1991 the longest cable-stayed bridge in the world, and the span of 530 m is still thge longest for cable-stayed bridges in concrete. The Øresund Bridge with its sapn of 490...

  20. Age of Onset in Concordant Twins and Other Relative Pairs With Multiple Sclerosis

    OpenAIRE

    Sadovnick, A. Dessa; Yee, Irene M.; Guimond, Colleen; Reis, Jacques; Dyment, David A.; Ebers, George C.

    2009-01-01

    The ages of onset in multiple sclerosis cases span more than 7 decades. Data are presented for affected relative pairs from a Canadian population base of 30,000 multiple sclerosis index cases (1993?2008). The effects of genetic sharing, parent of origin, intergenerational versus collinear differences, and gender on the ages of onset were evaluated in the following concordant pairs: monozygotic twins (n?=?29), dizygotic twins (n?=?10), siblings (n?=?614), first cousins (n?=?405), half siblings...

  1. Life-Span Development of Visual Working Memory: When is Feature Binding Difficult?

    OpenAIRE

    Cowan, Nelson; Naveh-Benjamin, Moshe; Kilb, Angela; Saults, J. Scott

    2006-01-01

    We asked whether the ability to keep in working memory the binding between a visual object and its spatial location changes with development across the life span more than memory for item information. Paired arrays of colored squares were identical or differed in the color of one square and, in the latter case, the changed color was unique on that trial (item change) or was duplicated elsewhere in the array (color-location binding change). Children (8–10 and 11–12 years old) and older adults ...

  2. Recoil effects in multiphoton electron-positron pair creation

    International Nuclear Information System (INIS)

    Krajewska, K.; Kaminski, J. Z.

    2010-01-01

    Triply differential probability rates for electron-positron pair creation in laser-nucleus collisions, calculated within the S-matrix approach, are investigated as functions of the nuclear recoil. Pronounced enhancements of differential probability rates of multiphoton pair production are found for a nonzero momentum transfer from the colliding nucleus. The corresponding rates show a very dramatic dependence on the polarization of the laser field impinging on the nucleus; only for a linearly polarized light are the multiphoton rates for electron-positron pair production considerably large. We focus therefore on this case. Our numerical results for different geometries of the reaction particles demonstrate that, for the linearly polarized laser field of an infinite extent (which is a good approximation for femtosecond laser pulses), the pair creation is far more efficient if the nucleus is detected in the direction of the laser-field propagation. The corresponding angular distributions of the created particles show that the high-energy pairs are predominantly produced in the plane spanned by the polarization vector and the laser-field propagation direction, while the low-energy pairs are rather spread around the latter of the two directions. The enhancement of differential probability rates at each energy sector, defined by the four-momentum conservation relation, is observed with varying the energy of the produced particles. The total probability rates of pair production are also evaluated and compared with the corresponding results for the case when one disregards the recoil effect. A tremendous enhancement of the total probability rates of the electron-positron pair creation is observed if one takes into account the nuclear recoil.

  3. Angular distributions of light projectile fragments in deep inelastic Pb+Em interactions at 160 A GeV

    CERN Document Server

    Adamovich, M I; Alexandrov, Yu A; Andreeva, N P; Badyal, S K; Basova, E E; Bhalla, K B; Bhasin, A; Bhatia, V S; Bradnova, V; Bubnov, V I; Cai, X; Chasnikov, I Yu; Chen, G M; Chernova, L P; Chernyavsky, M M; Dhamija, S; El-Chenawi, K F; Felea, D; Feng, S Q; Gaitinov, A S; Ganssauge, E R; Garpman, S I A; Gerassimov, S G; Gheata, A; Gheata, M; Grote, J; Gulamov, K G; Sen-Gupta, S K; Gupta, V K; Henjes, U; Jakobsson, B; Kanygina, E K; Karabova, M; Kharlamov, S P; Kovalenko, A D; Krasnov, S A; Kumar, V; Larionova, V G; Lepekhin, F G; Levitskaya, O V; Li, Y X; Liu, L S; Lokanathan, S; Lord, J J; Lukicheva, N S; Lu, Y; Luo, S B; Mangotra, L K; Manhas, I; Mittra, I S; Musaeva, A K; Nasyrov, S Z; Navotny, V S; Nystrand, J; Otterlund, I; Peresadko, N G; Qian, W Y; Qin, Y M; Raniwala, R; Rao, N K; Röper, M D; Rusakova, V V; Saidkhanov, N; Salmanova, N A; Seitimbetov, A M; Seliverstov, D M; Simonov, B B; Sethi, R; Singh, B; Skelding, D; Söderström, K; Stenlund, E; Svechnikova, L N; Svensson, T; Tawfik, A M; Tothova, M; Tretyakova, M I; Trofimova, T P; Tuleeva, U I; Vashisht, V; Vokal, S; Vrláková, J; Wang, H Q; Wang, X R; Weng, Z Q; Wilkes, R J; Yang, C B; Yin, Z B; Yu, L Z; Zhang, D H; Zheng, P Y; Zhokhova, S I; Zhou, D C

    1999-01-01

    The nuclear emulsion was exposed at CERN by the lead projectile at 160 A GeV. The angles between any pair of fragments with Z=2-4 have been measured in the emulsion plane for the events which did not contain heavy fragments. The constant characterizing the normal angle ( phi ) distribution of the fragment momentum projection onto the emulsion plane with respect to initial projectile momentum p/sub 0/ is found to be sigma /sub phi /=(0.37+or-0.02) mrad. Corresponding value sigma /sub 0/=(121+or-6) MeV/c of nucleon momentum distribution in the lead nucleus coincides with that expected from Fermi momentum distribution for this nucleus. The peak in the pair-angle distribution of double-charged fragments, /sup 8/Be to 2 alpha , is presented for the region of small angles (<0.1 mrad). The fraction of alpha -particles coming from the decay of the ground state /sup 8/Be is found to be (13+or-2)601130f their whole number. (14 refs).

  4. An Efficient Genome Fragment Assembling Using GA with Neighborhood Aware Fitness Function

    Directory of Open Access Journals (Sweden)

    Satoko Kikuchi

    2012-01-01

    Full Text Available To decode a long genome sequence, shotgun sequencing is the state-of-the-art technique. It needs to properly sequence a very large number, sometimes as large as millions, of short partially readable strings (fragments. Arranging those fragments in correct sequence is known as fragment assembling, which is an NP-problem. Presently used methods require enormous computational cost. In this work, we have shown how our modified genetic algorithm (GA could solve this problem efficiently. In the proposed GA, the length of the chromosome, which represents the volume of the search space, is reduced with advancing generations, and thereby improves search efficiency. We also introduced a greedy mutation, by swapping nearby fragments using some heuristics, to improve the fitness of chromosomes. We compared results with Parsons’ algorithm which is based on GA too. We used fragments with partial reads on both sides, mimicking fragments in real genome assembling process. In Parsons’ work base-pair array of the whole fragment is known. Even then, we could obtain much better results, and we succeeded in restructuring contigs covering 100% of the genome sequences.

  5. A new crystal structure fragment-based pharmacophore method for G protein-coupled receptors

    DEFF Research Database (Denmark)

    Fidom, Kimberley; Isberg, Vignir; Hauser, Alexander Sebastian

    2015-01-01

    and receptor residue pairs, from crystal structure complexes. We describe the procedure to collect a library with more than 250 fragments covering 29 residue positions within the generic transmembrane binding pocket. We describe how the library fragments are recombined and inferred to build pharmacophores...... for new targets. A validating retrospective virtual screening of histamine H1 and H3 receptor pharmacophores yielded area-under-the-curves of 0.88 and 0.82, respectively. The fragment-based method has the unique advantage that it can be applied to targets for which no (homologous) crystal structures...... or ligands are known. 47% of the class A G protein-coupled receptors can be targeted with at least four-element pharmacophores. The fragment libraries can also be used to grow known ligands or for rotamer refinement of homology models. Researchers can download the complete fragment library or a subset...

  6. Analysis of Food Pairing in Regional Cuisines of India

    Science.gov (United States)

    Bagler, Ganesh

    2015-01-01

    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food. PMID:26430895

  7. Analysis of Food Pairing in Regional Cuisines of India.

    Science.gov (United States)

    Jain, Anupam; N K, Rakhi; Bagler, Ganesh

    2015-01-01

    Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

  8. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Advance features in the SPAN and SPAN/XRF gamma ray and X ray spectrum analysis software

    International Nuclear Information System (INIS)

    Wang Liyu

    1998-01-01

    This paper describes the advanced techniques, integral peak background, experimental peak shape and complex peak shape, which have been used successfully in the software packages SPAN and SPAN/XRF to process gamma ray and X ray spectra from HPGe and Si(Li) detector. Main features of SPAN and SPAN/XRF are also described. The software runs on PC and has convenient graphical capabilities and a powerful user interface. (author)

  10. The fragmentation of proto-globular clusters. I. Thermal instabilities

    International Nuclear Information System (INIS)

    Murray, S.D.; Lin, D.N.C.

    1989-01-01

    The metal abundances among the stars within a typical globular cluster are remarkably homogeneous. This indicates that star formation in these systems was a globally coordinated event which occurred over a time span less than or comparable to the collapse time scale of the cluster. This issue is addressed by assuming that the fragmentation of a proto-globular cluster cloud proceeded in two steps. In the first step, thermal instability led to the rapid growth of initial fluctuations. This led to a large contrast in the dynamical time scales between the perturbations and the parent cloud, and the perturbations then underwent gravitational instabilities on short time scales. This process is modeled using one-dimensional hydrodynamic simulations of clouds both with and without external heat sources and self-gravity. The models include the effects of a non-equilibrium H2 abundance. The results indicate that fragmentation can occur on time scales significantly less than the dynamical time scale of the parent cloud. 21 refs

  11. The Old Saxon Leipzig "Heliand" Manuscript Fragment (MS L): New Evidence Concerning Luther, the Poet, and Ottonian Heritage

    Science.gov (United States)

    Price, Timothy Blaine

    2010-01-01

    Begun as an investigation of the linguistic and paleographic evidence on the Old Saxon Leipzig "Heliand" fragment, the dissertation encompasses three analyses spanning over a millennium of that manuscript's existence. First, a direct analysis clarifies errors in the published transcription (4.2). The corrections result from digital…

  12. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  13. Long span DNA paired-end-tag (DNA-PET sequencing strategy for the interrogation of genomic structural mutations and fusion-point-guided reconstruction of amplicons.

    Directory of Open Access Journals (Sweden)

    Fei Yao

    Full Text Available Structural variations (SVs contribute significantly to the variability of the human genome and extensive genomic rearrangements are a hallmark of cancer. While genomic DNA paired-end-tag (DNA-PET sequencing is an attractive approach to identify genomic SVs, the current application of PET sequencing with short insert size DNA can be insufficient for the comprehensive mapping of SVs in low complexity and repeat-rich genomic regions. We employed a recently developed procedure to generate PET sequencing data using large DNA inserts of 10-20 kb and compared their characteristics with short insert (1 kb libraries for their ability to identify SVs. Our results suggest that although short insert libraries bear an advantage in identifying small deletions, they do not provide significantly better breakpoint resolution. In contrast, large inserts are superior to short inserts in providing higher physical genome coverage for the same sequencing cost and achieve greater sensitivity, in practice, for the identification of several classes of SVs, such as copy number neutral and complex events. Furthermore, our results confirm that large insert libraries allow for the identification of SVs within repetitive sequences, which cannot be spanned by short inserts. This provides a key advantage in studying rearrangements in cancer, and we show how it can be used in a fusion-point-guided-concatenation algorithm to study focally amplified regions in cancer.

  14. Analysis of Food Pairing in Regional Cuisines of India.

    Directory of Open Access Journals (Sweden)

    Anupam Jain

    Full Text Available Any national cuisine is a sum total of its variety of regional cuisines, which are the cultural and historical identifiers of their respective regions. India is home to a number of regional cuisines that showcase its culinary diversity. Here, we study recipes from eight different regional cuisines of India spanning various geographies and climates. We investigate the phenomenon of food pairing which examines compatibility of two ingredients in a recipe in terms of their shared flavor compounds. Food pairing was enumerated at the level of cuisine, recipes as well as ingredient pairs by quantifying flavor sharing between pairs of ingredients. Our results indicate that each regional cuisine follows negative food pairing pattern; more the extent of flavor sharing between two ingredients, lesser their co-occurrence in that cuisine. We find that frequency of ingredient usage is central in rendering the characteristic food pairing in each of these cuisines. Spice and dairy emerged as the most significant ingredient classes responsible for the biased pattern of food pairing. Interestingly while individual spices contribute to negative food pairing, dairy products on the other hand tend to deviate food pairing towards positive side. Our data analytical study highlighting statistical properties of the regional cuisines, brings out their culinary fingerprints that could be used to design algorithms for generating novel recipes and recipe recommender systems. It forms a basis for exploring possible causal connection between diet and health as well as prospection of therapeutic molecules from food ingredients. Our study also provides insights as to how big data can change the way we look at food.

  15. Amperean Pairing and the Pseudogap Phase of Cuprate Superconductors

    Science.gov (United States)

    Lee, Patrick A.

    2014-07-01

    The enigmatic pseudogap phase in underdoped cuprate high-Tc superconductors has long been recognized as a central puzzle of the Tc problem. Recent data show that the pseudogap is likely a distinct phase, characterized by a medium range and quasistatic charge ordering. However, the origin of the ordering wave vector and the mechanism of the charge order is unknown. At the same time, earlier data show that precursive superconducting fluctuations are also associated with this phase. We propose that the pseudogap phase is a novel pairing state where electrons on the same side of the Fermi surface are paired, in strong contrast with conventional Bardeen-Cooper-Schrieffer theory which pairs electrons on opposite sides of the Fermi surface. In this state the Cooper pair carries a net momentum and belongs to a general class called pair density wave. The microscopic pairing mechanism comes from a gauge theory formulation of the resonating valence bond (RVB) picture, where spinons traveling in the same direction feel an attractive force in analogy with Ampere's effects in electromagnetism. We call this Amperean pairing. Charge order automatically appears as a subsidiary order parameter even when long-range pair order is destroyed by phase fluctuations. Our theory gives a prediction of the ordering wave vector which is in good agreement with experiment. Furthermore, the quasiparticle spectrum from our model explains many of the unusual features reported in photoemission experiments. The Fermi arc, the unusual way the tip of the arc terminates, and the relation of the spanning vector of the arc tips to the charge ordering wave vector also come out naturally. Finally, we propose an experiment that can directly test the notion of Amperean pairing.

  16. Determinantal spanning forests on planar graphs

    OpenAIRE

    Kenyon, Richard

    2017-01-01

    We generalize the uniform spanning tree to construct a family of determinantal measures on essential spanning forests on periodic planar graphs in which every component tree is bi-infinite. Like the uniform spanning tree, these measures arise naturally from the laplacian on the graph. More generally these results hold for the "massive" laplacian determinant which counts rooted spanning forests with weight $M$ per finite component. These measures typically have a form of conformal invariance, ...

  17. Can an Excess Electron Localise on a Purine Moiety in the Adenine-thymine Watson-Crick Base Pair? A Computational Study

    International Nuclear Information System (INIS)

    Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz

    2007-01-01

    The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.

  18. Thermodynamics and life span estimation

    International Nuclear Information System (INIS)

    Kuddusi, Lütfullah

    2015-01-01

    In this study, the life span of people living in seven regions of Turkey is estimated by applying the first and second laws of thermodynamics to the human body. The people living in different regions of Turkey have different food habits. The first and second laws of thermodynamics are used to calculate the entropy generation rate per unit mass of a human due to the food habits. The lifetime entropy generation per unit mass of a human was previously found statistically. The two entropy generations, lifetime entropy generation and entropy generation rate, enable one to determine the life span of people living in seven regions of Turkey with different food habits. In order to estimate the life span, some statistics of Turkish Statistical Institute regarding the food habits of the people living in seven regions of Turkey are used. The life spans of people that live in Central Anatolia and Eastern Anatolia regions are the longest and shortest, respectively. Generally, the following inequality regarding the life span of people living in seven regions of Turkey is found: Eastern Anatolia < Southeast Anatolia < Black Sea < Mediterranean < Marmara < Aegean < Central Anatolia. - Highlights: • The first and second laws of thermodynamics are applied to the human body. • The entropy generation of a human due to his food habits is determined. • The life span of Turks is estimated by using the entropy generation method. • Food habits of a human have effect on his life span

  19. Reading Ability and Memory Span: Long-Term Memory Contributions to Span for Good and Poor Readers.

    Science.gov (United States)

    McDougall, Sine J. P.; Donohoe, Rachael

    2002-01-01

    Investigates the extent to which differences in memory span for good and poor readers can be explained by differences in a long-term memory component to span as well as by differences in short-term memory processes. Discusses the nature of the interrelationships between memory span, reading and measures of phonological awareness. (SG)

  20. Life Span Developmental Approach

    Directory of Open Access Journals (Sweden)

    Ali Eryilmaz

    2011-03-01

    Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.

  1. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.

    2013-01-01

    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  2. Fragment-based lead generation: identification of seed fragments by a highly efficient fragment screening technology

    Science.gov (United States)

    Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris

    2009-08-01

    For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.

  3. AlphaSpace: Fragment-Centric Topographical Mapping To Target Protein–Protein Interaction Interfaces

    Science.gov (United States)

    2016-01-01

    Inhibition of protein–protein interactions (PPIs) is emerging as a promising therapeutic strategy despite the difficulty in targeting such interfaces with drug-like small molecules. PPIs generally feature large and flat binding surfaces as compared to typical drug targets. These features pose a challenge for structural characterization of the surface using geometry-based pocket-detection methods. An attractive mapping strategy—that builds on the principles of fragment-based drug discovery (FBDD)—is to detect the fragment-centric modularity at the protein surface and then characterize the large PPI interface as a set of localized, fragment-targetable interaction regions. Here, we introduce AlphaSpace, a computational analysis tool designed for fragment-centric topographical mapping (FCTM) of PPI interfaces. Our approach uses the alpha sphere construct, a geometric feature of a protein’s Voronoi diagram, to map out concave interaction space at the protein surface. We introduce two new features—alpha-atom and alpha-space—and the concept of the alpha-atom/alpha-space pair to rank pockets for fragment-targetability and to facilitate the evaluation of pocket/fragment complementarity. The resulting high-resolution interfacial map of targetable pocket space can be used to guide the rational design and optimization of small molecule or biomimetic PPI inhibitors. PMID:26225450

  4. Magnetic Pair Creation Transparency in Pulsars

    Science.gov (United States)

    Story, Sarah; Baring, M. G.

    2013-04-01

    The Fermi gamma-ray pulsar database now exceeds 115 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency below the turnover energy. We adopt a semi-analytic approach, spanning both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. Our work clearly demonstrates that including near-threshold physics in the pair creation rate is essential to deriving accurate attenuation lengths. The altitude bounds, typically in the range of 2-6 neutron star radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. For the Crab pulsar, which emits pulsed radiation up to energies of 120 GeV, we obtain a lower bound of around 15 neutron star radii to its emission altitude.

  5. Longitudinal spin dependence of massive lepton pair production

    International Nuclear Information System (INIS)

    Berger, E. L.; Gordon, L. E.; Klasen, M.

    2000-01-01

    In this paper, the authors summarize recent work in which they demonstrate that the Compton subprocess, q + g -> γ* + q also dominates the Drell-Yan cross section in polarized and unpolarized proton-proton reactions for values of the transverse momentum Q T of the pair that are larger than roughly half of the pair mass Q, Q T > Q/2. The Drell-Yan process is therefore a valuable, heretofore overlooked, independent source of constraints on the spin-averaged and spin-dependent gluon densities. Although the Drell-Yan cross section is smaller than the prompt photon cross section, massive lepton pair production is cleaner theoretically since long-range fragmentation contributions are absent as are the experimental and theoretical complications associated with isolation of the real photon. Moreover, the dynamics of spin-dependence in hard-scattering processes is a sufficiently complex topic, and its understanding at an early stage in its development, that several defensible approaches for extracting polarized parton densities deserve to be pursued with the expectation that consistent results must emerge

  6. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  7. High-performance analysis of single interphase cells with custom DNA probes spanning translocation break points

    Science.gov (United States)

    Weier, Heinz-Ulli G.; Munne, S.; Lersch, Robert A.; Marquez, C.; Wu, J.; Pedersen, Roger A.; Fung, Jingly

    1999-06-01

    The chromatin organization of interphase cell nuclei, albeit an object of intense investigation, is only poorly understood. In the past, this has hampered the cytogenetic analysis of tissues derived from specimens where only few cells were actively proliferating or a significant number of metaphase cells could be obtained by induction of growth. Typical examples of such hard to analyze cell systems are solid tumors, germ cells and, to a certain extent, fetal cells such as amniocytes, blastomeres or cytotrophoblasts. Balanced reciprocal translocations that do not disrupt essential genes and thus do not led to disease symptoms exit in less than one percent of the general population. Since the presence of translocations interferes with homologue pairing in meiosis, many of these individuals experience problems in their reproduction, such as reduced fertility, infertility or a history of spontaneous abortions. The majority of translocation carriers enrolled in our in vitro fertilization (IVF) programs carry simple translocations involving only two autosomes. While most translocations are relatively easy to spot in metaphase cells, the majority of cells biopsied from embryos produced by IVF are in interphase and thus unsuitable for analysis by chromosome banding or FISH-painting. We therefore set out to analyze single interphase cells for presence or absence of specific translocations. Our assay, based on fluorescence in situ hybridization (FISH) of breakpoint-spanning DNA probes, detects translocations in interphase by visual microscopic inspection of hybridization domains. Probes are prepared so that they span a breakpoint and cover several hundred kb of DNA adjacent to the breakpoint. On normal chromosomes, such probes label a contiguous stretch of DNA and produce a single hybridization domain per chromosome in interphase cells. The translocation disrupts the hybridization domain and the resulting two fragments appear as physically separated hybridization domains in

  8. From pair correlations to the quasi-particle-phonon nuclear model

    International Nuclear Information System (INIS)

    Solov'ev, V.G.

    1986-01-01

    Modern state of the nucleus theory is discussed. The main attention is paid to pair correlation theory of superconducting type and quasiparticle - phonon nucleus model. Pair correlation account allowed one to describe in detail a series of nucleus properties which did not fall within the framework of earlier known models as, for example, double-quasi-particle states in even-even deformed nuclei. To describe the wave function low-quasi-particle components at low, mean and high excitation energies, the nucleus quasi-particle-phonon model is formulated. The strength function method is used in the model and fragmentation of mono-quasi-particle, mono-phonon states and quasi-particle phonon state by many nuclear levels is calculated

  9. mmpdb: An Open-Source Matched Molecular Pair Platform for Large Multiproperty Data Sets.

    Science.gov (United States)

    Dalke, Andrew; Hert, Jérôme; Kramer, Christian

    2018-05-29

    Matched molecular pair analysis (MMPA) enables the automated and systematic compilation of medicinal chemistry rules from compound/property data sets. Here we present mmpdb, an open-source matched molecular pair (MMP) platform to create, compile, store, retrieve, and use MMP rules. mmpdb is suitable for the large data sets typically found in pharmaceutical and agrochemical companies and provides new algorithms for fragment canonicalization and stereochemistry handling. The platform is written in Python and based on the RDKit toolkit. It is freely available from https://github.com/rdkit/mmpdb .

  10. Fragmentation of SIV-gag vaccine induces broader T cell responses.

    Directory of Open Access Journals (Sweden)

    Adel Benlahrech

    Full Text Available High mutation rates of human immunodeficiency virus (HIV allows escape from T cell recognition preventing development of effective T cell vaccines. Vaccines that induce diverse T cell immune responses would help overcome this problem. Using SIV gag as a model vaccine, we investigated two approaches to increase the breadth of the CD8 T cell response. Namely, fusion of vaccine genes to ubiquitin to target the proteasome and increase levels of MHC class I peptide complexes and gene fragmentation to overcome competition between epitopes for presentation and recognition.three vaccines were compared: full-length unmodified SIV-mac239 gag, full-length gag fused at the N-terminus to ubiquitin and 7 gag fragments of equal size spanning the whole of gag with ubiquitin-fused to the N-terminus of each fragment. Genes were cloned into a replication defective adenovirus vector and immunogenicity assessed in an in vitro human priming system. The breadth of the CD8 T cell response, defined by the number of distinct epitopes, was assessed by IFN-γ-ELISPOT and memory phenotype and cytokine production evaluated by flow cytometry. We observed an increase of two- to six-fold in the number of epitopes recognised in the ubiquitin-fused fragments compared to the ubiquitin-fused full-length gag. In contrast, although proteasomal targeting was achieved, there was a marked reduction in the number of epitopes recognised in the ubiquitin-fused full-length gag compared to the full-length unmodified gene, but there were no differences in the number of epitope responses induced by non-ubiquitinated full-length gag and the ubiquitin-fused mini genes. Fragmentation and ubiquitination did not affect T cell memory differentiation and polyfunctionality, though most responses were directed against the Ad5 vector.Fragmentation but not fusion with ubiquitin increases the breadth of the CD8 T vaccine response against SIV-mac239 gag. Thus gene fragmentation of HIV vaccines may maximise

  11. Working memory and inhibitory control across the life span: Intrusion errors in the Reading Span Test.

    Science.gov (United States)

    Robert, Christelle; Borella, Erika; Fagot, Delphine; Lecerf, Thierry; de Ribaupierre, Anik

    2009-04-01

    The aim of this study was to examine to what extent inhibitory control and working memory capacity are related across the life span. Intrusion errors committed by children and younger and older adults were investigated in two versions of the Reading Span Test. In Experiment 1, a mixed Reading Span Test with items of various list lengths was administered. Older adults and children recalled fewer correct words and produced more intrusions than did young adults. Also, age-related differences were found in the type of intrusions committed. In Experiment 2, an adaptive Reading Span Test was administered, in which the list length of items was adapted to each individual's working memory capacity. Age groups differed neither on correct recall nor on the rate of intrusions, but they differed on the type of intrusions. Altogether, these findings indicate that the availability of attentional resources influences the efficiency of inhibition across the life span.

  12. Geminal-spanning orbitals make explicitly correlated reduced-scaling coupled-cluster methods robust, yet simple

    Science.gov (United States)

    Pavošević, Fabijan; Neese, Frank; Valeev, Edward F.

    2014-08-01

    We present a production implementation of reduced-scaling explicitly correlated (F12) coupled-cluster singles and doubles (CCSD) method based on pair-natural orbitals (PNOs). A key feature is the reformulation of the explicitly correlated terms using geminal-spanning orbitals that greatly reduce the truncation errors of the F12 contribution. For the standard S66 benchmark of weak intermolecular interactions, the cc-pVDZ-F12 PNO CCSD F12 interaction energies reproduce the complete basis set CCSD limit with mean absolute error cost compared to the conventional CCSD F12.

  13. Hierarchical material models for fragmentation modeling in NIF-ALE-AMR

    International Nuclear Information System (INIS)

    Fisher, A C; Masters, N D; Koniges, A E; Anderson, R W; Gunney, B T N; Wang, P; Becker, R; Dixit, P; Benson, D J

    2008-01-01

    Fragmentation is a fundamental process that naturally spans micro to macroscopic scales. Recent advances in algorithms, computer simulations, and hardware enable us to connect the continuum to microstructural regimes in a real simulation through a heterogeneous multiscale mathematical model. We apply this model to the problem of predicting how targets in the NIF chamber dismantle, so that optics and diagnostics can be protected from damage. The mechanics of the initial material fracture depend on the microscopic grain structure. In order to effectively simulate the fragmentation, this process must be modeled at the subgrain level with computationally expensive crystal plasticity models. However, there are not enough computational resources to model the entire NIF target at this microscopic scale. In order to accomplish these calculations, a hierarchical material model (HMM) is being developed. The HMM will allow fine-scale modeling of the initial fragmentation using computationally expensive crystal plasticity, while the elements at the mesoscale can use polycrystal models, and the macroscopic elements use analytical flow stress models. The HMM framework is built upon an adaptive mesh refinement (AMR) capability. We present progress in implementing the HMM in the NIF-ALE-AMR code. Additionally, we present test simulations relevant to NIF targets

  14. Hierarchical material models for fragmentation modeling in NIF-ALE-AMR

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, A C; Masters, N D; Koniges, A E; Anderson, R W; Gunney, B T N; Wang, P; Becker, R [Lawrence Livermore National Laboratory, PO Box 808, Livermore, CA 94551 (United States); Dixit, P; Benson, D J [University of California San Diego, 9500 Gilman Dr., La Jolla. CA 92093 (United States)], E-mail: fisher47@llnl.gov

    2008-05-15

    Fragmentation is a fundamental process that naturally spans micro to macroscopic scales. Recent advances in algorithms, computer simulations, and hardware enable us to connect the continuum to microstructural regimes in a real simulation through a heterogeneous multiscale mathematical model. We apply this model to the problem of predicting how targets in the NIF chamber dismantle, so that optics and diagnostics can be protected from damage. The mechanics of the initial material fracture depend on the microscopic grain structure. In order to effectively simulate the fragmentation, this process must be modeled at the subgrain level with computationally expensive crystal plasticity models. However, there are not enough computational resources to model the entire NIF target at this microscopic scale. In order to accomplish these calculations, a hierarchical material model (HMM) is being developed. The HMM will allow fine-scale modeling of the initial fragmentation using computationally expensive crystal plasticity, while the elements at the mesoscale can use polycrystal models, and the macroscopic elements use analytical flow stress models. The HMM framework is built upon an adaptive mesh refinement (AMR) capability. We present progress in implementing the HMM in the NIF-ALE-AMR code. Additionally, we present test simulations relevant to NIF targets.

  15. Spatial perturbation of a wing-tip vortex using pulsed span-wise jets

    Science.gov (United States)

    Heyes, A. L.; Smith, D. A. R.

    The separation distance required between transport aircraft to avoid wake vortices remains a limiting factor on airport capacity. The dissipation of the wake can be accelerated by perturbing co-operative instabilities between multiple pairs of vortices. This paper presents the results of a preliminary experimental investigation into the use of pulsed span-wise air jets in the wing tip to perturb a single tip vortex in the very near field. Velocity measurements were made using PIV and hot-wire anemometry. The results demonstrate that the vortex position can be modulated at frequencies up to 50 Hz and, as such, the method shows promise for forcing instability in multiple vortex wakes.

  16. Life Span Developmental Approach

    OpenAIRE

    Ali Eryilmaz

    2011-01-01

    The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of...

  17. Self-Attractive Hartree Decomposition: Partitioning Electron Density into Smooth Localized Fragments.

    Science.gov (United States)

    Zhu, Tianyu; de Silva, Piotr; Van Voorhis, Troy

    2018-01-09

    Chemical bonding plays a central role in the description and understanding of chemistry. Many methods have been proposed to extract information about bonding from quantum chemical calculations, the majority of them resorting to molecular orbitals as basic descriptors. Here, we present a method called self-attractive Hartree (SAH) decomposition to unravel pairs of electrons directly from the electron density, which unlike molecular orbitals is a well-defined observable that can be accessed experimentally. The key idea is to partition the density into a sum of one-electron fragments that simultaneously maximize the self-repulsion and maintain regular shapes. This leads to a set of rather unusual equations in which every electron experiences self-attractive Hartree potential in addition to an external potential common for all the electrons. The resulting symmetry breaking and localization are surprisingly consistent with chemical intuition. SAH decomposition is also shown to be effective in visualization of single/multiple bonds, lone pairs, and unusual bonds due to the smooth nature of fragment densities. Furthermore, we demonstrate that it can be used to identify specific chemical bonds in molecular complexes and provides a simple and accurate electrostatic model of hydrogen bonding.

  18. Virtual fragment preparation for computational fragment-based drug design.

    Science.gov (United States)

    Ludington, Jennifer L

    2015-01-01

    Fragment-based drug design (FBDD) has become an important component of the drug discovery process. The use of fragments can accelerate both the search for a hit molecule and the development of that hit into a lead molecule for clinical testing. In addition to experimental methodologies for FBDD such as NMR and X-ray Crystallography screens, computational techniques are playing an increasingly important role. The success of the computational simulations is due in large part to how the database of virtual fragments is prepared. In order to prepare the fragments appropriately it is necessary to understand how FBDD differs from other approaches and the issues inherent in building up molecules from smaller fragment pieces. The ultimate goal of these calculations is to link two or more simulated fragments into a molecule that has an experimental binding affinity consistent with the additive predicted binding affinities of the virtual fragments. Computationally predicting binding affinities is a complex process, with many opportunities for introducing error. Therefore, care should be taken with the fragment preparation procedure to avoid introducing additional inaccuracies.This chapter is focused on the preparation process used to create a virtual fragment database. Several key issues of fragment preparation which affect the accuracy of binding affinity predictions are discussed. The first issue is the selection of the two-dimensional atomic structure of the virtual fragment. Although the particular usage of the fragment can affect this choice (i.e., whether the fragment will be used for calibration, binding site characterization, hit identification, or lead optimization), general factors such as synthetic accessibility, size, and flexibility are major considerations in selecting the 2D structure. Other aspects of preparing the virtual fragments for simulation are the generation of three-dimensional conformations and the assignment of the associated atomic point charges.

  19. Unusual behavior of projectile fragments formed in the bombardment of copper with relativistic Ar ions

    International Nuclear Information System (INIS)

    Dersch, G.; Beckmann, R.; Feige, G.

    1985-01-01

    The interaction properties of projectile fragments from the fragmentation of 0.9 GeV/nucleon and 1.8 GeV/nucleon 40 Ar with Cu have been studied using radioactivation techniques. In this experiment, two identical copper blocks, 1 cm thick and 8 cm in diameter, are irradiated by relativistic projectiles in different configurations. In configuration 0, the blocks are touching while in configuration 10 or 20, the blocks are separated by 10 or 20 cm of air, respectively. It is assumed that when the relativistic projectiles interact with the first block of each pair, projectile fragments are created which interact with other nuclei in the first and second blocks. What is measured is the ratio of some target fragment activity, such as 24 Na or 28 Mg, produced in the second block relative to the first block, R

  20. Efficient and accurate local approximations to coupled-electron pair approaches: An attempt to revive the pair natural orbital method.

    Science.gov (United States)

    Neese, Frank; Wennmohs, Frank; Hansen, Andreas

    2009-03-21

    Coupled-electron pair approximations (CEPAs) and coupled-pair functionals (CPFs) have been popular in the 1970s and 1980s and have yielded excellent results for small molecules. Recently, interest in CEPA and CPF methods has been renewed. It has been shown that these methods lead to competitive thermochemical, kinetic, and structural predictions. They greatly surpass second order Moller-Plesset and popular density functional theory based approaches in accuracy and are intermediate in quality between CCSD and CCSD(T) in extended benchmark studies. In this work an efficient production level implementation of the closed shell CEPA and CPF methods is reported that can be applied to medium sized molecules in the range of 50-100 atoms and up to about 2000 basis functions. The internal space is spanned by localized internal orbitals. The external space is greatly compressed through the method of pair natural orbitals (PNOs) that was also introduced by the pioneers of the CEPA approaches. Our implementation also makes extended use of density fitting (or resolution of the identity) techniques in order to speed up the laborious integral transformations. The method is called local pair natural orbital CEPA (LPNO-CEPA) (LPNO-CPF). The implementation is centered around the concepts of electron pairs and matrix operations. Altogether three cutoff parameters are introduced that control the size of the significant pair list, the average number of PNOs per electron pair, and the number of contributing basis functions per PNO. With the conservatively chosen default values of these thresholds, the method recovers about 99.8% of the canonical correlation energy. This translates to absolute deviations from the canonical result of only a few kcal mol(-1). Extended numerical test calculations demonstrate that LPNO-CEPA (LPNO-CPF) has essentially the same accuracy as parent CEPA (CPF) methods for thermochemistry, kinetics, weak interactions, and potential energy surfaces but is up to 500

  1. Would protecting tropical forest fragments provide carbon and biodiversity cobenefits under REDD+?

    Science.gov (United States)

    Magnago, Luiz Fernando S; Magrach, Ainhoa; Laurance, William F; Martins, Sebastião V; Meira-Neto, João Augusto A; Simonelli, Marcelo; Edwards, David P

    2015-09-01

    Tropical forests store vast amounts of carbon and are the most biodiverse terrestrial habitats, yet they are being converted and degraded at alarming rates. Given global shortfalls in the budgets required to prevent carbon and biodiversity loss, we need to seek solutions that simultaneously address both issues. Of particular interest are carbon-based payments under the Reducing Emissions from Deforestation and Forest Degradation (REDD+) mechanism to also conserve biodiversity at no additional cost. One potential is for REDD+ to protect forest fragments, especially within biomes where contiguous forest cover has diminished dramatically, but we require empirical tests of the strength of any carbon and biodiversity cobenefits in such fragmented systems. Using the globally threatened Atlantic Forest landscape, we measured above-ground carbon stocks within forest fragments spanning 13 to 23 442 ha in area and with different degrees of isolation. We related these stocks to tree community structure and to the richness and abundance of endemic and IUCN Red-listed species. We found that increasing fragment size has a positive relationship with above-ground carbon stock and with abundance of IUCN Red-listed species and tree community structure. We also found negative relationships between distance from large forest block and tree community structure, endemic species richness and abundance, and IUCN Red-listed species abundance. These resulted in positive congruence between carbon stocks and Red-listed species, and the abundance and richness of endemic species, demonstrating vital cobenefits. As such, protecting forest fragments in hotspots of biodiversity, particularly larger fragments and those closest to sources, offers important carbon and biodiversity cobenefits. More generally, our results suggest that macroscale models of cobenefits under REDD+ have likely overlooked key benefits at small scales, indicating the necessity to apply models that include finer

  2. Simultaneous measurement of neutrons and fission fragments of thermal neutron fission of U-233

    International Nuclear Information System (INIS)

    Itsuro Kimura; Katsuhisa Nishio; Yoshihiro Nakagome

    2000-01-01

    The multiplicity and the energy of prompt neutrons from the fragments for 233 U(n th , f) were measured as functions of fragment mass and total kinetic energy. Average neutron energy against the fragment mass showed a nearly symmetric distribution about the half mass division with two valleys at 98 and 145 u. The slope of the neutron multiplicity with total kinetic energy depended on the fragment mass and showed the minimum at about 130 u. The obtained neutron data were applied to determine the total excitation energy of the system, and the resulting value in the typical asymmetric fission lied between 22 and 25 MeV. The excitation energy agreed with that determined by subtracting the total kinetic energy from the Q-value within 1 MeV, thus satisfied the energy conservation. In the symmetric fission, where the mass yield was drastically suppresses, the total excitation energy is significantly large and reaches to about 40 MeV, suggesting that fragment pairs are preferentially formed in a compact configuration at the scission point [ru

  3. Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.

    2005-06-01

    For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)

  4. Comparative study of BxNyCz nanojunctions fragments

    International Nuclear Information System (INIS)

    Batista, Fabiana Aparecida de Souza; Manzanares, Raquel Dastre; Carvalho, Ana Claudia Monteiro; Reis Junior, Magno dos; Custodio, Rogerio

    2011-01-01

    Theoretical analysis of formation energy and geometry was done to compare the relative stabilities of modified carbon nanostructures representative fragments. Structure and energies of formation were calculated at semiempirical level of theory. Depending of B-N pair localization on the molecular structures the formation enthalpy decreases. B-N substitution in tubular structures at low concentration decreases the energy when the tubes have small diameters. Our results are in according to experimental works which have shown that boron and nitrogen are met at region of defects in B X C Y N Z nanostructures. (author)

  5. Age Differences in Memory Span

    Science.gov (United States)

    Chi, Michelene T. H.

    1977-01-01

    Three experiments were conducted to determine processes underlying age differences in the level of recall in a memory-span task. Five-year-olds recalled fewer items than adults in memory-span tasks involving both familiar and unfamiliar faces, even though the use of rehearsal and recoding strategies was minimized for adults. (MS)

  6. Colour connection and diquark fragmentation in e{sup +}e{sup -}->cc-bar qq-bar ->h{sup '}s process

    Energy Technology Data Exchange (ETDEWEB)

    Han Wei [Department of Physics, Shandong University, Jinan 250100 (China)]. E-mail: hanwei@mail.sdu.edu.cn; Li Shiyuan [Department of Physics, Shandong University, Jinan 250100 (China) and Institute of Particle Physics, Huazhong Normal University, Wuhan 430079 (China)]. E-mail: lishy@sdu.edu.cn; Si Zongguo [Department of Physics, Shandong University, Jinan 250100 (China)]. E-mail: zgsi@sdu.edu.cn; Yang Zhongjuan [Department of Physics, Shandong University, Jinan 250100 (China)]. E-mail: yangzhongjuan@mail.sdu.edu.cn

    2006-11-02

    The hadronization effects induced by different colour connections of cc-bar qq-bar system in e{sup +}e{sup -} annihilation are investigated by a toy model where diquark fragmentation is employed based on Pythia. It is found that the correlations between the charm baryons and charm antibaryons produced via diquark pair fragmentation are much stronger, and their momentum spectra are harder than those from the standard colour connection in Pythia.

  7. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  8. On the size of monotone span programs

    NARCIS (Netherlands)

    Nikov, V.S.; Nikova, S.I.; Preneel, B.; Blundo, C.; Cimato, S.

    2005-01-01

    Span programs provide a linear algebraic model of computation. Monotone span programs (MSP) correspond to linear secret sharing schemes. This paper studies the properties of monotone span programs related to their size. Using the results of van Dijk (connecting codes and MSPs) and a construction for

  9. London SPAN version 4 parameter file format

    International Nuclear Information System (INIS)

    2004-06-01

    Powernext SA is a Multilateral Trading Facility in charge of managing the French power exchange through an optional and anonymous organised trading system. Powernext SA collaborates with the clearing organization LCH.Clearnet SA to secure and facilitate the transactions. The French Standard Portfolio Analysis of Risk (SPAN) is a system used by LCH.Clearnet to calculate the initial margins from and for its clearing members. SPAN is a computerized system which calculates the impact of several possible variations of rates and volatility on by-product portfolios. The initial margin call is equal to the maximum probable loss calculated by the system. This document contains details of the format of the London SPAN version 4 parameter file. This file contains all the parameters and risk arrays required to calculate SPAN margins. London SPAN Version 4 is an upgrade from Version 3, which is also known as LME SPAN. This document contains the full revised file specification, highlighting the changes from Version 3 to Version 4

  10. 28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

    Science.gov (United States)

    Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

    2015-01-01

    Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

  11. Ion pair formation in the vacuum ultraviolet region of NO studied by negative ion imaging spectroscopy

    International Nuclear Information System (INIS)

    Hikosaka, Y.; Kaneyasu, T.; Shigemasa, E.

    2007-01-01

    The pair formation of positive and negative fragment ions has been studied in the vacuum ultraviolet region of NO, with negative ion imaging spectroscopy. The negative ion yield curve obtained in the photon energy region of 19-25 eV exhibits many structures which are absent from the photoabsorption spectrum in the same region. The partial yields and asymmetry parameters associated with the dissociations into individual ion pair limits have been extracted from the negative ion images observed. On the basis of these quantities, the assignments for the structures exhibited on the negative ion yield curve are given and the dynamical properties on the ion pair dissociation are discussed

  12. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  13. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  14. Coulomb and even-odd effects in cold and super-asymmetric fragmentation for thermal neutron induced fission of 235U

    International Nuclear Information System (INIS)

    Modesto, Montoya

    2014-01-01

    The Coulomb effects hypothesis is used to interpret even-odd effects of maximum total kinetic energy as a function of mass and charge of fragments from thermal neutron induced fission of 235 U. Assuming spherical fragments at scission, the Coulomb interaction energy between fragments (C sph ) is higher than the Q-value, the available energy. Therefore at scission the fragments must be deformed, so that the Coulomb interaction energy does not exceed the Q-value. The fact that the even-odd effects in the maximum total kinetic energy as a function of the charge and mass, respectively, are lower than the even-odd effects of Q is consistent with the assumption that odd mass fragments are softer than the even-even fragments. Even-odd effects of charge distribution in super asymmetric fragmentation also are interpreted with the Coulomb effect hypothesis. Because the difference between C sph and Q increases with asymmetry, fragmentations require higher total deformation energy to occur. Higher deformation energy of the fragments implies lower free energy to break pairs of nucleons. This explains why in the asymmetric fragmentation region, the even-odd effects of the distribution of proton number and neutron number increases with asymmetry. (author).

  15. Dihadron fragmentation functions in the quark-jet model: Transversely polarized quarks

    Science.gov (United States)

    Matevosyan, Hrayr H.; Kotzinian, Aram; Thomas, Anthony W.

    2018-01-01

    Within the most recent extension of the quark-jet hadronization framework, we explore the transverse-polarization-dependent dihadron fragmentation functions (DiFFs) H1∢ and H1⊥ of a quark into π+π- pairs. Monte Carlo (MC) simulations are employed to model polarized quark hadronization and calculate the corresponding number densities. These, in turn, are used to extract the Fourier cosine moments of the DiFFs H1∢ and H1⊥. A notable finding is that there are previously unnoticed apparent discrepancies between the definitions of the so-called interference DiFF (IFF) H1∢ , entering the cross sections for two-hadron semi-inclusive electroproduction, and those involved in the production of two pairs of hadrons from back-to-back jets in electron-positron annihilation. This manuscript completes the studies of all four leading-twist DiFFs for unpolarized hadron pairs within the quark-jet framework, following our previous work on the helicity-dependent DiFF G1⊥.

  16. Urban habitat fragmentation and genetic population structure of bobcats in coastal southern California

    Science.gov (United States)

    Ruell, E.W.; Riley, S.P.D.; Douglas, M.R.; Antolin, M.F.; Pollinger, J.R.; Tracey, J.A.; Lyren, L.M.; Boydston, E.E.; Fisher, R.N.; Crooks, K.R.

    2012-01-01

    Although habitat fragmentation is recognized as a primary threat to biodiversity, the effects of urban development on genetic population structure vary among species and landscapes and are not yet well understood. Here we use non-invasive genetic sampling to compare the effects of fragmentation by major roads and urban development on levels of dispersal, genetic diversity, and relatedness between paired bobcat populations in replicate landscapes in coastal southern California. We hypothesized that bobcat populations in sites surrounded by urbanization would experience reduced functional connectivity relative to less isolated nearby populations. Our results show that bobcat genetic population structure is affected by roads and development but not always as predicted by the degree that these landscape features surround fragments. Instead, we suggest that urban development may affect functional connectivity between bobcat populations more by limiting the number and genetic diversity of source populations of migrants than by creating impermeable barriers to dispersal.

  17. Numerical experimental investigation of coalescence phenomenon in triple systems of gaseous protogalactic fragments

    International Nuclear Information System (INIS)

    Kiseleva, L.G.; Orlov, V.V.

    1987-01-01

    By computer simulations in the framework of the general three-body problem, the evolution of triple systems of gasous photogalactic fragments has been investigated. The fragments have the same masses the initial velocities are equal to zero. The initial positions are chosen by uniform scanning in the region D of all possible initial configurations. The computations are carried on until a moment of the first double approach of fragments. The different fragment radii in this moment are considered. It is shown for these r a merging (coalescence) in the pair of gaseous fragments takes place in the majority of cases (from 50.2% at r=0.001 d to 96.7% at r=0.1 d (where d - an average system size). An average specific momentum of their orbital motion transforming to spin momentum of a ''merger'' is (0.4±0.5)x10 29 √μxl cm 2 /s for the most probable value r=10xl kpc (the fragment masses are equal to 5x10 10 μM Sun ; l and μ are the scale factors), it is in agreement with the specific angular momenta for disc galaxies on l, μ ∼ 1. In the region D for every r a continuous zone of initial configurations corresponding to the mergings is separated

  18. Numerical-experiment investigation of coalescence of gaseous protogalactic fragments in triple systems

    International Nuclear Information System (INIS)

    Kiseleva, L.G.; Orlov, V.V.

    1988-01-01

    The numerical-experiment approach in the framework of the general gravitational three-body problem has been used to investigate the dynamical evolution of triple systems of gaseous protogalactic fragments. The masses of the fragments are equal, the initial velocities zero. The initial positions were specified by uniform scanning in the region D of all possible initial configurations. Calculations were continued until the first two-body encounter of the fragments. Different values of the fragment radii at this times were considered, namely, r in the interval [0.001, 0.1]d, where d is the mean diameter of the system. It is shown that for such r the pair of gaseous fragments coalesces in the majority of cases (from 50.2% for r = 0.001d to 96.7% for r = 0.1d). The mean specific angular momentum of their relative motion, which becomes spin angular momentum of the coalescence product, is (0.8 +- 1.0)/centered dot/10 29 /root/μl cm 2 sec for the most probable value r = 10l kpc (the masses of the fragments are 5/centered dot/10 10 μM/circled dot/; l and μ are scale factors), this agreeing in order of magnitude with the specific angular momenta of disk galaxies if l, μ /approximately/ 1. For each value of r, a continuous zone of initial configurations corresponding to coalescences is identified in the region D

  19. Comparison on the heat requirements of a four-span greenhouse with a melting snow system and a single-span greenhouse

    International Nuclear Information System (INIS)

    Furuno, S.; Sase, S.; Ishii, M.

    2004-01-01

    The heat requirements were measured and compared between a four-span greenhouse with a melting snow system and a typical single-span greenhouse with no melting snow system. Generally, single-span greenhouses require no melting snow system because snow drops off naturally from the roofs by gravity. The results for the four-span greenhouse showed that the provided heat by a heater for melting snow increased with an increase in snowfall, and there was a high correlation between them. The heat requirement per unit floor area of the four-span greenhouse was slightly less than that of the single-span greenhouse. This suggests that the decrease in heat requirement for internal air because of the larger floor/surface area ratio of the four-span greenhouse was more than the increase in heat requirement for melting snow. The measured heat requirement of the four-span greenhouse with the melting snow system was equal to the estimated heat load based on a common calculation procedure. On the other hand, that of the single-span greenhouse was slightly smaller than the estimated heat load. These suggest that the estimated heat load based on the common calculation procedure was slightly overestimated and larger than the actual heat requirement excluding the heat for the melting snow in snowy area. This is likely due to the fact that the parameters in the common calculation procedure were determined under the condition of larger net radiation than that in snowy area

  20. Linking crowding, visual span, and reading.

    Science.gov (United States)

    He, Yingchen; Legge, Gordon E

    2017-09-01

    The visual span is hypothesized to be a sensory bottleneck on reading speed with crowding thought to be the major sensory factor limiting the size of the visual span. This proposed linkage between crowding, visual span, and reading speed is challenged by the finding that training to read crowded letters reduced crowding but did not improve reading speed (Chung, 2007). Here, we examined two properties of letter-recognition training that may influence the transfer to improved reading: the spatial arrangement of training stimuli and the presence of flankers. Three groups of nine young adults were trained with different configurations of letter stimuli at 10° in the lower visual field: a flanked-local group (flanked letters localized at one position), a flanked-distributed group (flanked letters distributed across different horizontal locations), and an isolated-distributed group (isolated and distributed letters). We found that distributed training, but not the presence of flankers, appears to be necessary for the training benefit to transfer to increased reading speed. Localized training may have biased attention to one specific, small area in the visual field, thereby failing to improve reading. We conclude that the visual span represents a sensory bottleneck on reading, but there may also be an attentional bottleneck. Reducing the impact of crowding can enlarge the visual span and can potentially facilitate reading, but not when adverse attentional bias is present. Our results clarify the association between crowding, visual span, and reading.

  1. Viability of meta-populations of wetland birds in a fragmented landscape: Testing the key-patch approach

    NARCIS (Netherlands)

    Vermaat, J.E.; Vigneau, N.; Omtzigt, N.

    2008-01-01

    The key patch approach assumes that metapopulations in fragmented landscapes are likely to be viable with at least one "key" sub-population that is sufficiently large to ensure re-colonization of surrounding minor habitat patches. It is based on a minimum viable number of breeding pairs and

  2. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  3. Heavy-residue isoscaling as a probe of the symmetry energy of hot fragments

    International Nuclear Information System (INIS)

    Souliotis, G.A.; Shetty, D.V.; Keksis, A.; Bell, E.; Jandel, M.; Veselsky, M.; Yennello, S.J.

    2006-01-01

    The isoscaling properties of isotopically resolved projectile residues from peripheral collisions of 86 Kr (25 MeV/nucleon) 64 Ni (25 MeV/nucleon), and 136 Xe (20 MeV/nucleon) beams on various target pairs are employed to probe the symmetry energy coefficient of the nuclear binding energy. The present study focuses on heavy projectile fragments produced in peripheral and semiperipheral collisions near the onset of multifragment emission (E * /A=2-3 MeV). For these fragments, the measured average velocities are used to extract excitation energies. The excitation energies, in turn, are used to estimate the temperatures of the fragmenting quasiprojectiles in the framework the Fermi gas model. The isoscaling analysis of the fragment yields provided the isoscaling parameters α that, in combination with temperatures and isospin asymmetries provided the symmetry energy coefficient of the nuclear binding energy of the hot fragmenting quasiprojectiles. The extracted values of the symmetry energy coefficient at this excitation energy range (2-3 MeV/nucleon) are lower than the typical liquid-drop model value ∼25 MeV corresponding to ground-state nuclei and show a monotonic decrease with increasing excitation energy. This result is of importance in the formation of hot nuclei in heavy-ion reactions and in hot stellar environments such as supernova

  4. Detailed free span assessment for Mexilhao flow lines

    Energy Technology Data Exchange (ETDEWEB)

    Pereira, Antonio; Franco, Luciano; Eigbe, Uwa; BomfimSilva, Carlos [INTECSEA, Houston, TX (United States); Escudero, Carlos [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil)

    2009-07-01

    The subsea gas production system of Mexilhao Field SPS-35, Santos Basin, offshore Brazil, is composed basically of two rigid 12.75 inches production flow lines approximately 21 km long installed in a fairly rough seabed. During the basic design, the free span assessment was performed considering the maximum allowable free span length determined by the response model proposed by DNV-RP-F105. This approach resulted in a large number of predicted free span requiring corrections, leading to a higher capital cost for the project. In this sense, a detailed free span VIV fatigue assessment was proposed, considering multi-spans and multi-mode effects and also the post lay survey data. The assessment followed the DNV-RP-F105 recommendations for multi-spans and multi-mode effects, using Finite Element Analysis to determine the natural frequencies, mode shapes and corresponding stresses associated with the mode shapes. The assessment was performed in three stages, the first during the detailed design as part of the bottom roughness analysis using the expected residual pipelay tension. The second stage was performed after pipelay, considering the post-lay survey data, where the actual requirements for span correction were determined. Actual pipelay tension was used and seabed soil stiffness adjusted in the model to match the as-laid pipeline profile obtained from the survey data. The first and second stage assessments are seamlessly automated to speed up the evaluation process and allow for quick response in the field, which was important to keep the construction vessel time minimized. The third stage was performed once the corrections of the spans were made and the purpose was to confirm that the new pipeline configuration along the supported spans had sufficient fatigue life for the temporary and operational phases. For the assessment of all three stages, the probability of occurrence and directionality of the near bottom current was considered to improve prediction of the

  5. Missing Fragments: Detecting Cooperative Binding in Fragment-Based Drug Design

    Science.gov (United States)

    2012-01-01

    The aim of fragment-based drug design (FBDD) is to identify molecular fragments that bind to alternate subsites within a given binding pocket leading to cooperative binding when linked. In this study, the binding of fragments to human phenylethanolamine N-methyltransferase is used to illustrate how (a) current protocols may fail to detect fragments that bind cooperatively, (b) theoretical approaches can be used to validate potential hits, and (c) apparent false positives obtained when screening against cocktails of fragments may in fact indicate promising leads. PMID:24900472

  6. Spatial and temporal dimensions of landscape fragmentation across the Brazilian Amazon.

    Science.gov (United States)

    Rosa, Isabel M D; Gabriel, Cristina; Carreiras, Joāo M B

    2017-01-01

    The Brazilian Amazon in the past decades has been suffering severe landscape alteration, mainly due to anthropogenic activities, such as road building and land clearing for agriculture. Using a high-resolution time series of land cover maps (classified as mature forest, non-forest, secondary forest) spanning from 1984 through 2011, and four uncorrelated fragmentation metrics (edge density, clumpiness index, area-weighted mean patch size and shape index), we examined the temporal and spatial dynamics of forest fragmentation in three study areas across the Brazilian Amazon (Manaus, Santarém and Machadinho d'Oeste), inside and outside conservation units. Moreover, we compared the impacts on the landscape of: (1) different land uses (e.g. cattle ranching, crop production), (2) occupation processes (spontaneous vs. planned settlements) and (3) implementation of conservation units. By 2010/2011, municipalities located along the Arc of Deforestation had more than 55% of the remaining mature forest strictly confined to conservation units. Further, the planned settlement showed a higher rate of forest loss, a more persistent increase in deforested areas and a higher relative incidence of deforestation inside conservation units. Distinct agricultural activities did not lead to significantly different landscape structures; the accessibility of the municipality showed greater influence in the degree of degradation of the landscapes. Even with a high proportion of the landscapes covered by conservation units, which showed a strong inhibitory effect on forest fragmentation, we show that dynamic agriculturally driven economic activities, in municipalities with extensive road development, led to more regularly shaped, heavily fragmented landscapes, with higher densities of forest edge.

  7. Origin of complex fragments from 32S + natAg reaction at 37.5 A.MeV

    International Nuclear Information System (INIS)

    Benchekroun, D.; Cheynis, B.; Demeyer, A.; Gerlic, E.; Guinet, D.; Lautesse, P.; Lebreton, L.; Magda, M.T.; Stern, M.; Chabane, A.; Desesquelles, P.; Giorni, A.; Heuer, D.; Lleres, A.; Viano, J.B.

    1996-08-01

    Fragment emission from collisions of 32 S with nat Ag at 37.5 A.MeV has been studied with the 4π multidetector AMPHORA. Production of intermediate mass and heavy fragments as well as of light charged particles has been measured. The total charged particle multiplicity and polar angular distributions have been used to select various classes of collisions. Analysis of angular and energy distributions of fragments and light particles in central collisions indicates the formation of a hot source (excitation energy of ∼ 4.4 A.MeV) with an additional contribution from a preequilibrium process at more forward angles. Azimuthal angle correlations of He - Li, Li - Li, B - B, and C - C pairs have been used as a tool to study the origin of complex fragments. Data at backward angles are well described by considering a thermalized emitter with an angular momentum around 70 h and a fragment emission time of the order of 200 fm/c. A microscopic approach of BNV type confirms these emission times and angular momenta indicating the persistence of an incomplete fusion process responsible for the emission of complex fragments at backward angles

  8. Properties of large p sub( t) jets in massive lepton-pair production at large q sub( t)

    International Nuclear Information System (INIS)

    Kinoshita, Kisei; Kinoshita, Yukiko.

    1979-01-01

    Production mechanism of massive lepton-pairs with large transverse momentum is discussed in connection with the properties of hadronic jets on the away side. Significant differences of CIM and QCD perturbation model will show up in the angular dependence and quantum number content of the away jets. If the QCD perturbation terms dominate, we can extract the gluon distributions inside hadrons and the gluon fragmentation function from the properties of the away jets triggering large q sub( t) lepton pairs. (author)

  9. The leptoquark hunter's guide: pair production

    Science.gov (United States)

    Diaz, Bastian; Schmaltz, Martin; Zhong, Yi-Ming

    2017-10-01

    Leptoquarks occur in many new physics scenarios and could be the next big discovery at the LHC. The purpose of this paper is to point out that a model-independent search strategy covering all possible leptoquarks is possible and has not yet been fully exploited. To be systematic we organize the possible leptoquark final states according to a leptoquark matrix with entries corresponding to nine experimentally distinguishable leptoquark decays: any of {light-jet, b-jet, top} with any of {neutrino, e/ μ, τ}. The 9 possibilities can be explored in a largely model-independent fashion with pair-production of leptoquarks at the LHC. We review the status of experimental searches for the 9 components of the leptoquark matrix, pointing out which 3 have not been adequately covered. We plead that experimenters publish bounds on leptoquark cross sections as functions of mass for as wide a range of leptoquark masses as possible. Such bounds are essential for reliable recasts to general leptoquark models. To demonstrate the utility of the leptoquark matrix approach we collect and summarize searches with the same final states as leptoquark pair production and use them to derive bounds on a complete set of Minimal Leptoquark models which span all possible flavor and gauge representations for scalar and vector leptoquarks.

  10. EARLY STAGES OF CLUSTER FORMATION: FRAGMENTATION OF MASSIVE DENSE CORES DOWN TO {approx}< 1000 AU

    Energy Technology Data Exchange (ETDEWEB)

    Palau, Aina; Girart, Josep M. [Institut de Ciencies de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciencies, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Fuente, Asuncion [Observatorio Astronomico Nacional, P.O. Box 112, E-28803 Alcala de Henares, Madrid (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciencies del Cosmos, Universitat de Barcelona, Marti Franques, 1, E-08028 Barcelona (Spain); Ho, Paul T. P.; Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Sanchez-Monge, Alvaro; Fontani, Francesco; Cesaroni, Riccardo [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Commercon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, Ecole Normale Superieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Boissier, Jeremie [Istituto di Radioastronomia, INAF, Via Gobetti 101, I-40129 Bologna (Italy); Zapata, Luis A., E-mail: palau@ieec.uab.es [Centro de Radioastronomia y Astrofisica, Universidad Nacional Autonoma de Mexico, P.O. Box 3-72, 58090 Morelia, Michoacan (Mexico)

    2013-01-10

    In order to study the fragmentation of massive dense cores, which constitute the cluster cradles, we observed the continuum at 1.3 mm and the CO (2-1) emission of four massive cores with the Plateau de Bure Interferometer in the most extended configuration. We detected dust condensations down to {approx}0.3 M {sub Sun} and separate millimeter sources down to 0.''4 or {approx}< 1000 AU, comparable to the sensitivities and separations reached in optical/infrared studies of clusters. The CO (2-1) high angular resolution images reveal high-velocity knots usually aligned with previously known outflow directions. This, in combination with additional cores from the literature observed at similar mass sensitivity and spatial resolution, allowed us to build a sample of 18 protoclusters with luminosities spanning three orders of magnitude. Among the 18 regions, {approx}30% show no signs of fragmentation, while 50% split up into {approx}> 4 millimeter sources. We compiled a list of properties for the 18 massive dense cores, such as bolometric luminosity, total mass, and mean density, and found no correlation of any of these parameters with the fragmentation level. In order to investigate the combined effects of the magnetic field, radiative feedback, and turbulence in the fragmentation process, we compared our observations to radiation magnetohydrodynamic simulations and found that the low-fragmented regions are reproduced well in the magnetized core case, while the highly fragmented regions are consistent with cores where turbulence dominates over the magnetic field. Overall, our study suggests that the fragmentation in massive dense cores could be determined by the initial magnetic field/turbulence balance in each particular core.

  11. Diverse responses of species to landscape fragmentation in a simple food chain.

    Science.gov (United States)

    Liao, Jinbao; Bearup, Daniel; Blasius, Bernd

    2017-09-01

    Habitat destruction, characterized by habitat loss and fragmentation, is a key driver of species extinction in spatial extended communities. Recently, there has been some progress in the theory of spatial food webs, however to date practically little is known about how habitat configurational fragmentation influences multi-trophic food web dynamics. To explore how habitat fragmentation affects species persistence in food webs, we introduce a modelling framework that describes the site occupancy of species in a tri-trophic system. We assume that species dispersal range increases with trophic level, exploiting pair-approximation techniques to describe the effect of habitat clustering. In accordance with the trophic rank hypothesis, both habitat loss and fragmentation generally cause species extinction, with stronger effects occurring at higher trophic levels. However, species display diverse responses (negative, neutral or positive) to habitat loss and fragmentation separately, depending on their dispersal range and trophic position. Counter-intuitively, prey species may benefit from habitat loss due to a release in top-down control. Similarly, habitat fragmentation has almost no influence on the site occupancy of the intermediate consumer in the tri-trophic system, though it decreases those of both basal species and top predator. Consequently, species' responses to habitat destruction vary as other species become extinct. Our results reiterate the importance of the interplay between bottom-up and top-down control in trophically linked communities, and highlight the complex responses occurring in even a simple food chain. © 2017 The Authors. Journal of Animal Ecology © 2017 British Ecological Society.

  12. Structures of endothiapepsin-fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library.

    Science.gov (United States)

    Huschmann, Franziska U; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S; Mueller, Uwe

    2016-05-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein-ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin-fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity.

  13. Structures of endothiapepsin–fragment complexes from crystallographic fragment screening using a novel, diverse and affordable 96-compound fragment library

    Science.gov (United States)

    Huschmann, Franziska U.; Linnik, Janina; Sparta, Karine; Ühlein, Monika; Wang, Xiaojie; Metz, Alexander; Schiebel, Johannes; Heine, Andreas; Klebe, Gerhard; Weiss, Manfred S.; Mueller, Uwe

    2016-01-01

    Crystallographic screening of the binding of small organic compounds (termed fragments) to proteins is increasingly important for medicinal chemistry-oriented drug discovery. To enable such experiments in a widespread manner, an affordable 96-compound library has been assembled for fragment screening in both academia and industry. The library is selected from already existing protein–ligand structures and is characterized by a broad ligand diversity, including buffer ingredients, carbohydrates, nucleotides, amino acids, peptide-like fragments and various drug-like organic compounds. When applied to the model protease endothiapepsin in a crystallographic screening experiment, a hit rate of nearly 10% was obtained. In comparison to other fragment libraries and considering that no pre-screening was performed, this hit rate is remarkably high. This demonstrates the general suitability of the selected compounds for an initial fragment-screening campaign. The library composition, experimental considerations and time requirements for a complete crystallographic fragment-screening campaign are discussed as well as the nine fully refined obtained endothiapepsin–fragment structures. While most of the fragments bind close to the catalytic centre of endothiapepsin in poses that have been observed previously, two fragments address new sites on the protein surface. ITC measurements show that the fragments bind to endothiapepsin with millimolar affinity. PMID:27139825

  14. Sexual conflict, life span, and aging.

    Science.gov (United States)

    Adler, Margo I; Bonduriansky, Russell

    2014-06-17

    The potential for sexual conflict to influence the evolution of life span and aging has been recognized for more than a decade, and recent work also suggests that variation in life span and aging can influence sexually antagonistic coevolution. However, empirical exploration of these ideas is only beginning. Here, we provide an overview of the ideas and evidence linking inter- and intralocus sexual conflicts with life span and aging. We aim to clarify the conceptual basis of this research program, examine the current state of knowledge, and suggest key questions for further investigation. Copyright © 2014 Cold Spring Harbor Laboratory Press; all rights reserved.

  15. Charmed-meson fragmentation functions with finite-mass corrections and their application in various processes

    Energy Technology Data Exchange (ETDEWEB)

    Kneesch, Torben

    2010-12-15

    We have calculated the single-inclusive production cross section of massive quarks in electron-positron-annihilation with next-to-leading order QCD corrections. With these results we have extracted fragmentation functions for the fragmentation from partons into D{sup 0}, D{sup +} and D{sup *} mesons, where we have used experimental data from the B factories Belle and CLEO and from the ALEPH and OPAL experiments at the LEP collider. In our analysis we have included the masses of c and b quarks and of the D mesons and tested the evolution of fragmentation functions with a global fit spanning the B factories' center-of-mass energy of {radical}(s)=10.5 GeV to LEP's run at the Z boson resonance at M{sub Z}. We have applied this fragmentation functions in deep inelastic scattering for comparisons with HERA data using parton cross sections from the literature available in program form. We have then modified this cross section to calculate predictions for deep inelastic two-photon-scattering. By applying the Weizsaecker-Williams spectrum on the real photon we have calculated predictions for LEP1, LEP2 and the future ILC experiments. For ILC we have also included a beamstrahlung spectrum. Finally we have calculated production cross sections for the planned e{gamma} mode of the ILC with the help of a Compton spectrum. (orig.)

  16. Towards a population synthesis model of self-gravitating disc fragmentation and tidal downsizing II: the effect of fragment-fragment interactions

    Science.gov (United States)

    Forgan, D. H.; Hall, C.; Meru, F.; Rice, W. K. M.

    2018-03-01

    It is likely that most protostellar systems undergo a brief phase where the protostellar disc is self-gravitating. If these discs are prone to fragmentation, then they are able to rapidly form objects that are initially of several Jupiter masses and larger. The fate of these disc fragments (and the fate of planetary bodies formed afterwards via core accretion) depends sensitively not only on the fragment's interaction with the disc, but also with its neighbouring fragments. We return to and revise our population synthesis model of self-gravitating disc fragmentation and tidal downsizing. Amongst other improvements, the model now directly incorporates fragment-fragment interactions while the disc is still present. We find that fragment-fragment scattering dominates the orbital evolution, even when we enforce rapid migration and inefficient gap formation. Compared to our previous model, we see a small increase in the number of terrestrial-type objects being formed, although their survival under tidal evolution is at best unclear. We also see evidence for disrupted fragments with evolved grain populations - this is circumstantial evidence for the formation of planetesimal belts, a phenomenon not seen in runs where fragment-fragment interactions are ignored. In spite of intense dynamical evolution, our population is dominated by massive giant planets and brown dwarfs at large semimajor axis, which direct imaging surveys should, but only rarely, detect. Finally, disc fragmentation is shown to be an efficient manufacturer of free-floating planetary mass objects, and the typical multiplicity of systems formed via gravitational instability will be low.

  17. Investigating the structure and fragmentation of a highly filamentary IRDC

    Science.gov (United States)

    Henshaw, J. D.; Caselli, P.; Fontani, F.; Jiménez-Serra, I.; Tan, J. C.; Longmore, S. N.; Pineda, J. E.; Parker, R. J.; Barnes, A. T.

    2016-11-01

    We present 3.7 arcsec (˜0.05 pc) resolution 3.2 mm dust continuum observations from the Institut de Radioastronomie Millimétrique Plateau de Bure Interferometer, with the aim of studying the structure and fragmentation of the filamentary infrared dark cloud (IRDC) G035.39-00.33. The continuum emission is segmented into a series of 13 quasi-regularly spaced (λobs ˜ 0.18 pc) cores, following the major axis of the IRDC. We compare the spatial distribution of the cores with that predicted by theoretical work describing the fragmentation of hydrodynamic fluid cylinders, finding a significant (a factor of ≳ 8) discrepancy between the two. Our observations are consistent with the picture emerging from kinematic studies of molecular clouds suggesting that the cores are harboured within a complex network of independent sub-filaments. This result emphasizes the importance of considering the underlying physical structure, and potentially, dynamically important magnetic fields, in any fragmentation analysis. The identified cores exhibit a range in (peak) beam-averaged column density (3.6 × 1023 cm-2 < NH, c < 8.0 × 1023 cm-2), mass (8.1 M⊙ < Mc < 26.1 M⊙), and number density (6.1 × 105 cm-3 < nH, c, eq < 14.7 × 105 cm-3). Two of these cores, dark in the mid-infrared, centrally concentrated, monolithic (with no traceable substructure at our PdBI resolution), and with estimated masses of the order ˜20-25 M⊙, are good candidates for the progenitors of intermediate-to-high-mass stars. Virial parameters span a range 0.2 < αvir < 1.3. Without additional support, possibly from dynamically important magnetic fields with strengths of the order of 230 μG < B < 670 μG, the cores are susceptible to gravitational collapse. These results may imply a multilayered fragmentation process, which incorporates the formation of sub-filaments, embedded cores, and the possibility of further fragmentation.

  18. Bose-Einstein correlations in W-pair decays

    CERN Document Server

    Barate, R; Ghez, P; Goy, C; Jézéquel, S; Lees, J P; Martin, F; Merle, E; Minard, M N; Pietrzyk, B; Alemany, R; Bravo, S; Casado, M P; Chmeissani, M; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Morawitz, P; Pacheco, A; Riu, I; Ruiz, H; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Boix, G; Buchmüller, O L; Cattaneo, M; Cerutti, F; Ciulli, V; Davies, G; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Greening, T C; Halley, A W; Hansen, J B; Harvey, J; Janot, P; Jost, B; Kado, M; Leroy, O; Maley, P; Mato, P; Minten, Adolf G; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tournefier, E; Valassi, Andrea; Wright, A E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Dessagne, S; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Pascolo, J M; Perret, P; Podlyski, F; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Swynghedauw, M; Tanaka, R; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Corden, M; Georgiopoulos, C H; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Chalmers, M; Kennedy, J; Lynch, J G; Negus, P; O'Shea, V; Räven, B; Smith, D; Teixeira-Dias, P; Thompson, A S; Ward, J J; Cavanaugh, R J; Dhamotharan, S; Geweniger, C; Hanke, P; Hepp, V; Kluge, E E; Leibenguth, G; Putzer, A; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Marinelli, N; Martin, E B; Nash, J; Nowell, J; Przysiezniak, H; Sciabà, A; Sedgbeer, J K; Thompson, J C; Thomson, E; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Ellis, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Robertson, N A; Smizanska, M; Williams, M I; Giehl, I; Hölldorfer, F; Jakobs, K; Kleinknecht, K; Kröcker, M; Müller, A S; Nürnberger, H A; Quast, G; Renk, B; Rohne, E; Sander, H G; Schmeling, S; Wachsmuth, H W; Zeitnitz, C; Ziegler, T; Aubert, Jean-Jacques; Bonissent, A; Carr, J; Coyle, P; Ealet, A; Fouchez, D; Tilquin, A; Aleppo, M; Antonelli, M; Gilardoni, S S; Ragusa, F; Büscher, V; Dietl, H; Ganis, G; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wiedenmann, W; Wolf, G; Azzurri, P; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Lefrançois, J; Serin, L; Veillet, J J; Videau, I; De Vivie de Régie, J B; Zerwas, D; Bagliesi, G; Boccali, T; Bozzi, C; Calderini, G; Dell'Orso, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sguazzoni, G; Tenchini, Roberto; Venturi, A; Verdini, P G; Blair, G A; Coles, J; Cowan, G D; Green, M G; Hutchcroft, D E; Jones, L T; Medcalf, T; Strong, J A; Botterill, David R; Clifft, R W; Edgecock, T R; Norton, P R; Tomalin, I R; Bloch-Devaux, B; Colas, P; Fabbro, B; Faïf, G; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Seager, P; Trabelsi, A; Tuchming, B; Vallage, B; Black, S N; Dann, J H; Loomis, C; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Hodgson, P N; Lehto, M H; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Grupen, Claus; Hess, J; Misiejuk, A; Prange, G; Sieler, U; Borean, C; Giannini, G; Gobbo, B; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Hayes, O J; Hu, H; Jin, S; Kile, J; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Von Wimmersperg-Töller, J H; Wu Sau Lan; Wu, X; Zobernig, G

    2000-01-01

    Bose-Einstein correlations are studied in semileptonicWW --> qqbarlnu and fully hadronic WW --> qqbarqqbar W-pair decays with the ALEPH detector at LEP at centre-of-mass energies of 172, 183 and 189GeV. They are compared with those made at the Z peak after correction for the different flavour compositions. A Monte Carlo model of Bose-Einsteincorrelations based on the JETSET hadronization scheme was tuned to the Z data and reproduces the correlations in the WW --> qqbarlnu events. The same Monte Carlo reproduces the correlations in the WW --> qqbarqqbarchannel assuming independent fragmentation of the two W's. A variant thismodel with Bose-Einstein correlations between decay products of different W's is disfavoured.

  19. Spanning forests and the vector bundle Laplacian

    OpenAIRE

    Kenyon, Richard

    2011-01-01

    The classical matrix-tree theorem relates the determinant of the combinatorial Laplacian on a graph to the number of spanning trees. We generalize this result to Laplacians on one- and two-dimensional vector bundles, giving a combinatorial interpretation of their determinants in terms of so-called cycle rooted spanning forests (CRSFs). We construct natural measures on CRSFs for which the edges form a determinantal process. ¶ This theory gives a natural generalization of the spanning tre...

  20. An Amazonian rainforest and its fragments as a laboratory of global change.

    Science.gov (United States)

    Laurance, William F; Camargo, José L C; Fearnside, Philip M; Lovejoy, Thomas E; Williamson, G Bruce; Mesquita, Rita C G; Meyer, Christoph F J; Bobrowiec, Paulo E D; Laurance, Susan G W

    2018-02-01

    We synthesize findings from one of the world's largest and longest-running experimental investigations, the Biological Dynamics of Forest Fragments Project (BDFFP). Spanning an area of ∼1000 km 2 in central Amazonia, the BDFFP was initially designed to evaluate the effects of fragment area on rainforest biodiversity and ecological processes. However, over its 38-year history to date the project has far transcended its original mission, and now focuses more broadly on landscape dynamics, forest regeneration, regional- and global-change phenomena, and their potential interactions and implications for Amazonian forest conservation. The project has yielded a wealth of insights into the ecological and environmental changes in fragmented forests. For instance, many rainforest species are naturally rare and hence are either missing entirely from many fragments or so sparsely represented as to have little chance of long-term survival. Additionally, edge effects are a prominent driver of fragment dynamics, strongly affecting forest microclimate, tree mortality, carbon storage and a diversity of fauna. Even within our controlled study area, the landscape has been highly dynamic: for example, the matrix of vegetation surrounding fragments has changed markedly over time, succeeding from large cattle pastures or forest clearcuts to secondary regrowth forest. This, in turn, has influenced the dynamics of plant and animal communities and their trajectories of change over time. In general, fauna and flora have responded differently to fragmentation: the most locally extinction-prone animal species are those that have both large area requirements and low tolerance of the modified habitats surrounding fragments, whereas the most vulnerable plants are those that respond poorly to edge effects or chronic forest disturbances, and that rely on vulnerable animals for seed dispersal or pollination. Relative to intact forests, most fragments are hyperdynamic, with unstable or fluctuating

  1. Coupling Matched Molecular Pairs with Machine Learning for Virtual Compound Optimization.

    Science.gov (United States)

    Turk, Samo; Merget, Benjamin; Rippmann, Friedrich; Fulle, Simone

    2017-12-26

    Matched molecular pair (MMP) analyses are widely used in compound optimization projects to gain insights into structure-activity relationships (SAR). The analysis is traditionally done via statistical methods but can also be employed together with machine learning (ML) approaches to extrapolate to novel compounds. The here introduced MMP/ML method combines a fragment-based MMP implementation with different machine learning methods to obtain automated SAR decomposition and prediction. To test the prediction capabilities and model transferability, two different compound optimization scenarios were designed: (1) "new fragments" which occurs when exploring new fragments for a defined compound series and (2) "new static core and transformations" which resembles for instance the identification of a new compound series. Very good results were achieved by all employed machine learning methods especially for the new fragments case, but overall deep neural network models performed best, allowing reliable predictions also for the new static core and transformations scenario, where comprehensive SAR knowledge of the compound series is missing. Furthermore, we show that models trained on all available data have a higher generalizability compared to models trained on focused series and can extend beyond chemical space covered in the training data. Thus, coupling MMP with deep neural networks provides a promising approach to make high quality predictions on various data sets and in different compound optimization scenarios.

  2. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  3. Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

    Science.gov (United States)

    Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

    2017-11-16

     Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

  4. Multi-pair states in electron–positron pair creation

    Directory of Open Access Journals (Sweden)

    Anton Wöllert

    2016-09-01

    Full Text Available Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  5. Multi-pair states in electron–positron pair creation

    Energy Technology Data Exchange (ETDEWEB)

    Wöllert, Anton, E-mail: woellert@mpi-hd.mpg.de; Bauke, Heiko, E-mail: heiko.bauke@mpi-hd.mpg.de; Keitel, Christoph H.

    2016-09-10

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  6. Multi-pair states in electron–positron pair creation

    International Nuclear Information System (INIS)

    Wöllert, Anton; Bauke, Heiko; Keitel, Christoph H.

    2016-01-01

    Ultra strong electromagnetic fields can lead to spontaneous creation of single or multiple electron–positron pairs. A quantum field theoretical treatment of the pair creation process combined with numerical methods provides a description of the fermionic quantum field state, from which all observables of the multiple electron–positron pairs can be inferred. This allows to study the complex multi-particle dynamics of electron–positron pair creation in-depth, including multi-pair statistics as well as momentum distributions and spin. To illustrate the potential benefit of this approach, it is applied to the intermediate regime of pair creation between nonperturbative Schwinger pair creation and perturbative multiphoton pair creation where the creation of multi-pair states becomes nonnegligible but cascades do not yet set in. Furthermore, it is demonstrated how spin and helicity of the created electrons and positrons are affected by the polarization of the counterpropagating laser fields, which induce the creation of electron–positron pairs.

  7. Span efficiency in hawkmoths.

    Science.gov (United States)

    Henningsson, Per; Bomphrey, Richard J

    2013-07-06

    Flight in animals is the result of aerodynamic forces generated as flight muscles drive the wings through air. Aerial performance is therefore limited by the efficiency with which momentum is imparted to the air, a property that can be measured using modern techniques. We measured the induced flow fields around six hawkmoth species flying tethered in a wind tunnel to assess span efficiency, ei, and from these measurements, determined the morphological and kinematic characters that predict efficient flight. The species were selected to represent a range in wingspan from 40 to 110 mm (2.75 times) and in mass from 0.2 to 1.5 g (7.5 times) but they were similar in their overall shape and their ecology. From high spatio-temporal resolution quantitative wake images, we extracted time-resolved downwash distributions behind the hawkmoths, calculating instantaneous values of ei throughout the wingbeat cycle as well as multi-wingbeat averages. Span efficiency correlated positively with normalized lift and negatively with advance ratio. Average span efficiencies for the moths ranged from 0.31 to 0.60 showing that the standard generic value of 0.83 used in previous studies of animal flight is not a suitable approximation of aerodynamic performance in insects.

  8. Malingering in Toxic Exposure. Classification Accuracy of Reliable Digit Span and WAIS-III Digit Span Scaled Scores

    Science.gov (United States)

    Greve, Kevin W.; Springer, Steven; Bianchini, Kevin J.; Black, F. William; Heinly, Matthew T.; Love, Jeffrey M.; Swift, Douglas A.; Ciota, Megan A.

    2007-01-01

    This study examined the sensitivity and false-positive error rate of reliable digit span (RDS) and the WAIS-III Digit Span (DS) scaled score in persons alleging toxic exposure and determined whether error rates differed from published rates in traumatic brain injury (TBI) and chronic pain (CP). Data were obtained from the files of 123 persons…

  9. Signal Enhancement with Variable Span Linear Filters

    DEFF Research Database (Denmark)

    Benesty, Jacob; Christensen, Mads Græsbøll; Jensen, Jesper Rindom

    This book introduces readers to the novel concept of variable span speech enhancement filters, and demonstrates how it can be used for effective noise reduction in various ways. Further, the book provides the accompanying Matlab code, allowing readers to easily implement the main ideas discussed....... Variable span filters combine the ideas of optimal linear filters with those of subspace methods, as they involve the joint diagonalization of the correlation matrices of the desired signal and the noise. The book shows how some well-known filter designs, e.g. the minimum distortion, maximum signal......-to-noise ratio, Wiener, and tradeoff filters (including their new generalizations) can be obtained using the variable span filter framework. It then illustrates how the variable span filters can be applied in various contexts, namely in single-channel STFT-based enhancement, in multichannel enhancement in both...

  10. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  11. Electrode spanning with partial tripolar stimulation mode in cochlear implants.

    Science.gov (United States)

    Wu, Ching-Chih; Luo, Xin

    2014-12-01

    The perceptual effects of electrode spanning (i.e., the use of nonadjacent return electrodes) in partial tripolar (pTP) mode were tested on a main electrode EL8 in five cochlear implant (CI) users. Current focusing was controlled by σ (the ratio of current returned within the cochlea), and current steering was controlled by α (the ratio of current returned to the basal electrode). Experiment 1 tested whether asymmetric spanning with α = 0.5 can create additional channels around standard pTP stimuli. It was found that in general, apical spanning (i.e., returning current to EL6 rather than EL7) elicited a pitch between those of standard pTP stimuli on main electrodes EL8 and EL9, while basal spanning (i.e., returning current to EL10 rather than EL9) elicited a pitch between those of standard pTP stimuli on main electrodes EL7 and EL8. The pitch increase caused by apical spanning was more salient than the pitch decrease caused by basal spanning. To replace the standard pTP channel on the main electrode EL8 when EL7 or EL9 is defective, experiment 2 tested asymmetrically spanned pTP stimuli with various α, and experiment 3 tested symmetrically spanned pTP stimuli with various σ. The results showed that pitch increased with decreasing α in asymmetric spanning, or with increasing σ in symmetric spanning. Apical spanning with α around 0.69 and basal spanning with α around 0.38 may both elicit a similar pitch as the standard pTP stimulus. With the same σ, the symmetrically spanned pTP stimulus was higher in pitch than the standard pTP stimulus. A smaller σ was thus required for symmetric spanning to match the pitch of the standard pTP stimulus. In summary, electrode spanning is an effective field-shaping technique that is useful for adding spectral channels and handling defective electrodes with CIs.

  12. [Effects of habitat fragmentation on nesting site selection of red-crowned crane].

    Science.gov (United States)

    Wan, Dongmei; Gao, Wei; Wang, Qiuyu; Wang, Haitao; Liu, Mingyu

    2002-05-01

    During April and May of 1985, 1995 and 1998, red-crowned crane's nesting and variation of breeding population quantities in Shuangtaihekou National Natural Reserve in Liaoning, and also the habitat fragmentation there were investigated. Associated with previous data of the reserve, red-crowned crane's nesting habitat had been seriously fragmentated into 91 patches from one integrated reed wetland. The area of the smallest patch was 0.37 km2, and the minimum distance of two nests was 304 m. Compared with records of previous data, the minimum area of nesting habitat reduced by 0.72 km2. However, the breeding population quantities of red-crowned crane had maintained at about 30 pairs for a long period. The red-crowned crane adapted to the changed environment by the ecological adaptation strategy of reducing area of nesting habitat.

  13. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  14. Jet shape and fragmentation function measurements with CMS

    International Nuclear Information System (INIS)

    Mao, Yaxian

    2014-01-01

    We present measurements of the jet fragmentation functions and transverse momentum profiles (shapes) in PbPb collisions at √(s NN )=2.76 TeV per nucleon-pair center-of-mass energy with the CMS detector. Jets are reconstructed by the anti-k T sequential clustering algorithm with a resolution parameter of 0.3, using particle-flow objects that combine tracking and calorimetric information. In this proceedings the jet properties of inclusive jets with transverse momentum p T >100 GeV/c in PbPb collisions are measured for reconstructed charged particles with p T >1 GeV/c in a cone of radius √(Δϕ 2 +Δη 2 )=0.3 around the jet axis. A data sample of PbPb collisions collected in 2011 at a center-of-mass energy of √(s NN )=2.76 TeV corresponding to an integrated luminosity of 150 μb −1 is used. The results for PbPb collisions as a function of collision centrality are compared to reference distributions based on the full 2013 pp statistics collected at the same collision energy. Centrality-dependent modifications of the fragmentation functions and shapes are revealed

  15. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  16. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  17. Application of the fragment molecular orbital method analysis to fragment-based drug discovery of BET (bromodomain and extra-terminal proteins) inhibitors.

    Science.gov (United States)

    Ozawa, Motoyasu; Ozawa, Tomonaga; Ueda, Kazuyoshi

    2017-06-01

    The molecular interactions of inhibitors of bromodomains (BRDs) were investigated. BRDs are protein interaction modules that recognizing ε-N-acetyl-lysine (εAc-Lys) motifs found in histone tails and are promising protein-protein interaction (PPI) targets. First, we analyzed a peptide ligand containing εAc-Lys to evaluate native PPIs. We then analyzed tetrahydroquinazoline-6-yl-benzensulfonamide derivatives found by fragment-based drug design (FBDD) and examined their interactions with the protein compared with the peptide ligand in terms of the inter-fragment interaction energy. In addition, we analyzed benzodiazepine derivatives that are high-affinity ligands for BRDs and examined differences in the CH/π interactions of the amino acid residues. We further surveyed changes in the charges of the amino acid residues among individual ligands, performed pair interaction energy decomposition analysis and estimated the water profile within the ligand binding site. Thus, useful insights for drug design were provided. Through these analyses and considerations, we show that the FMO method is a useful drug design tool to evaluate the process of FBDD and to explore PPI inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. The SPAN cookbook: A practical guide to accessing SPAN

    Science.gov (United States)

    Mason, Stephanie; Tencati, Ronald D.; Stern, David M.; Capps, Kimberly D.; Dorman, Gary; Peters, David J.

    1990-01-01

    This is a manual for remote users who wish to send electronic mail messages from the Space Physics Analysis Network (SPAN) to scientific colleagues on other computer networks and vice versa. In several instances more than one gateway has been included for the same network. Users are provided with an introduction to each network listed with helpful details about accessing the system and mail syntax examples. Also included is information on file transfers, remote logins, and help telephone numbers.

  19. Radiation effects on life span in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Johnson, T.E.; Hartman, P.S.

    1988-01-01

    Wild-type and radiation-sensitive (Rad) mutants of Caenorhabditis elegans were irradiated using a 137 Cs source (2.7 krads/min.) at several developmental stages and subsequently monitored for life span. Acute doses of radiation ranged from 1 krad to 300 krads. All stages required doses above 100 krads to reduce mean life span. Dauers and third stage larvae were more sensitive, and 8-day-old adults were the most resistant. Occasional statistically significant but nonrepeatable increases in survival were observed after intermediate levels of irradiation (10-30 krads). Unirradiated rad-4 and rad-7 had life spans similar to wild-type; all others had a significant reduction in survival. The mutants were about as sensitive as wild-type to the effects of ionizing radiation including occasional moderate life span extensions at intermediate doses. We conclude that the moderate life span extensions sometimes observed after irradiation are likely to be mediated by a means other than the induction of DNA repair enzymes

  20. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    /child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  1. 23 CFR 650.809 - Movable span bridges.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Movable span bridges. 650.809 Section 650.809 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS BRIDGES, STRUCTURES, AND HYDRAULICS Navigational Clearances for Bridges § 650.809 Movable span bridges. A fixed bridge...

  2. Signal enhancement with variable span linear filters

    CERN Document Server

    Benesty, Jacob; Jensen, Jesper R

    2016-01-01

    This book introduces readers to the novel concept of variable span speech enhancement filters, and demonstrates how it can be used for effective noise reduction in various ways. Further, the book provides the accompanying Matlab code, allowing readers to easily implement the main ideas discussed. Variable span filters combine the ideas of optimal linear filters with those of subspace methods, as they involve the joint diagonalization of the correlation matrices of the desired signal and the noise. The book shows how some well-known filter designs, e.g. the minimum distortion, maximum signal-to-noise ratio, Wiener, and tradeoff filters (including their new generalizations) can be obtained using the variable span filter framework. It then illustrates how the variable span filters can be applied in various contexts, namely in single-channel STFT-based enhancement, in multichannel enhancement in both the time and STFT domains, and, lastly, in time-domain binaural enhancement. In these contexts, the properties of ...

  3. A fragmentation study of kaempferol using electrospray quadrupole time-of-flight mass spectrometry at high mass resolution

    Science.gov (United States)

    March, Raymond E.; Miao, Xiu-Sheng

    2004-02-01

    A mass spectrometric method based on the combined use of electrospray ionization, collision-induced dissociation and tandem mass spectrometry at high mass resolution has been applied to an investigation of the structural characterization of protonated and deprotonated kaempferol (3,5,7,4'-tetrahydroxyflavone). Low-energy product ion mass spectra of [M+H]+ ions showed simple fragmentations of the C ring that permitted characterization of the substituents in the A and B rings. In addition, four rearrangement reactions accompanied by losses of C2H2O, CHO[radical sign], CO, and H2O were observed. Low-energy product ion mass spectra of [M-H]- ions showed only four rearrangement reactions accompanied by losses of OH[radical sign], CO, CH2O, and C2H2O. The use of elevated cone voltages permitted observation of product ion mass spectra of selected primary and secondary fragment ions so that each fragment ion reported was observed as a direct product of its immediate precursor ion. Product ion mass spectra examined at high mass resolution allowed unambiguous determination of the elemental composition of fragment ions and resolution of two pairs of isobars. Fragmentation mechanisms and ion structures have been proposed.

  4. CALCULATION OF FRAGMENTATION FUNCTIONS IN TWO-HADRON SEMI-INCLUSIVE PROCESSES

    International Nuclear Information System (INIS)

    BIANCONI, A.; BOFFI, S.; BOER, D.; JAKOB, R.; RADICI, M.

    2001-01-01

    We investigate the properties of interference fragmentation functions arising from the emission of two leading hadrons inside the same jet for inclusive lepton-nucleon deep inelastic scattering. Using an extended spectator model for the mechanism of the hadronization, we give a complete calculation and numerical estimates for the examples of a proton-pion pair produced with invariant mass on the Roper resonance, and of two pions produced with invariant mass close to the ρ mass. We discuss azimuthal angular dependence of the leading order cross section to point up favourable conditions for extracting transversity from experimental data

  5. Ionic fragmentation of the isoprene molecule in the VUV energy range (12 to 310 eV)

    Energy Technology Data Exchange (ETDEWEB)

    Bernini, R.B., E-mail: rafael.bernini@ifrj.edu.br [Instituto Federal de Ciência e Tecnologia do Rio de Janeiro (IFRJ), 25050-100 Duque de Caxias, RJ (Brazil); Coutinho, L.H. [Instituto de Física, Universidade Federal do Rio De Janeiro (UFRJ), 21941-972 Rio de Janeiro, RJ (Brazil); Nunez, C.V. [Laboratório de Bioprospecção e Biotecnologia, Coordenação de Tecnologia e Inovação, Instituto Nacional de Pesquisas da Amazônia (INPA), 69060-001 Manaus, AM (Brazil); Castilho, R.B. de [Departamento de Química, Instituto de Ciências Exatas, Universidade Federal do Amazonas (UFAM), 69077-000 Manaus, AM (Brazil); Souza, G.G.B. de [Instituto de Química, Universidade Federal do Rio de Janeiro (UFRJ), 21949-900 Rio de Janeiro, RJ (Brazil)

    2015-07-15

    Highlights: • Ionic fragmentation of isoprene following valence-shell and C 1s excitation. • Experimental observation of single and double ionization processes. • Large increase in fragmentation following core excitation. • Similar dissociation pattern bellow (270 eV) and above (310 eV) core edge. • Stable molecular ion observed at all photon energies. - Abstract: Isoprene, C{sub 5}H{sub 8}, is a biogenic volatile compound emitted from plants and animals, playing an important role in atmospheric chemistry. In this work, we have studied the ionic fragmentation of the isoprene molecule induced by high energy photons (synchrotron radiation), both at the valence (12.0, 14.0, 16.0, 18.0, and 21.0 eV) and carbon 1s edge (270 and 310 eV, respectively, below and above edge) energies. The ionic fragments were mass-analyzed using a Wiley–McLaren time-of-flight spectrometer (TOF) and single (PEPICO) and double ionization coincidence (PEPIPICO) spectra were obtained. As expected, the fragmentation degree increases with increasing energy. Below and above the carbon 1s edge, the fragmentation patterns are quite similar, and basically the same fragments are observed as compared to the spectra following valence-shell ionization. Stable doubly-charged ions were not observed. A PEPIPICO spectrum has shown that the main dissociation route for doubly-ionized species corresponds to the [CH{sub 3}]{sup +}/[C{sub 4}H{sub 2–5}]{sup +} ion pair. Intense fragmentation of the isoprene molecule has been observed following valence shell and core electron ionization. The observance of basically the same fragments when moving from valence to inner-shell suggests that basically the same fragmentation routes are present in both cases. All doubly (or multiply)-charged cations are unstable, at least on a microsecond scale.

  6. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  7. Effect of molecular structure on fragmentation of isolated organic molecules in solid rare gas matrices

    International Nuclear Information System (INIS)

    Kobzarenko, A.V.; Sukhov, F.F.; Orlov, A.Yu.; Kovalev, G.V.; Baranova, I.A.; Feldman, V.I.

    2012-01-01

    The effect of excess energy on the primary radical cations of bifunctional carbonyl compounds and aliphatic alkynes was simulated by matrix isolation method using rare gas matrices with various ionization potentials. The formation of fragmentation products was monitored by EPR and FTIR spectroscopy. It was shown that the radical cations of bifunctional compounds (CH 3 OCH 2 COCH 3 and CH 3 COCOCH 3 ) dissociated effectively yielding · CH 3 radicals upon irradiation in solid argon matrix at T≤16 K. In addition to isolated methyl radicals, the radical pairs consisting of two methyl radicals separated by two CO molecules were detected in the case of diacetyl. The probability of fragmentation decreases with the decreasing excess energy by switching from Ar to Xe. In general, bifunctional molecules were found to be less stable to “hot” ionic fragmentation in low-temperature solids in comparison with simple prototype compounds. In the case of alkynes of the R--C≡CH type, a noticeable yield of fragmentation products was observed when R=–C(CH 3 ) 3 , but it was negligible for R=–CH 3 . The mechanisms of “hot” reactions and excess energy relaxation are discussed. - Highlights: ► Radiolysis of bifunctional organic compounds and alkynes. ► Dependence of “hot” fragmentation probability from molecular structure. ► Ions of bifunctional compounds are less stable than those of monofunctional ones. ► Alkynes are rather stable to “hot” fragmentation.

  8. Hydrogen bond disruption in DNA base pairs from (14)C transmutation.

    Science.gov (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A

    2014-09-04

    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  9. Multitemporal analysis of forest fragmentation in Hindu Kush Himalaya-a case study from Khangchendzonga Biosphere Reserve, Sikkim, India.

    Science.gov (United States)

    Sharma, Mohit; Areendran, G; Raj, Krishna; Sharma, Ankita; Joshi, P K

    2016-10-01

    Forests in the mountains are a treasure trove; harbour a large biodiversity; and provide fodder, firewood, timber and non-timber forest products; all of these are essential for human survival in the highest mountains on earth. The present paper attempts a spatiotemporal assessment of forest fragmentation and changes in land use land cover (LULC) pattern using multitemporal satellite data over a time span of around a decade (2000-2009), within the third highest protected area (PA) in the world. The fragmentation analysis using Landscape Fragmentation Tool (LFT) depicts a decrease in large core, edge and patches areas by 5.93, 3.64 and 0.66 %, respectively, while an increase in non-forest and perforated areas by 6.59 and 4.01 %, respectively. The land cover dynamics shows a decrease in open forest, alpine scrub, alpine meadows, snow and hill shadow areas by 2.81, 0.39, 8.18, 3.46 and 0.60 %, respectively, and there is an increase in dense forest and glacier area by 4.79 and 10.65 %, respectively. The change analysis shows a major transformation in areas from open forest to dense forest and from alpine meadows to alpine scrub. In order to quantify changes induced by forest fragmentation and to characterize composition and configuration of LULC mosaics, fragmentation indices were computed using Fragstats at class level, showing the signs of accelerated fragmentation. The outcome of the analysis revealed the effectiveness of geospatial tools coupled with landscape ecology in characterization and quantification of forest fragmentation and land cover changes. The present study provides a baseline database for sustainable conservation planning that will benefit the subsistence livelihoods in the region. Recommendations made based on the present analysis will help to recover forest and halt the pessimistic effects of fragmentation and land cover changes on biodiversity and ecosystem services in the region.

  10. A Motivational Theory of Life-Span Development

    Science.gov (United States)

    Heckhausen, Jutta; Wrosch, Carsten; Schulz, Richard

    2010-01-01

    This article had four goals. First, the authors identified a set of general challenges and questions that a life-span theory of development should address. Second, they presented a comprehensive account of their Motivational Theory of Life-Span Development. They integrated the model of optimization in primary and secondary control and the…

  11. The use of passwords to introduce theconcepts of spanning set and span

    Directory of Open Access Journals (Sweden)

    Andrea Cárcamo

    2017-01-01

    Full Text Available The aim of this paper is to present a proposal for teaching linear algebra based on heuristic of emergent models and mathematical modelling. This proposal begins with a problematic situation  related  to  the  creation  and  use  of  secure  passwords,  which  leads  first-year  students  of  engineering  toward  the  construction  of  the  concepts  of  spanning  set  and  span. The  proposal  is  designed  from  the  results  of  the  two  cycles  of  experimentation  teaching, design-based  research,  which  give  evidence  that  allows  students  to  progress  from  a  situation in a real context to the concepts of linear algebra. This proposal, previously adapted, could have similar results when applied to another group of students.

  12. Diet and prey availability of terrestrial insectivorous birds prone to extinction in amazonian forest fragments

    Directory of Open Access Journals (Sweden)

    Luiz Augusto Macedo Mestre

    2010-12-01

    Full Text Available This study compared niche breath, prey size, and diet variability in two pairs of sympatric species of terrestrial insectivorous birds, each pair containing one species that can persist in small forest fragments and one that does not. The pairs were Myrmeciza ferruginea and Sclerurus rufigularis; and Formicarius colma and F. analis, respectively. The prey availability in forest fragments was also sampled and compared to the availability in continuous forests. Niche breath indices did not differ between pair members, but diet variability differed in the opposite direction from that hypothesized. Although the two bird species most vulnerable to fragmentation fed on larger prey than less vulnerable species, prey availability, including that based on prey size did not differ among fragmented versus continuous forest sites. Thus, diet per se appeared not to be an important cause of extinction-proneness in these species. The simplest explanation proposed, that vulnerability to fragmentation was directly related to territory size, requires testing. However, it was consistent with observations that the bird species feeding on larger prey also need larger territories.Dieta e disponibilidade de presas de aves insetívoras terrestres em fragmentos florestais amazônicos. As aves insetívoras terrestres são um dos grupos mais vulneráveis à fragmentação de florestas tropicais; no entanto algumas espécies desta guilda ainda sobrevivem em fragmentos florestais e em florestas secundárias. Se a sensibilidade destas aves à fragmentação de florestas estivesse associada à dieta, então espécies com a dieta relativamente flexível teriam maior propensão em persistir nos fragmentos florestais. Este estudo comparou sobreposição trófica, amplitude de nicho, tamanho de presas e variabilidade de dieta de dois pares de espécies de aves insetívoras terrestres, onde cada par foi composto por uma espécie que persiste nos fragmentos e outra que n

  13. Fission fragment mass and total kinetic energy distributions of spontaneously fissioning plutonium isotopes

    Science.gov (United States)

    Pomorski, K.; Nerlo-Pomorska, B.; Bartel, J.; Schmitt, C.

    2018-03-01

    The fission-fragment mass and total kinetic energy (TKE) distributions are evaluated in a quantum mechanical framework using elongation, mass asymmetry, neck degree of freedom as the relevant collective parameters in the Fourier shape parametrization recently developed by us. The potential energy surfaces (PES) are calculated within the macroscopic-microscopic model based on the Lublin-Strasbourg Drop (LSD), the Yukawa-folded (YF) single-particle potential and a monopole pairing force. The PES are presented and analysed in detail for even-even Plutonium isotopes with A = 236-246. They reveal deep asymmetric valleys. The fission-fragment mass and TKE distributions are obtained from the ground state of a collective Hamiltonian computed within the Born-Oppenheimer approximation, in the WKB approach by introducing a neck-dependent fission probability. The calculated mass and total kinetic energy distributions are found in good agreement with the data.

  14. EU Regulation of E-Commercspan>e A Commentary

    NARCIS (Netherlands)

    Lodder, A.R.; Murray, A.D.

    2017-01-01

    For the last twenty years the European Union has been extremely active in the field of e-commercspan>e. This important new book addresses the key pieces of EU legislation in the field of e-commercspan>e, including the E-Commercspan>e Directive, the Services Directive, the Consumer Directive, the General Data

  15. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  16. Observations of radiation-induced chromosome fragment loss in live mammalian cells in culture, and its effect on colony-forming ability

    International Nuclear Information System (INIS)

    Grote, S.J.; Joshi, G.P.; Revell, S.H.; Shaw, C.A.

    1981-01-01

    A preceding paper (Grote, Joshi, Revell and Shaw 1981) describe a method for the direct scrutiny of live cultured mammalian cells with a microscope, and reported that all diploid Syrian hamster cells (BHK 21 C13) of a sample given 1.4 Gy of 220 kV X-rays in G1 reached post-radiation mitosis without discernible abnormality, but then diverged in observed behaviour: descendant cells from some first mitoses continued to proliferate normally while cells from other first mitoses behaved abnormally and produced either slow-growth or stop-growth colonies. This paper completes the study of the same irradiated cell sample, and shows that these post-mitotic differences in clonogenic ability were related to acentric chromosome fragment losses at post-radiation mitosis, which were detected in live daughter-cell pairs as micronuclei. The proportion of live daughter-cell pairs scored as deficient was at least 80 per cent of the proportion of comparable fixed-and-stained mitoses with detected acentric fragments. (author)

  17. A sensitive short read homology search tool for paired-end read sequencing data.

    Science.gov (United States)

    Techa-Angkoon, Prapaporn; Sun, Yanni; Lei, Jikai

    2017-10-16

    Homology search is still a significant step in functional analysis for genomic data. Profile Hidden Markov Model-based homology search has been widely used in protein domain analysis in many different species. In particular, with the fast accumulation of transcriptomic data of non-model species and metagenomic data, profile homology search is widely adopted in integrated pipelines for functional analysis. While the state-of-the-art tool HMMER has achieved high sensitivity and accuracy in domain annotation, the sensitivity of HMMER on short reads declines rapidly. The low sensitivity on short read homology search can lead to inaccurate domain composition and abundance computation. Our experimental results showed that half of the reads were missed by HMMER for a RNA-Seq dataset. Thus, there is a need for better methods to improve the homology search performance for short reads. We introduce a profile homology search tool named Short-Pair that is designed for short paired-end reads. By using an approximate Bayesian approach employing distribution of fragment lengths and alignment scores, Short-Pair can retrieve the missing end and determine true domains. In particular, Short-Pair increases the accuracy in aligning short reads that are part of remote homologs. We applied Short-Pair to a RNA-Seq dataset and a metagenomic dataset and quantified its sensitivity and accuracy on homology search. The experimental results show that Short-Pair can achieve better overall performance than the state-of-the-art methodology of profile homology search. Short-Pair is best used for next-generation sequencing (NGS) data that lack reference genomes. It provides a complementary paired-end read homology search tool to HMMER. The source code is freely available at https://sourceforge.net/projects/short-pair/ .

  18. Magnetic Pair Creation Attenuation Altitude Constraints in Gamma-Ray Pulsars

    Science.gov (United States)

    Baring, Matthew; Story, Sarah

    The Fermi gamma-ray pulsar database now exceeds 150 sources and has defined an important part of Fermi's science legacy, providing rich information for the interpretation of young energetic pulsars and old millisecond pulsars. Among the well established population characteristics is the common occurrence of exponential turnovers in the 1-10 GeV range. These turnovers are too gradual to arise from magnetic pair creation in the strong magnetic fields of pulsar inner magnetospheres, so their energy can be used to provide lower bounds to the typical altitude of GeV band emission. We explore such constraints due to single-photon pair creation transparency at and below the turnover energy. Our updated computations span both domains when general relativistic influences are important and locales where flat spacetime photon propagation is modified by rotational aberration effects. The altitude bounds, typically in the range of 2-5 stellar radii, provide key information on the emission altitude in radio quiet pulsars that do not possess double-peaked pulse profiles. However, the exceptional case of the Crab pulsar provides an altitude bound of around 20% of the light cylinder radius if pair transparency persists out to 350 GeV, the maximum energy detected by MAGIC. This is an impressive new physics-based constraint on the Crab's gamma-ray emission locale.

  19. Fundamental study of hydrogen-attachment-induced peptide fragmentation occurring in the gas phase and during the matrix-assisted laser desorption/ionization process.

    Science.gov (United States)

    Asakawa, Daiki; Takahashi, Hidenori; Iwamoto, Shinichi; Tanaka, Koichi

    2018-05-09

    Mass spectrometry with hydrogen-radical-mediated fragmentation techniques has been used for the sequencing of proteins/peptides. The two methods, matrix-assisted laser desorption/ionization in-source decay (MALDI-ISD) and hydrogen attachment/abstraction dissociation (HAD) are known as hydrogen-radical-mediated fragmentation techniques. MALDI-ISD occurs during laser induced desorption processes, whereas HAD utilizes the association of hydrogen with peptide ions in the gas phase. In this study, the general mechanisms of MALDI-ISD and HAD of peptides were investigated. We demonstrated the fragmentation of four model peptides and investigated the fragment formation pathways using density functional theory (DFT) calculations. The current experimental and computational joint study indicated that MALDI-ISD and HAD produce aminoketyl radical intermediates, which immediately undergo radical-induced cleavage at the N-Cα bond located on the C-terminal side of the radical site, leading to the c'/z˙ fragment pair. In the case of MALDI-ISD, the z˙ fragments undergo a subsequent reaction with the matrix to give z' and matrix adducts of the z fragments. In contrast, the c' and z˙ fragments react with hydrogen atoms during the HAD processes, and various fragment species, such as c˙, c', z˙ and z', were observed in the HAD-MS/MS mass spectra.

  20. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  1. Role of pn-pairs in nuclear structure

    International Nuclear Information System (INIS)

    Nie, G.K.

    2003-01-01

    -clusters, or in fragment of molecular, glued to the surface of the liquid drop. Isospin invariance of nuclear forces is embodied as demand of equivalence of proton and neutron nuclear potentials in one pn-pair. Then the difference between proton and neutron binding energy ΔE has to be defined by Coulomb potential in which the α- cluster is placed. In frame of this model radius of proton's positions have been calculated taking into account the placement of clusters according shell model and the root mean square radii of nuclei have been calculated for nuclei from 4 He to 44 Ti with very good agreement with experimental values. For nuclei from 46 V to 58 Cu ΔE and size of last shell as well as size of the nuclei have been estimated. In the model presented here features of 4 main basic models of nuclear structure: liquid drop model, boson, shell and α-cluster models, have been married

  2. Diferença entre span verbal e visual nos gêneros: estudo piloto Difference between verbal and visual span in genders: pilot study

    Directory of Open Access Journals (Sweden)

    Mariana Cristina Pedrassa Sagrilo

    2012-01-01

    Full Text Available OBJETIVO: avaliar a memória de trabalho analisando a capacidade de retenção de estímulos auditivos (span verbal e visuais (span visual e estabelecer a relação com o gênero (masculino e feminino. MÉTODO: participaram deste estudo 20 crianças entre seis anos e cinco meses e sete anos, sendo 10 sujeitos do sexo masculino e 10 sujeitos do sexo feminino. Todos os sujeitos foram submetidos às provas de avaliação do span verbal e visual em ordem direta e inversa. RESULTADOS: apenas na prova de palavras dissílabas com fonologia semelhante e semântica diferente do span verbal, houve variância significante entre os gêneros. As crianças do sexo feminino apresentaram melhor desempenho em relação ao outro gênero, bem como maior capacidade de retenção de palavras dissílabas com fonologia e semântica diferentes. No span visual (ordem direta e inversa as crianças do sexo masculino obtiveram melhor desempenho, apesar de não ter diferenças significantes. Em relação à idade não houve diferença de retenção de estímulos. CONCLUSÃO: as crianças do sexo feminino, neste estudo, apresentaram tendência à melhor desempenho do span verbal e as crianças do sexo masculino tendência a melhor desempenho no span visual. No entanto, o estudo é limitado devido ao reduzido número de participantes na amostra.PURPOSE: to evaluate the working memory analyzing the retention ability of auditory stimuli (verbal span and visual stimuli (visual span, and to establish its relation to gender (male and female. METHOD: 20 subjects - 10 female children and 10 male children - from six and five months to seven years old took part in this study. All subjects were submitted to evaluation tests for both verbal and visual spans in direct and inverse orders. RESULTS: there was a significant variance between genders only in the test involving disyllabic words with phonology similar to and semantics different from verbal span. Female children showed a better

  3. HAL-2 promotes homologous pairing during Caenorhabditis elegans meiosis by antagonizing inhibitory effects of synaptonemal complex precursors.

    Science.gov (United States)

    Zhang, Weibin; Miley, Natasha; Zastrow, Michael S; MacQueen, Amy J; Sato, Aya; Nabeshima, Kentaro; Martinez-Perez, Enrique; Mlynarczyk-Evans, Susanna; Carlton, Peter M; Villeneuve, Anne M

    2012-01-01

    During meiosis, chromosomes align with their homologous pairing partners and stabilize this alignment through assembly of the synaptonemal complex (SC). Since the SC assembles cooperatively yet is indifferent to homology, pairing and SC assembly must be tightly coordinated. We identify HAL-2 as a key mediator in this coordination, showing that HAL-2 promotes pairing largely by preventing detrimental effects of SC precursors (SYP proteins). hal-2 mutants fail to establish pairing and lack multiple markers of chromosome movement mediated by pairing centers (PCs), chromosome sites that link chromosomes to cytoplasmic microtubules through nuclear envelope-spanning complexes. Moreover, SYP proteins load inappropriately along individual unpaired chromosomes in hal-2 mutants, and markers of PC-dependent movement and function are restored in hal-2; syp double mutants. These and other data indicate that SYP proteins can impede pairing and that HAL-2 promotes pairing predominantly but not exclusively by counteracting this inhibition, thereby enabling activation and regulation of PC function. HAL-2 concentrates in the germ cell nucleoplasm and colocalizes with SYP proteins in nuclear aggregates when SC assembly is prevented. We propose that HAL-2 functions to shepherd SYP proteins prior to licensing of SC assembly, preventing untimely interactions between SC precursors and chromosomes and allowing sufficient accumulation of precursors for rapid cooperative assembly upon homology verification.

  4. Spanning trees and the Eurozone crisis

    Science.gov (United States)

    Dias, João

    2013-12-01

    The sovereign debt crisis in the euro area has not yet been solved and recent developments in Spain and Italy have further deteriorated the situation. In this paper we develop a new approach to analyze the ongoing Eurozone crisis. Firstly, we use Maximum Spanning Trees to analyze the topological properties of government bond rates’ dynamics. Secondly, we combine the information given by both Maximum and Minimum Spanning Trees to obtain a measure of market dissimilarity or disintegration. Thirdly, we extend this measure to include a convenient distance not limited to the interval [0, 2]. Our empirical results show that Maximum Spanning Tree gives an adequate description of the separation of the euro area into two distinct groups: those countries strongly affected by the crisis and those that have remained resilient during this period. The measures of market dissimilarity also reveal a persistent separation of these two groups and, according to our second measure, this separation strongly increased during the period July 2009-March 2012.

  5. Spatial genetic structure in continuous and fragmented populations of Pinus pinaster Aiton.

    Science.gov (United States)

    De-Lucas, A I; González-Martínez, S C; Vendramin, G G; Hidalgo, E; Heuertz, M

    2009-11-01

    Habitat fragmentation, i.e., the reduction of populations into small isolated remnants, is expected to increase spatial genetic structure (SGS) in plant populations through nonrandom mating, lower population densities and potential aggregation of reproductive individuals. We investigated the effects of population size reduction and genetic isolation on SGS in maritime pine (Pinus pinaster Aiton) using a combined experimental and simulation approach. Maritime pine is a wind-pollinated conifer which has a scattered distribution in the Iberian Peninsula as a result of forest fires and habitat fragmentation. Five highly polymorphic nuclear microsatellites were genotyped in a total of 394 individuals from two population pairs from the Iberian Peninsula, formed by one continuous and one fragmented population each. In agreement with predictions, SGS was significant and stronger in fragments (Sp = 0.020 and Sp = 0.026) than in continuous populations, where significant SGS was detected for one population only (Sp = 0.010). Simulations suggested that under fat-tailed dispersal, small population size is a stronger determinant of SGS than genetic isolation, while under normal dispersal, genetic isolation has a stronger effect. SGS was always stronger in real populations than in simulations, except if unrealistically narrow dispersal and/or high variance of reproductive success were modelled (even when accounting for potential overestimation of SGS in real populations as a result of short-distance sampling). This suggests that factors such as nonrandom mating or selection not considered in the simulations were additionally operating on SGS in Iberian maritime pine populations.

  6. Tumor containing fragment number influences immunohistochemistry positive rate of HER2 in biopsy specimens of gastric cancer.

    Science.gov (United States)

    Xu, Chen; Liu, Yalan; Ge, Xiaowen; Jiang, Dongxian; Zhang, Ying; Ji, Yuan; Hou, Jun; Huang, Jie; Su, Jieakesu; Zeng, Haiying; Qin, Jing; Hou, Yingyong

    2017-05-26

    HER2 assessment in biopsy specimens of gastric cancer (GC) is challenging because of the intratumoral heterogeneity. False negative results may be get because of limited biopsy material. The aim of this study is to explore how tumor-containing fragment number and biopsy specimen number affect HER2 immunohistochemistry (IHC) positive rate. Eight hundred and ninety biopsy specimens and 459 paired resected specimens were collected. IHC staining of HER2 was performed. HER2 IHC positive (scored 3+) rate was compared based on tumor-containing fragment number, biopsy specimen number, average size and tumor tissue proportion of tumor-containing fragments. The positive predictability of biopsy specimens to resected specimens was analyzed based on tumor fragment number. HER2 IHC positive rates were 2.0, 3.5, 7.0, 13.2, 17.1, and 15.9% when tumor fragment numbers were 1, 2, 3, 4, 5 and 6 respectively. The rate rose with the increase of tumor fragment number (P = 0.004). ROC curve analysis showed that biopsy specimens exhibited positive predictability when tumor fragment number reached 3, but showed better performance when the number was ≥4 (P fragment number reached 4, no statistic differences were reached in either HER2 IHC positive rate or positive predictability with further increase of the number (P > 0.05). HER2 IHC positive rate was not associated with biopsy number (P = 0.127), average size of tumor fragments (P = 0.397), and tumor tissue proportion of tumor fragments (P = 0.825) directly. The number of tumor-containing fragments influences HER2 IHC positive (scored 3+) rate. Greater than or equal to 4 (≥4) tumor fragments give better results in the positive rate as well as positive predictability. We recommend the number of tumor containing fragments be described in the HER2 IHC pathology reports for clinical reference in endoscopic biopsy specimens of GC.

  7. The European legal framework regarding e-commercspan>e

    NARCIS (Netherlands)

    Schaub, M.Y.

    2004-01-01

    The year 2000 is a memorable year in the history of e-commercspan>e. This is the year of the so-called 'dot.com shake-out'. The year 2000 is also the year the European Union issued its e-commercspan>e directive. The directive means to regulate but also facilitate e-commercspan>e in the internal market, by laying

  8. Azimuthal Anisotropies in Nuclear Fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.

    2002-01-01

    The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)

  9. Evaluating the efficiency of shortcut span protection

    DEFF Research Database (Denmark)

    Ruepp, Sarah Renée; Dittmann, Lars; Berger, Michael Stübert

    2010-01-01

    This paper presents a comparison of various recovery methods in terms of capacity efficiency with the underlying aim of reducing control plane load. In particular, a method where recovery requests are bundled towards the destination (Shortcut Span Protection) is evaluated can compared against tra...... traditional recovery methods. The optimization model is presented and our simulation results show that Shortcut Span Protection uses more capacity than the unbundled related methods, but this is compensated by easier control and management of the recovery actions.......This paper presents a comparison of various recovery methods in terms of capacity efficiency with the underlying aim of reducing control plane load. In particular, a method where recovery requests are bundled towards the destination (Shortcut Span Protection) is evaluated can compared against...

  10. Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

    2016-11-15

    The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. On the cardinality of smallest spanning sets of rings | Boudi ...

    African Journals Online (AJOL)

    Let R = (R, +, ·) be a ring. Then Z ⊆ R is called spanning if the R-module generated by Z is equal to the ring R. A spanning set Z ⊆ R is called smallest if there is no spanning set of smaller cardinality than Z. It will be shown that the cardinality of a smallest spanning set of a ring R is not always decidable. In particular, a ring R ...

  13. Mitigating the Impact of Nurse Manager Large Spans of Control.

    Science.gov (United States)

    Simpson, Brenda Baird; Dearmon, Valorie; Graves, Rebecca

    Nurse managers are instrumental in achievement of organizational and unit performance goals. Greater spans of control for managers are associated with decreased satisfaction and performance. An interprofessional team measured one organization's nurse manager span of control, providing administrative assistant support and transformational leadership development to nurse managers with the largest spans of control. Nurse manager satisfaction and transformational leadership competency significantly improved following the implementation of large span of control mitigation strategies.

  14. Visual working memory span in adults with cochlear implants: Some preliminary findings

    Directory of Open Access Journals (Sweden)

    Aaron C. Moberly

    2017-12-01

    Full Text Available Objective: Neurocognitive functions, specifically verbal working memory (WM, contribute to speech recognition in postlingual adults with cochlear implants (CIs and normal-hearing (NH listener shearing degraded speech. Three hypotheses were tested: (1 WM accuracy as assessed using three visual span measures — digits, objects, and symbols — would correlate with recognition scores for spectrally degraded speech (through a CI or when noise-vocoded; (2 WM accuracy would be best for digit span, intermediate for object span, and lowest for symbol span, due to the increasing cognitive demands across these tasks. Likewise, response times, relating to processing demands, would be shortest for digit span, intermediate for object span, and longest for symbol span; (3 CI users would demonstrate poorer and slower performance than NH peers on WM tasks, as a result of less efficient verbally mediated encoding strategies associated with a period of prolonged auditory deprivation. Methods: Cross-sectional study of 30 postlingually deaf adults with CIs and 34 NH controls. Participants were tested for sentence recognition in quiet (CI users or after noise-vocoding (NH peers, along with WM using visual measures of digit span, object span, and symbol span. Results: Of the three measures of WM, digit span scores alone correlated with sentence recognition for CI users; no correlations were found using these three measures for NH peers. As predicted, WM accuracy (and response times were best (and fastest for digit span, intermediate for object span, and worst (and slowest for symbol span. CI users and NH peers demonstrated equivalent WM accuracy and response time for digit span and object span, and similar response times for symbol span, but contrary to our original predictions, CI users demonstrated better accuracy on symbol span than NH peers. Conclusions: Verbal WM assessed using visual tasks relates weakly to sentence recognition for degraded speech. CI users

  15. Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

    Science.gov (United States)

    Gouge, Michael F.

    2011-01-01

    Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

  16. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  17. The composite complex span: French validation of a short working memory task.

    Science.gov (United States)

    Gonthier, Corentin; Thomassin, Noémylle; Roulin, Jean-Luc

    2016-03-01

    Most studies in individual differences in the field of working memory research use complex span tasks to measure working memory capacity. Various complex span tasks based on different materials have been developed, and these tasks have proven both reliable and valid; several complex span tasks are often combined to provide a domain-general estimate of working memory capacity with even better psychometric properties. The present work sought to address two issues. Firstly, having participants perform several full-length complex span tasks in succession makes for a long and tedious procedure. Secondly, few complex span tasks have been translated and validated in French. We constructed a French working memory task labeled the Composite Complex Span (CCS). The CCS includes shortened versions of three classic complex span tasks: the reading span, symmetry span, and operation span. We assessed the psychometric properties of the CCS, including test-retest reliability and convergent validity, with Raven's Advanced Progressive Matrices and with an alpha span task; the CCS demonstrated satisfying qualities in a sample of 1,093 participants. This work provides evidence that shorter versions of classic complex span tasks can yield valid working memory estimates. The materials and normative data for the CCS are also included.

  18. Measurement of jet fragmentation into charged particles in pp and PbPb collisions at $\\sqrt{s_{NN}}$= 2.76 TeV

    CERN Document Server

    Chatrchyan, Serguei; Sirunyan, Albert M; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hammer, Josef; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kiesenhofer, Wolfgang; Knünz, Valentin; Krammer, Manfred; Liko, Dietrich; Mikulec, Ivan; Pernicka, Manfred; Rahbaran, Babak; Rohringer, Christine; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Wagner, Philipp; Waltenberger, Wolfgang; Walzel, Gerhard; Widl, Edmund; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Bansal, Sunil; Cornelis, Tom; De Wolf, Eddi A; Janssen, Xavier; Luyckx, Sten; Maes, Thomas; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Selvaggi, Michele; Staykova, Zlatka; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Gonzalez Suarez, Rebeca; Kalogeropoulos, Alexis; Maes, Michael; Olbrechts, Annik; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Charaf, Otman; Clerbaux, Barbara; De Lentdecker, Gilles; Dero, Vincent; Gay, Arnaud; Hreus, Tomas; Léonard, Alexandre; Marage, Pierre Edouard; Reis, Thomas; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wang, Jian; Adler, Volker; Beernaert, Kelly; Cimmino, Anna; Costantini, Silvia; Garcia, Guillaume; Grunewald, Martin; Klein, Benjamin; Lellouch, Jérémie; Marinov, Andrey; Mccartin, Joseph; Ocampo Rios, Alberto Andres; Ryckbosch, Dirk; Strobbe, Nadja; Thyssen, Filip; Tytgat, Michael; Vanelderen, Lukas; Verwilligen, Piet; Walsh, Sinead; Yazgan, Efe; Zaganidis, Nicolas; Basegmez, Suzan; Bruno, Giacomo; Castello, Roberto; Caudron, Adrien; Ceard, Ludivine; Delaere, Christophe; Du Pree, Tristan; Favart, Denis; Forthomme, Laurent; Giammanco, Andrea; Hollar, Jonathan; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Nuttens, Claude; Pagano, Davide; Perrini, Lucia; Pin, Arnaud; Piotrzkowski, Krzysztof; Schul, Nicolas; Vizan Garcia, Jesus Manuel; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Hammad, Gregory Habib; Alves, Gilvan; Correa Martins Junior, Marcos; De Jesus Damiao, Dilson; Martins, Thiago; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Aldá Júnior, Walter Luiz; Carvalho, Wagner; Custódio, Analu; Melo Da Costa, Eliza; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Matos Figueiredo, Diego; Mundim, Luiz; Nogima, Helio; Oguri, Vitor; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Soares Jorge, Luana; Sznajder, Andre; Bernardes, Cesar Augusto; De Almeida Dias, Flavia; Tomei, Thiago; De Moraes Gregores, Eduardo; Lagana, Caio; Da Cunha Marinho, Franciole; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Stoykova, Stefka; Sultanov, Georgi; Tcholakov, Vanio; Trayanov, Rumen; Vutova, Mariana; Dimitrov, Anton; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Jian; Wang, Xianyou; Wang, Zheng; Xiao, Hong; Xu, Ming; Zang, Jingjing; Zhang, Zhen; Asawatangtrakuldee, Chayanit; Ban, Yong; Guo, Shuang; Guo, Yifei; Li, Wenbo; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Teng, Haiyun; Wang, Siguang; Zhu, Bo; Zou, Wei; Avila, Carlos; Gomez, Juan Pablo; Gomez Moreno, Bernardo; Osorio Oliveros, Andres Felipe; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Duric, Senka; Kadija, Kreso; Luetic, Jelena; Morovic, Srecko; Attikis, Alexandros; Galanti, Mario; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Finger, Miroslav; Finger Jr, Michael; Assran, Yasser; Elgammal, Sherif; Ellithi Kamel, Ali; Khalil, Shaaban; Mahmoud, Mohammed; Radi, Amr; Kadastik, Mario; Müntel, Mait; Raidal, Martti; Rebane, Liis; Tiko, Andres; Azzolini, Virginia; Eerola, Paula; Fedi, Giacomo; Voutilainen, Mikko; Härkönen, Jaakko; Heikkinen, Mika Aatos; Karimäki, Veikko; Kinnunen, Ritva; Kortelainen, Matti J; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Peltola, Timo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Ungaro, Donatella; Wendland, Lauri; Banzuzi, Kukka; Korpela, Arja; Tuuva, Tuure; Besancon, Marc; Choudhury, Somnath; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Millischer, Laurent; Nayak, Aruna; Rander, John; Rosowsky, André; Shreyber, Irina; Titov, Maksym; Baffioni, Stephanie; Beaudette, Florian; Benhabib, Lamia; Bianchini, Lorenzo; Bluj, Michal; Broutin, Clementine; Busson, Philippe; Charlot, Claude; Daci, Nadir; Dahms, Torsten; Dobrzynski, Ludwik; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Nguyen, Matthew; Ochando, Christophe; Paganini, Pascal; Sabes, David; Salerno, Roberto; Sirois, Yves; Veelken, Christian; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Bodin, David; Brom, Jean-Marie; Cardaci, Marco; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Ferro, Cristina; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Juillot, Pierre; Karim, Mehdi; Le Bihan, Anne-Catherine; Van Hove, Pierre; Fassi, Farida; Mercier, Damien; Beauceron, Stephanie; Beaupere, Nicolas; Bondu, Olivier; Boudoul, Gaelle; Brun, Hugues; Chasserat, Julien; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Ille, Bernard; Kurca, Tibor; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sordini, Viola; Tosi, Silvano; Tschudi, Yohann; Verdier, Patrice; Viret, Sébastien; Tsamalaidze, Zviad; Anagnostou, Georgios; Beranek, Sarah; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Jussen, Ruediger; Klein, Katja; Merz, Jennifer; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Wittmer, Bruno; Zhukov, Valery; Ata, Metin; Caudron, Julien; Dietz-Laursonn, Erik; Duchardt, Deborah; Erdmann, Martin; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Klingebiel, Dennis; Kreuzer, Peter; Lingemann, Joschka; Magass, Carsten; Merschmeyer, Markus; Meyer, Arnd; Olschewski, Mark; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Weber, Martin; Bontenackels, Michael; Cherepanov, Vladimir; Davids, Martina; Flügge, Günter; Geenen, Heiko; Geisler, Matthias; Haj Ahmad, Wael; Hoehle, Felix; Kargoll, Bastian; Kress, Thomas; Kuessel, Yvonne; Linn, Alexander; Nowack, Andreas; Perchalla, Lars; Pooth, Oliver; Rennefeld, Jörg; Sauerland, Philip; Stahl, Achim; Aldaya Martin, Maria; Behr, Joerg; Behrenhoff, Wolf; Behrens, Ulf; Bergholz, Matthias; Bethani, Agni; Borras, Kerstin; Burgmeier, Armin; Cakir, Altan; Calligaris, Luigi; Campbell, Alan; Castro, Elena; Costanza, Francesco; Dammann, Dirk; Eckerlin, Guenter; Eckstein, Doris; Fischer, David; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Gunnellini, Paolo; Habib, Shiraz; Hauk, Johannes; Hellwig, Gregor; Jung, Hannes; Kasemann, Matthias; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Knutsson, Albert; Krämer, Mira; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Lohmann, Wolfgang; Lutz, Benjamin; Mankel, Rainer; Marfin, Ihar; Marienfeld, Markus; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Naumann-Emme, Sebastian; Olzem, Jan; Perrey, Hanno; Petrukhin, Alexey; Pitzl, Daniel; Raspereza, Alexei; Ribeiro Cipriano, Pedro M; Riedl, Caroline; Rosin, Michele; Salfeld-Nebgen, Jakob; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Spiridonov, Alexander; Stein, Matthias; Walsh, Roberval; Wissing, Christoph; Autermann, Christian; Blobel, Volker; Bobrovskyi, Sergei; Draeger, Jula; Enderle, Holger; Erfle, Joachim; Gebbert, Ulla; Görner, Martin; Hermanns, Thomas; Höing, Rebekka Sophie; Kaschube, Kolja; Kaussen, Gordon; Kirschenmann, Henning; Klanner, Robert; Lange, Jörn; Mura, Benedikt; Nowak, Friederike; Peiffer, Thomas; Pietsch, Niklas; Rathjens, Denis; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schlieckau, Eike; Schmidt, Alexander; Schröder, Matthias; Schum, Torben; Seidel, Markus; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Barth, Christian; Berger, Joram; Böser, Christian; Chwalek, Thorsten; De Boer, Wim; Descroix, Alexis; Dierlamm, Alexander; Feindt, Michael; Guthoff, Moritz; Hackstein, Christoph; Hartmann, Frank; Hauth, Thomas; Heinrich, Michael; Held, Hauke; Hoffmann, Karl-Heinz; Honc, Simon; Katkov, Igor; Komaragiri, Jyothsna Rani; Martschei, Daniel; Mueller, Steffen; Müller, Thomas; Niegel, Martin; Nürnberg, Andreas; Oberst, Oliver; Oehler, Andreas; Ott, Jochen; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Ratnikova, Natalia; Röcker, Steffen; Scheurer, Armin; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Troendle, Daniel; Ulrich, Ralf; Wagner-Kuhr, Jeannine; Wayand, Stefan; Weiler, Thomas; Zeise, Manuel; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Manolakos, Ioannis; Markou, Athanasios; Markou, Christos; Mavrommatis, Charalampos; Ntomari, Eleni; Gouskos, Loukas; Mertzimekis, Theodoros; Panagiotou, Apostolos; Saoulidou, Niki; Evangelou, Ioannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Patras, Vaios; Bencze, Gyorgy; Hajdu, Csaba; Hidas, Pàl; Horvath, Dezso; Krajczar, Krisztian; Radics, Balint; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Beni, Noemi; Czellar, Sandor; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Karancsi, János; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Gupta, Ruchi; Jindal, Monika; Kaur, Manjit; Kohli, Jatinder Mohan; Mehta, Manuk Zubin; Nishu, Nishu; Saini, Lovedeep Kaur; Sharma, Archana; Singh, Jasbir; Ahuja, Sudha; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Kumar, Ashok; Kumar, Arun; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Sharma, Varun; Shivpuri, Ram Krishen; Banerjee, Sunanda; Bhattacharya, Satyaki; Dutta, Suchandra; Gomber, Bhawna; Jain, Sandhya; Jain, Shilpi; Khurana, Raman; Sarkar, Subir; Sharan, Manoj; Abdulsalam, Abdulla; Choudhury, Rajani Kant; Dutta, Dipanwita; Kailas, Swaminathan; Kumar, Vineet; Mehta, Pourus; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Aziz, Tariq; Ganguly, Sanmay; Guchait, Monoranjan; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Parida, Bibhuti; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Hashemi, Majid; Hesari, Hoda; Jafari, Abideh; Khakzad, Mohsen; Mohammadi, Abdollah; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Chhibra, Simranjit Singh; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Lusito, Letizia; Maggi, Giorgio; Maggi, Marcello; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pompili, Alexis; Pugliese, Gabriella; Selvaggi, Giovanna; Silvestris, Lucia; Singh, Gurpreet; Venditti, Rosamaria; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Primavera, Federica; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gianni; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Gonzi, Sandro; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Colafranceschi, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Musenich, Riccardo; Benaglia, Andrea; De Guio, Federico; Di Matteo, Leonardo; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Martelli, Arabella; Massironi, Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Sala, Silvano; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Carrillo Montoya, Camilo Andres; Cavallo, Nicola; De Cosa, Annapaola; Dogangun, Oktay; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Merola, Mario; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bellan, Paolo; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Dorigo, Tommaso; Gasparini, Fabrizio; Gozzelino, Andrea; Kanishchev, Konstantin; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Meneguzzo, Anna Teresa; Nespolo, Massimo; Pazzini, Jacopo; Perrozzi, Luca; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Zotto, Pierluigi; Zucchetta, Alberto; Zumerle, Gianni; Gabusi, Michele; Ratti, Sergio P; Riccardi, Cristina; Torre, Paola; Vitulo, Paolo; Biasini, Maurizio; Bilei, Gian Mario; Fanò, Livio; Lariccia, Paolo; Lucaroni, Andrea; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Romeo, Francesco; Saha, Anirban; Santocchia, Attilio; Taroni, Silvia; Azzurri, Paolo; Bagliesi, Giuseppe; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Palla, Fabrizio; Rizzi, Andrea; Serban, Alin Titus; Spagnolo, Paolo; Squillacioti, Paola; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Diemoz, Marcella; Grassi, Marco; Longo, Egidio; Meridiani, Paolo; Micheli, Francesco; Nourbakhsh, Shervin; Organtini, Giovanni; Paramatti, Riccardo; Rahatlou, Shahram; Sigamani, Michael; Soffi, Livia; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Biino, Cristina; Botta, Cristina; Cartiglia, Nicolo; Costa, Marco; Demaria, Natale; Graziano, Alberto; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Potenza, Alberto; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Vilela Pereira, Antonio; Belforte, Stefano; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; Marone, Matteo; Montanino, Damiana; Penzo, Aldo; Schizzi, Andrea; Heo, Seong Gu; Kim, Tae Yeon; Nam, Soon-Kwon; Chang, Sunghyun; Chung, Jin Hyuk; Kim, Dong Hee; Kim, Gui Nyun; Kong, Dae Jung; Park, Hyangkyu; Ro, Sang-Ryul; Son, Dong-Chul; Son, Taejin; Kim, Jae Yool; Kim, Zero Jaeho; Song, Sanghyeon; Jo, Hyun Yong; Choi, Suyong; Gyun, Dooyeon; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Tae Jeong; Lee, Kyong Sei; Moon, Dong Ho; Park, Sung Keun; Seo, Eunsung; Choi, Minkyoo; Kang, Seokon; Kim, Hyunyong; Kim, Ji Hyun; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Cho, Yongjin; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Kim, Min Suk; Kwon, Eunhyang; Lee, Byounghoon; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Bilinskas, Mykolas Jurgis; Grigelionis, Ignas; Janulis, Mindaugas; Juodagalvis, Andrius; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-de La Cruz, Ivan; Lopez-Fernandez, Ricardo; Magaña Villalba, Ricardo; Martínez-Ortega, Jorge; Sánchez-Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A; Krofcheck, David; Bell, Alan James; Butler, Philip H; Doesburg, Robert; Reucroft, Steve; Silverwood, Hamish; Ahmad, Muhammad; Asghar, Muhammad Irfan; Hoorani, Hafeez R; Khalid, Shoaib; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Shah, Mehar Ali; Shoaib, Muhammad; Brona, Grzegorz; Bunkowski, Karol; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Bialkowska, Helena; Boimska, Bozena; Frueboes, Tomasz; Gokieli, Ryszard; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Almeida, Nuno; Bargassa, Pedrame; David Tinoco Mendes, Andre; Faccioli, Pietro; Fernandes, Miguel; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Seixas, Joao; Varela, Joao; Vischia, Pietro; Afanasiev, Serguei; Belotelov, Ivan; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Karjavin, Vladimir; Kozlov, Guennady; Lanev, Alexander; Malakhov, Alexander; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Smirnov, Vitaly; Volodko, Anton; Zarubin, Anatoli; Evstyukhin, Sergey; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Vorobyev, Andrey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Matveev, Viktor; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Erofeeva, Maria; Gavrilov, Vladimir; Kossov, Mikhail; Lychkovskaya, Natalia; Popov, Vladimir; Safronov, Grigory; Semenov, Sergey; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Belyaev, Andrey; Boos, Edouard; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Korotkikh, Vladimir; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Perfilov, Maxim; Petrushanko, Sergey; Popov, Andrey; Sarycheva, Ludmila; Savrin, Viktor; Snigirev, Alexander; Vardanyan, Irina; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Rusakov, Sergey V; Vinogradov, Alexey; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Grishin, Viatcheslav; Kachanov, Vassili; Konstantinov, Dmitri; Korablev, Andrey; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Ekmedzic, Marko; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Arce, Pedro; Battilana, Carlo; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Diez Pardos, Carmen; Domínguez Vázquez, Daniel; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Merino, Gonzalo; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Senghi Soares, Mara; Willmott, Carlos; Albajar, Carmen; Codispoti, Giuseppe; de Trocóniz, Jorge F; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Piedra Gomez, Jonatan; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Duarte Campderros, Jordi; Felcini, Marta; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Jorda, Clara; Lobelle Pardo, Patricia; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Rodrigo, Teresa; Rodríguez-Marrero, Ana Yaiza; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Sobron Sanudo, Mar; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Baillon, Paul; Ball, Austin; Barney, David; Bernet, Colin; Bianchi, Giovanni; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Breuker, Horst; Camporesi, Tiziano; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; D'Enterria, David; Dabrowski, Anne; De Roeck, Albert; Di Guida, Salvatore; Dobson, Marc; Dupont-Sagorin, Niels; Elliott-Peisert, Anna; Frisch, Benjamin; Funk, Wolfgang; Georgiou, Georgios; Giffels, Manuel; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Giunta, Marina; Glege, Frank; Gomez-Reino Garrido, Robert; Govoni, Pietro; Gowdy, Stephen; Guida, Roberto; Hansen, Magnus; Harris, Philip; Hartl, Christian; Harvey, John; Hegner, Benedikt; Hinzmann, Andreas; Innocente, Vincenzo; Janot, Patrick; Kaadze, Ketino; Karavakis, Edward; Kousouris, Konstantinos; Lecoq, Paul; Lee, Yen-Jie; Lenzi, Piergiulio; Lourenco, Carlos; Maki, Tuula; Malberti, Martina; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mozer, Matthias Ulrich; Mulders, Martijn; Musella, Pasquale; Nesvold, Erik; Orimoto, Toyoko; Orsini, Luciano; Palencia Cortezon, Enrique; Perez, Emmanuelle; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Piparo, Danilo; Polese, Giovanni; Quertenmont, Loic; Racz, Attila; Reece, William; Rodrigues Antunes, Joao; Rolandi, Gigi; Rommerskirchen, Tanja; Rovelli, Chiara; Rovere, Marco; Sakulin, Hannes; Santanastasio, Francesco; Schäfer, Christoph; Schwick, Christoph; Segoni, Ilaria; Sekmen, Sezen; Sharma, Archana; Siegrist, Patrice; Silva, Pedro; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Spiropulu, Maria; Stoye, Markus; Tsirou, Andromachi; Veres, Gabor Istvan; Vlimant, Jean-Roch; Wöhri, Hermine Katharina; Worm, Steven; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Meier, Frank; Renker, Dieter; Rohe, Tilman; Sibille, Jennifer; Bäni, Lukas; Bortignon, Pierluigi; Buchmann, Marco-Andrea; Casal, Bruno; Chanon, Nicolas; Chen, Zhiling; Deisher, Amanda; Dissertori, Günther; Dittmar, Michael; Dünser, Marc; Eugster, Jürg; Freudenreich, Klaus; Grab, Christoph; Hits, Dmitry; Lecomte, Pierre; Lustermann, Werner; Marini, Andrea Carlo; Martinez Ruiz del Arbol, Pablo; Mohr, Niklas; Moortgat, Filip; Nägeli, Christoph; Nef, Pascal; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pape, Luc; Pauss, Felicitas; Peruzzi, Marco; Ronga, Frederic Jean; Rossini, Marco; Sala, Leonardo; Sanchez, Ann - Karin; Starodumov, Andrei; Stieger, Benjamin; Takahashi, Maiko; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Hannsjoerg Artur; Wehrli, Lukas; Aguilo, Ernest; Amsler, Claude; Chiochia, Vincenzo; De Visscher, Simon; Favaro, Carlotta; Ivova Rikova, Mirena; Millan Mejias, Barbara; Otiougova, Polina; Robmann, Peter; Snoek, Hella; Tupputi, Salvatore; Verzetti, Mauro; Chang, Yuan-Hann; Chen, Kuan-Hsin; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Liu, Zong-Kai; Lu, Yun-Ju; Mekterovic, Darko; Singh, Anil; Volpe, Roberta; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Dietz, Charles; Grundler, Ulysses; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Majumder, Devdatta; Petrakou, Eleni; Shi, Xin; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wan, Xia; Wang, Minzu; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Karapinar, Guler; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Latife Nukhet; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilin, Bugra; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yalvac, Metin; Yildirim, Eda; Zeyrek, Mehmet; Gülmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Cankocak, Kerem; Levchuk, Leonid; Bostock, Francis; Brooke, James John; Clement, Emyr; Cussans, David; Flacher, Henning; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Kreczko, Lukasz; Metson, Simon; Newbold, Dave M; Nirunpong, Kachanon; Poll, Anthony; Senkin, Sergey; Smith, Vincent J; Williams, Thomas; Basso, Lorenzo; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Jackson, James; Kennedy, Bruce W; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R; Womersley, William John; Bainbridge, Robert; Ball, Gordon; Beuselinck, Raymond; Buchmuller, Oliver; Colling, David; Cripps, Nicholas; Cutajar, Michael; Dauncey, Paul; Davies, Gavin; Della Negra, Michel; Ferguson, William; Fulcher, Jonathan; Futyan, David; Gilbert, Andrew; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Jarvis, Martyn; Karapostoli, Georgia; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Mathias, Bryn; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Papageorgiou, Anastasios; Pela, Joao; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rogerson, Samuel; Rose, Andrew; Ryan, Matthew John; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardle, Nicholas; Whyntie, Tom; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leggat, Duncan; Leslie, Dawn; Martin, William; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Hatakeyama, Kenichi; Liu, Hongxuan; Scarborough, Tara; Henderson, Conor; Rumerio, Paolo; Avetisyan, Aram; Bose, Tulika; Fantasia, Cory; Heister, Arno; St John, Jason; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; Sulak, Lawrence; Alimena, Juliette; Bhattacharya, Saptaparna; Cutts, David; Ferapontov, Alexey; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Laird, Edward; Landsberg, Greg; Luk, Michael; Narain, Meenakshi; Nguyen, Duong; Segala, Michael; Sinthuprasith, Tutanon; Speer, Thomas; Tsang, Ka Vang; Breedon, Richard; Breto, Guillermo; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Dolen, James; Erbacher, Robin; Gardner, Michael; Houtz, Rachel; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Mall, Orpheus; Miceli, Tia; Nelson, Randy; Pellett, Dave; Rutherford, Britney; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Vasquez Sierra, Ricardo; Andreev, Valeri; Cline, David; Cousins, Robert; Duris, Joseph; Erhan, Samim; Everaerts, Pieter; Farrell, Chris; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Plager, Charles; Rakness, Gregory; Schlein, Peter; Tucker, Jordan; Valuev, Vyacheslav; Weber, Matthias; Babb, John; Clare, Robert; Dinardo, Mauro Emanuele; Ellison, John Anthony; Gary, J William; Giordano, Ferdinando; Hanson, Gail; Jeng, Geng-Yuan; Liu, Hongliang; Long, Owen Rosser; Luthra, Arun; Nguyen, Harold; Paramesvaran, Sudarshan; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Evans, David; Golf, Frank; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Macneill, Ian; Mangano, Boris; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Sudano, Elizabeth; Tadel, Matevz; Tu, Yanjun; Vartak, Adish; Wasserbaech, Steven; Würthwein, Frank; Yagil, Avraham; Yoo, Jaehyeok; Barge, Derek; Bellan, Riccardo; Campagnari, Claudio; D'Alfonso, Mariarosaria; Danielson, Thomas; Flowers, Kristen; Geffert, Paul; Incandela, Joe; Justus, Christopher; Kalavase, Puneeth; Koay, Sue Ann; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Lowette, Steven; Mccoll, Nickolas; Pavlunin, Viktor; Rebassoo, Finn; Ribnik, Jacob; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; West, Christopher; Apresyan, Artur; Bornheim, Adolf; Chen, Yi; Di Marco, Emanuele; Duarte, Javier; Gataullin, Marat; Ma, Yousi; Mott, Alexander; Newman, Harvey B; Rogan, Christopher; Timciuc, Vladlen; Traczyk, Piotr; Veverka, Jan; Wilkinson, Richard; Yang, Yong; Zhu, Ren-Yuan; Akgun, Bora; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Liu, Yueh-Feng; Paulini, Manfred; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Drell, Brian Robert; Edelmaier, Christopher; Ford, William T; Gaz, Alessandro; Heyburn, Bernadette; Luiggi Lopez, Eduardo; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Alexander, James; Chatterjee, Avishek; Eggert, Nicholas; Gibbons, Lawrence Kent; Heltsley, Brian; Khukhunaishvili, Aleko; Kreis, Benjamin; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Ryd, Anders; Salvati, Emmanuele; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Vaughan, Jennifer; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bloch, Ingo; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Green, Dan; Gutsche, Oliver; Hahn, Alan; Hanlon, Jim; Harris, Robert M; Hirschauer, James; Hooberman, Benjamin; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Kilminster, Benjamin; Klima, Boaz; Kunori, Shuichi; Kwan, Simon; Leonidopoulos, Christos; Lincoln, Don; Lipton, Ron; Lueking, Lee; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Maruyama, Sho; Mason, David; McBride, Patricia; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Prokofyev, Oleg; Sexton-Kennedy, Elizabeth; Sharma, Seema; Spalding, William J; Spiegel, Leonard; Tan, Ping; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yumiceva, Francisco; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Das, Souvik; De Gruttola, Michele; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Gartner, Joseph; Hugon, Justin; Kim, Bockjoo; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Low, Jia Fu; Matchev, Konstantin; Milenovic, Predrag; Mitselmakher, Guenakh; Muniz, Lana; Remington, Ronald; Rinkevicius, Aurelijus; Sellers, Paul; Skhirtladze, Nikoloz; Snowball, Matthew; Yelton, John; Zakaria, Mohammed; Gaultney, Vanessa; Lebolo, Luis Miguel; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Jordon Rowe; Adams, Todd; Askew, Andrew; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Gleyzer, Sergei V; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Jenkins, Merrill; Johnson, Kurtis F; Prosper, Harrison; Veeraraghavan, Venkatesh; Weinberg, Marc; Baarmand, Marc M; Dorney, Brian; Hohlmann, Marcus; Kalakhety, Himali; Vodopiyanov, Igor; Adams, Mark Raymond; Anghel, Ioana Maria; Apanasevich, Leonard; Bai, Yuting; Bazterra, Victor Eduardo; Betts, Russell Richard; Bucinskaite, Inga; Callner, Jeremy; Cavanaugh, Richard; Dragoiu, Cosmin; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hamdan, Saleh; Hofman, David Jonathan; Khalatyan, Samvel; Lacroix, Florent; Malek, Magdalena; O'Brien, Christine; Silkworth, Christopher; Strom, Derek; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren; Duru, Firdevs; Griffiths, Scott; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Norbeck, Edwin; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Tiras, Emrah; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bolognesi, Sara; Fehling, David; Giurgiu, Gavril; Gritsan, Andrei; Guo, Zijin; Hu, Guofan; Maksimovic, Petar; Rappoccio, Salvatore; Swartz, Morris; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Grachov, Oleg; Kenny Iii, Raymond Patrick; Murray, Michael; Noonan, Daniel; Sanders, Stephen; Stringer, Robert; Tinti, Gemma; Wood, Jeffrey Scott; Zhukova, Victoria; Barfuss, Anne-Fleur; Bolton, Tim; Chakaberia, Irakli; Ivanov, Andrew; Khalil, Sadia; Makouski, Mikhail; Maravin, Yurii; Shrestha, Shruti; Svintradze, Irakli; Gronberg, Jeffrey; Lange, David; Wright, Douglas; Baden, Drew; Boutemeur, Madjid; Calvert, Brian; Eno, Sarah Catherine; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G; Kirn, Malina; Kolberg, Ted; Lu, Ying; Marionneau, Matthieu; Mignerey, Alice; Pedro, Kevin; Peterman, Alison; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C; Twedt, Elizabeth; Bauer, Gerry; Bendavid, Joshua; Busza, Wit; Butz, Erik; Cali, Ivan Amos; Chan, Matthew; Dutta, Valentina; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Hahn, Kristan Allan; Kim, Yongsun; Klute, Markus; Li, Wei; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Rudolph, Matthew; Stephans, George; Stöckli, Fabian; Sumorok, Konstanty; Sung, Kevin; Velicanu, Dragos; Wenger, Edward Allen; Wolf, Roger; Wyslouch, Bolek; Xie, Si; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Cooper, Seth; Cushman, Priscilla; Dahmes, Bryan; De Benedetti, Abraham; Franzoni, Giovanni; Gude, Alexander; Haupt, Jason; Kao, Shih-Chuan; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Pastika, Nathaniel; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Tambe, Norbert; Turkewitz, Jared; Cremaldi, Lucien Marcus; Kroeger, Rob; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Avdeeva, Ekaterina; Bloom, Kenneth; Bose, Suvadeep; Butt, Jamila; Claes, Daniel R; Dominguez, Aaron; Eads, Michael; Jindal, Pratima; Keller, Jason; Kravchenko, Ilya; Lazo-Flores, Jose; Malbouisson, Helena; Malik, Sudhir; Snow, Gregory R; Baur, Ulrich; Godshalk, Andrew; Iashvili, Ia; Jain, Supriya; Kharchilava, Avto; Kumar, Ashish; Shipkowski, Simon Peter; Smith, Kenneth; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Chasco, Matthew; Haley, Joseph; Nash, David; Trocino, Daniele; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Kubik, Andrew; Mucia, Nicholas; Odell, Nathaniel; Ofierzynski, Radoslaw Adrian; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Velasco, Mayda; Won, Steven; Antonelli, Louis; Berry, Douglas; Brinkerhoff, Andrew; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Wayne, Mitchell; Wolf, Matthias; Bylsma, Ben; Durkin, Lloyd Stanley; Hart, Andrew; Hill, Christopher; Hughes, Richard; Kotov, Khristian; Ling, Ta-Yung; Puigh, Darren; Rodenburg, Marissa; Vuosalo, Carl; Williams, Grayson; Winer, Brian L; Adam, Nadia; Berry, Edmund; Elmer, Peter; Gerbaudo, Davide; Halyo, Valerie; Hebda, Philip; Hegeman, Jeroen; Hunt, Adam; Lopes Pegna, David; Lujan, Paul; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Raval, Amita; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zuranski, Andrzej; Acosta, Jhon Gabriel; Brownson, Eric; Huang, Xing Tao; Lopez, Angel; Mendez, Hector; Oliveros, Sandra; Ramirez Vargas, Juan Eduardo; Zatserklyaniy, Andriy; Alagoz, Enver; Barnes, Virgil E; Benedetti, Daniele; Bolla, Gino; Bortoletto, Daniela; De Mattia, Marco; Everett, Adam; Hu, Zhen; Jones, Matthew; Koybasi, Ozhan; Kress, Matthew; Laasanen, Alvin T; Leonardo, Nuno; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Vidal Marono, Miguel; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Guragain, Samir; Parashar, Neeti; Adair, Antony; Boulahouache, Chaouki; Cuplov, Vesna; Ecklund, Karl Matthew; Geurts, Frank JM; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Chung, Yeon Sei; Covarelli, Roberto; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Garcia-Bellido, Aran; Goldenzweig, Pablo; Gotra, Yury; Han, Jiyeon; Harel, Amnon; Korjenevski, Sergey; Miner, Daniel Carl; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Malik, Sarah; Mesropian, Christina; Arora, Sanjay; Barker, Anthony; Chou, John Paul; Contreras-Campana, Christian; Contreras-Campana, Emmanuel; Duggan, Daniel; Ferencek, Dinko; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Lath, Amitabh; Panwalkar, Shruti; Park, Michael; Patel, Rishi; Rekovic, Vladimir; Richards, Alan; Robles, Jorge; Rose, Keith; Salur, Sevil; Schnetzer, Steve; Seitz, Claudia; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Cerizza, Giordano; Hollingsworth, Matthew; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Eusebi, Ricardo; Flanagan, Will; Gilmore, Jason; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Osipenkov, Ilya; Pakhotin, Yuriy; Perloff, Alexx; Roe, Jeffrey; Safonov, Alexei; Sakuma, Tai; Sengupta, Sinjini; Suarez, Indara; Tatarinov, Aysen; Toback, David; Akchurin, Nural; Damgov, Jordan; Dudero, Phillip Russell; Jeong, Chiyoung; Kovitanggoon, Kittikul; Lee, Sung Won; Libeiro, Terence; Roh, Youn; Volobouev, Igor; Appelt, Eric; Engh, Daniel; Florez, Carlos; Greene, Senta; Gurrola, Alfredo; Johns, Willard; Johnston, Cody; Kurt, Pelin; Maguire, Charles; Melo, Andrew; Sheldon, Paul; Snook, Benjamin; Tuo, Shengquan; Velkovska, Julia; Arenton, Michael Wayne; Balazs, Michael; Boutle, Sarah; Cox, Bradley; Francis, Brian; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Wood, John; Yohay, Rachel; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Kottachchi Kankanamge Don, Chamath; Lamichhane, Pramod; Sakharov, Alexandre; Anderson, Michael; Bachtis, Michail; Belknap, Donald; Borrello, Laura; Carlsmith, Duncan; Cepeda, Maria; Dasu, Sridhara; Gray, Lindsey; Grogg, Kira Suzanne; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Lazaridis, Christos; Leonard, Jessica; Loveless, Richard; Mohapatra, Ajit; Ojalvo, Isabel; Palmonari, Francesco; Pierro, Giuseppe Antonio; Ross, Ian; Savin, Alexander; Smith, Wesley H; Swanson, Joshua

    2012-01-01

    Jet fragmentation in pp and PbPb collisions at a centre-of-mass energy of 2.76 TeV per nucleon pair was studied using data collected with the CMS detector at the LHC. Fragmentation functions are constructed using charged-particle tracks with transverse momenta pt > 4 GeV for dijet events with a leading jet of pt > 100 GeV. The fragmentation functions in PbPb events are compared to those in pp data as a function of collision centrality, as well as dijet-pt imbalance. Special emphasis is placed on the most central PbPb events including dijets with unbalanced momentum, indicative of energy loss of the hard scattered parent partons. The fragmentation patterns for both the leading and subleading jets in PbPb collisions agree with those seen in pp data at 2.76 TeV. The results provide evidence that, despite the large parton energy loss observed in PbPb collisions, the high-pt component of the fragmentation function evaluated with respect to the reconstructed jet momentum is not strongly modified in comparison to je...

  19. Visual-Attentional Span and Lexical ­Decision in Skilled Adult Readers

    Science.gov (United States)

    Holmes, Virginia M.; Dawson, Georgia

    2014-01-01

    The goal of the study was to examine the association between visual-attentional span and lexical decision in skilled adult readers. In the span tasks, an array of letters was presented briefly and recognition or production of a single cued letter (partial span) or production of all letters (whole span) was required. Independently of letter…

  20. Exact Solutions of Fragmentation Equations with General Fragmentation Rates and Separable Particles Distribution Kernels

    Directory of Open Access Journals (Sweden)

    S. C. Oukouomi Noutchie

    2014-01-01

    Full Text Available We make use of Laplace transform techniques and the method of characteristics to solve fragmentation equations explicitly. Our result is a breakthrough in the analysis of pure fragmentation equations as this is the first instance where an exact solution is provided for the fragmentation evolution equation with general fragmentation rates. This paper is the key for resolving most of the open problems in fragmentation theory including “shattering” and the sudden appearance of infinitely many particles in some systems with initial finite particles number.

  1. Land fragmentation and production diversification

    NARCIS (Netherlands)

    Ciaian, Pavel; Guri, Fatmir; Rajcaniova, Miroslava; Drabik, Dusan; Paloma, Sergio Gomez Y.

    2018-01-01

    We analyze the impact of land fragmentation on production diversification in rural Albania. Albania represents a particularly interesting case for studying land fragmentation as the fragmentation is a direct outcome of land reforms. The results indicate that land fragmentation is an important driver

  2. Reliability and validity of Web-SPAN, a web-based method for assessing weight status, diet and physical activity in youth.

    Science.gov (United States)

    Storey, K E; McCargar, L J

    2012-02-01

    Web-based surveys are becoming increasing popular. The present study aimed to assess the reliability and validity of the Web-Survey of Physical Activity and Nutrition (Web-SPAN) for self-report of height and weight, diet and physical activity by youth. School children aged 11-15years (grades 7-9; n=459) participated in the school-based research (boys, n=225; girls, n=233; mean age, 12.8years). Students completed Web-SPAN (self-administered) twice and participated in on-site school assessments [height, weight, 3-day food/pedometer record, Physical Activity Questionnaire for Older Children (PAQ-C), shuttle run]. Intraclass (ICC) and Pearson's correlation coefficients and paired samples t-tests were used to assess the test-retest reliability of Web-SPAN and to compare Web-SPAN with the on-site assessments. Test-retest reliability for height (ICC=0.90), weight (ICC=0.98) and the PAQ-C (ICC=0.79) were highly correlated, whereas correlations for nutrients were not as strong (ICC=0.37-0.64). There were no differences between Web-SPAN times 1 and 2 for height and weight, although there were differences for the PAQ-C and most nutrients. Web-SPAN was strongly correlated with the on-site assessments, including height (ICC=0.88), weight (ICC=0.93) and the PAQ-C (ICC=0.70). Mean differences for height and the PAQ-C were not significant, whereas mean differences for weight were significant resulting in an underestimation of being overweight/obesity prevalence (84% agreement). Correlations for nutrients were in the range 0.24-0.40; mean differences were small but generally significantly different. Correlations were weak between the web-based PAQ-C and 3-day pedometer record (r=0.28) and 20-m shuttle run (r=0.28). Web-SPAN is a time- and cost-effective method that can be used to assess the diet and physical activity status of youth in large cross-sectional studies and to assess group trends (weight status). © 2011 The Authors. Journal of Human Nutrition and Dietetics © 2011 The

  3. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  4. Examining the locus of age effects on complex span tasks.

    Science.gov (United States)

    McCabe, Jennifer; Hartman, Marilyn

    2003-09-01

    To investigate the locus of age effects on complex span tasks, the authors evaluated the contributions of working memory functions and processing speed. Age differences were found in measures of storage capacity, language processing speed, and lower level speed. Statistically controlling for each of these in hierarchical regressions substantially reduced, but did not eliminate, the complex span age effect. Accounting for lower level speed and storage, however, removed essentially the entire age effect, suggesting that both functions play important and independent roles. Additional evidence for the role of storage capacity was the absence of complex span age differences with span size calibrated to individual word span performance. Explanations for age differences based on inhibition and concurrent task performamce were not supported.

  5. WildSpan: mining structured motifs from protein sequences

    Directory of Open Access Journals (Sweden)

    Chen Chien-Yu

    2011-03-01

    Full Text Available Abstract Background Automatic extraction of motifs from biological sequences is an important research problem in study of molecular biology. For proteins, it is desired to discover sequence motifs containing a large number of wildcard symbols, as the residues associated with functional sites are usually largely separated in sequences. Discovering such patterns is time-consuming because abundant combinations exist when long gaps (a gap consists of one or more successive wildcards are considered. Mining algorithms often employ constraints to narrow down the search space in order to increase efficiency. However, improper constraint models might degrade the sensitivity and specificity of the motifs discovered by computational methods. We previously proposed a new constraint model to handle large wildcard regions for discovering functional motifs of proteins. The patterns that satisfy the proposed constraint model are called W-patterns. A W-pattern is a structured motif that groups motif symbols into pattern blocks interleaved with large irregular gaps. Considering large gaps reflects the fact that functional residues are not always from a single region of protein sequences, and restricting motif symbols into clusters corresponds to the observation that short motifs are frequently present within protein families. To efficiently discover W-patterns for large-scale sequence annotation and function prediction, this paper first formally introduces the problem to solve and proposes an algorithm named WildSpan (sequential pattern mining across large wildcard regions that incorporates several pruning strategies to largely reduce the mining cost. Results WildSpan is shown to efficiently find W-patterns containing conserved residues that are far separated in sequences. We conducted experiments with two mining strategies, protein-based and family-based mining, to evaluate the usefulness of W-patterns and performance of WildSpan. The protein-based mining mode

  6. Evidence for a transverse single-spin asymmetry in leptoproduction of π+π- pairs

    International Nuclear Information System (INIS)

    Airapetian, A.

    2008-03-01

    A single-spin asymmetry was measured in the azimuthal distribution of π + π - . pairs produced in semi-inclusive deep-inelastic scattering on a transversely polarized hydrogen target. For the first time, evidence is found for a correlation between the transverse target polarization and the azimuthal orientation of the plane containing the two pions. The corresponding single-spin asymmetry is expected to be related to the product of the little-known quark transversity distribution function and an unknown naive-T-odd chiral-odd dihadron fragmentation function. (orig.)

  7. Pair production of heavy quarkonium and Bc(*) mesons at hadron colliders

    International Nuclear Information System (INIS)

    Li Rong; Zhang Yujie; Chao Kuangta

    2009-01-01

    We investigate the pair production of S-wave heavy quarkonium at the LHC in the color-singlet mechanism (CSM) and estimate the contribution from the gluon fragmentation process in the color-octet mechanism (COM) for comparison. With the matrix elements extracted previously in the leading-order calculations, the numerical results show that the production rates are quite large for the pair production processes at the LHC. The p t distribution of double J/ψ production in the CSM is dominant over that in the COM when p t is smaller than about 10 GeV. For the production of double Υ, the contribution of the COM is always larger than that in the CSM. The large differences in the theoretical predictions between the CSM and COM for the p t distributions in the large p t region are useful in clarifying the effects of COM on the quarkonium production. We also investigate the pair production of S-wave B c and B c * mesons, and the measurement of these processes is useful to test the CSM and extract the long-distance matrix elements for the B c and B c * mesons. Aside from numerical calculations, analytical expressions for the production differential cross sections of all these processes are also given.

  8. Mapping the developmental constraints on working memory span performance.

    Science.gov (United States)

    Bayliss, Donna M; Jarrold, Christopher; Baddeley, Alan D; Gunn, Deborah M; Leigh, Eleanor

    2005-07-01

    This study investigated the constraints underlying developmental improvements in complex working memory span performance among 120 children of between 6 and 10 years of age. Independent measures of processing efficiency, storage capacity, rehearsal speed, and basic speed of processing were assessed to determine their contribution to age-related variance in complex span. Results showed that developmental improvements in complex span were driven by 2 age-related but separable factors: 1 associated with general speed of processing and 1 associated with storage ability. In addition, there was an age-related contribution shared between working memory, processing speed, and storage ability that was important for higher level cognition. These results pose a challenge for models of complex span performance that emphasize the importance of processing speed alone.

  9. Performance, Career Dynamics, and Span of Control

    DEFF Research Database (Denmark)

    Smeets, Valerie Anne Rolande; Waldman, Michael; Warzynski, Frederic Michel Patrick

    that higher ability managers should supervise more subordinates, or equivalently, have a larger span of control. And although some of this theory’s predictions have been empirically investigated, there has been little systematic investigation of the theory’s predictions concerning span of control....... In this paper we first extend the theoretical literature on the scale-of-operations effect to allow firms’ beliefs concerning a manager’s ability to evolve over the manager’s career, where much of our focus is the determinants of span of control. We then empirically investigate testable predictions from......There is an extensive theoretical literature based on what is called the scale-of-operations effect, i.e., the idea that the return to managerial ability is higher the more resources the manager influences with his or her decisions. This idea leads to various testable predictions including...

  10. Fragment-based drug design.

    Science.gov (United States)

    Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H

    2011-01-01

    Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.

  11. Fragment informatics and computational fragment-based drug design: an overview and update.

    Science.gov (United States)

    Sheng, Chunquan; Zhang, Wannian

    2013-05-01

    Fragment-based drug design (FBDD) is a promising approach for the discovery and optimization of lead compounds. Despite its successes, FBDD also faces some internal limitations and challenges. FBDD requires a high quality of target protein and good solubility of fragments. Biophysical techniques for fragment screening necessitate expensive detection equipment and the strategies for evolving fragment hits to leads remain to be improved. Regardless, FBDD is necessary for investigating larger chemical space and can be applied to challenging biological targets. In this scenario, cheminformatics and computational chemistry can be used as alternative approaches that can significantly improve the efficiency and success rate of lead discovery and optimization. Cheminformatics and computational tools assist FBDD in a very flexible manner. Computational FBDD can be used independently or in parallel with experimental FBDD for efficiently generating and optimizing leads. Computational FBDD can also be integrated into each step of experimental FBDD and help to play a synergistic role by maximizing its performance. This review will provide critical analysis of the complementarity between computational and experimental FBDD and highlight recent advances in new algorithms and successful examples of their applications. In particular, fragment-based cheminformatics tools, high-throughput fragment docking, and fragment-based de novo drug design will provide the focus of this review. We will also discuss the advantages and limitations of different methods and the trends in new developments that should inspire future research. © 2012 Wiley Periodicals, Inc.

  12. Consequences of severe habitat fragmentation on density, genetics, and spatial capture-recapture analysis of a small bear population.

    Directory of Open Access Journals (Sweden)

    Sean M Murphy

    Full Text Available Loss and fragmentation of natural habitats caused by human land uses have subdivided several formerly contiguous large carnivore populations into multiple small and often isolated subpopulations, which can reduce genetic variation and lead to precipitous population declines. Substantial habitat loss and fragmentation from urban development and agriculture expansion relegated the Highlands-Glades subpopulation (HGS of Florida, USA, black bears (Ursus americanus floridanus to prolonged isolation; increasing human land development is projected to cause ≥ 50% loss of remaining natural habitats occupied by the HGS in coming decades. We conducted a noninvasive genetic spatial capture-recapture study to quantitatively describe the degree of contemporary habitat fragmentation and investigate the consequences of habitat fragmentation on population density and genetics of the HGS. Remaining natural habitats sustaining the HGS were significantly more fragmented and patchier than those supporting Florida's largest black bear subpopulation. Genetic diversity was low (AR = 3.57; HE = 0.49 and effective population size was small (NE = 25 bears, both of which remained unchanged over a period spanning one bear generation despite evidence of some immigration. Subpopulation density (0.054 bear/km2 was among the lowest reported for black bears, was significantly female-biased, and corresponded to a subpopulation size of 98 bears in available habitat. Conserving remaining natural habitats in the area occupied by the small, genetically depauperate HGS, possibly through conservation easements and government land acquisition, is likely the most important immediate step to ensuring continued persistence of bears in this area. Our study also provides evidence that preferentially placing detectors (e.g., hair traps or cameras primarily in quality habitat across fragmented landscapes poses a challenge to estimating density-habitat covariate relationships using spatial

  13. Actigraphic Sleep Duration and Fragmentation in Older Women: Associations With Performance Across Cognitive Domains.

    Science.gov (United States)

    Spira, Adam P; Stone, Katie L; Redline, Susan; Ensrud, Kristine E; Ancoli-Israel, Sonia; Cauley, Jane A; Yaffe, Kristine

    2017-08-01

    To determine the association of actigraphic sleep duration and fragmentation with cognition in community-dwelling older women. We studied 782 women (mean age = 87.4) of varied cognitive status from the Study of Osteoporotic Fractures who completed wrist actigraphy and the Modified Mini-Mental State Examination (3MS), California Verbal Learning Test-II-Short Form, digit span, verbal fluency tests, and the Trailmaking Test, Part B (Trails B). Total sleep time (TST) and wake after sleep onset (WASO) tertiles were our primary predictors. There were few significant associations in adjusted analyses. Compared to women with intermediate TST (mean = 430.1 minutes), those with the longest (508.7 minutes) had significantly poorer performance on the 3MS and phonemic and semantic fluency. Compared to women with the least WASO (31.5 minutes), those in the middle tertile (61.5 minutes) had significantly poorer delayed recall and those in the middle tertile and highest tertile (126.2 minutes) had poorer total recall and semantic fluency. We observed significant adjusted associations of TST with impaired 3MS performance and of WASO with impaired delayed recall, semantic fluency, and digit span. After excluding participants with adjudicated dementia diagnoses or indeterminate cognitive status, some adjusted associations remained but decreased in magnitude, others became nonsignificant, and a new association emerged. In community-dwelling older women, longer objectively measured sleep duration and greater sleep fragmentation are associated with poorer performance and impairment in only a subset of cognitive domains. Some of these associations may be driven by women with dementia in whom disturbed sleep and cognitive performance share an underlying neuropathological basis. Published by Oxford University Press on behalf of Sleep Research Society (SRS) 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  14. Measuring pair-wise molecular interactions in a complex mixture

    Science.gov (United States)

    Chakraborty, Krishnendu; Varma, Manoj M.; Venkatapathi, Murugesan

    2016-03-01

    Complex biological samples such as serum contain thousands of proteins and other molecules spanning up to 13 orders of magnitude in concentration. Present measurement techniques do not permit the analysis of all pair-wise interactions between the components of such a complex mixture to a given target molecule. In this work we explore the use of nanoparticle tags which encode the identity of the molecule to obtain the statistical distribution of pair-wise interactions using their Localized Surface Plasmon Resonance (LSPR) signals. The nanoparticle tags are chosen such that the binding between two molecules conjugated to the respective nanoparticle tags can be recognized by the coupling of their LSPR signals. This numerical simulation is done by DDA to investigate this approach using a reduced system consisting of three nanoparticles (a gold ellipsoid with aspect ratio 2.5 and short axis 16 nm, and two silver ellipsoids with aspect ratios 3 and 2 and short axes 8 nm and 10 nm respectively) and the set of all possible dimers formed between them. Incident light was circularly polarized and all possible particle and dimer orientations were considered. We observed that minimum peak separation between two spectra is 5 nm while maximum is 184nm.

  15. Dynamics of investor spanning trees around dot-com bubble.

    Directory of Open Access Journals (Sweden)

    Sindhuja Ranganathan

    Full Text Available We identify temporal investor networks for Nokia stock by constructing networks from correlations between investor-specific net-volumes and analyze changes in the networks around dot-com bubble. The analysis is conducted separately for households, financial, and non-financial institutions. Our results indicate that spanning tree measures for households reflected the boom and crisis: the maximum spanning tree measures had a clear upward tendency in the bull markets when the bubble was building up, and, even more importantly, the minimum spanning tree measures pre-reacted the burst of the bubble. At the same time, we find less clear reactions in the minimal and maximal spanning trees of non-financial and financial institutions around the bubble, which suggests that household investors can have a greater herding tendency around bubbles.

  16. Dynamics of investor spanning trees around dot-com bubble.

    Science.gov (United States)

    Ranganathan, Sindhuja; Kivelä, Mikko; Kanniainen, Juho

    2018-01-01

    We identify temporal investor networks for Nokia stock by constructing networks from correlations between investor-specific net-volumes and analyze changes in the networks around dot-com bubble. The analysis is conducted separately for households, financial, and non-financial institutions. Our results indicate that spanning tree measures for households reflected the boom and crisis: the maximum spanning tree measures had a clear upward tendency in the bull markets when the bubble was building up, and, even more importantly, the minimum spanning tree measures pre-reacted the burst of the bubble. At the same time, we find less clear reactions in the minimal and maximal spanning trees of non-financial and financial institutions around the bubble, which suggests that household investors can have a greater herding tendency around bubbles.

  17. Characterization of a fragment of semideciduous in transition to savannah, in the city of Bebedouro, SP Caracterização de um fragmento de floresta estacional semidecidual em transição com o cerrado, no município de Bebedouro, SP. DOI: 10.7902/ecb.v2i1.26

    OpenAIRE

    Edmilson Escher; Antonio Sergio Ferraudo; Josué Marcondes de Souza; Fábio Luiz Viana; Áurea Maria Therezinha Colli

    2011-01-01

    <span class="longtext"><span lang="EN-US">This study aimed to characterize a fragment of semideciduous forest in transition to savanna located in the settlement area of ​​the municipality of Bebedouro, SP, for conservation purposes. We used the method of the plots, standing out from a sample area of ​​2800 meters, subdivided into seven parcels of 20 m by 20 m. <span lang="EN-US">Were measured, marked with numbered PVC platelets and identified all trees with diam...

  18. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  19. Developmental Dyslexia: The Visual Attention Span Deficit Hypothesis

    Science.gov (United States)

    Bosse, Marie-Line; Tainturier, Marie Josephe; Valdois, Sylviane

    2007-01-01

    The visual attention (VA) span is defined as the amount of distinct visual elements which can be processed in parallel in a multi-element array. Both recent empirical data and theoretical accounts suggest that a VA span deficit might contribute to developmental dyslexia, independently of a phonological disorder. In this study, this hypothesis was…

  20. Assessment of fragment projection hazard: probability distributions for the initial direction of fragments.

    Science.gov (United States)

    Tugnoli, Alessandro; Gubinelli, Gianfilippo; Landucci, Gabriele; Cozzani, Valerio

    2014-08-30

    The evaluation of the initial direction and velocity of the fragments generated in the fragmentation of a vessel due to internal pressure is an important information in the assessment of damage caused by fragments, in particular within the quantitative risk assessment (QRA) of chemical and process plants. In the present study an approach is proposed to the identification and validation of probability density functions (pdfs) for the initial direction of the fragments. A detailed review of a large number of past accidents provided the background information for the validation procedure. A specific method was developed for the validation of the proposed pdfs. Validated pdfs were obtained for both the vertical and horizontal angles of projection and for the initial velocity of the fragments. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Noise Reduction with Optimal Variable Span Linear Filters

    DEFF Research Database (Denmark)

    Jensen, Jesper Rindom; Benesty, Jacob; Christensen, Mads Græsbøll

    2016-01-01

    In this paper, the problem of noise reduction is addressed as a linear filtering problem in a novel way by using concepts from subspace-based enhancement methods, resulting in variable span linear filters. This is done by forming the filter coefficients as linear combinations of a number...... included in forming the filter. Using these concepts, a number of different filter designs are considered, like minimum distortion, Wiener, maximum SNR, and tradeoff filters. Interestingly, all these can be expressed as special cases of variable span filters. We also derive expressions for the speech...... demonstrate the advantages and properties of the variable span filter designs, and their potential performance gain compared to widely used speech enhancement methods....

  2. Peripheral collisions of 2 GeV/nucleon Fe nuclei in nuclear emulsion. I. Light projectile fragments

    International Nuclear Information System (INIS)

    Friedlander, E.M.; Crawford, H.J.; Gimpel, R.W.; Greiner, D.E.; Heckman, H.H.; Lindstrom, P.J.

    1978-01-01

    Observations on 374 collisions of 1.88-GeV/nucleon Fe nuclei in Ilford G-5 nuclear track emulsion, in which at least one projectle fragment of Z > = 3 was emitted within a 6 0 cone, revealed several features of projectile breakup. The onset of copious multiple fragmentation was observed. The relatively high α-particle multiplicities allowed for the first time a study of the α multiplicity distribution; a Poisson distribution gave an excellent fit. The data showed a significant enhancement of α-particle pairs with very small relative momenta. The transverse momentum distributions, which should reflect best the thermal motion in the projectile system, are in flagrant discrepancy with theoretical predictions; the distributions show a marked target dependence. The charges of all projectile fragments up to B were determined by measurement of gap-length distributions. Events with N/sub h/ = 0 are a class apart from the rest of the events; between N/sub h/ = 1 and N/sub h/ = 9 there is surprisingly little change in most parameters. 4 figures

  3. Knowledge-based Fragment Binding Prediction

    Science.gov (United States)

    Tang, Grace W.; Altman, Russ B.

    2014-01-01

    Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971

  4. Compressive forces achieved in simulated equine third metacarpal bone lateral condylar fractures of varying fragment thickness with Acutrak Plus screw and 4.5 mm AO cortical screws.

    Science.gov (United States)

    Lewis, Andrew J; Sod, Gary A; Burba, Daniel J; Mitchell, Colin F

    2010-01-01

    To compare compression pressure (CP) of 6.5 mm Acutrak Plus (AP) and 4.5 mm AO cortical screws (AO) when inserted in simulated lateral condylar fractures of equine 3rd metacarpal (MC3) bones. Paired in vitro biomechanical testing. Cadaveric equine MC3 bones (n=12 pair). Complete lateral condylar osteotomies were created parallel to the midsagittal ridge at 20, 12, and 8 mm axial to the epicondylar fossa on different specimens grouped accordingly. Interfragmentary compression was measured using a pressure sensor placed in the fracture plane before screw placement for fracture fixation. CP was acquired and mean values of CP for each fixation method were compared between the 6.5 mm (AP) and 4.5 mm (AO) for each group using a paired t-test within each fracture fragment thickness group with statistical significance set at Pfractures, especially complete fractures. Because interfragmentary compression plays a factor in the overall stability of a repair, it is recommended for use only in patients with thin lateral condyle fracture fragments, as the compression tends to decrease with an increase in thickness.

  5. Fragmentation in the branching coral Acropora palmata (Lamarck): growth, survivorship, and reproduction of colonies and fragments.

    Science.gov (United States)

    Lirman

    2000-08-23

    Acropora palmata, a branching coral abundant on shallow reef environments throughout the Caribbean, is susceptible to physical disturbance caused by storms. Accordingly, the survivorship and propagation of this species are tied to its capability to recover after fragmentation. Fragments of A. palmata comprised 40% of ramets within populations that had experienced recent storms. While the survivorship of A. palmata fragments was not directly related to the size of fragments, removal of fragments from areas where they settled was influenced by size. Survivorship of fragments was also affected by type of substratum; the greatest mortality (58% loss within the first month) was observed on sand, whereas fragments placed on top of live colonies of A. palmata fused to the underlying tissue and did not experience any losses. Fragments created by Hurricane Andrew on a Florida reef in August 1992 began developing new growth (proto-branches) 7 months after the storm. The number of proto-branches on fragments was dependent on size, but growth was not affected by the size of fragments. Growth-rates of proto-branches increased exponentially with time (1.7 cm year(-1) for 1993-1994, 2.7 cm year(-1) for 1994-1995, 4.2 cm year(-1) for 1995-1996, and 6.5 cm year(-1) for 1996-1997), taking over 4 years for proto-branches to achieve rates comparable to those of adult colonies on the same reef (6.9 cm year(-1)). In addition to the initial mortality and reduced growth-rates, fragmentation resulted in a loss of reproductive potential. Neither colonies that experienced severe fragmentation nor fragments contained gametes until 4 years after the initial damage. Although A. palmata may survive periodic fragmentation, the long-term effects of this process will depend ultimately on the balance between the benefits and costs of this process.

  6. Plasminogen fragments K 1-3 and K 5 bind to different sites in fibrin fragment DD.

    Science.gov (United States)

    Grinenko, T V; Kapustianenko, L G; Yatsenko, T A; Yusova, O I; Rybachuk, V N

    2016-01-01

    Specific plasminogen-binding sites of fibrin molecule are located in Аα148-160 regions of C-terminal domains. Plasminogen interaction with these sites initiates the activation process of proenzyme and subsequent fibrin lysis. In this study we investigated the binding of plasminogen fragments K 1-3 and K 5 with fibrin fragment DD and their effect on Glu-plasminogen interaction with DD. It was shown that the level of Glu-plasminogen binding to fibrin fragment DD is decreased by 50-60% in the presence of K 1-3 and K 5. Fragments K 1-3 and K 5 have high affinity to fibrin fragment DD (Kd is 0.02 for K 1-3 and 0.054 μМ for K 5). K 5 interaction is independent and K 1-3 is partly dependent on C-terminal lysine residues. K 1-3 interacts with complex of fragment DD-immobilized K 5 as well as K 5 with complex of fragment DD-immobilized K 1-3. The plasminogen fragments do not displace each other from binding sites located in fibrin fragment DD, but can compete for the interaction. The results indicate that fibrin fragment DD contains different binding sites for plasminogen kringle fragments K 1-3 and K 5, which can be located close to each other. The role of amino acid residues of fibrin molecule Аα148-160 region in interaction with fragments K 1-3 and K 5 is discussed.

  7. Fractal statistics of brittle fragmentation

    Directory of Open Access Journals (Sweden)

    M. Davydova

    2013-04-01

    Full Text Available The study of fragmentation statistics of brittle materials that includes four types of experiments is presented. Data processing of the fragmentation of glass plates under quasi-static loading and the fragmentation of quartz cylindrical rods under dynamic loading shows that the size distribution of fragments (spatial quantity is fractal and can be described by a power law. The original experimental technique allows us to measure, apart from the spatial quantity, the temporal quantity - the size of time interval between the impulses of the light reflected from the newly created surfaces. The analysis of distributions of spatial (fragment size and temporal (time interval quantities provides evidence of obeying scaling laws, which suggests the possibility of self-organized criticality in fragmentation.

  8. Comparison of Monte Carlo generator predictions for bottom and charm hadrons in the decays of top quarks and the fragmentation of high pT jets

    CERN Document Server

    The ATLAS collaboration

    2014-01-01

    Modeling of the fragmentation and decay of heavy flavor hadrons is compared for four Monte Carlo generators: Pythia8, Pythia6, Herwig ++ and Herwig. Heavy flavor hadron production fractions and fragmentation functions are studied using top-quark pair and high transverse momentum jet samples generated for pp collisions at $\\sqrt{s} = 8$ TeV. The performance of the generators for heavy flavor fragmentation is also validated using e+e− annihilation events generated at $\\sqrt{s} = 91.2$ GeV (for $b$-quarks) and $\\sqrt{s} = 10.53$GeV (for $c$-quarks). In addition, bottom and charm hadron decays for the four generators are compared both to results with EvtGen Monte Carlo model and to experimental measurements.

  9. Dual boundary spanning

    DEFF Research Database (Denmark)

    Li-Ying, Jason

    2016-01-01

    The extant literature runs short in understanding openness of innovation regarding and the different pathways along which internal and external knowledge resources can be combined. This study proposes a unique typology for outside-in innovations based on two distinct ways of boundary spanning......: whether an innovation idea is created internally or externally and whether an innovation process relies on external knowledge resources. This yields four possible types of innovation, which represent the nuanced variation of outside-in innovations. Using historical data from Canada for 1945...

  10. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  11. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  12. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  13. Exploring boundary-spanning practices among creativity managers

    DEFF Research Database (Denmark)

    Andersen, Poul Houman; Kragh, Hanne

    2015-01-01

    Purpose – External inputs are critical for organisational creativity. In order to bridge different thought worlds and cross-organisational barriers, managers must initiate and motivate boundary spanning processes. The purpose of this paper is to explore how boundary spanners manage creativity...... and observation. Findings – Three meta-practices used by managers to manage boundary-spanning creative projects are presented: defining the creative space, making space for creativity and acting in the creative space. These practices are detailed in seven case studies of creative projects. Research limitations...

  14. A Distributed Spanning Tree Algorithm

    DEFF Research Database (Denmark)

    Johansen, Karl Erik; Jørgensen, Ulla Lundin; Nielsen, Sven Hauge

    We present a distributed algorithm for constructing a spanning tree for connected undirected graphs. Nodes correspond to processors and edges correspond to two-way channels. Each processor has initially a distinct identity and all processors perform the same algorithm. Computation as well...

  15. Generalized nonimaging compound elliptical and compound hyperbolic luminaire designs for pair-overlap illumination applications.

    Science.gov (United States)

    Georlette, O; Gordon, J M

    1994-07-01

    Generalized nonimaging compound elliptical luminaires (CEL's) and compound hyperbolic luminaires (CHL's) are developed for pair-overlap illumination applications. A comprehensive analysis of CEL's and CHL's is presented. This includes the possibility of reflector truncation, as well as the extreme direction that spans the full range from positive to negative. Negative extreme direction devices have been overlooked in earlier studies and are shown to be well suited to illumination problems for which large cutoff angles are required. Flux maps can be calculated analytically without the need for computer ray tracing. It is demonstrated that, for a broad range of cutoff angles, adjacent pairs of CEL's and CHL's can generate highly uniform far-field illuminance while maintaining maximal lighting efficiency and excellent glare control. The trade-off between luminaire compactness and flux homogeneity is also illustrated. For V troughs, being a special case of CHL's and being well suited to simple, inexpensive fabri ation, we identify geometries that closely approach the performance characteristics of the optimized CEL's and CHL's.

  16. Fragment library design: using cheminformatics and expert chemists to fill gaps in existing fragment libraries.

    Science.gov (United States)

    Kutchukian, Peter S; So, Sung-Sau; Fischer, Christian; Waller, Chris L

    2015-01-01

    Fragment based screening (FBS) has emerged as a mainstream lead discovery strategy in academia, biotechnology start-ups, and large pharma. As a prerequisite of FBS, a structurally diverse library of fragments is desirable in order to identify chemical matter that will interact with the range of diverse target classes that are prosecuted in contemporary screening campaigns. In addition, it is also desirable to offer synthetically amenable starting points to increase the probability of a successful fragment evolution through medicinal chemistry. Herein we describe a method to identify biologically relevant chemical substructures that are missing from an existing fragment library (chemical gaps), and organize these chemical gaps hierarchically so that medicinal chemists can efficiently navigate the prioritized chemical space and subsequently select purchasable fragments for inclusion in an enhanced fragment library.

  17. Developing Boundary-Spanning Capacity for Regional Sustainability Transitions—A Comparative Case Study of the Universities of Augsburg (Germany and Linz (Austria

    Directory of Open Access Journals (Sweden)

    Gesa Pflitsch

    2018-03-01

    Full Text Available The potential of universities to become ‘change agents’ for sustainability has increasingly been highlighted in the literature. Some largely open questions are how universities get involved in regional sustainability transitions and how that affects their role in these processes. This paper argues that universities need to develop a boundary-spanning capacity, which enables them to transcend disciplinary as well as sectoral boundaries in order to adopt a developmental role in regional sustainability transitions. It is investigated how universities develop this capacity within a particular regional context, using the method of a transition topology. Comparing how the relationships of universities with their surrounding regions developed in Augsburg (Germany and Linz (Austria, the paper shows why these processes are place-specific. A university’s boundary-spanning capacity develops over time and differs according to the actors involved. The primarily bottom-up driven process in Augsburg was thematically quite broad and involved diverse actors. In Linz, the top-down initiated process was fragmented and more narrowly focused. Individual value-driven actors that made use of their personal networks played an important role in both regions.

  18. Controlling the spotlight of attention: visual span size and flexibility in schizophrenia.

    Science.gov (United States)

    Elahipanah, Ava; Christensen, Bruce K; Reingold, Eyal M

    2011-10-01

    The current study investigated the size and flexible control of visual span among patients with schizophrenia during visual search performance. Visual span is the region of the visual field from which one extracts information during a single eye fixation, and a larger visual span size is linked to more efficient search performance. Therefore, a reduced visual span may explain patients' impaired performance on search tasks. The gaze-contingent moving window paradigm was used to estimate the visual span size of patients and healthy participants while they performed two different search tasks. In addition, changes in visual span size were measured as a function of two manipulations of task difficulty: target-distractor similarity and stimulus familiarity. Patients with schizophrenia searched more slowly across both tasks and conditions. Patients also demonstrated smaller visual span sizes on the easier search condition in each task. Moreover, healthy controls' visual span size increased as target discriminability or distractor familiarity increased. This modulation of visual span size, however, was reduced or not observed among patients. The implications of the present findings, with regard to previously reported visual search deficits, and other functional and structural abnormalities associated with schizophrenia, are discussed. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  20. Life Span Exercise Among Elite Intercollegiate Student Athletes

    OpenAIRE

    Sorenson, Shawn C.; Romano, Russell; Azen, Stanley P.; Schroeder, E. Todd; Salem, George J.

    2015-01-01

    Background: Despite prominent public attention, data on life span health and exercise outcomes among elite, competitive athletes are sparse and do not reflect the diversity of modern athletes. Hypothesis: Life span exercise behavior differs between National Collegiate Athletic Association (NCAA) student athletes and a nonathlete control group. Sustained exercise is associated with improved cardiopulmonary health outcomes. Study Design: Cross-sectional, descriptive epidemiology study. Level of...

  1. Generalized pairing strategies-a bridge from pairing strategies to colorings

    Directory of Open Access Journals (Sweden)

    Győrffy Lajos

    2016-12-01

    Full Text Available In this paper we define a bridge between pairings and colorings of the hypergraphs by introducing a generalization of pairs called t-cakes for t ∈ ℕ, t ≥ 2. For t = 2 the 2-cakes are the same as the well-known pairs of system of distinct representatives, that can be turned to pairing strategies in Maker-Breaker hypergraph games, see Hales and Jewett [12]. The two-colorings are the other extremity of t-cakes, in which the whole ground set of the hypergraph is one big cake that we divide into two parts (color classes. Starting from the pairings (2-cake placement and two-colorings we define the generalized t-cake placements where we pair p elements by q elements (p, q ∈ ℕ, 1 ≤ p, q < t, p + q = t.

  2. A distributed spanning tree algorithm

    DEFF Research Database (Denmark)

    Johansen, Karl Erik; Jørgensen, Ulla Lundin; Nielsen, Svend Hauge

    1988-01-01

    We present a distributed algorithm for constructing a spanning tree for connected undirected graphs. Nodes correspond to processors and edges correspond to two way channels. Each processor has initially a distinct identity and all processors perform the same algorithm. Computation as well as comm...

  3. A study of electron-positron pair equilibria in models of compact X- and gamma-ray sources

    International Nuclear Information System (INIS)

    Bjoernsson, G.

    1990-01-01

    Thermal electron-positron pair equilibria in two temperature models of compact x ray and gamma ray sources are studied. The pairs are assumed to be heated by Coulomb interaction with the much hotter protons and cooled by bremsstrahlung emission, Compton scattering, and annihilation. Two parameters, the proton optical depth and the compactness, characterize each equilibrium state. It is shown that a careful account of the energy balance is very important when the stability properties of the pair equilibria in a spherical plasma cloud are determined. The equilibria are found to be unstable in a very limited range of compactness and proton optical depth. This particular instability is unlikely to be the cause of the observed variability of the compact sources and implies that it is possible to build up high pair densities by a thermal mechanism in two temperature environments. The most important result considers the effects of pairs on the structure of geometrically and effectively optically thin accretion disks. A new approach for solving for the equilibrium structure of the disks is presented. In effect, the pair equilibrium states are projected into the space spanned by the disk structure parameters. This allows a direct visualization of all possible disk solutions at once. Each solution profile needs to be calculated only once and a complete disk solution is obtained by a simple radial coordinate transformation. The disk solutions are thus seen to be scale free in terms of the radial coordinate as well as in terms of the mass of the central object and the accretion rate. Two particular disk solutions are given. It is shown that including electron-positron pairs in the disk structure calculations leads to a breakdown of the thin disk assumptions and that more detailed disk modeling is required before electron-positron pairs can be self-consistently included

  4. Galaxy Zoo: A Catalog of Overlapping Galaxy Pairs for Dust Studies

    Science.gov (United States)

    Keel, William C.; Manning, Anna M.; Holwerda, Benne W.; Mezzoprete, Massimo; Lintott, Chris J.; Schawinski, Kevin; Gay, Pamela; Masters, Karen L.

    2013-01-01

    Analysis of galaxies with overlapping images offers a direct way to probe the distribution of dust extinction and its effects on the background light. We present a catalog of 1990 such galaxy pairs selected from the Sloan Digital Sky Survey (SDSS) by volunteers of the Galaxy Zoo project. We highlight subsamples which are particularly useful for retrieving such properties of the dust distribution as UV extinction, the extent perpendicular to the disk plane, and extinction in the inner parts of disks. The sample spans wide ranges of morphology and surface brightness, opening up the possibility of using this technique to address systematic changes in dust extinction or distribution with galaxy type. This sample will form the basis for forthcoming work on the ranges of dust distributions in local disk galaxies, both for their astrophysical implications and as the low-redshift part of a study of the evolution of dust properties. Separate lists and figures show deep overlaps, where the inner regions of the foreground galaxy are backlit, and the relatively small number of previously-known overlapping pairs outside the SDSS DR7 sky coverage.

  5. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Science.gov (United States)

    Hwang, Hanshin; Taylor, John-Stephen

    2005-03-29

    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  6. Effective Fragment Potential Method for H-Bonding: How To Obtain Parameters for Nonrigid Fragments.

    Science.gov (United States)

    Dubinets, Nikita; Slipchenko, Lyudmila V

    2017-07-20

    Accuracy of the effective fragment potential (EFP) method was explored for describing intermolecular interaction energies in three dimers with strong H-bonded interactions, formic acid, formamide, and formamidine dimers, which are a part of HBC6 database of noncovalent interactions. Monomer geometries in these dimers change significantly as a function of intermonomer separation. Several EFP schemes were considered, in which fragment parameters were prepared for a fragment in its gas-phase geometry or recomputed for each unique fragment geometry. Additionally, a scheme in which gas-phase fragment parameters are shifted according to relaxed fragment geometries is introduced and tested. EFP data are compared against the coupled cluster with single, double, and perturbative triple excitations (CCSD(T)) method in a complete basis set (CBS) and the symmetry adapted perturbation theory (SAPT). All considered EFP schemes provide a good agreement with CCSD(T)/CBS for binding energies at equilibrium separations, with discrepancies not exceeding 2 kcal/mol. However, only the schemes that utilize relaxed fragment geometries remain qualitatively correct at shorter than equilibrium intermolecular distances. The EFP scheme with shifted parameters behaves quantitatively similar to the scheme in which parameters are recomputed for each monomer geometry and thus is recommended as a computationally efficient approach for large-scale EFP simulations of flexible systems.

  7. Ancestral telomere shortening: a countdown that will increase mean life span?

    Science.gov (United States)

    Hertzog, Radu G

    2006-01-01

    Like cells, all mammals have a limited life span. Among cells there are a few exceptions (e.g., immortal cells), among mammals not, even if some of them live longer. Many in vitro and in vivo studies support the consensus that telomere length is strongly correlated with life span. At the somatic cellular level, long telomeres have been associated with longer life span. A different situation can be seen in immortal cells, such as cancer, germ and stem cells, where telomeres are maintained by telomerase, a specialized reverse transcriptase that is involved in synthesis of telomeres. Irrespective of telomere length, if telomerase is active, telomeres can be maintained at a sufficient length to ensure cell survival. To the contrary, telomeres shorten progressively with each cell division and when a critical telomere length (Hayflick limit) is reached, the cells undergo senescence and subsequently apoptosis. In mammals, those with the longest telomeres (e.g., mice) have the shortest life span. Furthermore, the shorter the mean telomere length, the longer the mean life span, as observed in humans (10-14 kpb) and bowhead-whales (undetermined telomere length), which have the longest mean life span among mammals. Over the past centuries, human average life span has increased. The hypothesis presented here suggests that this continual increase in the mean life span could be due to a decrease of mean telomere length over the last hundreds years. Actually, the life span is not directly influenced by length of telomeres, but rather by telomere length - dependent gene expression pattern. According to Greider, "rather than average telomere length, it is the shortest telomere length that makes the biggest difference to a cell". In the context of fast-growing global elderly population due to increase in life expectancy, it also seem to be an age related increase in cancer incidence. Nevertheless, extending healthy life span could depend on how good cells achieve, during the

  8. Robust Object Tracking Using Valid Fragments Selection.

    Science.gov (United States)

    Zheng, Jin; Li, Bo; Tian, Peng; Luo, Gang

    Local features are widely used in visual tracking to improve robustness in cases of partial occlusion, deformation and rotation. This paper proposes a local fragment-based object tracking algorithm. Unlike many existing fragment-based algorithms that allocate the weights to each fragment, this method firstly defines discrimination and uniqueness for local fragment, and builds an automatic pre-selection of useful fragments for tracking. Then, a Harris-SIFT filter is used to choose the current valid fragments, excluding occluded or highly deformed fragments. Based on those valid fragments, fragment-based color histogram provides a structured and effective description for the object. Finally, the object is tracked using a valid fragment template combining the displacement constraint and similarity of each valid fragment. The object template is updated by fusing feature similarity and valid fragments, which is scale-adaptive and robust to partial occlusion. The experimental results show that the proposed algorithm is accurate and robust in challenging scenarios.

  9. Self-organized criticality in fragmenting

    DEFF Research Database (Denmark)

    Oddershede, L.; Dimon, P.; Bohr, J.

    1993-01-01

    The measured mass distributions of fragments from 26 fractured objects of gypsum, soap, stearic paraffin, and potato show evidence of obeying scaling laws; this suggests the possibility of self-organized criticality in fragmenting. The probability of finding a fragment scales inversely to a power...

  10. Energy production using fission fragment rockets

    International Nuclear Information System (INIS)

    Chapline, G.; Matsuda, Y.

    1991-08-01

    Fission fragment rockets are nuclear reactors with a core consisting of thin fibers in a vacuum, and which use magnetic fields to extract the fission fragments from the reactor core. As an alternative to ordinary nuclear reactors, fission fragment rockets would have the following advantages: Approximately twice as efficient if one can directly convert the fission fragment energy into electricity; by reducing the buildup of a fission fragment inventory in the reactor one could avoid a Chernobyl type disaster; and collecting the fission fragments outside the reactor could simplify the waste disposal problem. 6 refs., 4 figs., 2 tabs

  11. Vision in Flies: Measuring the Attention Span.

    Directory of Open Access Journals (Sweden)

    Sebastian Koenig

    Full Text Available A visual stimulus at a particular location of the visual field may elicit a behavior while at the same time equally salient stimuli in other parts do not. This property of visual systems is known as selective visual attention (SVA. The animal is said to have a focus of attention (FoA which it has shifted to a particular location. Visual attention normally involves an attention span at the location to which the FoA has been shifted. Here the attention span is measured in Drosophila. The fly is tethered and hence has its eyes fixed in space. It can shift its FoA internally. This shift is revealed using two simultaneous test stimuli with characteristic responses at their particular locations. In tethered flight a wild type fly keeps its FoA at a certain location for up to 4s. Flies with a mutation in the radish gene, that has been suggested to be involved in attention-like mechanisms, display a reduced attention span of only 1s.

  12. Vision in Flies: Measuring the Attention Span.

    Science.gov (United States)

    Koenig, Sebastian; Wolf, Reinhard; Heisenberg, Martin

    2016-01-01

    A visual stimulus at a particular location of the visual field may elicit a behavior while at the same time equally salient stimuli in other parts do not. This property of visual systems is known as selective visual attention (SVA). The animal is said to have a focus of attention (FoA) which it has shifted to a particular location. Visual attention normally involves an attention span at the location to which the FoA has been shifted. Here the attention span is measured in Drosophila. The fly is tethered and hence has its eyes fixed in space. It can shift its FoA internally. This shift is revealed using two simultaneous test stimuli with characteristic responses at their particular locations. In tethered flight a wild type fly keeps its FoA at a certain location for up to 4s. Flies with a mutation in the radish gene, that has been suggested to be involved in attention-like mechanisms, display a reduced attention span of only 1s.

  13. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  14. Detection of fission fragments by secondary emission; Detection des fragments de fission par emission secondaire

    Energy Technology Data Exchange (ETDEWEB)

    Audias, A [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1965-07-01

    This fission fragment detecting apparatus is based on the principle that fragments traversing a thin foil will cause emission of secondary electrons. These electrons are then accelerated (10 kV) and directly detected by means of a plastic scintillator and associated photomultiplier. Some of the advantages of such a detector are, its rapidity, its discriminating power between alpha particles and fission fragments, its small energy loss in detecting the fragments and the relatively great amount of fissionable material which it can contain. This paper is subdivided as follows: a) theoretical considerations b) constructional details of apparatus and some experimental details and c) a study of the secondary emission effect itself. (author) [French] Le detecteur de fragments de fission que nous avons realise est base sur le principe de l'emission secondaire produite par les fragments de fission traversant une feuille mince: les electrons secondaires emis sont acceleres a des tensions telles (de l'ordre de 10 kV), qu'ils soient directement detectables par un scintillateur plastique associe a un photomultiplicateur. L'interet d'un tel detecteur reside: dans sa rapidite, sa tres bonne discrimination alpha, fission, la possibilite de detecter les fragments de fission avec une perte d'energie pouvant rester relativement faible, et la possibilite d'introduire des quantites de matiere fissile plus importantes que dans les autres types de detecteurs. Ce travail comporte: -) un apercu bibliographique de la theorie du phenomene, -) realisation et mise au point du detecteur avec etude experimentale de quelques parametres intervenant dans l'emission secondaire, -) etude de l'emission secondaire (sur la face d'emergence des fragments de fission) en fonction de l'energie du fragment et en fonction de l'epaisseur de matiere traversee avant emission secondaire, et -) une etude comparative de l'emission secondaire sur la face d'incidence et sur la face d'emergence des fragments de

  15. Thermodynamics of the fuel fragmentation gas

    International Nuclear Information System (INIS)

    Perez, R.B.; Alsmiller, R.G. Jr.

    1977-01-01

    In the context of nuclear reactor safety studies, a program is in progress at ORNL whereby fuel-fragmentation situations are mocked up by the application of high-current capacitor discharges through solid UO 2 samples. The goal of the present work is to predict such quantities as the number of gas and liquid fragments and their energy distributions. The point of view adopted is that upon fragmentation, a cloud of UO 2 vapor is formed containing ''primeval'' liquid fragments which act as condensation centers. In the evolution of time, fragment growth is controlled by nucleation, coagulation and evaporation processes. Eventually, the vapor-droplet system will reach a situation in which clusters (fragments) of various sizes and UO 2 vapor will coexist in an ''association-disassociation'' equilibrium. Thus, the physical model considered here consists of the identification of the fragmentation gas with an ''imperfect'' vapor, made up of interacting UO 2 vapor and liquid fragments. The results of the study are presented

  16. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  17. Increasing Endurance by Building Fluency: Precision Teaching Attention Span.

    Science.gov (United States)

    Binder, Carl; And Others

    1990-01-01

    Precision teaching techniques can be used to chart students' attention span or endurance. Individual differences in attention span can then be better understood and dealt with effectively. The effects of performance duration on performance level, on error rates, and on learning rates are discussed. Implications for classroom practice are noted.…

  18. The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

    Science.gov (United States)

    Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

    2013-01-01

    In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

  19. The potential effects of climate change on amphibian distribution, range fragmentation and turnover in China.

    Science.gov (United States)

    Duan, Ren-Yan; Kong, Xiao-Quan; Huang, Min-Yi; Varela, Sara; Ji, Xiang

    2016-01-01

    Many studies predict that climate change will cause species movement and turnover, but few have considered the effect of climate change on range fragmentation for current species and/or populations. We used MaxEnt to predict suitable habitat, fragmentation and turnover for 134 amphibian species in China under 40 future climate change scenarios spanning four pathways (RCP2.6, RCP4.5, RCP6 and RCP8.5) and two time periods (the 2050s and 2070s). Our results show that climate change may cause a major shift in spatial patterns of amphibian diversity. Amphibians in China would lose 20% of their original ranges on average; the distribution outside current ranges would increase by 15%. Suitable habitats for over 90% of species will be located in the north of their current range, for over 95% of species in higher altitudes (from currently 137-4,124 m to 286-4,396 m in the 2050s or 314-4,448 m in the 2070s), and for over 75% of species in the west of their current range. Also, our results predict two different general responses to the climate change: some species contract their ranges while moving westwards, southwards and to higher altitudes, while others expand their ranges. Finally, our analyses indicate that range dynamics and fragmentation are related, which means that the effects of climate change on Chinese amphibians might be two-folded.

  20. The potential effects of climate change on amphibian distribution, range fragmentation and turnover in China

    Directory of Open Access Journals (Sweden)

    Ren-Yan Duan

    2016-07-01

    Full Text Available Many studies predict that climate change will cause species movement and turnover, but few have considered the effect of climate change on range fragmentation for current species and/or populations. We used MaxEnt to predict suitable habitat, fragmentation and turnover for 134 amphibian species in China under 40 future climate change scenarios spanning four pathways (RCP2.6, RCP4.5, RCP6 and RCP8.5 and two time periods (the 2050s and 2070s. Our results show that climate change may cause a major shift in spatial patterns of amphibian diversity. Amphibians in China would lose 20% of their original ranges on average; the distribution outside current ranges would increase by 15%. Suitable habitats for over 90% of species will be located in the north of their current range, for over 95% of species in higher altitudes (from currently 137–4,124 m to 286–4,396 m in the 2050s or 314–4,448 m in the 2070s, and for over 75% of species in the west of their current range. Also, our results predict two different general responses to the climate change: some species contract their ranges while moving westwards, southwards and to higher altitudes, while others expand their ranges. Finally, our analyses indicate that range dynamics and fragmentation are related, which means that the effects of climate change on Chinese amphibians might be two-folded.

  1. Models of fragmentation with composite power laws

    Science.gov (United States)

    Tavassoli, Z.; Rodgers, G. J.

    1999-06-01

    Some models for binary fragmentation are introduced in which a time dependent transition size produces two regions of fragment sizes above and below the transition size. In the first model we assume a fixed rate of fragmentation for the largest fragment and two different rates of fragmentation in the two regions of sizes above and below the transition size. The model is solved exactly in the long time limit to reveal stable time-invariant solutions for the fragment size and mass distributions. These solutions exhibit composite power law behaviours; power laws with two different exponents for fragments in smaller and larger regions. A special case of the model with no fragmentation in the smaller size region is also examined. Another model is also introduced which have three regions of fragment sizes with different rates of fragmentation. The similarities between the stable distributions in our models and composite power law distributions from experimental work on shock fragmentation of long thin glass rods and thick clay plates are discussed.

  2. Life span extension and neuronal cell protection by Drosophila nicotinamidase.

    Science.gov (United States)

    Balan, Vitaly; Miller, Gregory S; Kaplun, Ludmila; Balan, Karina; Chong, Zhao-Zhong; Li, Faqi; Kaplun, Alexander; VanBerkum, Mark F A; Arking, Robert; Freeman, D Carl; Maiese, Kenneth; Tzivion, Guri

    2008-10-10

    The life span of model organisms can be modulated by environmental conditions that influence cellular metabolism, oxidation, or DNA integrity. The yeast nicotinamidase gene pnc1 was identified as a key transcriptional target and mediator of calorie restriction and stress-induced life span extension. PNC1 is thought to exert its effect on yeast life span by modulating cellular nicotinamide and NAD levels, resulting in increased activity of Sir2 family class III histone deacetylases. In Caenorhabditis elegans, knockdown of a pnc1 homolog was shown recently to shorten the worm life span, whereas its overexpression increased survival under conditions of oxidative stress. The function and regulation of nicotinamidases in higher organisms has not been determined. Here, we report the identification and biochemical characterization of the Drosophila nicotinamidase, D-NAAM, and demonstrate that its overexpression significantly increases median and maximal fly life span. The life span extension was reversed in Sir2 mutant flies, suggesting Sir2 dependence. Testing for physiological effectors of D-NAAM in Drosophila S2 cells, we identified oxidative stress as a primary regulator, both at the transcription level and protein activity. In contrast to the yeast model, stress factors such as high osmolarity and heat shock, calorie restriction, or inhibitors of TOR and phosphatidylinositol 3-kinase pathways do not appear to regulate D-NAAM in S2 cells. Interestingly, the expression of D-NAAM in human neuronal cells conferred protection from oxidative stress-induced cell death in a sirtuin-dependent manner. Together, our findings establish a life span extending the ability of nicotinamidase in flies and offer a role for nicotinamide-modulating genes in oxidative stress regulated pathways influencing longevity and neuronal cell survival.

  3. English for au pairs the au pair's guide to learning English

    CERN Document Server

    Curtis, Lucy

    2014-01-01

    English for Au Pairs has interlinked stories about a group of au pairs new to England. Marta, an 18-year-old from Poland arrives in the UK to work as an au pair. Throughout her year-long stay she has many different experiences - some bad, some good - but with the support of her host family she finds new friends and improves her English. English for Au Pairs offers insight into the joys and difficulties of being an au pair while at the same time reinforcing English language learning through grammar explanations and exercises.

  4. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  5. PAIR INSTABILITY SUPERNOVAE: LIGHT CURVES, SPECTRA, AND SHOCK BREAKOUT

    International Nuclear Information System (INIS)

    Kasen, Daniel; Woosley, S. E.; Heger, Alexander

    2011-01-01

    For the initial mass range (140 M sun sun ) stars die in a thermonuclear runaway triggered by the pair-production instability. The supernovae they make can be remarkably energetic (up to ∼10 53 erg) and synthesize considerable amounts of radioactive isotopes. Here we model the evolution, explosion, and observational signatures of representative pair instability supernovae (PI SNe) spanning a range of initial masses and envelope structures. The predicted light curves last for hundreds of days and range in luminosity from very dim to extremely bright (L ∼ 10 44 erg s -1 ). The most massive events are bright enough to be seen at high redshift, but the extended light curve duration (∼1 yr)-prolonged by cosmological time-dilation-may make it difficult to detect them as transients. A more promising approach may be to search for the brief and luminous outbreak occurring when the explosion shock wave first reaches the stellar surface. Using a multi-wavelength radiation-hydrodynamics code we calculate that, in the rest frame, the shock breakout transients of PI SNe reach luminosities of 10 45 -10 46 erg s -1 , peak at wavelengths ∼30-170 A, and last for several hours. We discuss how observations of the light curves, spectra, and breakout emission can be used to constrain the mass, radius, and metallicity of the progenitor.

  6. A Minimum Spanning Tree Representation of Anime Similarities

    OpenAIRE

    Wibowo, Canggih Puspo

    2016-01-01

    In this work, a new way to represent Japanese animation (anime) is presented. We applied a minimum spanning tree to show the relation between anime. The distance between anime is calculated through three similarity measurements, namely crew, score histogram, and topic similarities. Finally, the centralities are also computed to reveal the most significance anime. The result shows that the minimum spanning tree can be used to determine the similarity anime. Furthermore, by using centralities c...

  7. Fragmentation of atomic clusters: A theoretical study

    International Nuclear Information System (INIS)

    Lopez, M.J.; Jellinek, J.

    1994-01-01

    Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time

  8. Power, Governance and Boundary Spanning Leadership in Public Sector Organisations

    DEFF Research Database (Denmark)

    Elmholdt, Claus Westergård; Fogsgaard, Morten

    2015-01-01

    the fact that analysis of boundary spanning leadership and power relations is an essential, significant, and critical tool in questioning different forms of management in public sector organizations. The aim of the workshop is to investigate, elucidate and discuss management across organizational units...... on the practice that evolves on the boundaries that span occupational groups, departments and organizations. The workshop takes it’s starting point in an interdisciplinary Scandinavian research project which deals with the question of how power processes can promote, or hinder, boundary spanning leadership...

  9. Decision-making heuristics and biases across the life span

    Science.gov (United States)

    Strough, JoNell; Karns, Tara E.; Schlosnagle, Leo

    2013-01-01

    We outline a contextual and motivational model of judgment and decision-making (JDM) biases across the life span. Our model focuses on abilities and skills that correspond to deliberative, experiential, and affective decision-making processes. We review research that addresses links between JDM biases and these processes as represented by individual differences in specific abilities and skills (e.g., fluid and crystallized intelligence, executive functioning, emotion regulation, personality traits). We focus on two JDM biases—the sunk-cost fallacy (SCF) and the framing effect. We trace the developmental trajectory of each bias from preschool through middle childhood, adolescence, early adulthood, and later adulthood. We conclude that life-span developmental trajectories differ depending on the bias investigated. Existing research suggests relative stability in the framing effect across the life span and decreases in the SCF with age, including in later life. We highlight directions for future research on JDM biases across the life span, emphasizing the need for process-oriented research and research that increases our understanding of JDM biases in people’s everyday lives. PMID:22023568

  10. Decision-making heuristics and biases across the life span.

    Science.gov (United States)

    Strough, Jonell; Karns, Tara E; Schlosnagle, Leo

    2011-10-01

    We outline a contextual and motivational model of judgment and decision-making (JDM) biases across the life span. Our model focuses on abilities and skills that correspond to deliberative, experiential, and affective decision-making processes. We review research that addresses links between JDM biases and these processes as represented by individual differences in specific abilities and skills (e.g., fluid and crystallized intelligence, executive functioning, emotion regulation, personality traits). We focus on two JDM biases-the sunk-cost fallacy (SCF) and the framing effect. We trace the developmental trajectory of each bias from preschool through middle childhood, adolescence, early adulthood, and later adulthood. We conclude that life-span developmental trajectories differ depending on the bias investigated. Existing research suggests relative stability in the framing effect across the life span and decreases in the SCF with age, including in later life. We highlight directions for future research on JDM biases across the life span, emphasizing the need for process-oriented research and research that increases our understanding of JDM biases in people's everyday lives. © 2011 New York Academy of Sciences.

  11. Probing the pairing interaction through two-neutron transfer reactions

    Directory of Open Access Journals (Sweden)

    Margueron J.

    2012-12-01

    shows that the improved treatment plays A role close to magicity, leading to an enhancement of the pair-transfer probability. In midshell regions, part of the error made by approximating the initial and final ground states by A single vacuum is compensated by projecting onto A good particle number. Surface effects are analyzed by using pairing interactions with A different volume/surface mixing. Finally, A simple expression of the pair-transfer probability is given in terms of occupation probabilities in the canonical basis. We show that, in the canonical basis formulation, surface effects that are visible in the transfer probability are related to the fragmentation of single-particle occupancies close to the Fermi energy. This provides A complementary interpretation with respect to the standard quasiparticle representation where surface effects are generated by the integrated radial profiles of the contributing wave functions.

  12. The Life Span Dwelling

    OpenAIRE

    Hans-Peter Hebensperger-Hüther; Gabriele Franger-Huhle

    2014-01-01

    The paper presents the findings from a survey of 10 different experimental housing projects in Bavaria. In 2005 students of architecture and students of social work at the University of Applied Science in Coburg approached the topic of “Life Span Dwelling” using interdisciplinary research methods. The scope of the research ranges from urban planning concepts to common spaces in the different neighborhoods, documenting user satisfaction with the individual unit and feasibility of rooms offered...

  13. Life span of animals under acute and chronic irradiation

    International Nuclear Information System (INIS)

    Zapol'skaya, N.A.; Fedorova, A.V.; Borisova, V.V.

    1978-01-01

    The study has been designed to see to what extent a single and long-term external and internal irradiations shorten the life span of animals. LDsub(50/30) for certain radionuclides whose absorbed doses show different spatiotemporal distributions are considered. It has been found that as far as the average life span is concerned, 137 Cs and 90 Sr have approximately the same effect whether they enter the body on a single occasion or repeatedly. With chronic total-body external gamma-irradiation, the decrease in life span is 5 times smaller than than with single-occasion irradiation. The main reason for the observed differences are found to be differences in the rates with which the absorbed doses are formed

  14. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  15. From elongated spanning trees to vicious random walks

    OpenAIRE

    Gorsky, A.; Nechaev, S.; Poghosyan, V. S.; Priezzhev, V. B.

    2012-01-01

    Given a spanning forest on a large square lattice, we consider by combinatorial methods a correlation function of $k$ paths ($k$ is odd) along branches of trees or, equivalently, $k$ loop--erased random walks. Starting and ending points of the paths are grouped in a fashion a $k$--leg watermelon. For large distance $r$ between groups of starting and ending points, the ratio of the number of watermelon configurations to the total number of spanning trees behaves as $r^{-\

  16. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  17. Geospatial analysis of forest fragmentation in Uttara Kannada District, India

    Directory of Open Access Journals (Sweden)

    Ramachandra T V

    2016-04-01

    Full Text Available Background: Landscapes consist of heterogeneous interacting dynamic elements with complex ecological, economic and cultural attributes. These complex interactions help in the sustenance of natural resources through bio-geochemical and hydrological cycling. The ecosystem functions are altered with changes in the landscape structure. Fragmentation of large contiguous forests to small and isolated forest patches either by natural phenomena or anthropogenic activities leads to drastic changes in forest patch sizes, shape, connectivity and internal heterogeneity, which restrict the movement leading to inbreeding among Meta populations with extirpation of species. Methods: Landscape dynamics are assessed through land use analysis by way of remote sensing data acquired at different time periods. Forest fragmentation is assessed at the pixel level through computation of two indicators, i.e., Pf (the ratio of pixels that are forested to the total non-water pixels in the window and Pff (the proportion of all adjacent (cardinal directions only pixel pairs that include at least one forest pixel, for which both pixels are forested. Results: Uttara Kannada District has the distinction of having the highest forest cover in Karnataka State, India. This region has been experiencing changes in its forest cover and consequent alterations in functional abilities of its ecosystem. Temporal land use analyses show the trend of deforestation, evident from the reduction of evergreen - semi evergreen forest cover from 57.31 % (1979 to 32.08 % (2013 Forest fragmentation at the landscape level shows a decline of interior forests 64.42 % (1979 to 25.62 % (2013 and transition of non-forest categories such as crop land, plantations and built-up areas, amounting now to 47.29 %. PCA prioritized geophysical and socio variables responsible for changes in the landscape structure at local levels. Conclusion: Terrestrial forest ecosystems in Uttara Kannada District of Central

  18. Photon-hadron fragmentation: theoretical situation

    International Nuclear Information System (INIS)

    Peschanski, R.

    1983-07-01

    Using a selection of new experimental results models of hadronic fragmentation and their phenomenological comparison are presented. Indeed a convenient theory of hadronic fragmentation -for instance based on Q.C.D.- does not exist: low transverse momentum fragmentation involves the badly known hadronic long-range forces. Models should clarify the situation in the prospect of an eventual future theory

  19. Recent progress on perturbative QCD fragmentation functions

    International Nuclear Information System (INIS)

    Cheung, K.

    1995-05-01

    The recent development of perturbative QCD (PQCD) fragmentation functions has strong impact on quarkonium production. I shall summarize B c meson production based on these PQCD fragmentation functions, as well as, the highlights of some recent activities on applying these PQCD fragmentation functions to explain anomalous J/ψ and ψ' production at the Tevatron. Finally, I discuss a fragmentation model based on the PQCD fragmentation functions for heavy quarks fragmenting into heavy-light mesons

  20. Life Span and Resiliency Theory: A Critical Review

    Directory of Open Access Journals (Sweden)

    Alexa Smith-Osborne

    2007-05-01

    Full Text Available Theories of life span development describe human growth and change over the life cycle (Robbins, Chatterjee, & Canda, 2006. Major types of developmental theories include biological, psychodynamic, behavioral, and social learning, cognitive, moral, and spiritual, and those influenced by systems, empowerment, and conflict theory. Life span development theories commonly focus on ontogenesis and sequential mastery of skills, tasks, and abilities. Social work scholars have pointed out that a limitation of life span and other developmental theory is lack of attention to resilience (Greene, 2007; Robbins et al., 1998. The concept of resilience was developed to “describe relative resistance to psychosocial risk experiences” (Rutter, 1999b, p. 119. Longitudinal studies focused on typical and atypical child development informed theory formulation in developmental psychopathology (Garmezy & Rutter, 1983; Luthar, Cichetti,& Becker, 2000 and in an evolving resilience model (Richardson, 2002; Werner & Smith, 1992. Research on resilience has found a positive relationship between a number of individual traits and contextual variables and resistance to a variety of risk factors among children and adolescents. More recently, resilience research has examined the operation of these same factors in the young adult, middle-age, and elder life stages. This article examines the historical and conceptual progression of the two developmental theories—life span and resiliency—and discusses their application to social work practice and education in human behavior in the social environment.

  1. Fragmentation and flow in central collisions

    International Nuclear Information System (INIS)

    Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

    1987-01-01

    Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

  2. Long-term effects of fragmentation and fragment properties on bird species richness in Hawaiian forests

    Science.gov (United States)

    David J. Flaspohler; Christian P. Giardina; Gregory P. Asner; Patrick Hart; Jonathan Price; Cassie Ka’apu Lyons; Xeronimo. Castaneda

    2010-01-01

    Forest fragmentation is a common disturbance affecting biological diversity, yet the impacts of fragmentation on many forest processes remain poorly understood. Forest restoration is likely to be more successful when it proceeds with an understanding of how native and exotic vertebrates utilize forest patches of different size. We used a system of forest fragments...

  3. Mass spectrometry for fragment screening.

    Science.gov (United States)

    Chan, Daniel Shiu-Hin; Whitehouse, Andrew J; Coyne, Anthony G; Abell, Chris

    2017-11-08

    Fragment-based approaches in chemical biology and drug discovery have been widely adopted worldwide in both academia and industry. Fragment hits tend to interact weakly with their targets, necessitating the use of sensitive biophysical techniques to detect their binding. Common fragment screening techniques include differential scanning fluorimetry (DSF) and ligand-observed NMR. Validation and characterization of hits is usually performed using a combination of protein-observed NMR, isothermal titration calorimetry (ITC) and X-ray crystallography. In this context, MS is a relatively underutilized technique in fragment screening for drug discovery. MS-based techniques have the advantage of high sensitivity, low sample consumption and being label-free. This review highlights recent examples of the emerging use of MS-based techniques in fragment screening. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  4. Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

    Science.gov (United States)

    Mei, B.; Tu, X. L.; Wang, M.

    2018-04-01

    An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

  5. Ontology aided modeling of organic reaction mechanisms with flexible and fragment based XML markup procedures.

    Science.gov (United States)

    Sankar, Punnaivanam; Aghila, Gnanasekaran

    2007-01-01

    The mechanism models for primary organic reactions encoding the structural fragments undergoing substitution, addition, elimination, and rearrangements are developed. In the proposed models, each and every structural component of mechanistic pathways is represented with flexible and fragment based markup technique in XML syntax. A significant feature of the system is the encoding of the electron movements along with the other components like charges, partial charges, half bonded species, lone pair electrons, free radicals, reaction arrows, etc. needed for a complete representation of reaction mechanism. The rendering of reaction schemes described with the proposed methodology is achieved with a concise XML extension language interoperating with the structure markup. The reaction scheme is visualized as 2D graphics in a browser by converting them into SVG documents enabling the desired layouts normally perceived by the chemists conventionally. An automatic representation of the complex patterns of the reaction mechanism is achieved by reusing the knowledge in chemical ontologies and developing artificial intelligence components in terms of axioms.

  6. The optimum spanning catenary cable

    Science.gov (United States)

    Wang, C. Y.

    2015-03-01

    A heavy cable spans two points in space. There exists an optimum cable length such that the maximum tension is minimized. If the two end points are at the same level, the optimum length is 1.258 times the distance between the ends. The optimum lengths for end points of different heights are also found.

  7. Van Kampen Colimits as Bicolimits in Span

    Science.gov (United States)

    Heindel, Tobias; Sobociński, Paweł

    The exactness properties of coproducts in extensive categories and pushouts along monos in adhesive categories have found various applications in theoretical computer science, e.g. in program semantics, data type theory and rewriting. We show that these properties can be understood as a single universal property in the associated bicategory of spans. To this end, we first provide a general notion of Van Kampen cocone that specialises to the above colimits. The main result states that Van Kampen cocones can be characterised as exactly those diagrams in ℂ that induce bicolimit diagrams in the bicategory of spans mathcal{S}pan_{mathbb{C}}, provided that ℂ has pullbacks and enough colimits.

  8. Spanning organizational boundaries to manage creative processes:

    DEFF Research Database (Denmark)

    Andersen, Poul Houman; Kragh, Hanne; Lettl, Christopher

    2013-01-01

    In order to continue to be innovative in the current fast-paced and competitive environment, organizations are increasingly dependent on creative inputs developed outside their boundaries. The paper addresses the boundary spanning activities that managers undertake to a) select and mobilize...... creative talent, b) create shared identity, and c) combine and integrate knowledge in innovation projects involving external actors. We study boundary spanning activities in two creative projects in the LEGO group. One involves identifying and integrating deep, specialized knowledge, the other focuses...... actors, and how knowledge is integrated across organizational boundaries. We discuss implications of our findings for managers and researchers in a business-to-business context...

  9. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  10. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  11. First measurement of the quark-to-photon fragmentation function

    International Nuclear Information System (INIS)

    Buskulic, D.; Casper, D.; Bonis, I. de

    1996-01-01

    Earlier measurements at LEP of isolated hard photons in hadronic Z decays, attributed to radiation from primary quark pairs, have been extended in the ALEPH experiment to include hard photon production inside hadron jets. Events are selected where all particles combine democratically to form hadron jets, one of which contains a photon with a fractional energy z ≥ 0.7. After statistical subtraction of non-prompt photons, the quark-to-photon fragmentation function, D(z), is extracted directly from the measured 2-jet rate. By taking into account the perturbative contributions to D(z) obtained from an O(αα S ) QCD calculation, the unknown non-perturbative component of D(z) is then determined at high z. Provided due account is taken of hadronization effects near z = 1, a good description of the other event topologies is then found. (orig.)

  12. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  13. Mahonian pairs

    OpenAIRE

    Sagan, Bruce E.; Savage, Carla D.

    2012-01-01

    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  14. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  15. From elongated spanning trees to vicious random walks

    Science.gov (United States)

    Gorsky, A.; Nechaev, S.; Poghosyan, V. S.; Priezzhev, V. B.

    2013-05-01

    Given a spanning forest on a large square lattice, we consider by combinatorial methods a correlation function of k paths (k is odd) along branches of trees or, equivalently, k loop-erased random walks. Starting and ending points of the paths are grouped such that they form a k-leg watermelon. For large distance r between groups of starting and ending points, the ratio of the number of watermelon configurations to the total number of spanning trees behaves as r-ν log r with ν = (k2 - 1) / 2. Considering the spanning forest stretched along the meridian of this watermelon, we show that the two-dimensional k-leg loop-erased watermelon exponent ν is converting into the scaling exponent for the reunion probability (at a given point) of k (1 + 1)-dimensional vicious walkers, ν˜ =k2 / 2. At the end, we express the conjectures about the possible relation to integrable systems.

  16. From elongated spanning trees to vicious random walks

    Energy Technology Data Exchange (ETDEWEB)

    Gorsky, A. [ITEP, B. Cheryomushkinskaya 25, 117218 Moscow (Russian Federation); Nechaev, S., E-mail: nechaev@lptms.u-psud.fr [LPTMS, Université Paris Sud, 91405 Orsay Cedex (France); P.N. Lebedev Physical Institute of the Russian Academy of Sciences, 119991 Moscow (Russian Federation); Poghosyan, V.S. [Institute for Informatics and Automation Problems NAS of Armenia, 375044 Yerevan (Armenia); Priezzhev, V.B. [Bogolubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, 141980 Dubna (Russian Federation)

    2013-05-01

    Given a spanning forest on a large square lattice, we consider by combinatorial methods a correlation function of k paths (k is odd) along branches of trees or, equivalently, k loop-erased random walks. Starting and ending points of the paths are grouped such that they form a k-leg watermelon. For large distance r between groups of starting and ending points, the ratio of the number of watermelon configurations to the total number of spanning trees behaves as r{sup −ν}logr with ν=(k{sup 2}−1)/2. Considering the spanning forest stretched along the meridian of this watermelon, we show that the two-dimensional k-leg loop-erased watermelon exponent ν is converting into the scaling exponent for the reunion probability (at a given point) of k(1+1)-dimensional vicious walkers, ν{sup -tilde=}k{sup 2}/2. At the end, we express the conjectures about the possible relation to integrable systems.

  17. From elongated spanning trees to vicious random walks

    International Nuclear Information System (INIS)

    Gorsky, A.; Nechaev, S.; Poghosyan, V.S.; Priezzhev, V.B.

    2013-01-01

    Given a spanning forest on a large square lattice, we consider by combinatorial methods a correlation function of k paths (k is odd) along branches of trees or, equivalently, k loop-erased random walks. Starting and ending points of the paths are grouped such that they form a k-leg watermelon. For large distance r between groups of starting and ending points, the ratio of the number of watermelon configurations to the total number of spanning trees behaves as r −ν logr with ν=(k 2 −1)/2. Considering the spanning forest stretched along the meridian of this watermelon, we show that the two-dimensional k-leg loop-erased watermelon exponent ν is converting into the scaling exponent for the reunion probability (at a given point) of k(1+1)-dimensional vicious walkers, ν -tilde= k 2 /2. At the end, we express the conjectures about the possible relation to integrable systems

  18. USING GENETIC ALGORTIHM TO SOLVE STEINER MINIMUM SPANNING TREE PROBLEM

    Directory of Open Access Journals (Sweden)

    Öznur İŞÇİ

    2006-03-01

    Full Text Available Genetic algorithms (GA are a stochastic research methods, and they produce solutions that are close to optimum or near optimum. In addition to GA's successful application to traveling salesman problem, square designation, allocation, workshop table, preparation of lesson/examination schedules, planning of communication networks, assembling line balanced, minimum spanning tree type many combinatorial optimization problems it would be applicable to make the best comparison in optimization. In this study a Java program is developed to solve Steiner minimum spanning tree problem by genetic algorithm and its performance is examined. According to the tests carried out on the problems that were given before in the literature, results that are close to optimum are obtained in by GA approach that is recommended in this study. For the predetermined points in the study, length and gain are calculated for Steiner minimum spanning tree problem and minimum spanning tree problem.

  19. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  20. MRI of displaced meniscal fragments

    Energy Technology Data Exchange (ETDEWEB)

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  1. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  2. Is the superior verbal memory span of Mandarin speakers due to faster rehearsal?

    Science.gov (United States)

    Mattys, Sven L; Baddeley, Alan; Trenkic, Danijela

    2018-04-01

    It is well established that digit span in native Chinese speakers is atypically high. This is commonly attributed to a capacity for more rapid subvocal rehearsal for that group. We explored this hypothesis by testing a group of English-speaking native Mandarin speakers on digit span and word span in both Mandarin and English, together with a measure of speed of articulation for each. When compared to the performance of native English speakers, the Mandarin group proved to be superior on both digit and word spans while predictably having lower spans in English. This suggests that the Mandarin advantage is not limited to digits. Speed of rehearsal correlated with span performance across materials. However, this correlation was more pronounced for English speakers than for any of the Chinese measures. Further analysis suggested that speed of rehearsal did not provide an adequate account of differences between Mandarin and English spans or for the advantage of digits over words. Possible alternative explanations are discussed.

  3. Exploratory and problem-solving consumer behavior across the life span.

    Science.gov (United States)

    Lesser, J A; Kunkel, S R

    1991-09-01

    Different cognitive functioning, social, and personality changes appear to occur systematically during the adult life span. This article synthesizes research on life span changes in order to develop age-specific models of shopping behavior. The models are tested within a naturalistic field study of shoppers.

  4. Geospatial analysis of forest fragmentation in Uttara Kannada District, India

    Institute of Scientific and Technical Information of China (English)

    Ramachandra T V; Bharath Setturu; Subash Chandran

    2016-01-01

    Background: Landscapes consist of heterogeneous interacting dynamic elements with complex ecological,economic and cultural attributes. These complex interactions help in the sustenance of natural resources through bio-geochemical and hydrological cycling. The ecosystem functions are altered with changes in the landscape structure. Fragmentation of large contiguous forests to small and isolated forest patches either by natural phenomena or anthropogenic activities leads to drastic changes in forest patch sizes, shape, connectivity and internal heterogeneity, which restrict the movement leading to inbreeding among Meta populations with extirpation of species.Methods: Landscape dynamics are assessed through land use analysis by way of remote sensing data acquired at different time periods. Forest fragmentation is assessed at the pixel level through computation of two indicators,i.e., Pf(the ratio of pixels that are forested to the total non-water pixels in the window) and Pff(the proportion of all adjacent(cardinal directions only) pixel pairs that include at least one forest pixel, for which both pixels are forested).Results: Uttara Kannada District has the distinction of having the highest forest cover in Karnataka State, India. This region has been experiencing changes in its forest cover and consequent alterations in functional abilities of its ecosystem. Temporal land use analyses show the trend of deforestation, evident from the reduction of evergreen-semi evergreen forest cover from 57.31 %(1979) to 32.08 %(2013) Forest fragmentation at the landscape level shows a decline of interior forests 64.42 %(1979) to 25.62 %(2013) and transition of non-forest categories such as crop land, plantations and built-up areas, amounting now to 47.29 %. PCA prioritized geophysical and socio variables responsible for changes in the landscape structure at local levels.Conclusion: Terrestrial forest ecosystems in Uttara Kannada District of Central Western Ghats have been

  5. Life Span Extension and Neuronal Cell Protection by Drosophila Nicotinamidase*S⃞

    OpenAIRE

    Balan, Vitaly; Miller, Gregory S.; Kaplun, Ludmila; Balan, Karina; Chong, Zhao-Zhong; Li, Faqi; Kaplun, Alexander; VanBerkum, Mark F. A.; Arking, Robert; Freeman, D. Carl; Maiese, Kenneth; Tzivion, Guri

    2008-01-01

    The life span of model organisms can be modulated by environmental conditions that influence cellular metabolism, oxidation, or DNA integrity. The yeast nicotinamidase gene pnc1 was identified as a key transcriptional target and mediator of calorie restriction and stress-induced life span extension. PNC1 is thought to exert its effect on yeast life span by modulating cellular nicotinamide and NAD levels, resulting in increased activity of Sir2 family class III histone ...

  6. Individual differences in personality change across the adult life span.

    Science.gov (United States)

    Schwaba, Ted; Bleidorn, Wiebke

    2018-06-01

    A precise and comprehensive description of personality continuity and change across the life span is the bedrock upon which theories of personality development are built. Little research has quantified the degree to which individuals deviate from mean-level developmental trends. In this study, we addressed this gap by examining individual differences in personality trait change across the life span. Data came from a nationally representative sample of 9,636 Dutch participants who provided Big Five self-reports at five assessment waves across 7 years. We divided our sample into 14 age groups (ages 16-84 at initial measurement) and estimated latent growth curve models to describe individual differences in personality change across the study period for each trait and age group. Across the adult life span, individual differences in personality change were small but significant until old age. For Openness, Conscientiousness, Extraversion, and Agreeableness, individual differences in change were most pronounced in emerging adulthood and decreased throughout midlife and old age. For Emotional Stability, individual differences in change were relatively consistent across the life span. These results inform theories of life span development and provide future directions for research on the causes and conditions of personality change. © 2017 Wiley Periodicals, Inc.

  7. Facilitating conditions for boundary-spanning behavior in governance networks

    OpenAIRE

    Meerkerk, Ingmar; Edelenbos, Jurian

    2017-01-01

    textabstractThis article examines the impact of two facilitating conditions for boundary-spanning behaviour in urban governance networks. While research on boundary spanning is growing, there is little attention for antecedents. Combining governance network literature on project management and organizational literature on facilitative and servant leadership, we examine two potential conditions: a facilitative project management style and executive support. We conducted survey research among p...

  8. Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

    2013-09-21

    The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

  9. Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

    International Nuclear Information System (INIS)

    Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

    2013-01-01

    The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

  10. The BioFragment Database (BFDb): An open-data platform for computational chemistry analysis of noncovalent interactions

    Science.gov (United States)

    Burns, Lori A.; Faver, John C.; Zheng, Zheng; Marshall, Michael S.; Smith, Daniel G. A.; Vanommeslaeghe, Kenno; MacKerell, Alexander D.; Merz, Kenneth M.; Sherrill, C. David

    2017-10-01

    Accurate potential energy models are necessary for reliable atomistic simulations of chemical phenomena. In the realm of biomolecular modeling, large systems like proteins comprise very many noncovalent interactions (NCIs) that can contribute to the protein's stability and structure. This work presents two high-quality chemical databases of common fragment interactions in biomolecular systems as extracted from high-resolution Protein DataBank crystal structures: 3380 sidechain-sidechain interactions and 100 backbone-backbone interactions that inaugurate the BioFragment Database (BFDb). Absolute interaction energies are generated with a computationally tractable explicitly correlated coupled cluster with perturbative triples [CCSD(T)-F12] "silver standard" (0.05 kcal/mol average error) for NCI that demands only a fraction of the cost of the conventional "gold standard," CCSD(T) at the complete basis set limit. By sampling extensively from biological environments, BFDb spans the natural diversity of protein NCI motifs and orientations. In addition to supplying a thorough assessment for lower scaling force-field (2), semi-empirical (3), density functional (244), and wavefunction (45) methods (comprising >1M interaction energies), BFDb provides interactive tools for running and manipulating the resulting large datasets and offers a valuable resource for potential energy model development and validation.

  11. Fragment-based quantitative structure-activity relationship (FB-QSAR) for fragment-based drug design.

    Science.gov (United States)

    Du, Qi-Shi; Huang, Ri-Bo; Wei, Yu-Tuo; Pang, Zong-Wen; Du, Li-Qin; Chou, Kuo-Chen

    2009-01-30

    In cooperation with the fragment-based design a new drug design method, the so-called "fragment-based quantitative structure-activity relationship" (FB-QSAR) is proposed. The essence of the new method is that the molecular framework in a family of drug candidates are divided into several fragments according to their substitutes being investigated. The bioactivities of molecules are correlated with the physicochemical properties of the molecular fragments through two sets of coefficients in the linear free energy equations. One coefficient set is for the physicochemical properties and the other for the weight factors of the molecular fragments. Meanwhile, an iterative double least square (IDLS) technique is developed to solve the two sets of coefficients in a training data set alternately and iteratively. The IDLS technique is a feedback procedure with machine learning ability. The standard Two-dimensional quantitative structure-activity relationship (2D-QSAR) is a special case, in the FB-QSAR, when the whole molecule is treated as one entity. The FB-QSAR approach can remarkably enhance the predictive power and provide more structural insights into rational drug design. As an example, the FB-QSAR is applied to build a predictive model of neuraminidase inhibitors for drug development against H5N1 influenza virus. (c) 2008 Wiley Periodicals, Inc.

  12. Minimal spanning trees, filaments and galaxy clustering

    International Nuclear Information System (INIS)

    Barrow, J.D.; Sonoda, D.H.

    1985-01-01

    A graph theoretical technique for assessing intrinsic patterns in point data sets is described. A unique construction, the minimal spanning tree, can be associated with any point data set given all the inter-point separations. This construction enables the skeletal pattern of galaxy clustering to be singled out in quantitative fashion and differs from other statistics applied to these data sets. This technique is described and applied to two- and three-dimensional distributions of galaxies and also to comparable random samples and numerical simulations. The observed CfA and Zwicky data exhibit characteristic distributions of edge-lengths in their minimal spanning trees which are distinct from those found in random samples. (author)

  13. Pair correlations in nuclei

    International Nuclear Information System (INIS)

    Shimizu, Yoshifumi

    2009-01-01

    Except for the closed shell nuclei, almost all nuclei are in the superconducting state at their ground states. This well-known pair correlation in nuclei causes various interesting phenomena. It is especially to be noted that the pair correlation becomes weak in the excited states of nuclei with high angular momentum, which leads to the pair phase transition to the normal state in the high spin limit. On the other hand, the pair correlation becomes stronger in the nuclei with lower nucleon density than in those with normal density. In the region of neutron halo or skin state of unstable nuclei, this phenomenon is expected to be further enhanced to be observed compared to the ground state of stable nuclei. An overview of those interesting aspects caused via the pair correlation is presented here in the sections titled 'pair correlations in ground states', pair correlations in high spin states' and 'pair correlations in unstable nuclei' focusing on the high spin state. (S. Funahashi)

  14. Understanding retirement: the promise of life-span developmental frameworks.

    Science.gov (United States)

    Löckenhoff, Corinna E

    2012-09-01

    The impending retirement of large population cohorts creates a pressing need for practical interventions to optimize outcomes at the individual and societal level. This necessitates comprehensive theoretical models that acknowledge the multi-layered nature of the retirement process and shed light on the dynamic mechanisms that drive longitudinal patterns of adjustment. The present commentary highlights ways in which contemporary life-span developmental frameworks can inform retirement research, drawing on the specific examples of Bronfenbrenner's Ecological Model, Baltes and Baltes Selective Optimization with Compensation Framework, Schulz and Heckhausen's Motivational Theory of Life-Span Development, and Carstensen's Socioemotional Selectivity Theory. Ultimately, a life-span developmental perspective on retirement offers not only new interpretations of known phenomena but may also help to identify novel directions for future research as well as promising pathways for interventions.

  15. Experimental many-pairs nonlocality

    Science.gov (United States)

    Poh, Hou Shun; Cerè, Alessandro; Bancal, Jean-Daniel; Cai, Yu; Sangouard, Nicolas; Scarani, Valerio; Kurtsiefer, Christian

    2017-08-01

    Collective measurements on large quantum systems together with a majority voting strategy can lead to a violation of the Clauser-Horne-Shimony-Holt Bell inequality. In the presence of many entangled pairs, this violation decreases quickly with the number of pairs and vanishes for some critical pair number that is a function of the noise present in the system. Here we show that a different binning strategy can lead to a more substantial Bell violation when the noise is sufficiently small. Given the relation between the critical pair number and the source noise, we then present an experiment where the critical pair number is used to quantify the quality of a high visibility photon pair source. Our results demonstrate nonlocal correlations using collective measurements operating on clusters of more than 40 photon pairs.

  16. Developmental Regulation across the Life Span: Toward a New Synthesis

    Science.gov (United States)

    Haase, Claudia M.; Heckhausen, Jutta; Wrosch, Carsten

    2013-01-01

    How can individuals regulate their own development to live happy, healthy, and productive lives? Major theories of developmental regulation across the life span have been proposed (e.g., dual-process model of assimilation and accommodation; motivational theory of life-span development; model of selection, optimization, and compensation), but they…

  17. RESEARCH OF USING OPEN DOUBLE T BEAMS FOR SPANS IN FLOATING BRIDGES

    Directory of Open Access Journals (Sweden)

    YU. M. Gorbatiuk

    2014-03-01

    Full Text Available Purpose. The publication presents the results of calculations of spans for floating bridges with open double T beams. The purpose of research is to analyze the suitability of spans from open double T beams for floating bridges with minimum weight under loads, which is provided by standards for modern floating bridges designing. Methodology. Comparative method, analytical calculation methods (influence lines methodology, strength calculations, endurance, maximum shear stress are used in this paper. Findings. Current loads for bridges calculations are 75% more than those, for which the spans of floating bridge from NZhM-56 property are designed. The use of open double T beams that is formed with double T beam no. 70 (the height of the open one is 104 cm reduces the cross sectional area in a weakened spot, but virtually it does not influence the strength and durability of the material. The use of open double T beams for spans of floating bridges saves up to 22 % of metal that means one in five spans will made of saved metal. Savings on each spans, such as CRP, will be 33.6 - 263 thous. grn. (considering the price of 1 ton of final product 29 thous. grn.. Originality. Research allows making next step in material saving and use of open double T beams for spans in the whole. Practical value. The obtained results give us possibility to make a number of conclusions that allow us to become more familiar and more practical with the use of open double T beams for spans of floating bridges.

  18. Is dynamic contrast-enhanced MRI useful for assessing proximal fragment vascularity in scaphoid fracture delayed and non-union?

    Energy Technology Data Exchange (ETDEWEB)

    Ng, Alex W.H.; Griffith, James F.; Li, Alvin [The Chinese University of Hong Kong, Department of Imaging and Interventional Radiology, Prince of Wales Hospital, Hong Kong, SAR (China); Taljanovic, Mihra S. [The University of Arizona Health Network, Department of Medical Imaging, 1501 N. Campbell Ave., P.O. Box 245067, Tucson, AZ (United States); Tse, W.L.; Ho, P.C. [The Chinese University of Hong Kong, Department of Orthopedics and Traumatology, Prince of Wales Hospital, Hong Kong (China)

    2013-07-15

    To assess dynamic contrast-enhanced magnetic resonance imaging (DCE MRI) as a measure of vascularity in scaphoid delayed-union or non-union. Thirty-five patients (34 male, one female; mean age, 27.4 {+-} 9.4 years; range, 16-51 years) with scaphoid delayed-union and non-union who underwent DCE MRI of the scaphoid between September 2002 and October 2012 were retrospectively reviewed. Proximal fragment vascularity was classified as good, fair, or poor on unenhanced MRI, contrast-enhanced MRI, and DCE MRI. For DCE MRI, enhancement slope, E{sub slope} comparison of proximal and distal fragments was used to classify the proximal fragment as good, fair, or poor vascularity. Proximal fragment vascularity was similarly graded at surgery in all patients. Paired t test and McNemar test were used for data comparison. Kappa value was used to assess level of agreement between MRI findings and surgical findings. Twenty-five (71 %) of 35 patients had good vascularity, four (11 %) had fair vascularity, and six (17 %) had poor vascularity of the proximal scaphoid fragment at surgery. DCE MRI parameters had the highest correlation with surgical findings (kappa = 0.57). Proximal scaphoid fragments with surgical poor vascularity had a significantly lower E{sub max} and E{sub slope} than those with good vascularity (p = 0.0043 and 0.027). The sensitivity, specificity, positive and negative predictive value and accuracy of DCE MRI in predicting impaired vascularity was 67, 86, 67, 86, and 80 %, respectively, which was better than that seen with unenhanced and post-contrast MRI. Flattened time intensity curves in both proximal and distal fragments were a feature of protracted non-union with a mean time interval of 101.6 {+-} 95.5 months between injury and MRI. DCE MRI has a higher diagnostic accuracy than either non-enhanced MRI or contrast enhanced MRI for assessing proximal fragment vascularity in scaphoid delayed-union and non-union. For proper interpretation of contrast

  19. Reframing landscape fragmentation's effects on ecosystem services.

    Science.gov (United States)

    Mitchell, Matthew G E; Suarez-Castro, Andrés F; Martinez-Harms, Maria; Maron, Martine; McAlpine, Clive; Gaston, Kevin J; Johansen, Kasper; Rhodes, Jonathan R

    2015-04-01

    Landscape structure and fragmentation have important effects on ecosystem services, with a common assumption being that fragmentation reduces service provision. This is based on fragmentation's expected effects on ecosystem service supply, but ignores how fragmentation influences the flow of services to people. Here we develop a new conceptual framework that explicitly considers the links between landscape fragmentation, the supply of services, and the flow of services to people. We argue that fragmentation's effects on ecosystem service flow can be positive or negative, and use our framework to construct testable hypotheses about the effects of fragmentation on final ecosystem service provision. Empirical efforts to apply and test this framework are critical to improving landscape management for multiple ecosystem services. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Fragment Size Distribution of Blasted Rock Mass

    Science.gov (United States)

    Jug, Jasmin; Strelec, Stjepan; Gazdek, Mario; Kavur, Boris

    2017-12-01

    Rock mass is a heterogeneous material, and the heterogeneity of rock causes sizes distribution of fragmented rocks in blasting. Prediction of blasted rock mass fragmentation has a significant role in the overall economics of opencast mines. Blasting as primary fragmentation can significantly decrease the cost of loading, transport, crushing and milling operations. Blast fragmentation chiefly depends on the specific blast design (geometry of blast holes drilling, the quantity and class of explosive, the blasting form, the timing and partition, etc.) and on the properties of the rock mass (including the uniaxial compressive strength, the rock mass elastic Young modulus, the rock discontinuity characteristics and the rock density). Prediction and processing of blasting results researchers can accomplish by a variety of existing software’s and models, one of them is the Kuz-Ram model, which is possibly the most widely used approach to estimating fragmentation from blasting. This paper shows the estimation of fragmentation using the "SB" program, which was created by the authors. Mentioned program includes the Kuz-Ram model. Models of fragmentation are confirmed and calibrated by comparing the estimated fragmentation with actual post-blast fragmentation from image processing techniques. In this study, the Kuz-Ram fragmentation model has been used for an open-pit limestone quarry in Dalmatia, southern Croatia. The resulting calibrated value of the rock factor enables the quality prognosis of fragmentation in further blasting works, with changed drilling geometry and blast design parameters. It also facilitates simulation in the program to optimize blasting works and get the desired fragmentations of the blasted rock mass.

  1. Au pair trajectories

    DEFF Research Database (Denmark)

    Dalgas, Karina Märcher

    2015-01-01

    pair-sending families in the Philippines, this dissertation examines the long-term trajectories of these young Filipinas. It shows how the au pairs’ local and transnational family relations develop over time and greatly influence their life trajectories. A focal point of the study is how au pairs...... that Filipina au pairs see their stay abroad as an avenue of personal development and social recognition, I examine how the au pairs re-position themselves within their families at home through migration, and how they navigate between the often conflicting expectations of participation in the sociality......Since 2000, thousands of young Filipino migrants have come to Denmark as au pairs. Officially, they are there to “broaden their cultural horizons” by living temporarily with a Danish host family, but they also conduct domestic labor in exchange for food and money, which allows them to send...

  2. Increased Life Span due to Calorie Restriction in Respiratory-Deficient Yeast.

    Directory of Open Access Journals (Sweden)

    2005-11-01

    Full Text Available A model for replicative life span extension by calorie restriction (CR in yeast has been proposed whereby reduced glucose in the growth medium leads to activation of the NAD-dependent histone deacetylase Sir2. One mechanism proposed for this putative activation of Sir2 is that CR enhances the rate of respiration, in turn leading to altered levels of NAD or NADH, and ultimately resulting in enhanced Sir2 activity. An alternative mechanism has been proposed in which CR decreases levels of the Sir2 inhibitor nicotinamide through increased expression of the gene coding for nicotinamidase, PNC1. We have previously reported that life span extension by CR is not dependent on Sir2 in the long-lived BY4742 strain background. Here we have determined the requirement for respiration and the effect of nicotinamide levels on life span extension by CR. We find that CR confers robust life span extension in respiratory-deficient cells independent of strain background, and moreover, suppresses the premature mortality associated with loss of mitochondrial DNA in the short-lived PSY316 strain. Addition of nicotinamide to the medium dramatically shortens the life span of wild type cells, due to inhibition of Sir2. However, even in cells lacking both Sir2 and the replication fork block protein Fob1, nicotinamide partially prevents life span extension by CR. These findings (1 demonstrate that respiration is not required for the longevity benefits of CR in yeast, (2 show that nicotinamide inhibits life span extension by CR through a Sir2-independent mechanism, and (3 suggest that CR acts through a conserved, Sir2-independent mechanism in both PSY316 and BY4742.

  3. Increased life span due to calorie restriction in respiratory-deficient yeast.

    Directory of Open Access Journals (Sweden)

    Matt Kaeberlein

    2005-11-01

    Full Text Available A model for replicative life span extension by calorie restriction (CR in yeast has been proposed whereby reduced glucose in the growth medium leads to activation of the NAD+-dependent histone deacetylase Sir2. One mechanism proposed for this putative activation of Sir2 is that CR enhances the rate of respiration, in turn leading to altered levels of NAD+ or NADH, and ultimately resulting in enhanced Sir2 activity. An alternative mechanism has been proposed in which CR decreases levels of the Sir2 inhibitor nicotinamide through increased expression of the gene coding for nicotinamidase, PNC1. We have previously reported that life span extension by CR is not dependent on Sir2 in the long-lived BY4742 strain background. Here we have determined the requirement for respiration and the effect of nicotinamide levels on life span extension by CR. We find that CR confers robust life span extension in respiratory-deficient cells independent of strain background, and moreover, suppresses the premature mortality associated with loss of mitochondrial DNA in the short-lived PSY316 strain. Addition of nicotinamide to the medium dramatically shortens the life span of wild type cells, due to inhibition of Sir2. However, even in cells lacking both Sir2 and the replication fork block protein Fob1, nicotinamide partially prevents life span extension by CR. These findings (1 demonstrate that respiration is not required for the longevity benefits of CR in yeast, (2 show that nicotinamide inhibits life span extension by CR through a Sir2-independent mechanism, and (3 suggest that CR acts through a conserved, Sir2-independent mechanism in both PSY316 and BY4742.

  4. Medium-scale melt-sodium fragmentation experiments

    International Nuclear Information System (INIS)

    Chu, T.Y.; Beattie, A.G.; Drotning, W.D.; Powers, D.A.

    1979-01-01

    The results of a series of fragmentation experiments involving up to 20 Kg of thermitically produced high temperature melts and 23 Kg of sodium are presented. Except for one experiment where some centimeter size particles are observed, the fragment distributions seem to be in the range of previous data. Spatial distribution of the fragments in the debris bed appears to be stratified. Scanning electron micrographs of fragments indicate fragmentation to be occurring in the molten state for the more intense interactions observed. Interaction data obtained show quiescent periods of 0.5 to 1.5 second between pressure pulses. The force impulse values per unit mass of melt seems to be in the same range as previous experiments

  5. EVENT GENERATION OF STANDARD MODEL HIGGS DECAY TO DIMUON PAIRS USING PYTHIA SOFTWARE

    CERN Document Server

    Yusof, Adib

    2015-01-01

    My project for CERN Summer Student Programme 2015 is on Event Generation of Standard Model Higgs Decay to Dimuon Pairs using Pythia Software. Briefly, Pythia or specifically, Pythia 8.1 is a program for the generation of high-energy Physics events that is able to describe the collisions at any given energies between elementary particles such as Electron, Positron, Proton as well as anti-Proton. It contains theory and models for a number of Physics aspects, including hard and soft interactions, parton distributions, initial-state and final-state parton showers, multiparton interactions, fragmentation and decay. All programming code is to be written in C++ language for this version (the previous version uses FORTRAN) and can be linked to ROOT software for displaying output in form of histogram. For my project, I need to generate events for standard model Higgs Boson into Muon and anti-Muon pairs (H→μ+ μ) to study the expected significance value for this particular process at centre-of-mass energy of 13 TeV...

  6. Dislocation processes in quasicrystals-Kink-pair formation control or jog-pair formation control

    International Nuclear Information System (INIS)

    Takeuchi, Shin

    2005-01-01

    A computer simulation of dislocation in a model quasiperiodic lattice indicates that the dislocation feels a large Peierls potential when oriented in particular directions. For a dislocation with a high Peierls potential, the glide velocity and the climb velocity of the dislocation can be described almost in parallel in terms of the kink-pair formation followed by kink motion and the jog-pair formation followed by jog motion, respectively. The activation enthalpy of the kink-pair formation is the sum of the kink-pair formation enthalpy and the atomic jump activation enthalpy, while the activation enthalpy of the jog-pair formation involves the jog-pair enthalpy and the self-diffusion enthalpy. Since the kink-pair energy can be considerably larger than the jog-pair energy, the climb velocity can be faster than the glide velocity, so that the plastic deformation of quasicrystals can be brought not by dislocation glide but by dislocation climb at high temperatures

  7. Boundary Spanning in Higher Education: How Universities Can Enable Success

    Science.gov (United States)

    Skolaski, Jennifer Pauline

    2012-01-01

    Purpose: The purpose of this research is to better understand the identity and work of academic and extension staff who have boundary spanning responsibilities. The results will help universities, especially public land-grant universities with an outreach mission, to create stronger policies and systems to support boundary spanning staff members…

  8. Probing the direct step of relativistic heavy ion fragmentation: (12C, 11B+p) at 2.1 GeV/nucleon with C and CH2 targets

    International Nuclear Information System (INIS)

    Webb, M.L.

    1987-06-01

    Relativistic heavy ion collisions may be classified as central (and near central), peripheral, and grazing with each collision type producing different proton and other charged projectile fragment scattering mechanisms and characteristics. This report focuses on peripheral and grazing collisions in the fragmentation of Carbon-12 into Boron-11 and a proton, testing models of the kinetics involved in this reaction. The data were measured at the Heavy Ion Superconducting Spectrometer (HISS) at Lawrence Berkeley Laboratory and include excitation energy for the p/Boron-11 pair, and rapidity versus transverse momentum for protons and Boron-11. 58 refs., 35 figs., 8 tabs

  9. Dual Fragment Impact of PBX Charges

    Science.gov (United States)

    Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

    2017-06-01

    Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

  10. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    International Nuclear Information System (INIS)

    Palau, Aina; Girart, Josep M.; Estalella, Robert; Fuente, Asunción; Fontani, Francesco; Sánchez-Monge, Álvaro; Commerçon, Benoit; Hennebelle, Patrick; Busquet, Gemma; Bontemps, Sylvain; Zapata, Luis A.; Zhang, Qizhou; Di Francesco, James

    2014-01-01

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  11. Fragmentation of massive dense cores down to ≲ 1000 AU: Relation between fragmentation and density structure

    Energy Technology Data Exchange (ETDEWEB)

    Palau, Aina; Girart, Josep M. [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB-Facultat de Ciències, Torre C5-parell 2, E-08193 Bellaterra, Catalunya (Spain); Estalella, Robert [Departament d' Astronomia i Meteorologia (IEEC-UB), Institut de Ciències del Cosmos, Universitat de Barcelona, Martí i Franquès, 1, E-08028 Barcelona (Spain); Fuente, Asunción [Observatorio Astronómico Nacional, P.O. Box 112, E-28803 Alcalá de Henares, Madrid (Spain); Fontani, Francesco; Sánchez-Monge, Álvaro [Osservatorio Astrofisico di Arcetri, INAF, Lago E. Fermi 5, I-50125 Firenze (Italy); Commerçon, Benoit; Hennebelle, Patrick [Laboratoire de Radioastronomie, UMR CNRS 8112, École Normale Supérieure et Observatoire de Paris, 24 rue Lhomond, F-75231 Paris Cedex 05 (France); Busquet, Gemma [INAF-Istituto di Astrofisica e Planetologia Spaziali, Area di Recerca di Tor Vergata, Via Fosso Cavaliere 100, I-00133 Roma (Italy); Bontemps, Sylvain [Université de Bordeaux, LAB, UMR 5804, F-33270 Floirac (France); Zapata, Luis A. [Centro de Radioastronomía y Astrofísica, Universidad Nacional Autónoma de México, P.O. Box 3-72, 58090 Morelia, Michoacán (Mexico); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Di Francesco, James, E-mail: palau@ieec.uab.es [Department of Physics and Astronomy, University of Victoria, P.O. Box 355, STN CSC, Victoria, BC, V8W 3P6 (Canada)

    2014-04-10

    In order to shed light on the main physical processes controlling fragmentation of massive dense cores, we present a uniform study of the density structure of 19 massive dense cores, selected to be at similar evolutionary stages, for which their relative fragmentation level was assessed in a previous work. We inferred the density structure of the 19 cores through a simultaneous fit of the radial intensity profiles at 450 and 850 μm (or 1.2 mm in two cases) and the spectral energy distribution, assuming spherical symmetry and that the density and temperature of the cores decrease with radius following power-laws. Even though the estimated fragmentation level is strictly speaking a lower limit, its relative value is significant and several trends could be explored with our data. We find a weak (inverse) trend of fragmentation level and density power-law index, with steeper density profiles tending to show lower fragmentation, and vice versa. In addition, we find a trend of fragmentation increasing with density within a given radius, which arises from a combination of flat density profile and high central density and is consistent with Jeans fragmentation. We considered the effects of rotational-to-gravitational energy ratio, non-thermal velocity dispersion, and turbulence mode on the density structure of the cores, and found that compressive turbulence seems to yield higher central densities. Finally, a possible explanation for the origin of cores with concentrated density profiles, which are the cores showing no fragmentation, could be related with a strong magnetic field, consistent with the outcome of radiation magnetohydrodynamic simulations.

  12. Gallstone fragmentation by control electrohydraulic lithotripsy

    International Nuclear Information System (INIS)

    Tung, G.A.; Mueller, P.R.; Brink, J.A.; Saini, S.; Picus, D.; Simeone, J.F.; Ferrucci, J.T.

    1989-01-01

    The authors have performed in vitro contact electrohydraulic lithotripsy (EHL) of 100 gallstones > 10 mm in diameter to identify physical and technical factors that affect fragmentation success. Ninety-one of 100 stones were fragmented with a 3-F electrode (average, seven shocks; range, 1--42); only 12 stones were fragmented with a single shock. Of the nine stones refractory to 50 shocks, four were > 30 mm in diameter and five stones were densely calcified. The most important variable determining power requirements for fragmentation was gallstone size (R = .58), but radiographic calcification of gallstones was also important (R = .47). Stones < 15 mm tended to produce fragments of left-angle 2 mm; stones right-angle 20 mm tended to produce two to five large discrete fragments (P , .05). In addition, lithotripsy could be conducted equally well in 1:1 dilute diatrizoate contrast agent as in 1:6 normal saline, suggesting that contact EHL could be performed under fluoroscopy

  13. A pluggable service platform architecture for e-commercspan>e

    NARCIS (Netherlands)

    Aulkemeier, Fabian; Paramartha, Mohammad Anggasta; Iacob, Maria Eugenia; van Hillegersberg, Jos

    2016-01-01

    In the beginning of the e-commercspan>e era, retailers mostly adopted vertically integrated solutions to control the entire e-commercspan>e value chain. However, they began to realize that to achieve agility, a better approach would be to focus on certain core capabilities and then create a partner ecosystem

  14. Implications of e-commercspan>e for banking and finance

    NARCIS (Netherlands)

    Heng, Michael S.H.

    2001-01-01

    The aim of the paper is to show that e-commercspan>e holds the potential totransform banking and financial systems. There are three aspects in which e-commercecan affect banking and finance. First, banks and financial firms can use thetechnology and business practice of e-commercspan>e to market their

  15. Fragmentation functions approach in pQCD fragmentation phenomena

    International Nuclear Information System (INIS)

    Rolli, S.

    1996-07-01

    Next-to-leading order parton fragmentation functions into light mesons are presented. They have been extracted from real and simulated e + e - data and used to predict inclusive single particle distributions at different machines

  16. Fragmentation of neck-like structures

    International Nuclear Information System (INIS)

    Montoya, C.; Bowman, D.R.; Peaslee, G.F.; Michigan State Univ., East Lansing, MI

    1994-01-01

    Evidence for intermediate mass fragment emission from neck-like structures joining projectile- and target-like residues has been observed for peripheral 129 Xe+ nat Cu collisions at E/A=50 MeV. These framents are emitted primarily at velocities intermediate between those of the projectile and the target. Relative to the charge distribution for fragments evaporated from the projectile-like residue, the distribution for ''neck'' emission shows an enhanced emission for fragments with 4 f < 8. (orig.)

  17. Topological anisotropy of stone-wales waves in graphenic fragments.

    Science.gov (United States)

    Ori, Ottorino; Cataldo, Franco; Putz, Mihai V

    2011-01-01

    Stone-Wales operators interchange four adjacent hexagons with two pentagon-heptagon 5|7 pairs that, graphically, may be iteratively propagated in the graphene layer, originating a new interesting structural defect called here Stone-Wales wave. By minimization, the Wiener index topological invariant evidences a marked anisotropy of the Stone-Wales defects that, topologically, are in fact preferably generated and propagated along the diagonal of the graphenic fragments, including carbon nanotubes and graphene nanoribbons. This peculiar edge-effect is shown in this paper having a predominant topological origin, leaving to future experimental investigations the task of verifying the occurrence in nature of wave-like defects similar to the ones proposed here. Graph-theoretical tools used in this paper for the generation and the propagation of the Stone-Wales defects waves are applicable to investigate isomeric modifications of chemical structures with various dimensionality like fullerenes, nanotubes, graphenic layers, schwarzites, zeolites.

  18. First Measurement of the Quark-to-Photon Fragmentation Function

    CERN Document Server

    Thompson, J

    1995-01-01

    Earlier measurements at LEP of isolated hard photons in hadronic $Z$ decays attributed to radiation from primary quark pairs, have been extended in the ALEPH experiment to include hard photon production {\\em inside} hadron jets. Events are selected where all particles combine democratically to form hadron jets, one of which contains a photon with a fractional energy $z\\geq 0.7$. After statistical subtraction of non-prompt photons, the quark- to-photon fragmentation function, $D(z)$, is extracted directly from the measured prompt production rate. By taking into account the perturbative contributions to $D(z)$ obtained from an $\\cal{O}(\\alpha \\alpha_S)$ QCD calculation, the unknown non-perturbative component of $D(z)$ is determined at high $z$. This measurement is compared with an earlier theoretical parametrisation widely used to determine the level of quark bremsstrahlung present in prompt photon production at the hadron colliders.

  19. Forest Fragments Surrounded by Sugar Cane Are More Inhospitable to Terrestrial Amphibian Abundance Than Fragments Surrounded by Pasture

    Directory of Open Access Journals (Sweden)

    Paula Eveline Ribeiro D’Anunciação

    2013-01-01

    Full Text Available In recent years, there has been increasing interest in matrix-type influence on forest fragments. Terrestrial amphibians are good bioindicators for this kind of research because of low vagility and high philopatry. This study compared richness, abundance, and species composition of terrestrial amphibians through pitfall traps in two sets of semideciduous seasonal forest fragments in southeastern Brazil, according to the predominant surrounding matrix (sugar cane and pasture. There were no differences in richness, but fragments surrounded by sugar cane had the lowest abundance of amphibians, whereas fragments surrounded by pastures had greater abundance. The most abundant species, Rhinella ornata, showed no biometric differences between fragment groups but like many other amphibians sampled showed very low numbers of individuals in fragments dominated by sugar cane fields. Our data indicate that the sugar cane matrix negatively influences the community of amphibians present in fragments surrounded by this type of land use.

  20. Fragmentation of Ceramics in Rapid Expansion Mode

    Science.gov (United States)

    Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

    The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

  1. The Role of Covert Retrieval in Working Memory Span Tasks: Evidence from Delayed Recall Tests

    Science.gov (United States)

    McCabe, David P.

    2008-01-01

    The current study examined delayed recall of items that had been processed during simple and complex span tasks. Three experiments were reported showing that despite more items being recalled initially from a simple span task (i.e., word span) than a complex span task (i.e., operation span), on a delayed recall test more items were recalled that…

  2. Percolation versus microcanonical fragmentation - comparison of fragment size distribution: Where is the liquid-gas transition in nuclei?

    International Nuclear Information System (INIS)

    Jaqaman, H.R.; Birzeit Univ.; Papp, G.; Eoetvoes Lorand Tudomanyegyetem, Budapest; Gross, D.H.E.; Freie Univ. Berlin

    1990-01-01

    The distributions of fragments produced by microcanonical multifragmentation of hot nuclei are compared with the cluster distributions predicted by a bond percolation model on a finite lattice. The conditional moments of these distributions are used together with the correlations between the largest three fragments in each event. Whereas percolation and statistical nuclear fragmentation agree in many details as in the usual plots of the averaged moments of the fragment distributions which yield the critical exponents, they turn out to be essentially different when less averaged quantities or correlations are considered. The differences between the predictions of the two models are mainly due to the particularities of the nuclear problem, especially the effect of the long-range Coulomb force which favours the break-up of the highly excited nucleus into two large fragments (pseudo-fission) and, to a somewhat lesser extent, enhances the possibility for the cracking of the nucleus into more than two large fragments. The fission events are, however, clearly separated from a second branch of critical correlations which shows up clearly in both nuclear fragmentation and percolation. We think that this critical correlation branch is due to the liquid-gas phase transition in finite nuclei. (orig.)

  3. PAIRS AND GROUPS OF GENETICALLY RELATED LONG-PERIOD COMETS AND PROPOSED IDENTITY OF THE MYSTERIOUS LICK OBJECT OF 1921

    Energy Technology Data Exchange (ETDEWEB)

    Sekanina, Zdenek [Jet Propulsion Laboratory, California Institute of Technology, 4800 Oak Grove Drive, Pasadena, CA 91109 (United States); Kracht, Rainer, E-mail: Zdenek.Sekanina@jpl.nasa.gov, E-mail: R.Kracht@t-online.de [Ostlandring 53, D-25335 Elmshorn, Schleswig-Holstein (Germany)

    2016-05-20

    We present the history of investigation of the dynamical properties of pairs and groups of genetically related long-period comets (other than the Kreutz sungrazing system). Members of a comet pair or group move in nearly identical orbits, and their origin as fragments of a common parent comet is unquestionable. The only variable is the time of perihelion passage, which differs considerably from member to member owing primarily to an orbital-momentum increment acquired during breakup. Meter-per-second separation velocities account for gaps of years or tens of years, thanks to the orbital periods of many millennia. The physical properties of individual members may not at all be alike, as illustrated by the trio of C/1988 A1, C/1996 Q1, and C/2015 F3. We exploit orbital similarity to examine whether the enigmatic and as-yet-unidentified object discovered from the Lick Observatory near the Sun at sunset on 1921 August 7 happened to be a member of such a pair and to track down the long-period comet to which it might be genetically related. Our search shows that the Lick object, which could not be a Kreutz sungrazer, was likely a companion to comet C/1847 C1 (Hind), whose perihelion distance was ∼9 R {sub ⊙} and true orbital period was approximately 8300 yr. The gap of 74.4 yr between their perihelion times is consistent with a separation velocity of ∼1 m s{sup −1} which sets the fragments apart following the parent's breakup in a general proximity of perihelion during the previous return to the Sun in the seventh millennium BCE.

  4. The formation of planets by disc fragmentation

    Directory of Open Access Journals (Sweden)

    Stamatellos Dimitris

    2013-04-01

    Full Text Available I discuss the role that disc fragmentation plays in the formation of gas giant and terrestrial planets, and how this relates to the formation of brown dwarfs and low-mass stars, and ultimately to the process of star formation. Protostellar discs may fragment, if they are massive enough and can cool fast enough, but most of the objects that form by fragmentation are brown dwarfs. It may be possible that planets also form, if the mass growth of a proto-fragment is stopped (e.g. if this fragment is ejected from the disc, or suppressed and even reversed (e.g by tidal stripping. I will discuss if it is possible to distinguish whether a planet has formed by disc fragmentation or core accretion, and mention of a few examples of observed exoplanets that are suggestive of formation by disc fragmentation.

  5. Extraction of 16th Century Calender Fragments

    DEFF Research Database (Denmark)

    Holck, Jakob Povl; Etheridge, Christian

    at the Cultural Heritage & Archaeometric Research Team, SDU. Upon finding medieval manuscript fragments in the university library’s special collections, scholars at the Centre for Medieval Literature are consulted. In most cases, digital pictures of the finds will circulate in the international community...... fragments may require extensive use of Big Data and other forms of analysis in order to be identified. Usually, the university library prefers not to remove the fragments from their “fragment carriers”. In order to read fragments that are only partially visible or invisible, x-ray technology may be deployed...... of medieval scholars. Thousands of 16th and 17th Century books are stored in the University Library of Southern Denmark. One out of five of these books is expected to contain medieval manuscript fragments or fragments of rare prints, e.g. incunabula....

  6. Paternal smoking habits affect the reproductive life span of daughters

    DEFF Research Database (Denmark)

    Fukuda, Misao; Fukuda, Kiyomi; Shimizu, Takashi

    2011-01-01

    The present study assessed whether the smoking habits of fathers around the time of conception affected the period in which daughters experienced menstrual cycles (i.e., the reproductive life span). The study revealed that the smoking habits of the farther shortened the daughters' reproductive life...... span compared with daughters whose fathers did not smoke....

  7. On the number of spanning trees in random regular graphs

    DEFF Research Database (Denmark)

    Greenhill, Catherine; Kwan, Matthew; Wind, David Kofoed

    2014-01-01

    Let d >= 3 be a fixed integer. We give an asympotic formula for the expected number of spanning trees in a uniformly random d-regular graph with n vertices. (The asymptotics are as n -> infinity, restricted to even n if d is odd.) We also obtain the asymptotic distribution of the number of spanning...

  8. Time-varying span efficiency through the wingbeat of desert locusts.

    Science.gov (United States)

    Henningsson, Per; Bomphrey, Richard J

    2012-06-07

    The flight performance of animals depends greatly on the efficacy with which they generate aerodynamic forces. Accordingly, maximum range, load-lifting capacity and peak accelerations during manoeuvres are all constrained by the efficiency of momentum transfer to the wake. Here, we use high-speed particle image velocimetry (1 kHz) to record flow velocities in the near wake of desert locusts (Schistocerca gregaria, Forskål). We use the measured flow fields to calculate time-varying span efficiency throughout the wing stroke cycle. The locusts are found to operate at a maximum span efficiency of 79 per cent, typically at a plateau of about 60 per cent for the majority of the downstroke, but at lower values during the upstroke. Moreover, the calculated span efficiencies are highest when the largest lift forces are being generated (90% of the total lift is generated during the plateau of span efficiency) suggesting that the combination of wing kinematics and morphology in locust flight perform most efficiently when doing the most work.

  9. Life Span Extension and Neuronal Cell Protection by Drosophila Nicotinamidase*S⃞

    Science.gov (United States)

    Balan, Vitaly; Miller, Gregory S.; Kaplun, Ludmila; Balan, Karina; Chong, Zhao-Zhong; Li, Faqi; Kaplun, Alexander; VanBerkum, Mark F. A.; Arking, Robert; Freeman, D. Carl; Maiese, Kenneth; Tzivion, Guri

    2008-01-01

    The life span of model organisms can be modulated by environmental conditions that influence cellular metabolism, oxidation, or DNA integrity. The yeast nicotinamidase gene pnc1 was identified as a key transcriptional target and mediator of calorie restriction and stress-induced life span extension. PNC1 is thought to exert its effect on yeast life span by modulating cellular nicotinamide and NAD levels, resulting in increased activity of Sir2 family class III histone deacetylases. In Caenorhabditis elegans, knockdown of a pnc1 homolog was shown recently to shorten the worm life span, whereas its overexpression increased survival under conditions of oxidative stress. The function and regulation of nicotinamidases in higher organisms has not been determined. Here, we report the identification and biochemical characterization of the Drosophila nicotinamidase, D-NAAM, and demonstrate that its overexpression significantly increases median and maximal fly life span. The life span extension was reversed in Sir2 mutant flies, suggesting Sir2 dependence. Testing for physiological effectors of D-NAAM in Drosophila S2 cells, we identified oxidative stress as a primary regulator, both at the transcription level and protein activity. In contrast to the yeast model, stress factors such as high osmolarity and heat shock, calorie restriction, or inhibitors of TOR and phosphatidylinositol 3-kinase pathways do not appear to regulate D-NAAM in S2 cells. Interestingly, the expression of D-NAAM in human neuronal cells conferred protection from oxidative stress-induced cell death in a sirtuin-dependent manner. Together, our findings establish a life span extending the ability of nicotinamidase in flies and offer a role for nicotinamide-modulating genes in oxidative stress regulated pathways influencing longevity and neuronal cell survival. PMID:18678867

  10. Evidence for deficits in the temporal attention span of poor readers.

    Directory of Open Access Journals (Sweden)

    Troy A W Visser

    Full Text Available While poor reading is often associated with phonological deficits, many studies suggest that visual processing might also be impaired. In particular, recent research has indicated that poor readers show impaired spatial visual attention spans in partial and whole report tasks. Given the similarities between competition-based accounts for reduced visual attention span and similar explanations for impairments in sequential object processing, the present work examined whether poor readers show deficits in their "temporal attention span"--that is, their ability to rapidly and accurately process sequences of consecutive target items.Poor and normal readers monitored a sequential stream of visual items for two (TT condition or three (TTT condition consecutive target digits. Target identification was examined using both unconditional and conditional measures of accuracy in order to gauge the overall likelihood of identifying a target and the likelihood of identifying a target given successful identification of previous items. Compared to normal readers, poor readers showed small but consistent deficits in identification across targets whether unconditional or conditional accuracy was used. Additionally, in the TTT condition, final-target conditional accuracy was poorer than unconditional accuracy, particularly for poor readers, suggesting a substantial cost arising from processing the previous two targets that was not present in normal readers.Mirroring the differences found between poor and normal readers in spatial visual attention span, the present findings suggest two principal differences between the temporal attention spans of poor and normal readers. First, the consistent pattern of reduced performance across targets suggests increased competition amongst items within the same span for poor readers. Second, the steeper decline in final target performance amongst poor readers in the TTT condition suggests a reduction in the extent of their

  11. Evidence for deficits in the temporal attention span of poor readers.

    Science.gov (United States)

    Visser, Troy A W

    2014-01-01

    While poor reading is often associated with phonological deficits, many studies suggest that visual processing might also be impaired. In particular, recent research has indicated that poor readers show impaired spatial visual attention spans in partial and whole report tasks. Given the similarities between competition-based accounts for reduced visual attention span and similar explanations for impairments in sequential object processing, the present work examined whether poor readers show deficits in their "temporal attention span"--that is, their ability to rapidly and accurately process sequences of consecutive target items. Poor and normal readers monitored a sequential stream of visual items for two (TT condition) or three (TTT condition) consecutive target digits. Target identification was examined using both unconditional and conditional measures of accuracy in order to gauge the overall likelihood of identifying a target and the likelihood of identifying a target given successful identification of previous items. Compared to normal readers, poor readers showed small but consistent deficits in identification across targets whether unconditional or conditional accuracy was used. Additionally, in the TTT condition, final-target conditional accuracy was poorer than unconditional accuracy, particularly for poor readers, suggesting a substantial cost arising from processing the previous two targets that was not present in normal readers. Mirroring the differences found between poor and normal readers in spatial visual attention span, the present findings suggest two principal differences between the temporal attention spans of poor and normal readers. First, the consistent pattern of reduced performance across targets suggests increased competition amongst items within the same span for poor readers. Second, the steeper decline in final target performance amongst poor readers in the TTT condition suggests a reduction in the extent of their temporal attention

  12. Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

    Science.gov (United States)

    Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

    2017-02-01

    A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis

    OpenAIRE

    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian

    2016-01-01

    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...

  14. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  15. The paired-domination and the upper paired-domination numbers of graphs

    Directory of Open Access Journals (Sweden)

    Włodzimierz Ulatowski

    2015-01-01

    Full Text Available In this paper we continue the study of paired-domination in graphs. A paired-dominating set, abbreviated PDS, of a graph \\(G\\ with no isolated vertex is a dominating set of vertices whose induced subgraph has a perfect matching. The paired-domination number of \\(G\\, denoted by \\(\\gamma_{p}(G\\, is the minimum cardinality of a PDS of \\(G\\. The upper paired-domination number of \\(G\\, denoted by \\(\\Gamma_{p}(G\\, is the maximum cardinality of a minimal PDS of \\(G\\. Let \\(G\\ be a connected graph of order \\(n\\geq 3\\. Haynes and Slater in [Paired-domination in graphs, Networks 32 (1998, 199-206], showed that \\(\\gamma_{p}(G\\leq n-1\\ and they determine the extremal graphs \\(G\\ achieving this bound. In this paper we obtain analogous results for \\(\\Gamma_{p}(G\\. Dorbec, Henning and McCoy in [Upper total domination versus upper paired-domination, Questiones Mathematicae 30 (2007, 1-12] determine \\(\\Gamma_{p}(P_n\\, instead in this paper we determine \\(\\Gamma_{p}(C_n\\. Moreover, we describe some families of graphs \\(G\\ for which the equality \\(\\gamma_{p}(G=\\Gamma_{p}(G\\ holds.

  16. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  17. The spectroscopy of fission fragments

    International Nuclear Information System (INIS)

    Phillips, W.R.

    1998-01-01

    High-resolution measurements on γ rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author)

  18. [Fragment-based drug discovery: concept and aim].

    Science.gov (United States)

    Tanaka, Daisuke

    2010-03-01

    Fragment-Based Drug Discovery (FBDD) has been recognized as a newly emerging lead discovery methodology that involves biophysical fragment screening and chemistry-driven fragment-to-lead stages. Although fragments, defined as structurally simple and small compounds (typically FBDD primarily turns our attention to weakly but specifically binding fragments (hit fragments) as the starting point of medicinal chemistry. Hit fragments are then promoted to more potent lead compounds through linking or merging with another hit fragment and/or attaching functional groups. Another positive aspect of FBDD is ligand efficiency. Ligand efficiency is a useful guide in screening hit selection and hit-to-lead phases to achieve lead-likeness. Owing to these features, a number of successful applications of FBDD to "undruggable targets" (where HTS and other lead identification methods failed to identify useful lead compounds) have been reported. As a result, FBDD is now expected to complement more conventional methodologies. This review, as an introduction of the following articles, will summarize the fundamental concepts of FBDD and will discuss its advantages over other conventional drug discovery approaches.

  19. Velocity distribution of fragments of catastrophic impacts

    Science.gov (United States)

    Takagi, Yasuhiko; Kato, Manabu; Mizutani, Hitoshi

    1992-01-01

    Three dimensional velocities of fragments produced by laboratory impact experiments were measured for basalts and pyrophyllites. The velocity distribution of fragments obtained shows that the velocity range of the major fragments is rather narrow, at most within a factor of 3 and that no clear dependence of velocity on the fragment mass is observed. The NonDimensional Impact Stress (NDIS) defined by Mizutani et al. (1990) is found to be an appropriate scaling parameter to describe the overall fragment velocity as well as the antipodal velocity.

  20. Isolation and characterization of reverse transcriptase fragments of LTR retrotransposons from the genome of Chenopodium quinoa (Amaranthaceae).

    Science.gov (United States)

    Kolano, Bozena; Bednara, Edyta; Weiss-Schneeweiss, Hanna

    2013-10-01

    High heterogeneity was observed among conserved domains of reverse transcriptase ( rt ) isolated from quinoa. Only one Ty1- copia rt was highly amplified. Reverse transcriptase sequences were located predominantly in pericentromeric region of quinoa chromosomes. The heterogeneity, genomic abundance, and chromosomal distribution of reverse transcriptase (rt)-coding fragments of Ty1-copia and Ty3-gypsy long terminal repeat retrotransposons were analyzed in the Chenopodium quinoa genome. Conserved domains of the rt gene were amplified and characterized using degenerate oligonucleotide primer pairs. Sequence analyses indicated that half of Ty1-copia rt (51 %) and 39 % of Ty3-gypsy rt fragments contained intact reading frames. High heterogeneity among rt sequences was observed for both Ty1-copia and Ty3-gypsy rt amplicons, with Ty1-copia more heterogeneous than Ty3-gypsy. Most of the isolated rt fragments were present in quinoa genome in low copy numbers, with only one highly amplified Ty1-copia rt sequence family. The gypsy-like RNase H fragments co-amplified with Ty1-copia-degenerate primers were shown to be highly amplified in the quinoa genome indicating either higher abundance of some gypsy families of which rt domains could not be amplified, or independent evolution of this gypsy-region in quinoa. Both Ty1-copia and Ty3-gypsy retrotransposons were preferentially located in pericentromeric heterochromatin of quinoa chromosomes. Phylogenetic analyses of newly amplified rt fragments together with well-characterized retrotransposon families from other organisms allowed identification of major lineages of retroelements in the genome of quinoa and provided preliminary insight into their evolutionary dynamics.

  1. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  2. Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

    Science.gov (United States)

    Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

    2018-04-01

    The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

  3. Spanning the Home/Work Creative Space

    DEFF Research Database (Denmark)

    Davis, Lee N.; Davis, Jerome; Hoisl, Karin

    the employee brings to work. Based on Woodman et al.’s (1993) “interactionist perspective” on organizational creativity, supplemented by literature on search and knowledge re/combination, we explore whether and how leisure time activities can span the creative space between the employee’s home and workplace...

  4. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma

    2017-11-01

    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  5. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Science.gov (United States)

    Sloma, Michael F; Mathews, David H

    2017-11-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  6. Current fragmentation in deep inelastic scattering

    International Nuclear Information System (INIS)

    Hamer, C.J.

    1975-04-01

    It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

  7. [Survey on menopausal age and menstruation span in women in Pudong district of Shanghai].

    Science.gov (United States)

    Chen, Hua; Feng, You-ji; Shu, Hui-min; Lu, Tian-mei; Zhu, Hong-mei; Yang, Bin-lie; Xiong, Miao

    2010-06-01

    To investigate natural spontaneous menopausal age, menstruation span and their relationship with menarche age and parity in Pudong district of Shanghai. From Jan 2007 to Jul 2008, 15 083 spontaneous menopause women undergoing cervical cancer screening were enrolled in this study. The questionnaire included menarche age, parity, spontaneous menopausal age and menstruation span. Those women were divided into four groups based on age, which were group of 56 - 60, 61 - 65, 66 - 70 and more than 70.Analysis of variance (ANOVA) was used for comparing difference between menopausal age and menstruation span. Multiple factor regressions was used to analyze the relationship between menarche age, parity and menopausal age and menstruation span. (1) Spontaneous menopausal age: the minimum was 29 years old, the maximum was 61 years old, and the mean age was (50.6 ± 3.7) years old. The mean spontaneous menopause age were (50.9 ± 3.4), (50.7 ± 3.7), (50.0 ± 4.1), (49.6 ± 4.0) years in groups of 56 - 60, 61 - 65, 66 - 70 and more than 70 years. With the increasing age range in four groups, the increasing trends of menopausal age were observed, which the difference of 1.36 year was shown between groups of 56 - 60 and more than 70 years. (2) Menstruation span: the mean of menstruation span was (34.3 ± 4.1) years, which the minimal age of 12 years and maximal age of 48 years were recorded. (34.6 ± 3.8), (34.3 ± 4.1), (33.9 ± 4.6), (33.2 ± 4.5) were observed in groups of 56 - 60, 61 - 65, 66 - 70 and more than 70 years. With the increasing age range in four groups, the increasing trends of menstruation span were observed, which the difference of 1.41 year was shown between groups of 56 - 60 and more than 70 years. (3) The impact of menarche age on menopausal age and menstruation span: there was no correlation between menarche age and menopausal age (r = 0.02); however, menstruation span was found to be negatively correlated with the menarche age (r = -0.43). (4) The impact

  8. Fragment emission from modestly excited nuclear systems

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

    1996-07-08

    Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

  9. The spectroscopy of fission fragments

    Energy Technology Data Exchange (ETDEWEB)

    Phillips, W.R. [Department of Physics and Astronomy, University of Manchester, Manchester, M13 9PL (United Kingdom); Collaboration: La Direction des Sciences de la Matiere du CEA (FR); Le Fonds National de la Recherche Scientifique de Belgique (BE)

    1998-12-31

    High-resolution measurements on {gamma} rays from fission fragments have provided a rich source of information, unobtainable at the moment in any other way, on the spectroscopy of neutron-rich nuclei. In recent years important data have been obtained on the yrast- and near yrast-structure of neutron-rich fission fragments. We discuss the scope of measurements which can be made on prompt gamma rays from secondary fission fragments, the techniques used in the experiments and some results recently obtained. (author) 24 refs., 8 figs., 1 tab.

  10. Endovascular Removal of Fractured Inferior Vena Cava Filter Fragments: 5-Year Registry Data with Prospective Outcomes on Retained Fragments.

    Science.gov (United States)

    Kesselman, Andrew J; Hoang, Nam Sao; Sheu, Alexander Y; Kuo, William T

    2018-06-01

    To evaluate the safety and efficacy of attempted percutaneous filter fragment removal during retrieval of fractured inferior vena cava (IVC) filters and to report outcomes associated with retained filter fragments. Over a 5-year period, 82 consecutive patients presenting with a fractured IVC filter were prospectively enrolled into an institutional review board-approved registry. There were 27 men and 55 women (mean, 47 y; range, 19-85 y). After main filter removal, percutaneous removal of fragments was attempted if they were deemed intravascular and accessible on preprocedural computed tomography (CT), cone-beam CT, and/or intravascular ultrasound; distal pulmonary artery (PA) fragments were left alone. A total of 185 fragments were identified (81 IVC, 33 PA, 16 cardiac, 2 hepatic vein, 1 renal vein, 1 aorta, 51 retroperitoneal). Mean filter dwell time was 2,183 days (range, 59-9,936 d). Eighty-seven of 185 fragments (47%) were deemed amenable to attempted removal: 65 IVC, 11 PA, 8 cardiac, 2 hepatic, and 1 aortic. Primary safety outcomes were major procedure-related complications. Fragment removal was successful in 78 of 87 cases (89.7%; 95% confidence interval [CI], 81.3-95.2). There were 6 minor complications with no consequence (6.9%; 95% CI, 2.6-14.4) involving intraprocedural fragment embolization and 1 major complication (1.1%; 95% CI, 0.0-6.2), a cardiac tamponade that was successfully treated. The complication rate from attempted cardiac fragment removal was 12.5% (1 of 8; 95% CI, 0.3-52.7). Among patients with retained cardiopulmonary fragments (n = 19), 81% remained asymptomatic during long-term clinical follow-up of 845 days (range, 386-2,071 d). Percutaneous removal of filter fragments from the IVC and proximal PAs is safe and effective overall, but attempted intracardiac fragment removal carries a higher risk of complication. Most residual filter fragments not amenable to percutaneous removal remain asymptomatic and may be monitored clinically

  11. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  12. Fragger: a protein fragment picker for structural queries.

    Science.gov (United States)

    Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

    2017-01-01

    Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

  13. Interorganizational Boundary Spanning in Global Software Development

    DEFF Research Database (Denmark)

    Søderberg, Anne-Marie; Romani, Laurence

    , and which skills and competencies they draw on in their efforts to deal with emerging cross-cultural issues in a way that paves ground for developing a shared understanding and common platform for the client and vendor representatives. A framework of boundary spanning leadership practices is adapted...... to virtuality and cultural diversity. This paper, which draws on a case study of collaborative work in a global software development project, focuses on key boundary spanners in an Indian vendor company, who are responsible for developing trustful and sustainable client relations and coordinating complex...... projects across multiple cultures, languages, organisational boundaries, time zones and geographical distances. It looks into how these vendor managers get prepared for their complex boundary spanning work, which cross-cultural challenges they experience in their collaboration with Western clients...

  14. Kaon fragmentation function from NJL-jet model

    International Nuclear Information System (INIS)

    Matevosyan, Hrayr H.; Thomas, Anthony W.; Bentz, Wolfgang

    2010-01-01

    The NJL-jet model provides a sound framework for calculating the fragmentation functions in an effective chiral quark theory, where the momentum and isospin sum rules are satisfied without the introduction of ad hoc parameters [1]. Earlier studies of the pion fragmentation functions using the Nambu-Jona-Lasinio (NJL) model within this framework showed good qualitative agreement with the empirical parameterizations. Here we extend the NJL-jet model by including the strange quark. The corrections to the pion fragmentation function and corresponding kaon fragmentation functions are calculated using the elementary quark to quark-meson fragmentation functions from NJL. The results for the kaon fragmentation function exhibit a qualitative agreement with the empirical parameterizations, while the unfavored strange quark fragmentation to pions is shown to be of the same order of magnitude as the unfavored light quark's. The results of these studies are expected to provide important guidance for the analysis of a large variety of semi-inclusive data.

  15. Estimation of Height from Arm Span in 6-11 Years Children in Odisha, India

    Directory of Open Access Journals (Sweden)

    Snigdha Prava Mishra

    2017-10-01

    Full Text Available Introduction: Standing height is an important anthropometric parameter to track longitudinal growth, to estimate body fatness and to calculate energy requirement. Measurement of height may be difficult in children who cannot stand. Aim: To establish regression equation for estimation of height from arm span in children. To check comparative relevancy of this equation with fixed height-to-arm span ratio (HAR for estimation of height. Materials and Methods: A cross-sectional study was conducted with 6-11 years school children (n=1465, Boys=774, Girls=691 in state of Odisha, India. Height was measured by portable stadiometer and arm span was measured by fiberglass measuring tape to nearest 0.1 cm. Pearson correlation and regression analysis was carried out between height and arm span data. p<0.05 (two tail was considered statistically significant. Results: Mean height and arm span in boys (124.16±8.74 cm and 125.57±10.43 cm respectively was significantly more (p<0.001 than height and arm span in girls (121.18±10.37 cm and 121.50±11.68 cm respectively. Mean HAR was 0.9942±0.0279. Correlation between height and arm span in boys was r = 0.94 (p<0.001 and in girls was r = 0.96 (p<0.001. Overall correlation coefficient was r = 0.95 (p<0.001. Regression equation for estimation of height from arm span was established: Height (cm = 0.8192 * arm span (cm + 21.46. Conclusion: Height in children of 6-11 years showed strong positive correlation with arm span. Regression equation established from this study can be used to estimate height from arm span. This estimation is more reliable than estimation of height from HAR.

  16. Fragmentation of rotating protostellar clouds

    International Nuclear Information System (INIS)

    Tohline, J.E.

    1980-01-01

    We examine, with a three-dimensional hydrodynamic computer code, the behavior of rotating, isothermal gas clouds as they collapse from Jeans unstable configurations, in order to determine whether they are susceptible to fragmentation during the initial dynamic collapse phase of their evolution. We find that a gas cloud will not fragment unless (a) it begins collapsing from a radius much smaller than the Jeans radius (i.e., the cloud initially encloses many Jeans masses) and (b) irregularities in the cloud's initial structure (specifically, density inhomogeneities) enclose more than one Jeans mass of material. Gas pressure smooths out features that are not initially Jeans unstable while rotation plays no direct role in damping inhomogeneities. Instead of fragmenting, most of our models collapse to a ring configuration (as has been observed by other investigators in two-dimensional, axisymmetric models). The rings appear to be less susceptible to gragmentation from arbitrary perturbations in their structure than has previously been indicated in other work. Because our models, which include the effects of gas pressure, do not readily fragment during a phase of dynamic collapse, we suggest that gas clouds in the galactic disk undergo fragmentation only during quasi-equilibrium phases of their evolution

  17. Fragment-based approaches to TB drugs.

    Science.gov (United States)

    Marchetti, Chiara; Chan, Daniel S H; Coyne, Anthony G; Abell, Chris

    2018-02-01

    Tuberculosis is an infectious disease associated with significant mortality and morbidity worldwide, particularly in developing countries. The rise of antibiotic resistance in Mycobacterium tuberculosis (Mtb) urgently demands the development of new drug leads to tackle resistant strains. Fragment-based methods have recently emerged at the forefront of pharmaceutical development as a means to generate more effective lead structures, via the identification of fragment molecules that form weak but high quality interactions with the target biomolecule and subsequent fragment optimization. This review highlights a number of novel inhibitors of Mtb targets that have been developed through fragment-based approaches in recent years.

  18. Pair- ${v}$ -SVR: A Novel and Efficient Pairing nu-Support Vector Regression Algorithm.

    Science.gov (United States)

    Hao, Pei-Yi

    This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory. Moreover, pair--SVR has additional advantage of using parameter for controlling the bounds on fractions of SVs and errors. Furthermore, the upper bound and lower bound functions of the regression model estimated by pair--SVR capture well the characteristics of data distributions, thus facilitating automatic estimation of the conditional mean and predictive variance simultaneously. This may be useful in many cases, especially when the noise is heteroscedastic and depends strongly on the input values. The experimental results validate the superiority of our pair--SVR in both training/prediction speed and generalization ability.This paper proposes a novel and efficient pairing nu-support vector regression (pair--SVR) algorithm that combines successfully the superior advantages of twin support vector regression (TSVR) and classical -SVR algorithms. In spirit of TSVR, the proposed pair--SVR solves two quadratic programming problems (QPPs) of smaller size rather than a single larger QPP, and thus has faster learning speed than classical -SVR. The significant advantage of our pair--SVR over TSVR is the improvement in the prediction speed and generalization ability by introducing the concepts of the insensitive zone and the regularization term that embodies the essence of statistical learning theory

  19. The Influence of Dietary Fat Source on Life Span in Calorie Restricted Mice.

    Science.gov (United States)

    López-Domínguez, José A; Ramsey, Jon J; Tran, Dianna; Imai, Denise M; Koehne, Amanda; Laing, Steven T; Griffey, Stephen M; Kim, Kyoungmi; Taylor, Sandra L; Hagopian, Kevork; Villalba, José M; López-Lluch, Guillermo; Navas, Plácido; McDonald, Roger B

    2015-10-01

    Calorie restriction (CR) without malnutrition extends life span in several animal models. It has been proposed that a decrease in the amount of polyunsaturated fatty acids (PUFAs), and especially n-3 fatty acids, in membrane phospholipids may contribute to life span extension with CR. Phospholipid PUFAs are sensitive to dietary fatty acid composition, and thus, the purpose of this study was to determine the influence of dietary lipids on life span in CR mice. C57BL/6J mice were assigned to four groups (a 5% CR control group and three 40% CR groups) and fed diets with soybean oil (high in n-6 PUFAs), fish oil (high in n-3 PUFAs), or lard (high in saturated and monounsaturated fatty acids) as the primary lipid source. Life span was increased (p Life span was also increased (p life span in mice on CR, and suggest that a diet containing a low proportion of PUFAs and high proportion of monounsaturated and saturated fats may maximize life span in animals maintained on CR. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. The Zero-Degree Detector system for fragmentation studies

    International Nuclear Information System (INIS)

    Adams, J.H.; Christl, M.J.; Howell, L.W.; Kuznetsov, E.

    2007-01-01

    The measurement of nuclear fragmentation cross-sections requires the detection and identification of individual projectile fragments. If light and heavy fragments are recorded in the same detector, it may be impossible to distinguish the signal from the light fragment. To overcome this problem, we have developed the Zero-degree Detector System (ZDDS). The ZDDS enables the measurement of cross-sections for light fragment production by using pixelated detectors to separately measure the signals of each fragment. The system has been used to measure the fragmentation of beams as heavy as Fe at the NASA Space Radiation Laboratory at Brookhaven National Laboratory and the Heavy Ion Medical Accelerator in Chiba, Japan

  1. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  2. Introduction to fragment-based drug discovery.

    Science.gov (United States)

    Erlanson, Daniel A

    2012-01-01

    Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.

  3. Report on Pairing-based Cryptography.

    Science.gov (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily

    2015-01-01

    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  4. Mechanisms Affecting Population Density in Fragmented Habitat

    Directory of Open Access Journals (Sweden)

    Lutz Tischendorf

    2005-06-01

    Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation

  5. The relationship between short-term memory and working memory: complex span made simple?

    Science.gov (United States)

    Bayliss, Donna M; Jarrold, Christopher; Baddeley, Alan D; Gunn, Deborah M

    2005-01-01

    This experiment addresses the question of what makes a working memory measure a good predictor of higher-level abilities. Verbal and visuospatial processing episodes were interleaved with distinct verbal and visuospatial storage episodes to form four complex span tasks. Although these measures were reliable predictors of reading and mathematics ability in children, they were no more predictive of these abilities than corresponding simple span tasks involving storage alone. However, when individual differences in storage ability and processing capacity were controlled for, residual variance in complex span performance was related to academic ability in some cases. These findings indicate that complex span tasks are multiply determined, and that differences in task structure can dramatically influence the relative importance of these multiple constraints and the predictive power of a complex span measure.

  6. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  7. 1-Skeletons of the Spanning Tree Problems with Additional Constraints

    Directory of Open Access Journals (Sweden)

    V. A. Bondarenko

    2015-01-01

    Full Text Available In this paper, we study polyhedral properties of two spanning tree problems with additional constraints. In the first problem, it is required to find a tree with a minimum sum of edge weights among all spanning trees with the number of leaves less than or equal to a given value. In the second problem, an additional constraint is the assumption that the degree of all nodes of the spanning tree does not exceed a given value. The recognition versions of both problems are NP-complete. We consider polytopes of these problems and their 1-skeletons. We prove that in both cases it is a NP-complete problem to determine whether the vertices of 1-skeleton are adjacent. Although it is possible to obtain a superpolynomial lower bounds on the clique numbers of these graphs. These values characterize the time complexity in a broad class of algorithms based on linear comparisons. The results indicate a fundamental difference between combinatorial and geometric properties of the considered problems from the classical minimum spanning tree problem.

  8. The visual attention span deficit in dyslexia is visual and not verbal.

    Science.gov (United States)

    Lobier, Muriel; Zoubrinetzky, Rachel; Valdois, Sylviane

    2012-06-01

    The visual attention (VA) span deficit hypothesis of dyslexia posits that letter string deficits are a consequence of impaired visual processing. Alternatively, some have interpreted this deficit as resulting from a visual-to-phonology code mapping impairment. This study aims to disambiguate between the two interpretations by investigating performance in a non-verbal character string visual categorization task with verbal and non-verbal stimuli. Results show that VA span ability predicts performance for the non-verbal visual processing task in normal reading children. Furthermore, VA span impaired dyslexic children are also impaired for the categorization task independently of stimuli type. This supports the hypothesis that the underlying impairment responsible for the VA span deficit is visual, not verbal. Copyright © 2011 Elsevier Srl. All rights reserved.

  9. Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator

    International Nuclear Information System (INIS)

    Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.

    1993-10-01

    Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)

  10. Ternary-fragmentation-driving potential energies of 252Cf

    Science.gov (United States)

    Karthikraj, C.; Ren, Zhongzhou

    2017-12-01

    Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.

  11. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  12. The effects of age on processing and storage in working memory span tasks and reading comprehension.

    Science.gov (United States)

    Schroeder, Paul J

    2014-01-01

    BACKGROUND/STUDY CONTEXT: Declines in verbal working memory span task performance have been associated with deficits in the language processing abilities of healthy older adults, but it is unclear how storage and processing contribute to this relationship. Moreover, recent studies of the psychometric properties of span measures in the general cognitive literature highlight the need for a critical reassessment of age-related differences in working memory task performance. Forty-two young (Mage = 19.45 years) and 42 older participants (Mage = 73.00 years) completed a series of neuropsychological screening measures, four memory span tasks (one-syllable word span, three-syllable word span, reading span, and sentence span), and a measure of reading comprehension. Each span measure was completed under self-paced and timed encoding conditions. A 2 (age) × 2 (task type) × 2 (encoding conditions) mixed-model design was used. (1) Age effects were reliable for both simple and complex span task performance; (2) limiting the available encoding time yielded lower recall scores across tasks and exacerbated age differences in simple span performance; and (3) both encoding condition and age affected the relationship between each of the span measures and the relationship between span and reading comprehension. Declines in both storage and processing abilities contributed to age differences in span task performance and the relationship between span and reading comprehension. Although older people appear to benefit from task administration protocols that promote successful memory encoding, researchers should be aware of the potential risks to validity posed by such accommodations.

  13. Relations between Preschool Attention Span-Persistence and Age 25 Educational Outcomes

    Science.gov (United States)

    McClelland, Megan M.; Acock, Alan C.; Piccinin, Andrea; Rhea, Sally Ann; Stallings, Michael C.

    2013-01-01

    This study examined relations between children's attention span-persistence in preschool and later school achievement and college completion. Children were drawn from the Colorado Adoption Project using adopted and non-adopted children (N = 430). Results of structural equation modeling indicated that children's age 4 attention span-persistence…

  14. Spanning k-ended trees of 3-regular connected graphs

    Directory of Open Access Journals (Sweden)

    Hamed Ghasemian Zoeram

    2017-10-01

    Full Text Available A vertex of degree one is called an end-vertex and the set of end-vertices of G is denoted by End(G. For a positive integer k, a tree T be called k-ended tree if $|End(T| \\leq k$. In this paper, we obtain sufficient conditions for spanning k-trees of 3-regular connected graphs. We give a construction sequence of graphs satisfying the condition. At the end, we present a conjecture about spanning k-ended trees of 3-regular connected graphs.

  15. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  16. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  17. Faster Fully-Dynamic minimum spanning forest

    DEFF Research Database (Denmark)

    Holm, Jacob; Rotenberg, Eva; Wulff-Nilsen, Christian

    2015-01-01

    We give a new data structure for the fully-dynamic minimum spanning forest problem in simple graphs. Edge updates are supported in O(log4 n/log logn) expected amortized time per operation, improving the O(log4 n) amortized bound of Holm et al. (STOC’98, JACM’01).We also provide a deterministic data...

  18. Hands as markers of fragmentation

    Directory of Open Access Journals (Sweden)

    A. Barnard

    2005-07-01

    Full Text Available Margaret Atwood is an internationally read, translated, and critiqued writer whose novels have established her as one of the most esteemed authors in English (McCombs & Palmer, 1991:1. Critical studies of her work deal mainly with notions of identity from psychoanalytical perspectives. This study has identified a gap in current critical studies on Atwood’s works, namely the challenging of textual unity which is paralleled in the challenging of the traditional (single narrative voice. The challenging of textual unity and the single narrative voice brings about the fragmentation of both. This article will focus on the role that hands play as markers of fragmentation in “The Blind Assassin” (2000. In the novel, the writing hand destabilises the narrative voice, since it is not connected to the voice of a single author. If the author of the text – the final signified – is eliminated, the text becomes fragmentary and open, inviting the reader to contribute to the creation of meaning. Hands play a signficant role in foregrounding the narrator’s fragmented identity, and consequently, the fragmentation of the text. We will investigate this concept in the light of Roland Barthes’ notion of the scriptor, whose hand is metaphorically severed from his or her “voice”. Instead of the text being a unified entity, it becomes unstable and it displays the absence of hierarchical textual levels. Based mainly on Barthes’ writings, this article concludes that hands foreground the narrator’s fragmented identity, which is paralleled in the fragmented text.

  19. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  20. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  1. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab...

  2. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  3. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  4. Gamma Radiation from Fission Fragments

    International Nuclear Information System (INIS)

    Higbie, Jack

    1969-10-01

    The gamma radiation from the fragments of the thermal neutron fission of 235 U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10 -10 sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass

  5. Gamma Radiation from Fission Fragments

    Energy Technology Data Exchange (ETDEWEB)

    Higbie, Jack

    1969-10-15

    The gamma radiation from the fragments of the thermal neutron fission of {sup 235}U has been investigated, and the preliminary data are presented here with suggestions for further lines of research and some possible interpretations of the data. The data have direct bearing on the fission process and the mode of fragment de-excitation. The parameters measured are the radiation decay curve for the time interval (1 - 7) x 10{sup -10} sec after fission, the photon yield, the total gamma ray energy yield, and the average photon energy. The last three quantities are measured as a function of the fragment mass.

  6. Structure-borne low-frequency noise from multi-span bridges: A prediction method and spatial distribution

    Science.gov (United States)

    Song, X. D.; Wu, D. J.; Li, Q.; Botteldooren, D.

    2016-04-01

    Structure-borne noise from railway bridges at far-field points is an important indicator in environmental noise assessment. However, studies that predict structure-borne noise tend to model only single-span bridges, thus ignoring the sound pressure radiating from adjacent spans. To simulate the noise radiating from multi-span bridges induced by moving vehicles, the vibrations of a multi-span bridge are first obtained from a three-dimensional (3D) vehicle-track-bridge dynamic interaction simulation using the mode superposition method. A procedure based on the 2.5-dimensional (2.5D) boundary element method (BEM) is then presented to promote the efficiency of acoustical computation compared with the 3D BEM. The simulated results obtained from both the single-span and multi-span bridge models are compared with the measured results. The sound predictions calculated from the single-span model are accurate only for a minority of near-field points. In contrast, the sound pressures calculated from the multi-span bridge model match the measured results in both the time and frequency domains for all of the near-field and far-field points. The number of bridge spans required in the noise simulation is then recommended related to the distance between the track center and the field points of interest. The spatial distribution of multi-span structure-borne noise is also studied. The variation in sound pressure levels is insignificant along the length of the bridge, which validates the finding that the sound test section can be selected at an arbitrary plane perpendicular to the multi-span bridge.

  7. Heavy neutron-deficient radioactive beams: fission studies and fragment distributions

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, K.H.; Benlliure, J.; Heinz, A.; Voss, B. [Gesellschaft fuer Schwerionenforschung mbH, Darmstadt (Germany); Boeckstiegel, C.; Grewe, A.; Steinhaeuser, S.; Clerc, H.G.; Jong, M. de; Junghans, A.R.; Mueller, J. [Technische Hochschule Darmstadt (Germany). Inst. fuer Kernphysik; Pfuetzner, M. [Warsaw Univ. (Poland). Inst. of Experimental Physics

    1998-02-01

    The secondary-beam facility of GSI Darmstadt was used to study the fission process of short-lived radioactive nuclei. Relativistic secondary projectiles were produced by fragmentation of a 1 A GeV {sup 238}U primary beam and identified in nuclear charge and mass number. Their production cross sections were determined, and the fission competition in the statistical deexcitation was deduced for long isotopical chains. New results on the enhancement of the nuclear level density in spherical and deformed nuclei due to collective rotational and vibrational excitations were obtained. Using these reaction products as secondary beams, the dipole giant resonance was excited by electromagnetic interactions in a secondary lead target, and fission from excitation energies around 11 MeV was induced. The fission fragments were identified in nuclear charge, and their velocity vectors were determined. Elemental yields and total kinetic energies have been determined for a number of neutron-deficient actinides and preactinides which were not accessible with conventional techniques. The characteristics of multimodal fission of nuclei around {sup 226}Th were systematically investigated and related to the influence of shell effects on the potential energy and on the level density between fission barrier and scission. A systematic view on the large number of elemental yields measured gave rise to a new interpretation of the enhanced production of even elements in nuclear fission and allowed for a new understanding of pair breaking in large-scale collective motion. (orig.)

  8. Cooper Pairs in Insulators?

    International Nuclear Information System (INIS)

    Valles, James

    2008-01-01

    Nearly 50 years elapsed between the discovery of superconductivity and the emergence of the microscopic theory describing this zero resistance state. The explanation required a novel phase of matter in which conduction electrons joined in weakly bound pairs and condensed with other pairs into a single quantum state. Surprisingly, this Cooper pair formation has also been invoked to account for recently uncovered high-resistance or insulating phases of matter. To address this possibility, we have used nanotechnology to create an insulating system that we can probe directly for Cooper pairs. I will present the evidence that Cooper pairs exist and dominate the electrical transport in these insulators and I will discuss how these findings provide new insight into superconductor to insulator quantum phase transitions.

  9. The effects of repeat testing, malingering, and traumatic brain injury on visuospatial memory span

    Directory of Open Access Journals (Sweden)

    David L Woods

    2016-01-01

    Full Text Available Spatial span tests such as the Corsi Block Test (CBT and the spatial span test of the Wechsler Memory Scale are widely used to assess deficits in spatial working memory. We conducted three experiments to evaluate the test-retest reliability and clinical sensitivity of a new computerized spatial span test (C-SST that incorporates psychophysical methods to improve the precision of spatial span measurement. In Experiment 1, we analyzed C-SST test-retest reliability in 49 participants who underwent three test sessions at weekly intervals. Intraclass correlation coefficients (ICC were higher for a psychophysically derived mean span (MnS metric (0.83 than for the maximal span and total correct metrics used in traditional spatial-span tests. Response times (ReTs also showed high ICCs (0.93 that correlated negatively with MnS scores and correlated positively with response-time latencies from other tests of processing speed. Learning effects were insignificant. Experiment 2 examined the performance of Experiment 1 participants when instructed to feign symptoms of traumatic brain injury: 57% showed abnormal MnS z-scores. A MnS z-score cutoff of 3.0 correctly classified 36% of simulated malingerers and 91% of the subgroup of 11 control participants with abnormal spans. Malingerers also made more substitution errors than control participants with abnormal spans (sensitivity = 43%, specificity = 91%. In addition, malingerers showed no evidence of ReT slowing, in contrast to significant abnormalities seen on other malingered tests of processing speed. As a result, differences between ReT z-scores and z-scores on other processing speed tests showed very high sensitivity and specificity in distinguishing malingering and control participants with either normal or abnormal spans. Experiment 3 examined C-SST performance in a group of patients with predominantly mild traumatic brain injury (TBI: neither MnS nor ReT z-scores showed significant group

  10. Anisotropy in highly charged ion induced molecule fragmentation

    International Nuclear Information System (INIS)

    Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

    2006-01-01

    Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

  11. Absolute fragmentation cross sections in atom-molecule collisions: Scaling laws for non-statistical fragmentation of polycyclic aromatic hydrocarbon molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chen, T.; Gatchell, M.; Stockett, M. H.; Alexander, J. D.; Schmidt, H. T.; Cederquist, H.; Zettergren, H., E-mail: henning@fysik.su.se [Department of Physics, Stockholm University, S-106 91 Stockholm (Sweden); Zhang, Y. [Department of Mathematics, Faculty of Physics, M. V. Lomonosov Moscow State University, Leninskie Gory, 119991 Moscow (Russian Federation); Rousseau, P.; Maclot, S.; Delaunay, R.; Adoui, L. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Université de Caen Basse-Normandie, Esplanade de la Paix, F-14032 Caen (France); Domaracka, A.; Huber, B. A. [CIMAP, UMR 6252, CEA/CNRS/ENSICAEN/Université de Caen Basse-Normandie, bd Henri Becquerel, BP 5133, F-14070 Caen Cedex 05 (France); Schlathölter, T. [Zernike Institute for Advanced Materials, University of Groningen, Nijenborgh 4, 9747AG Groningen (Netherlands)

    2014-06-14

    We present scaling laws for absolute cross sections for non-statistical fragmentation in collisions between Polycyclic Aromatic Hydrocarbons (PAH/PAH{sup +}) and hydrogen or helium atoms with kinetic energies ranging from 50 eV to 10 keV. Further, we calculate the total fragmentation cross sections (including statistical fragmentation) for 110 eV PAH/PAH{sup +} + He collisions, and show that they compare well with experimental results. We demonstrate that non-statistical fragmentation becomes dominant for large PAHs and that it yields highly reactive fragments forming strong covalent bonds with atoms (H and N) and molecules (C{sub 6}H{sub 5}). Thus nonstatistical fragmentation may be an effective initial step in the formation of, e.g., Polycyclic Aromatic Nitrogen Heterocycles (PANHs). This relates to recent discussions on the evolution of PAHNs in space and the reactivities of defect graphene structures.

  12. Spanning Tree Based Attribute Clustering

    DEFF Research Database (Denmark)

    Zeng, Yifeng; Jorge, Cordero Hernandez

    2009-01-01

    Attribute clustering has been previously employed to detect statistical dependence between subsets of variables. We propose a novel attribute clustering algorithm motivated by research of complex networks, called the Star Discovery algorithm. The algorithm partitions and indirectly discards...... inconsistent edges from a maximum spanning tree by starting appropriate initial modes, therefore generating stable clusters. It discovers sound clusters through simple graph operations and achieves significant computational savings. We compare the Star Discovery algorithm against earlier attribute clustering...

  13. Paternal smoking habits affect the reproductive life span of daughters.

    Science.gov (United States)

    Fukuda, Misao; Fukuda, Kiyomi; Shimizu, Takashi; Nobunaga, Miho; Andersen, Elisabeth Wreford; Byskov, Anne Grete; Andersen, Claus Yding

    2011-06-30

    The present study assessed whether the smoking habits of fathers around the time of conception affected the period in which daughters experienced menstrual cycles (i.e., the reproductive life span). The study revealed that the smoking habits of the farther shortened the daughters' reproductive life span compared with daughters whose fathers did not smoke. Copyright © 2011 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  14. Remarks about the hypothesis of limiting fragmentation

    International Nuclear Information System (INIS)

    Chou, T.T.; Yang, C.N.

    1987-01-01

    Remarks are made about the hypothesis of limiting fragmentation. In particular, the concept of favored and disfavored fragment distribution is introduced. Also, a sum rule is proved leading to a useful quantity called energy-fragmentation fraction. (author). 11 refs, 1 fig., 2 tabs

  15. Free span burial inspection pig. Phase B

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2002-04-01

    This report deals with design and construction of a pipeline pig for on-line internal inspection of offshore trenched gas pipelines for pipeline burial, free spans, exposures and loss of concrete weight coating. The measuring principle uses detection of the natural gamma radiation emitted by sea bed formations and the concrete coating of the pipe to map pipeline condition. The gamma ray flux penetrating to the internal side of the pipeline is an effect of the outside conditions. The measuring principle was confirmed in a occasionally present in the gas, blurred seriously sensor signals of the previous instrumentation. The continued project activities have been divided in two phases. Phase A comprised design and construction of a detector system, which could identify and quantify radioactive components from decay of radon-222. During Phase A a new gamma detector was tested in full scale exposed to radon-222. New data analysis procedures for the correction for the influence of radon-222 inside the pipeline, where developed and its utility successfully demonstrated. During Phase B the new detector was mounted in a pipeline pig constructed for inspection of 30-inch gas pipelines. Working conditions were demonstrated in three runs through the southern route of the DONG owned 30-inch gas pipelines crossing the Danish strait named the Great Belt. The FSB-technology found 88% of the free spans identified with the latest acoustic survey. The FSB-technology found in addition 22 free spans that were termed ''invisible'', because they were not identified by the most recent acoustic survey. It is believed that ''invisible free spans'' are either real free spans or locations, where the pipeline has no or very little support from deposits in the pipeline trench. The FSB-survey confirmed all exposed sections longer than 20 metres found by the acoustic survey in the first 21 kilometre of the pipeline. However, the FSB-survey underestimated

  16. Polarization and alignment of nucleus fission fragments

    International Nuclear Information System (INIS)

    Barabanov, A.L.; Grechukhin, D.P.

    1987-01-01

    Correlation of fragment orientation with orientation axis of fissile nucleus and with n-vector f vector of fragment divergence is considered. Estimations of polarization and alignment of fission fragments of preliminarily oriented nuclei in correlation (with n-vector f recording) and integral (with n-vector f averaging) experiments were conducted. It is shown that high sensitivity of polarization and fragment alignment to the character of nucleus movement at the stage of descent from barrier to rupture point exists

  17. Nuclear energy release from fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Li, Cheng [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Souza, S.R. [Instituto de Física, Universidade Federal do Rio de Janeiro Cidade Universitária, Caixa Postal 68528, 21945-970 Rio de Janeiro (Brazil); Tsang, M.B. [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); National Superconducting Cyclotron Laboratory and Physics and Astronomy Department, Michigan State University, East Lansing, MI 48824 (United States); Zhang, Feng-Shou, E-mail: fszhang@bnu.edu.cn [The Key Laboratory of Beam Technology and Material Modification of Ministry of Education, College of Nuclear Science and Technology, Beijing Normal University, Beijing 100875 (China); Beijing Radiation Center, Beijing 100875 (China); Center of Theoretical Nuclear Physics, National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou 730000 (China)

    2016-08-15

    It is well known that binary fission occurs with positive energy gain. In this article we examine the energetics of splitting uranium and thorium isotopes into various numbers of fragments (from two to eight) with nearly equal size. We find that the energy released by splitting {sup 230,232}Th and {sup 235,238}U into three equal size fragments is largest. The statistical multifragmentation model (SMM) is applied to calculate the probability of different breakup channels for excited nuclei. By weighing the probability distributions of fragment multiplicity at different excitation energies, we find the peaks of energy release for {sup 230,232}Th and {sup 235,238}U are around 0.7–0.75 MeV/u at excitation energy between 1.2 and 2 MeV/u in the primary breakup process. Taking into account the secondary de-excitation processes of primary fragments with the GEMINI code, these energy peaks fall to about 0.45 MeV/u.

  18. Enhancing reading performance through action video games: the role of visual attention span.

    Science.gov (United States)

    Antzaka, A; Lallier, M; Meyer, S; Diard, J; Carreiras, M; Valdois, S

    2017-11-06

    Recent studies reported that Action Video Game-AVG training improves not only certain attentional components, but also reading fluency in children with dyslexia. We aimed to investigate the shared attentional components of AVG playing and reading, by studying whether the Visual Attention (VA) span, a component of visual attention that has previously been linked to both reading development and dyslexia, is improved in frequent players of AVGs. Thirty-six French fluent adult readers, matched on chronological age and text reading proficiency, composed two groups: frequent AVG players and non-players. Participants performed behavioural tasks measuring the VA span, and a challenging reading task (reading of briefly presented pseudo-words). AVG players performed better on both tasks and performance on these tasks was correlated. These results further support the transfer of the attentional benefits of playing AVGs to reading, and indicate that the VA span could be a core component mediating this transfer. The correlation between VA span and pseudo-word reading also supports the involvement of VA span even in adult reading. Future studies could combine VA span training with defining features of AVGs, in order to build a new generation of remediation software.

  19. Dihadron fragmentation function and its evolution

    International Nuclear Information System (INIS)

    Majumder, A.; Wang Xinnian

    2004-01-01

    Dihadron fragmentation functions and their evolution are studied in the process of e + e - annihilation. Under the collinear factorization approximation and facilitated by the cut-vertex technique, the two hadron inclusive cross section at leading order is shown to factorize into a short distance parton cross section and a long distance dihadron fragmentation function. We provide the definition of such a dihadron fragmentation function in terms of parton matrix elements and derive its Dokshitzer-Gribov-Lipatov-Altarelli-Parisi evolution equation at leading log. The evolution equation for the nonsinglet quark fragmentation function is solved numerically with a simple ansatz for the initial condition and results are presented for cases of physical interest

  20. SCEDS: protein fragments for molecular replacement in Phaser

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Airlie J., E-mail: ajm201@cam.ac.uk [University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom); Nicholls, Robert A. [MRC Laboratory of Molecular Biology, Francis Crick Avenue, Cambridge Biomedical Campus, Cambridge CB2 0QH (United Kingdom); Schneider, Thomas R. [Hamburg Unit c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); University of Cambridge, Hills Road, Cambridge CB2 0XY (United Kingdom)

    2013-11-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C{sup α} atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser.

  1. SCEDS: protein fragments for molecular replacement in Phaser

    International Nuclear Information System (INIS)

    McCoy, Airlie J.; Nicholls, Robert A.; Schneider, Thomas R.

    2013-01-01

    Protein fragments suitable for use in molecular replacement can be generated by normal-mode perturbation, analysis of the difference distance matrix of the original versus normal-mode perturbed structures, and SCEDS, a score that measures the sphericity, continuity, equality and density of the resulting fragments. A method is described for generating protein fragments suitable for use as molecular-replacement (MR) template models. The template model for a protein suspected to undergo a conformational change is perturbed along combinations of low-frequency normal modes of the elastic network model. The unperturbed structure is then compared with each perturbed structure in turn and the structurally invariant regions are identified by analysing the difference distance matrix. These fragments are scored with SCEDS, which is a combined measure of the sphericity of the fragments, the continuity of the fragments with respect to the polypeptide chain, the equality in number of atoms in the fragments and the density of C α atoms in the triaxial ellipsoid of the fragment extents. The fragment divisions with the highest SCEDS are then used as separate template models for MR. Test cases show that where the protein contains fragments that undergo a change in juxtaposition between template model and target, SCEDS can identify fragments that lead to a lower R factor after ten cycles of all-atom refinement with REFMAC5 than the original template structure. The method has been implemented in the software Phaser

  2. Digit Span as a measure of everyday attention: a study of ecological validity.

    Science.gov (United States)

    Groth-Marnat, Gary; Baker, Sonya

    2003-12-01

    This study investigated the effectiveness of the WAIS-III Digit Span subtest to predict the everyday attention of 75 participants with heterogeneous neurological conditions who were administered the Digit Span subtest as well as the ecologically valid Test of Everyday Attention. In addition, the more visually oriented Picture Completion subtest along with the verbally loaded National Adult Reading Test were administered. Analysis indicated that, although Digit Span was a weak but statistically significant predictor of attentional ability (accounting for 12.7% of the unique variance). Picture Completion was a somewhat stronger predictor (accounting for 19% of the unique variance). The weak association of Digit Span and the Test of Everyday Attention, along with the finding that Picture Completion was a better predictor of performance on the Test of Everyday Attention, question the clinical utility of using Digit Span as a measure of everyday attention.

  3. Physical mapping of a 330 X 10(3)-base-pair region of the Myxococcus xanthus chromosome that is preferentially labeled during spore germination

    International Nuclear Information System (INIS)

    Komano, T.; Inouye, S.; Inouye, M.

    1985-01-01

    Myxococcus xanthus was pulse-labeled with [ 3 H]thymidine immediately after germination of dimethyl sulfoxide-induced spores. The restriction enzyme digests of the total chromosomal DNA from the pulse- labeled cells were analyzed by one-dimensional as well as two- dimensional agarose gel electrophoresis. Four PstI fragments preferentially labeled at a very early stage of germination were cloned into the unique PstI site of pBR322. By using these clones as probes, a restriction enzyme map was established covering approximately 6% of the total M. xanthus genome (330 X 10(3) base pairs). The distribution of the specific activities of the restriction fragments pulse-labeled after germination suggests a bidirectional mode of DNA replication from a fixed origin

  4. Charge Aspects of Composite Pair Superconductivity

    Science.gov (United States)

    Flint, Rebecca

    2014-03-01

    Conventional Cooper pairs form from well-defined electronic quasiparticles, making the internal structure of the pair irrelevant. However, in the 115 family of superconductors, the heavy electrons are forming as they pair and the internal pair structure becomes as important as the pairing mechanism. Conventional spin fluctuation mediated pairing cannot capture the direct transition from incoherent local moments to heavy fermion superconductivity, but the formation of composite pairs favored by the two channel Kondo effect can. These composite pairs are local d-wave pairs formed by two conduction electrons in orthogonal Kondo channels screening the same local moment. Composite pairing shares the same symmetries as magnetically mediated pairing, however, only composite pairing necessarily involves a redistribution of charge within the unit cell originating from the internal pair structure, both as a monopole (valence change) and a quadrupole effect. This redistribution will onset sharply at the superconducting transition temperature. A smoking gun test for composite pairing is therefore a sharp signature at Tc - for example, a cusp in the Mossbauer isomer shift in NpPd5Al2 or in the NQR shift in (Ce,Pu)CoIn5.

  5. Fatigue life assessment of free spanning pipelines containing corrosion defects

    Energy Technology Data Exchange (ETDEWEB)

    Lopes, Rita de Kassia D.; Campello, Georga C.; Matt, Cyntia G. da Costa; Benjamin, Adilson C.; Franciss, Ricardo [PETROBRAS S.A., Rio de Janeiro, RJ (Brazil). Centro de Pesquisas (CENPES)

    2009-12-19

    The free spanning pipelines assessment is a highlighted issue to be considered during the project and maintenance of the submarine pipelines. It is required to evaluate the fatigue life and the maximum stress due to VIV (Vortex Induced Vibration) as well as wave forces when applicable in case of shallow water. The code DNV-RP-F105 (2006) presents a methodology to calculate the fatigue life for free spanning pipelines. Such methodology however considers the pipe with no kind of defects. Nevertheless, sometimes corrosion defects are detected in periodic inspections and therefore their effects need to be taken into account in the fatigue life evaluation. The purpose of this paper thus is to present a procedure to assess the influence of the corrosion defects in the fatigue life of free spanning pipelines. Some FE analyses were performed to determine the stress concentrate factor (SCF) of the corrosion defects, which were used as input in the methodology presented in the code DNV-RP-F105 (2006). Curves of damage and so lifetime have been generated as function of the span length and water depth. As a practical application, this methodology was applied to a sub sea pipeline with several corrosion defects, localized in shallow water offshore Brazil. (author)

  6. Quantitative experimental modelling of fragmentation during explosive volcanism

    Science.gov (United States)

    Thordén Haug, Ø.; Galland, O.; Gisler, G.

    2012-04-01

    Phreatomagmatic eruptions results from the violent interaction between magma and an external source of water, such as ground water or a lake. This interaction causes fragmentation of the magma and/or the host rock, resulting in coarse-grained (lapilli) to very fine-grained (ash) material. The products of phreatomagmatic explosions are classically described by their fragment size distribution, which commonly follows power laws of exponent D. Such descriptive approach, however, considers the final products only and do not provide information on the dynamics of fragmentation. The aim of this contribution is thus to address the following fundamental questions. What are the physics that govern fragmentation processes? How fragmentation occurs through time? What are the mechanisms that produce power law fragment size distributions? And what are the scaling laws that control the exponent D? To address these questions, we performed a quantitative experimental study. The setup consists of a Hele-Shaw cell filled with a layer of cohesive silica flour, at the base of which a pulse of pressurized air is injected, leading to fragmentation of the layer of flour. The fragmentation process is monitored through time using a high-speed camera. By varying systematically the air pressure (P) and the thickness of the flour layer (h) we observed two morphologies of fragmentation: "lift off" where the silica flour above the injection inlet is ejected upwards, and "channeling" where the air pierces through the layer along sub-vertical conduit. By building a phase diagram, we show that the morphology is controlled by P/dgh, where d is the density of the flour and g is the gravitational acceleration. To quantify the fragmentation process, we developed a Matlab image analysis program, which calculates the number and sizes of the fragments, and so the fragment size distribution, during the experiments. The fragment size distributions are in general described by power law distributions of

  7. Skilled deaf readers have an enhanced perceptual span in reading.

    Science.gov (United States)

    Bélanger, Nathalie N; Slattery, Timothy J; Mayberry, Rachel I; Rayner, Keith

    2012-07-01

    Recent evidence suggests that, compared with hearing people, deaf people have enhanced visual attention to simple stimuli viewed in the parafovea and periphery. Although a large part of reading involves processing the fixated words in foveal vision, readers also utilize information in parafoveal vision to preprocess upcoming words and decide where to look next. In the study reported here, we investigated whether auditory deprivation affects low-level visual processing during reading by comparing the perceptual span of deaf signers who were skilled and less-skilled readers with the perceptual span of skilled hearing readers. Compared with hearing readers, the two groups of deaf readers had a larger perceptual span than would be expected given their reading ability. These results provide the first evidence that deaf readers' enhanced attentional allocation to the parafovea is used during complex cognitive tasks, such as reading.

  8. Minimum spanning trees and random resistor networks in d dimensions.

    Science.gov (United States)

    Read, N

    2005-09-01

    We consider minimum-cost spanning trees, both in lattice and Euclidean models, in d dimensions. For the cost of the optimum tree in a box of size L , we show that there is a correction of order L(theta) , where theta or =1 . The arguments all rely on the close relation of Kruskal's greedy algorithm for the minimum spanning tree, percolation, and (for some arguments) random resistor networks. The scaling of the entropy and free energy at small nonzero T , and hence of the number of near-optimal solutions, is also discussed. We suggest that the Steiner tree problem is in the same universality class as the minimum spanning tree in all dimensions, as is the traveling salesman problem in two dimensions. Hence all will have the same value of theta=-3/4 in two dimensions.

  9. Sex differences in life span: Females homozygous for the X chromosome do not suffer the shorter life span predicted by the unguarded X hypothesis.

    Science.gov (United States)

    Brengdahl, Martin; Kimber, Christopher M; Maguire-Baxter, Jack; Friberg, Urban

    2018-03-01

    Life span differs between the sexes in many species. Three hypotheses to explain this interesting pattern have been proposed, involving different drivers: sexual selection, asymmetrical inheritance of cytoplasmic genomes, and hemizygosity of the X(Z) chromosome (the unguarded X hypothesis). Of these, the unguarded X has received the least experimental attention. This hypothesis suggests that the heterogametic sex suffers a shortened life span because recessive deleterious alleles on its single X(Z) chromosome are expressed unconditionally. In Drosophila melanogaster, the X chromosome is unusually large (∼20% of the genome), providing a powerful model for evaluating theories involving the X. Here, we test the unguarded X hypothesis by forcing D. melanogaster females from a laboratory population to express recessive X-linked alleles to the same degree as males, using females exclusively made homozygous for the X chromosome. We find no evidence for reduced life span or egg-to-adult viability due to X homozygozity. In contrast, males and females homozygous for an autosome both suffer similar, significant reductions in those traits. The logic of the unguarded X hypothesis is indisputable, but our results suggest that the degree to which recessive deleterious X-linked alleles depress performance in the heterogametic sex appears too small to explain general sex differences in life span. © 2018 The Author(s). Evolution © 2018 The Society for the Study of Evolution.

  10. Impact failure and fragmentation properties of metals

    Energy Technology Data Exchange (ETDEWEB)

    Grady, D.E. [Applied Research Associates, Albuquerque, NM (United States); Kipp, M.E. [Sandia National Labs., Albuquerque, NM (United States)

    1998-03-01

    In the present study we describe the development of an experimental fracture material property test method specific to dynamic fragmentation. Spherical test samples of the metals of interest are subjected to controlled impulsive stress loads by acceleration to high velocities with a light-gas launcher facility and subsequent normal impact on thin plates. Motion, deformation and fragmentation of the test samples are diagnosed with multiple flash radiography methods. The impact plate materials are selected to be transparent to the x-ray method so that only test metal material is imaged. Through a systematic series of such tests both strain-to-failure and fragmentation resistance properties are determined through this experimental method. Fragmentation property data for several steels, copper, aluminum, tantalum and titanium have been obtained to date. Aspects of the dynamic data have been analyzed with computational methods to achieve a better understanding of the processes leading to failure and fragmentation, and to test an existing computational fragmentation model.

  11. Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass

    Directory of Open Access Journals (Sweden)

    Jonathan M. LaMantia

    2018-04-01

    Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.

  12. Predicting "Hot" and "Warm" Spots for Fragment Binding.

    Science.gov (United States)

    Rathi, Prakash Chandra; Ludlow, R Frederick; Hall, Richard J; Murray, Christopher W; Mortenson, Paul N; Verdonk, Marcel L

    2017-05-11

    Computational fragment mapping methods aim to predict hotspots on protein surfaces where small fragments will bind. Such methods are popular for druggability assessment as well as structure-based design. However, to date researchers developing or using such tools have had no clear way of assessing the performance of these methods. Here, we introduce the first diverse, high quality validation set for computational fragment mapping. The set contains 52 diverse examples of fragment binding "hot" and "warm" spots from the Protein Data Bank (PDB). Additionally, we describe PLImap, a novel protocol for fragment mapping based on the Protein-Ligand Informatics force field (PLIff). We evaluate PLImap against the new fragment mapping test set, and compare its performance to that of simple shape-based algorithms and fragment docking using GOLD. PLImap is made publicly available from https://bitbucket.org/AstexUK/pli .

  13. Scaling and critical behaviour in nuclear fragmentation

    International Nuclear Information System (INIS)

    Campi, X.

    1990-09-01

    These notes review recent results on nuclear fragmentation. An analysis of experimental data from exclusive experiments is made in the framework of modern theories of fragmentation of finite size objects. We discuss the existence of a critical regime of fragmentation and the relevance of scaling and finite size scaling

  14. Flutter suppression and stability analysis for a variable-span wing via morphing technology

    Science.gov (United States)

    Li, Wencheng; Jin, Dongping

    2018-01-01

    A morphing wing can enhance aerodynamic characteristics and control authority as an alternative to using ailerons. To use morphing technology for flutter suppression, the dynamical behavior and stability of a variable-span wing subjected to the supersonic aerodynamic loads are investigated numerically in this paper. An axially moving cantilever plate is employed to model the variable-span wing, in which the governing equations of motion are established via the Kane method and piston theory. A morphing strategy based on axially moving rates is proposed to suppress the flutter that occurs beyond the critical span length, and the flutter stability is verified by Floquet theory. Furthermore, the transient stability during the morphing motion is analyzed and the upper bound of the morphing rate is obtained. The simulation results indicate that the proposed morphing law, which is varying periodically with a proper amplitude, could accomplish the flutter suppression. Further, the upper bound of the morphing speed decreases rapidly once the span length is close to its critical span length.

  15. The politics of municipal fragmentation in Ghana

    Directory of Open Access Journals (Sweden)

    Abdulai Kuyini Mohammed

    2015-06-01

    Full Text Available The scholarly debate over the rival merits of local government consolidation and fragmentation is an old but enduring one. However, in this debate very little attention has been focused on the political dimension of council amalgamation and fragmentation – yet political considerations play a central role in both the formulation and outcomes of de-concentration policy. The purpose of this article is to fill a gap in the literature by examining local government fragmentation in Ghana from 1988 to 2014. The article does this by identifying the key players and analysing their interests and gains, as well as the tensions arising from the fragmentation exercise. The implications from the Ghanaian case for more general theories of fragmentation are drawn out.

  16. Modelling ecosystem service flows under uncertainty with stochiastic SPAN

    Science.gov (United States)

    Johnson, Gary W.; Snapp, Robert R.; Villa, Ferdinando; Bagstad, Kenneth J.

    2012-01-01

    Ecosystem service models are increasingly in demand for decision making. However, the data required to run these models are often patchy, missing, outdated, or untrustworthy. Further, communication of data and model uncertainty to decision makers is often either absent or unintuitive. In this work, we introduce a systematic approach to addressing both the data gap and the difficulty in communicating uncertainty through a stochastic adaptation of the Service Path Attribution Networks (SPAN) framework. The SPAN formalism assesses ecosystem services through a set of up to 16 maps, which characterize the services in a study area in terms of flow pathways between ecosystems and human beneficiaries. Although the SPAN algorithms were originally defined deterministically, we present them here in a stochastic framework which combines probabilistic input data with a stochastic transport model in order to generate probabilistic spatial outputs. This enables a novel feature among ecosystem service models: the ability to spatially visualize uncertainty in the model results. The stochastic SPAN model can analyze areas where data limitations are prohibitive for deterministic models. Greater uncertainty in the model inputs (including missing data) should lead to greater uncertainty expressed in the model’s output distributions. By using Bayesian belief networks to fill data gaps and expert-provided trust assignments to augment untrustworthy or outdated information, we can account for uncertainty in input data, producing a model that is still able to run and provide information where strictly deterministic models could not. Taken together, these attributes enable more robust and intuitive modelling of ecosystem services under uncertainty.

  17. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties

    Science.gov (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie

    2013-01-01

    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  18. Heart Rate Fragmentation: A Symbolic Dynamical Approach

    Directory of Open Access Journals (Sweden)

    Madalena D. Costa

    2017-11-01

    Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to

  19. Baculovirus display of functional antibody Fab fragments.

    Science.gov (United States)

    Takada, Shinya; Ogawa, Takafumi; Matsui, Kazusa; Suzuki, Tasuku; Katsuda, Tomohisa; Yamaji, Hideki

    2015-08-01

    The generation of a recombinant baculovirus that displays antibody Fab fragments on the surface was investigated. A recombinant baculovirus was engineered so that the heavy chain (Hc; Fd fragment) of a mouse Fab fragment was expressed as a fusion to the N-terminus of baculovirus gp64, while the light chain of the Fab fragment was simultaneously expressed as a secretory protein. Following infection of Sf9 insect cells with the recombinant baculovirus, the culture supernatant was analyzed by enzyme-linked immunosorbent assay using antigen-coated microplates and either an anti-mouse IgG or an anti-gp64 antibody. A relatively strong signal was obtained in each case, showing antigen-binding activity in the culture supernatant. In western blot analysis of the culture supernatant using the anti-gp64 antibody, specific protein bands were detected at an electrophoretic mobility that coincided with the molecular weight of the Hc-gp64 fusion protein as well as that of gp64. Flow cytometry using a fluorescein isothiocyanate-conjugated antibody specific to mouse IgG successfully detected the Fab fragments on the surface of the Sf9 cells. These results suggest that immunologically functional antibody Fab fragments can be displayed on the surface of baculovirus particles, and that a fluorescence-activated cell sorter with a fluorescence-labeled antigen can isolate baculoviruses displaying specific Fab fragments. This successful baculovirus display of antibody Fab fragments may offer a novel approach for the efficient selection of specific antibodies.

  20. Molten aluminum alloy fuel fragmentation experiments

    International Nuclear Information System (INIS)

    Gabor, J.D.; Purviance, R.T.; Cassulo, J.C.; Spencer, B.W.

    1992-01-01

    Experiments were conducted in which molten aluminum alloys were injected into a 1.2 m deep pool of water. The parameters varied were (i) injectant material (8001 aluminum alloy and 12.3 wt% U-87.7 wt% Al), (ii) melt superheat (O to 50 K), (iii) water temperature (313, 343 and 373 K) and (iv) size and geometry of the pour stream (5, 10 and 20 mm diameter circular and 57 mm annular). The pour stream fragmentation was dominated by surface tension with large particles (∼30 mm) being formed from varicose wave breakup of the 10-mm circular pours and from the annular flow off a 57 mm diameter tube. The fragments produced by the 5 mm circular et were smaller (∼ mm), and the 20 mm jet which underwent sinuous wave breakup produced ∼100 mm fragments. The fragments froze to form solid particles in 313 K water, and when the water was ≥343 K, the melt fragments did not freeze during their transit through 1.2 m of water

  1. Simulations of High Speed Fragment Trajectories

    Science.gov (United States)

    Yeh, Peter; Attaway, Stephen; Arunajatesan, Srinivasan; Fisher, Travis

    2017-11-01

    Flying shrapnel from an explosion are capable of traveling at supersonic speeds and distances much farther than expected due to aerodynamic interactions. Predicting the trajectories and stable tumbling modes of arbitrary shaped fragments is a fundamental problem applicable to range safety calculations, damage assessment, and military technology. Traditional approaches rely on characterizing fragment flight using a single drag coefficient, which may be inaccurate for fragments with large aspect ratios. In our work we develop a procedure to simulate trajectories of arbitrary shaped fragments with higher fidelity using high performance computing. We employ a two-step approach in which the force and moment coefficients are first computed as a function of orientation using compressible computational fluid dynamics. The force and moment data are then input into a six-degree-of-freedom rigid body dynamics solver to integrate trajectories in time. Results of these high fidelity simulations allow us to further understand the flight dynamics and tumbling modes of a single fragment. Furthermore, we use these results to determine the validity and uncertainty of inexpensive methods such as the single drag coefficient model.

  2. Transverse spin effects in hadron-pair production from semi-inclusive deep inelastic scattering

    CERN Document Server

    Adolph, C.; Alexakhin, V.Yu.; Alexeev, G.D.; Amoroso, A.; Antonov, A.A.; Badelek, B.; Balestra, F.; Barth, J.; Baum, G.; Bedfer, Y.; Bernhard, J.; Bertini, R.; Bettinelli, M.; Bieling, J.; Birsa, R.; Bisplinghoff, J.; Bordalo, P.; Bradamante, F.; Braun, C.; Bravar, A.; Bressan, A.; Burtin, E.; Chaberny, D.; Chiosso, M.; Chung, S.U.; Cicuttin, A.; Crespo, M.L.; Dalla Torre, S.; Das, S.; Dasgupta, S.S.; Dhara, L.; Donskov, S.V.; Duic, V.; Dunnweber, W.; Dziewiecki, M.; Efremov, A.; Elia, C.; Eversheim, P.D.; Eyrich, W.; Faessler, M.; Ferrero, A.; Filin, A.; Finger, M.; jr., M.Finger; Fischer, H.; Franco, C.; Friedrich, J.M.; Garfagnini, R.; Gautheron, F.; Gavrichtchouk, O.P.; Gazda, R.; Geyer, R.; Giorgi, M.; Gnesi, I.; Gobbo, B.; Grabmuller, S.; Grasso, A.; Grube, B.; Gushterski, R.; Guskov, A.; Guthorl, T.; Haas, F.; von Harrach, D.; Heinsius, F.H.; Herrmann, F.; Hess, C.; Hinterberger, F.; Horikawa, N.; Hoppner, Ch.; d'Hose, N.; Huber, S.; Ishimoto, S.; Ivanov, O.; Ivanshin, Yu.; Iwata, T.; Jahn, R.; Jasinski, P.; Joosten, R.; Kabuss, E.; Kang, D.; Ketzer, B.; Khaustov, G.V.; Khokhlov, Yu.A.; Kisselev, Yu.; Klein, F.; Klimaszewski, K.; Koblitz, S.; Koivuniemi, J.H.; Kolosov, V.N.; Konigsmann, K.; Konstantinov, V.F.; Korzenev, A.; Kotzinian, A.M.; Kramer, M.; Kroumchtein, Z.V.; Kunne, F.; Kurek, K.; Lauser, L.; Lednev, A.A.; Lehmann, A.; Levorato, S.; Lichtenstadt, J.; Maggiora, A.; Magnon, A.; Makke, N.; Mallot, G.K.; Mann, A.; Marchand, C.; Martin, A.; Marzec, J.; Massmann, F.; Matsuda, T.; Meyer, W.; Michigami, T.; Mikhailov, Yu.V.; Moinester, M.A.; Morreale, A.; Nagaytsev, A.; Nagel, T.; Nerling, F.; Neubert, S.; Neyret, D.; Nikolaenko, V.I.; Nowak, W.D.; Nunes, A.S.; Olshevsky, A.G.; Ostrick, M.; Padee, A.; Panknin, R.; Panzieri, D.; Parsamyan, B.; Paul, S.; Perevalova, E.; Pesaro, G.; Peshekhonov, D.V.; Piragino, G.; Platchkov, S.; Pochodzalla, J.; Polyakov, V.A.; Pontecorvo, G.; Pretz, J.; Quaresma, M.; Quintans, C.; Rajotte, J.F.; Ramos, S.; Rapatsky, V.; Reicherz, G.; Richter, A.; Rondio, E.; Rossiyskaya, N.S.; Ryabchikov, D.I.; Samoylenko, V.D.; Sandacz, A.; Sapozhnikov, M.G.; Sarkar, S.; Savin, I.A.; Sbrizzai, G.; Schiavon, P.; Schill, C.; Schluter, T.; Schmidt, K.; Schmitt, L.; Schonning, K.; Schopferer, S.; Schott, M.; Shevchenko, O.Yu.; Silva, L.; Sinha, L.; Slunecka, M.; Smirnov, G.I.; Sosio, S.; Sozzi, F.; Srnka, A.; Stolarski, M.; Sulc, M.; Sulej, R.; Sznajder, P.; Takekawa, S.; Wolbeek, J.Ter; Tessaro, S.; Tessarotto, F.; Teufel, A.; Tkatchev, L.G.; Uhl, S.; Uman, I.; Vandenbroucke, M.; Virius, M.; Vlassov, N.V.; Vossen, A.; Wang, L.; Windmolders, R.; Wislicki, W.; Zaremba, K.; Zavertyaev, M.; Zemlyanichkina, E.; Ziembicki, M.; Zhuravlev, N.; Zvyagin, A.

    2012-06-18

    First measurements of azimuthal asymmetries in hadron-pair production in deep-inelastic scattering of muons on transversely polarised ^6LiD (deuteron) and NH_3 (proton) targets are presented. The data were taken in the years 2002-2004 and 2007 with the COMPASS spectrometer using a muon beam of 160 GeV/c at the CERN SPS. The asymmetries provide access to the transversity distribution functions, without involving the Collins effect as in single hadron production. The sizeable asymmetries measured on the NH_ target indicate non-vanishing u-quark transversity and two-hadron interference fragmentation functions. The small asymmetries measured on the ^6LiD target can be interpreted as indication for a cancellation of u- and d-quark transversities.

  3. Microstructural characterization of pipe bomb fragments

    International Nuclear Information System (INIS)

    Gregory, Otto; Oxley, Jimmie; Smith, James; Platek, Michael; Ghonem, Hamouda; Bernier, Evan; Downey, Markus; Cumminskey, Christopher

    2010-01-01

    Recovered pipe bomb fragments, exploded under controlled conditions, have been characterized using scanning electron microscopy, optical microscopy and microhardness. Specifically, this paper examines the microstructural changes in plain carbon-steel fragments collected after the controlled explosion of galvanized, schedule 40, continuously welded, steel pipes filled with various smokeless powders. A number of microstructural changes were observed in the recovered pipe fragments: deformation of the soft alpha-ferrite grains, deformation of pearlite colonies, twin formation, bands of distorted pearlite colonies, slip bands, and cross-slip bands. These microstructural changes were correlated with the relative energy of the smokeless powder fillers. The energy of the smokeless powder was reflected in a reduction in thickness of the pipe fragments (due to plastic strain prior to fracture) and an increase in microhardness. Moreover, within fragments from a single pipe, there was a radial variation in microhardness, with the microhardness at the outer wall being greater than that at the inner wall. These findings were consistent with the premise that, with the high energy fillers, extensive plastic deformation and wall thinning occurred prior to pipe fracture. Ultimately, the information collected from this investigation will be used to develop a database, where the fragment microstructure and microhardness will be correlated with type of explosive filler and bomb design. Some analyses, specifically wall thinning and microhardness, may aid in field characterization of explosive devices.

  4. Pair potentials in liquid metals

    International Nuclear Information System (INIS)

    Faber, T.E.

    1980-01-01

    The argument which justifies the use of a pair potential to describe the structure-dependent term in the energy of liquid metals is briefly reviewed. Because there is an additional term in the energy which depends upon volume rather than structure, and because the pair potential itself is volume-dependent, the relationship between pair potential and observable properties such as pressure, bulk modulus and pair distribution function is more complicated for liquid metals than it is for molecular liquids. Perhaps for this reason, the agreement between pair potentials inferred from observable properties and pair potentials calculated by means of pseudo-potential theory is still far from complete. The pair potential concept is applicable only to simple liquid metals, in which the electron-ion interaction is weak. No attempt is made to discuss liquid transition and rare-earth metals, which are not simple in this sense. (author)

  5. Cryobiology of coral fragments.

    Science.gov (United States)

    Hagedorn, Mary; Farrell, Ann; Carter, Virginia L

    2013-02-01

    Around the world, coral reefs are dying due to human influences, and saving habitat alone may not stop this destruction. This investigation focused on the biological processes that will provide the first steps in understanding the cryobiology of whole coral fragments. Coral fragments are a partnership of coral tissue and endosymbiotic algae, Symbiodinium sp., commonly called zooxanthellae. These data reflected their separate sensitivities to chilling and a cryoprotectant (dimethyl sulfoxide) for the coral Pocillopora damicornis, as measured by tissue loss and Pulse Amplitude Modulated fluorometry 3weeks post-treatment. Five cryoprotectant treatments maintained the viability of the coral tissue and zooxanthellae at control values (1M dimethyl sulfoxide at 1.0, 1.5 and 2.0h exposures, and 1.5M dimethyl sulfoxide at 1.0 and 1.5h exposures, P>0.05, ANOVA), whereas 2M concentrations did not (Pzooxanthellae. During the winter when the fragments were chilled, the coral tissue remained relatively intact (∼25% loss) post-treatment, but the zooxanthellae numbers in the tissue declined after 5min of chilling (Pzooxanthellae numbers declined in response to chilling alone (P0.05, ANOVA), but it did not protect against the loss of zooxanthellae (Pzooxanthellae are the most sensitive element in the coral fragment complex and future cryopreservation protocols must be guided by their greater sensitivity. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. MaRaCluster: A Fragment Rarity Metric for Clustering Fragment Spectra in Shotgun Proteomics.

    Science.gov (United States)

    The, Matthew; Käll, Lukas

    2016-03-04

    Shotgun proteomics experiments generate large amounts of fragment spectra as primary data, normally with high redundancy between and within experiments. Here, we have devised a clustering technique to identify fragment spectra stemming from the same species of peptide. This is a powerful alternative method to traditional search engines for analyzing spectra, specifically useful for larger scale mass spectrometry studies. As an aid in this process, we propose a distance calculation relying on the rarity of experimental fragment peaks, following the intuition that peaks shared by only a few spectra offer more evidence than peaks shared by a large number of spectra. We used this distance calculation and a complete-linkage scheme to cluster data from a recent large-scale mass spectrometry-based study. The clusterings produced by our method have up to 40% more identified peptides for their consensus spectra compared to those produced by the previous state-of-the-art method. We see that our method would advance the construction of spectral libraries as well as serve as a tool for mining large sets of fragment spectra. The source code and Ubuntu binary packages are available at https://github.com/statisticalbiotechnology/maracluster (under an Apache 2.0 license).

  7. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  8. Octave-Spanning Mid-IR Supercontinuum Generation with Ultrafast Cascaded Nonlinearities

    DEFF Research Database (Denmark)

    Zhou, Binbin; Guo, Hairun; Liu, Xing

    2014-01-01

    An octave-spanning mid-IR supercontinuum is observed experimentally using ultrafast cascaded nonlinearities in an LiInS2 quadratic nonlinear crystal pumped with 70 fs energetic mid-IR pulses and cut for strongly phase-mismatched second-harmonic generation.......An octave-spanning mid-IR supercontinuum is observed experimentally using ultrafast cascaded nonlinearities in an LiInS2 quadratic nonlinear crystal pumped with 70 fs energetic mid-IR pulses and cut for strongly phase-mismatched second-harmonic generation....

  9. Fragment approaches in structure-based drug discovery

    International Nuclear Information System (INIS)

    Hubbard, Roderick E.

    2008-01-01

    Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets

  10. Fragmentation properties of 6Li

    International Nuclear Information System (INIS)

    Lovas, R.G.; Kruppa, A.T.; Beck, R.; Dickmann, F.

    1987-01-01

    The α+d and t+τ cluster structure of 6 Li is described in a microscopic α+d cluster model through quantities that enter into the description of cluster fragmentation processes. The states of the separate clusters α, d, t and τ are described as superpositions of Os Slater determinants belonging to different potential size parameters. To describe both the 6 Li and fragment state realistically, nucleon-nucleon forces optimized for the used model state spaces were constructed. The fragmentation properties predicted by them slightly differ from those calculated with some forces of common use provided the latter are modified so as to reproduce the α, d and 6 Li energies. (author) 61 refs.; 9 figs

  11. Geometrical scaling of jet fragmentation photons

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Koichi, E-mail: koichi.hattori@riken.jp [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Theoretical Research Division, Nishina Center, RIKEN, Wako, Saitama 351-0198 (Japan); McLerran, Larry, E-mail: mclerran@bnl.gov [RIKEN BNL Research Center, Brookhaven National Laboratory, Upton NY 11973 (United States); Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States); Physics Dept., China Central Normal University, Wuhan (China); Schenke, Björn, E-mail: bschenke@bnl.gov [Physics Dept., Bdg. 510A, Brookhaven National Laboratory, Upton, NY-11973 (United States)

    2016-12-15

    We discuss jet fragmentation photons in ultrarelativistic heavy-ion collisions. We argue that, if the jet distribution satisfies geometrical scaling and an anisotropic spectrum, these properties are transferred to photons during the jet fragmentation.

  12. Natural ventilation of large multi-span greenhouses

    NARCIS (Netherlands)

    Jong, de T.

    1990-01-01

    In this thesis the ventilation of large multi-span greenhouses caused by wind and temperature effects is studied. Quantification of the ventilation is important to improve the control of the greenhouse climate.

    Knowledge of the flow characteristics of the one-side-mounted windows of

  13. Pairing correlations in nuclei

    International Nuclear Information System (INIS)

    Baba, C.V.K.

    1988-01-01

    There are many similarities between the properties of nucleons in nuclei and electrons in metals. In addition to the properties explainable in terms of independent particle motion, there are many important co-operative effects suggesting correlated motion. Pairing correlation which leads to superconductivity in metals and several important properties in nuclei , is an exmple of such correlations. An attempt has been made to review the effects of pairing correlations in nuclei. Recent indications of reduction in pairing correlations at high angular momenta is discussed. A comparision between pairing correlations in the cases of nuclei and electrons in metals is attempted. (author). 20 refs., 10 figs

  14. Leaf life span plasticity in tropical seedlings grown under contrasting light regimes.

    Science.gov (United States)

    Vincent, Gregoire

    2006-02-01

    The phenotypic plasticity of leaf life span in response to low resource conditions has a potentially large impact on the plant carbon budget, notably in evergreen species not subject to seasonal leaf shedding, but has rarely been well documented. This study evaluates the plasticity of leaf longevity, in terms of its quantitative importance to the plant carbon balance under limiting light. Seedlings of four tropical tree species with contrasting light requirements (Alstonia scholaris, Hevea brasiliensis, Durio zibethinus and Lansium domesticum) were grown under three light regimes (full sunlight, 45 % sunlight and 12 % sunlight). Their leaf dynamics were monitored over 18 months. All species showed a considerable level of plasticity with regard to leaf life span: over the range of light levels explored, the ratio of the range to the mean value of life span varied from 29 %, for the least plastic species, to 84 %, for the most. The common trend was for leaf life span to increase with decreasing light intensity. The plasticity apparent in leaf life span was similar in magnitude to the plasticity observed in specific leaf area and photosynthetic rate, implying that it has a significant impact on carbon gain efficiency when plants acclimate to different light regimes. In all species, median survival time was negatively correlated with leaf photosynthetic capacity (or its proxy, the nitrogen content per unit area) and leaf emergence rate. Longer leaf life spans under low light are likely to be a consequence of slower ageing as a result of a slower photosynthetic metabolism.

  15. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  16. Time and resource limits on working memory: cross-age consistency in counting span performance.

    Science.gov (United States)

    Ransdell, Sarah; Hecht, Steven

    2003-12-01

    This longitudinal study separated resource demand effects from those of retention interval in a counting span task among 100 children tested in grade 2 and again in grades 3 and 4. A last card large counting span condition had an equivalent memory load to a last card small, but the last card large required holding the count over a longer retention interval. In all three waves of assessment, the last card large condition was found to be less accurate than the last card small. A model predicting reading comprehension showed that age was a significant predictor when entered first accounting for 26% of the variance, but counting span accounted for a further 22% of the variance. Span at Wave 1 accounted for significant unique variance at Wave 2 and at Wave 3. Results were similar for math calculation with age accounting for 31% of the variance and counting span accounting for a further 34% of the variance. Span at Wave 1 explained unique variance in math at Wave 2 and at Wave 3.

  17. Relationships between Categorical Perception of Phonemes, Phoneme Awareness, and Visual Attention Span in Developmental Dyslexia.

    Directory of Open Access Journals (Sweden)

    Rachel Zoubrinetzky

    Full Text Available We tested the hypothesis that the categorical perception deficit of speech sounds in developmental dyslexia is related to phoneme awareness skills, whereas a visual attention (VA span deficit constitutes an independent deficit. Phoneme awareness tasks, VA span tasks and categorical perception tasks of phoneme identification and discrimination using a d/t voicing continuum were administered to 63 dyslexic children and 63 control children matched on chronological age. Results showed significant differences in categorical perception between the dyslexic and control children. Significant correlations were found between categorical perception skills, phoneme awareness and reading. Although VA span correlated with reading, no significant correlations were found between either categorical perception or phoneme awareness and VA span. Mediation analyses performed on the whole dyslexic sample suggested that the effect of categorical perception on reading might be mediated by phoneme awareness. This relationship was independent of the participants' VA span abilities. Two groups of dyslexic children with a single phoneme awareness or a single VA span deficit were then identified. The phonologically impaired group showed lower categorical perception skills than the control group but categorical perception was similar in the VA span impaired dyslexic and control children. The overall findings suggest that the link between categorical perception, phoneme awareness and reading is independent from VA span skills. These findings provide new insights on the heterogeneity of developmental dyslexia. They suggest that phonological processes and VA span independently affect reading acquisition.

  18. Relationships between Categorical Perception of Phonemes, Phoneme Awareness, and Visual Attention Span in Developmental Dyslexia.

    Science.gov (United States)

    Zoubrinetzky, Rachel; Collet, Gregory; Serniclaes, Willy; Nguyen-Morel, Marie-Ange; Valdois, Sylviane

    2016-01-01

    We tested the hypothesis that the categorical perception deficit of speech sounds in developmental dyslexia is related to phoneme awareness skills, whereas a visual attention (VA) span deficit constitutes an independent deficit. Phoneme awareness tasks, VA span tasks and categorical perception tasks of phoneme identification and discrimination using a d/t voicing continuum were administered to 63 dyslexic children and 63 control children matched on chronological age. Results showed significant differences in categorical perception between the dyslexic and control children. Significant correlations were found between categorical perception skills, phoneme awareness and reading. Although VA span correlated with reading, no significant correlations were found between either categorical perception or phoneme awareness and VA span. Mediation analyses performed on the whole dyslexic sample suggested that the effect of categorical perception on reading might be mediated by phoneme awareness. This relationship was independent of the participants' VA span abilities. Two groups of dyslexic children with a single phoneme awareness or a single VA span deficit were then identified. The phonologically impaired group showed lower categorical perception skills than the control group but categorical perception was similar in the VA span impaired dyslexic and control children. The overall findings suggest that the link between categorical perception, phoneme awareness and reading is independent from VA span skills. These findings provide new insights on the heterogeneity of developmental dyslexia. They suggest that phonological processes and VA span independently affect reading acquisition.

  19. Relationships between Categorical Perception of Phonemes, Phoneme Awareness, and Visual Attention Span in Developmental Dyslexia

    Science.gov (United States)

    Zoubrinetzky, Rachel; Collet, Gregory; Serniclaes, Willy; Nguyen-Morel, Marie-Ange; Valdois, Sylviane

    2016-01-01

    We tested the hypothesis that the categorical perception deficit of speech sounds in developmental dyslexia is related to phoneme awareness skills, whereas a visual attention (VA) span deficit constitutes an independent deficit. Phoneme awareness tasks, VA span tasks and categorical perception tasks of phoneme identification and discrimination using a d/t voicing continuum were administered to 63 dyslexic children and 63 control children matched on chronological age. Results showed significant differences in categorical perception between the dyslexic and control children. Significant correlations were found between categorical perception skills, phoneme awareness and reading. Although VA span correlated with reading, no significant correlations were found between either categorical perception or phoneme awareness and VA span. Mediation analyses performed on the whole dyslexic sample suggested that the effect of categorical perception on reading might be mediated by phoneme awareness. This relationship was independent of the participants’ VA span abilities. Two groups of dyslexic children with a single phoneme awareness or a single VA span deficit were then identified. The phonologically impaired group showed lower categorical perception skills than the control group but categorical perception was similar in the VA span impaired dyslexic and control children. The overall findings suggest that the link between categorical perception, phoneme awareness and reading is independent from VA span skills. These findings provide new insights on the heterogeneity of developmental dyslexia. They suggest that phonological processes and VA span independently affect reading acquisition. PMID:26950210

  20. Intermittent pair-housing, pair relationship qualities, and HPA activity in adult female rhesus macaques.

    Science.gov (United States)

    Hannibal, Darcy L; Cassidy, Lauren C; Vandeleest, Jessica; Semple, Stuart; Barnard, Allison; Chun, Katie; Winkler, Sasha; McCowan, Brenda

    2018-05-02

    Laboratory rhesus macaques are often housed in pairs and may be temporarily or permanently separated for research, health, or management reasons. While both long-term social separations and introductions can stimulate a stress response that impacts inflammation and immune function, the effects of short-term overnight separations and whether qualities of the pair relationship mediate these effects are unknown. In this study, we investigated the effects of overnight separations on the urinary cortisol concentration of 20 differentially paired adult female rhesus macaques (Macaca mulatta) at the California National Primate Research Center. These females were initially kept in either continuous (no overnight separation) or intermittent (with overnight separation) pair-housing and then switched to the alternate pair-housing condition part way through the study. Each study subject was observed for 5 weeks, during which we collected measures of affiliative, aggressive, anxious, abnormal, and activity-state behaviors in both pair-housing conditions. Additionally, up to three urine samples were collected from each subject per week and assayed for urinary free cortisol and creatinine. Lastly, the behavioral observer scored each pair on four relationship quality attributes ("Anxious," "Tense," "Well-meshed," and "Friendly") using a seven-point scale. Data were analyzed using a generalized linear model with gamma distribution and an information theoretic approach to determine the best model set. An interaction between the intermittent pairing condition and tense pair adjective rating was in the top three models of the best model set. Dominance and rates of affiliation were also important for explaining urinary cortisol variation. Our results suggest that to prevent significant changes in HPA-axis activation in rhesus macaque females, which could have unintended effects on research outcomes, pairs with "Tense" relationships and overnight separations preventing tactile contact

  1. Fracture mechanics model of fragmentation

    International Nuclear Information System (INIS)

    Glenn, L.A.; Gommerstadt, B.Y.; Chudnovsky, A.

    1986-01-01

    A model of the fragmentation process is developed, based on the theory of linear elastic fracture mechanics, which predicts the average fragment size as a function of strain rate and material properties. This approach permits a unification of previous results, yielding Griffith's solution in the low-strain-rate limit and Grady's solution at high strain rates

  2. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  3. Heavy-Quark Production in the Target Fragmentation Region

    CERN Document Server

    Graudenz, Dirk

    1997-01-01

    Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...

  4. Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin : Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry

    NARCIS (Netherlands)

    Mondal, Milon; Radeva, Nedyalka; Fanlo-Virgos, Hugo; Otto, Sijbren; Klebe, Gerhard; Hirsch, Anna K. H.

    2016-01-01

    Fragment-based drug design (FBDD) affords active compounds for biological targets. While there are numerous reports on FBDD by fragment growing/optimization, fragment linking has rarely been reported. Dynamic combinatorial chemistry (DCC) has become a powerful hit-identification strategy for

  5. Experimental modelling of fragmentation applied to volcanic explosions

    Science.gov (United States)

    Haug, Øystein Thordén; Galland, Olivier; Gisler, Galen R.

    2013-12-01

    Explosions during volcanic eruptions cause fragmentation of magma and host rock, resulting in fragments with sizes ranging from boulders to fine ash. The products can be described by fragment size distributions (FSD), which commonly follow power laws with exponent D. The processes that lead to power-law distributions and the physical parameters that control D remain unknown. We developed a quantitative experimental procedure to study the physics of the fragmentation process through time. The apparatus consists of a Hele-Shaw cell containing a layer of cohesive silica flour that is fragmented by a rapid injection of pressurized air. The evolving fragmentation of the flour is monitored with a high-speed camera, and the images are analysed to obtain the evolution of the number of fragments (N), their average size (A), and the FSD. Using the results from our image-analysis procedure, we find transient empirical laws for N, A and the exponent D of the power-law FSD as functions of the initial air pressure. We show that our experimental procedure is a promising tool for unravelling the complex physics of fragmentation during phreatomagmatic and phreatic eruptions.

  6. Comparison between BIDE, PrefixSpan, and TRuleGrowth for Mining of Indonesian Text

    Science.gov (United States)

    Sa'adillah Maylawati, Dian; Irfan, Mohamad; Budiawan Zulfikar, Wildan

    2017-01-01

    Mining proscess for Indonesian language still be an interesting research. Multiple of words representation was claimed can keep the meaning of text better than bag of words. In this paper, we compare several sequential pattern algortihm, among others BIDE (BIDirectional Extention), PrefixSpan, and TRuleGrowth. All of those algorithm produce frequent word sequence to keep the meaning of text. However, the experiment result, with 14.006 of Indonesian tweet from Twitter, shows that BIDE can produce more efficient frequent word sequence than PrefixSpan and TRuleGrowth without missing the meaning of text. Then, the average of time process of PrefixSpan is faster than BIDE and TRuleGrowth. In the other hand, PrefixSpan and TRuleGrowth is more efficient in using memory than BIDE.

  7. Parents' and Teachers' Perceptions of Abnormal Attention Span of Elementary School-Age Children.

    Science.gov (United States)

    Segal-Triwitz, Yael; Kirchen, Louisa M; Shani Sherman, Tal; Levav, Miriam; Schonherz-Pine, Yael; Kushnir, Jonathan; Ariel, Raya; Gothelf, Doron

    2016-01-01

    To determine teacher and parental perception of minimal expected sustained attention span during various daily tasks among elementary school children. 54 parents and 47 teachers completed the attention span questionnaire (AtSQ) that was developed for this study. The AtSQ consists of 15 academic and leisure tasks that require a child's sustained attention. The study focused on third and fourth graders in Israel. There was a high degree of variability among teachers and parents in their responses to the AtSQ. The expected attention span of children as judged by parents was higher and more varied compared to teachers, and higher for girls than for boys. Our results indicate poor agreement in cutoff values for sustained attention span between teachers and parents and within each group.

  8. Neighbouring charge fragmentations in low energy fission

    International Nuclear Information System (INIS)

    Montoya, M.

    1986-10-01

    Shell and odd-even effects in fission have been largely studied until now. The structure in fragment mass, charge and kinetic energy distributions of fragments were interpreted as shell and even-odd effects. In this paper, we want to show that the discret change of fragment charge symmetry should produce also structures in those distribution. 19 refs

  9. Aspect Ratio Dependence of Impact Fragmentation

    International Nuclear Information System (INIS)

    Inaoka, H.; Toyosawa, E.; Takayasu, H.; Inaoka, H.

    1997-01-01

    A numerical model of three-dimensional impact fragmentation produces a power-law cumulative fragment mass distribution followed by a flat tail. The result is consistent with an experimental result in a recent paper by Meibom and Balslev [Phys. Rev. Lett. 76, 2492 (1996)]. Our numerical simulation also implies that the fragment mass distribution changes from a power law with a flat tail to a power law with a sudden cutoff, depending on the aspect ratio of the fractured object. copyright 1997 The American Physical Society

  10. Oblique non-neutral solitary Alfven modes in weakly nonlinear pair plasmas

    International Nuclear Information System (INIS)

    Verheest, Frank; Lakhina, G S

    2005-01-01

    The equal charge-to-mass ratio for both species in pair plasmas induces a decoupling of the linear eigenmodes between waves that are charge neutral or non-neutral, also at oblique propagation with respect to a static magnetic field. While the charge-neutral linear modes have been studied in greater detail, including their weakly and strongly nonlinear counterparts, the non-neutral mode has received less attention. Here the nonlinear evolution of a solitary non-neutral mode at oblique propagation is investigated in an electron-positron plasma. Employing the framework of reductive perturbation analysis, a modified Korteweg-de Vries equation (with cubic nonlinearity) for the lowest-order wave magnetic field is obtained. In the linear approximation, the non-neutral mode has its magnetic component orthogonal to the plane spanned by the directions of wave propagation and of the static magnetic field. The linear polarization is not maintained at higher orders. The results may be relevant to the microstructure in pulsar radiation or to the subpulses

  11. Fragment-assisted hit investigation involving integrated HTS and fragment screening: Application to the identification of phosphodiesterase 10A (PDE10A) inhibitors.

    Science.gov (United States)

    Varnes, Jeffrey G; Geschwindner, Stefan; Holmquist, Christopher R; Forst, Janet; Wang, Xia; Dekker, Niek; Scott, Clay W; Tian, Gaochao; Wood, Michael W; Albert, Jeffrey S

    2016-01-01

    Fragment-based drug design (FBDD) relies on direct elaboration of fragment hits and typically requires high resolution structural information to guide optimization. In fragment-assisted drug discovery (FADD), fragments provide information to guide selection and design but do not serve as starting points for elaboration. We describe FADD and high-throughput screening (HTS) campaign strategies conducted in parallel against PDE10A where fragment hit co-crystallography was not available. The fragment screen led to prioritized fragment hits (IC50's ∼500μM), which were used to generate a hypothetical core scaffold. Application of this scaffold as a filter to HTS output afforded a 4μM hit, which, after preparation of a small number of analogs, was elaborated into a 16nM lead. This approach highlights the strength of FADD, as fragment methods were applied despite the absence of co-crystallographical information to efficiently identify a lead compound for further optimization. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Gluon fragmentation in T(1S) decays

    International Nuclear Information System (INIS)

    Bienlein, J.K.

    1983-05-01

    In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

  13. Fragmentation of Relativistic 56Fe Nuclei in Emulsion

    International Nuclear Information System (INIS)

    Chernov, G.M.; Gulamov, K.G.; Gulyamov, U.G.; Navotny, V.Sh.; Petrov, N.V.; Svechnikova, L.N.; Jakobsson, B.; Oskarsson, A.; Otterlund, I.

    1983-03-01

    Experimental data on general characteristics of projectile fragments in inelastic interactions of relativistic 56 Fe nuclei in emulsion (multiplicities, transverse momentum distributions, azimuthal correlations) are presented and discussed. A strong dependence on the mass number of the projectile nucleus is observed for the transverse momenta of the emitted projectile fragments. These fragments exhibit an azimuthal asymmetry caused by the transverse motion of the fragmenting residue, but it is shown that this motion can be responsible only for a part of the increase in the average transverse momentum of the fragments with increasing mass of the projectile. (author)

  14. Aeroelastic stability of full-span tiltrotor aircraft model in forward flight

    Directory of Open Access Journals (Sweden)

    Zhiquan LI

    2017-12-01

    Full Text Available The existing full-span models of the tiltrotor aircraft adopted the rigid blade model without considering the coupling relationship among the elastic blade, wing and fuselage. To overcome the limitations of the existing full-span models and improve the precision of aeroelastic analysis of tiltrotor aircraft in forward flight, the aeroelastic stability analysis model of full-span tiltrotor aircraft in forward flight has been presented in this paper by considering the coupling among elastic blade, wing, fuselage and various components. The analytical model is validated by comparing with the calculation results and experimental data in the existing references. The influence of some structural parameters, such as the fuselage degrees of freedom, relative displacement between the hub center and the gravity center, and nacelle length, on the system stability is also investigated. The results show that the fuselage degrees of freedom decrease the critical stability velocity of tiltrotor aircraft, and the variation of the structural parameters has great influence on the system stability, and the instability form of system can change between the anti-symmetric and symmetric wing motions of vertical and chordwise bending. Keywords: Aeroelastic stability, Forward flight, Full-span model, Modal analysis, Tiltrotor aircraft

  15. Young Skilled Deaf Readers Have an Enhanced Perceptual Span in Reading.

    Science.gov (United States)

    Bélanger, Nathalie N; Lee, Michelle; Schotter, Elizabeth R

    2017-04-27

    Recently, Bélanger, Slattery, Mayberry and Rayner (2012) showed, using the moving window paradigm, that profoundly deaf adults have a wider perceptual span during reading relative to hearing adults matched on reading level. This difference might be related to the fact that deaf adults allocate more visual attention to simple stimuli in the parafovea (Bavelier, Dye & Hauser, 2006). Importantly, this reorganization of visual attention in deaf individuals is already manifesting in deaf children (Dye, Hauser & Bavelier, 2009). This leads to questions about the time course of the emergence of an enhanced perceptual span (which is under attentional control; Rayner, 2014; Miellet, O'Donnell, & Sereno, 2009) in young deaf readers. The present research addressed this question by comparing the perceptual spans of young deaf readers (age 7-15) and young hearing children (age 7-15). Young deaf readers, like deaf adults, were found to have a wider perceptual span relative to their hearing peers matched on reading level, suggesting that strong and early reorganization of visual attention in deaf individuals goes beyond the processing of simple visual stimuli and emerges into more cognitively complex tasks, such as reading.

  16. Percutaneous transhepatic fragmentation of gall stones and extraction of fragments

    International Nuclear Information System (INIS)

    Guenther, R.; Klose, K.; Schmidt, H.D.; Staritz, M.; Mainz Univ.; Mainz Univ.

    1983-01-01

    Attempts at percutaneous removal have been made in 13 patients with solitary and multiple intra- and extra-hepatic biliary duct stones measuring 5 to 30 mm. The stones were fragmented with a Dormia basket and the fragments removed transhepatically. In ten patients the procedure was successful, including one patient with multiple intra-hepatic stones. The procedure can be recommended for cases of calculous obstruction of biliary anastomoses or of stones which could not be removed by endoscopy, or where there is already biliary drainage being carried out, or in patients with a high opertive risk. In two patients, dilatation of the papilla was also carried out, in four patients a stenosis was dilated and in a further two patients, electro-incision of a stenosis was performed. (orig.) [de

  17. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  18. Schwinger pair creation of Kaluza-Klein particles: Pair creation without tunneling

    International Nuclear Information System (INIS)

    Friedmann, Tamar; Verlinde, Herman

    2005-01-01

    We study Schwinger pair creation of charged Kaluza-Klein (KK) particles from a static KK electric field. We find that the gravitational backreaction of the electric field on the geometry--which is incorporated via the electric KK-Melvin solution--prevents the electrostatic potential from overcoming the rest mass of the KK particles, thus impeding the tunneling mechanism which is often thought of as responsible for the pair creation. However, we find that pair creation still occurs with a finite rate formally similar to the classic Schwinger result, but via an apparently different mechanism, involving a combination of the Unruh effect and vacuum polarization due to the E-field

  19. [The evolution of plant life span: facts and hypotheses].

    Science.gov (United States)

    2006-01-01

    There are two different views on the evolution of life forms in Cormophyta: from woody plants to herbaceous ones or in opposite direction - from herbs to trees. In accordance with these views it is supposed that life span in plants changed in the course of evolution from many years (perennials) to few years (annuals, biennials), or went in reverse - from few years to many years. The author discusses the problems of senescence and longevity in Cormophyta in the context of various hypotheses of ageing (programmed death theory, mutation accumulation, antagonistic pleiotropy, disposable soma, genes of ageing, genes of longevity). Special attention is given to bio-morphological aspects of longevity and cases of non-ageing plants ("negative senescence", "potential immortality"). It is proposed to distinguish seven models of simple ontogenesis in Cormophyta that can exemplify the diversity of mechanisms of ageing and longevity. The evolution of life span in plants is considered as an indirect result of natural selection of other characteristics of organisms or as a consequence of fixation of modifications (episelectional evolution). It seems that short life span could emerge several times during evolution of one group of plants, thus favoring its adaptive radiation.

  20. Low doze γ-irradiation influence on drosophila life span in different genetics background

    International Nuclear Information System (INIS)

    Moskalev, A.

    2007-01-01

    Complete text of publication follows. The main goal of this work was to study in Drosophila melanogaster the contribution of DNA damage sensing and repair, apoptosis and heat shock defence into life span and physical activity alteration after gamma-irradiation at low doze rate. In our experiments, the strains were exposed to chronic gamma-irradiation from a 226Ra source (50 R/h) at doze rate 0.17 cGy/h at pre-imago development stages only. The absorbed radiation dose per generation (from embryo to imago, 12 days) was 60 cGy. Life span estimation was prepared in adult males and females separately. We compared the life span of apoptotic (p53, DIAP-1, dApaf-1, Dcp-1, reaper, grim and hid), heat shock defence (HSP70, HSP23, HSF), DNA damage sensing (ATR) and repair (XPF, XPC, PCNA, DSB repair helicase homologs) mutants after chronic irradiation with the control. On the basis of our investigation we have concluded: 1) Low doze irradiation alter the life span depending on genetic background (mutant alleles, heterozygosity level and sex); 2) Age dynamics of physical activity positively correlates with the life span; 3) Longevity potential forms at early development stages; 4) DNA damage sensing, DNA repair, heat shock defence and apoptosis as aging preventing mechanisms play crucial role in radiation-induced life span hormesis.

  1. The role of fragmentation mechanism in large-scale vapor explosions

    International Nuclear Information System (INIS)

    Liu, Jie

    2003-01-01

    A non-equilibrium, multi-phase, multi-component code PROVER-I is developed for propagation phase of vapor explosion. Two fragmentation models are used. The hydrodynamic fragmentation model is the same as Fletcher's one. A new thermal fragmentation model is proposed with three kinds of time scale for modeling instant fragmentation, spontaneous nucleation fragmentation and normal boiling fragmentation. The role of fragmentation mechanisms is investigated by the simulations of the pressure wave propagation and energy conversion ratio of ex-vessel vapor explosion. The spontaneous nucleation fragmentation results in a much higher pressure peak and a larger energy conversion ratio than hydrodynamic fragmentation. The instant fragmentation gives a slightly larger energy conversion ratio than spontaneous nucleation fragmentation, and the normal boiling fragmentation results in a smaller energy conversion ratio. The detailed analysis of the structure of pressure wave makes it clear that thermal detonation exists only under the thermal fragmentation circumstance. The high energy conversion ratio is obtained in a small vapor volume fraction. However, in larger vapor volume fraction conditions, the vapor explosion is weak. In a large-scale vapor explosion, the hydrodynamic fragmentation is essential when the pressure wave becomes strong, so a small energy conversion ratio is expected. (author)

  2. The effect of span length and girder type on bridge costs

    Directory of Open Access Journals (Sweden)

    Batikha Mustafa

    2017-01-01

    Full Text Available Bridges have an important role in impacting the civilization, growth and economy of cities from ancient time until these days due to their function in reducing transportation cost and time. Therefore, development of bridges has been a knowledge domain in civil engineering studies in terms of their types and construction materials to confirm a reliable, safe, economic design and construction. Girder-bridge of concrete deck and I-beam girder has been used widely for short and medium span bridges because of ease and low-cost of fabrication. However, many theoretical and practical investigations are still undertaken regarding the type of beam girder; i.e steel composite or prestressed concrete. This paper evaluates the effect of bridge span and the type of girder on the capital cost and life cycle costs of bridges. Three types of girders were investigated in this research: steel composite, pre-tensioned pre-stressed concrete and post-tensioned pre-stressed concrete. The structural design was analyzed for 5 span lengths: 20, 25, 30, 35 and 40m. Then, the capital construction cost was accounted for 15 bridges according to each span and construction materials. Moreover, the maintenance required for 50 years of bridge life was evaluated and built up as whole life costs for each bridge. As a result of this study, the influence of both span length and type of girder on initial construction cost and maintenance whole life costs were assessed to support the decision makers and designers in the selection process for the optimum solution of girder bridges.

  3. Diferença entre span verbal e visual nos gêneros: estudo piloto

    Directory of Open Access Journals (Sweden)

    Mariana Cristina Pedrassa Sagrilo

    2013-06-01

    Full Text Available OBJETIVO: avaliar a memória de trabalho analisando a capacidade de retenção de estímulos auditivos (span verbal e visuais (span visual e estabelecer a relação com o gênero (masculino e feminino. MÉTODO: participaram deste estudo 20 crianças entre seis anos e cinco meses e sete anos, sendo 10 sujeitos do sexo masculino e 10 sujeitos do sexo feminino. Todos os sujeitos foram submetidos às provas de avaliação do span verbal e visual em ordem direta e inversa. RESULTADOS: apenas na prova de palavras dissílabas com fonologia semelhante e semântica diferente do span verbal, houve variância significante entre os gêneros. As crianças do sexo feminino apresentaram melhor desempenho em relação ao outro gênero, bem como maior capacidade de retenção de palavras dissílabas com fonologia e semântica diferentes. No span visual (ordem direta e inversa as crianças do sexo masculino obtiveram melhor desempenho, apesar de não ter diferenças significantes. Em relação à idade não houve diferença de retenção de estímulos. CONCLUSÃO: as crianças do sexo feminino, neste estudo, apresentaram tendência à melhor desempenho do span verbal e as crianças do sexo masculino tendência a melhor desempenho no span visual. No entanto, o estudo é limitado devido ao reduzido número de participantes na amostra.

  4. Memory effects in nuclear fragmentation?

    International Nuclear Information System (INIS)

    Colonna, M.; Di Toro, M.; Guarnera, A.

    1994-01-01

    A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))

  5. Span Restoration in Optical Networks with Limited Wavelength Conversion

    DEFF Research Database (Denmark)

    Ruepp, Sarah Renée; Buron, Jakob Due; Andriolli, N

    2007-01-01

    Next generation optical networks provide functionalities to dynamically provision and recover connections, while emerging technologies allow for the conversion between wavelengths. These devices are however expensive and hence it is likely that only few are deployed throughout the network...... converter-saving wavelength assignment in GMPLS networks. The converter saving property of the Suggested Vector is particularly desirable in span restoration, where the pre-failure path stubs have to be merged to the restoration path at the failure-adjacent nodes. In order to avoid wavelength conversion....... Furthermore, we describe different scenarios to extend the suggested vector wavelength assignment scheme to multi-domain networks with focus on span restoration....

  6. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2003-01-01

    Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

  7. Gluon fragmentation into 3 PJ quarkonium

    International Nuclear Information System (INIS)

    Ma, J.P.

    1995-01-01

    The functions of the gluon fragmentation into 3 P j quarkonium are calculated to order α 2 s . With the recent progress in analysing quarkonium systems in QCD it is possible show how the so called divergence in the limit of the zero-binding energy, which is related to P-wave quarkonia, is treated correctly in the case of fragmentation functions. The obtained fragmentation functions satisfy explicitly at the order of α 2 s the Altarelli-Parisi equation and when z → 0 they behave as z -1 as expected. 19 refs., 7 figs

  8. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2005-01-01

    Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

  9. Qualitative Exploration of Acculturation and Life-Span Issues of Elderly Asian Americans

    Science.gov (United States)

    Lee, Jee Hyang; Heo, Nanseol; Lu, Junfei; Portman, Tarrell Awe Agahe

    2013-01-01

    Awareness of aging issues across diverse populations begins the journey toward counselors becoming culturally competent across client life spans. Understanding the life-span experiences of cultural groups is important for helping professionals. The purpose of this research was to gain insight into the qualitative experiences of Asian American…

  10. Fuel fragmentation data review and separate effects testing

    International Nuclear Information System (INIS)

    Yueh, Ken. H.; Snis, N.; Mitchell, D.; Munoz-Reja, C.

    2014-01-01

    A simple alternative test has been developed to study the fuel fragmentation process at loss of coolant accident (LOCA) temperatures. The new test heats a short section of fuel, approximately two pellets worth of material, in a tube furnace open to air. An axial slit is cut in the test sample cladding to reduce radial restraint and to simulate ballooned condition. The tube furnace allows the fuel fragmentation process be observed during the experiment. The test was developed as a simple alternative so large number of tests could be conducted quickly and efficiently to identify key variables that influence fuel fragmentation and to zeroing on the fuel fragmentation burn-up threshold. Several tests were conducted, using fuel materials from fuel rods that were used in earlier integral tests to benchmark and validate the test technique. High burn-up fuel materials known to be above the fragmentation threshold was used to evaluate the fragmentation process as a function of temperature. Even with an axial slit and both ends open, no significant fuel detachment/release was detected until above 750°C. Additional tests were conducted with fuel materials at burn-ups closer to the fuel fragmentation burn-up threshold. Results from these tests indicate a minor power history effect on the fuel fragmentation burn-up threshold. An evaluation of available literature and data generated from this work suggest a fuel fragmentation burn-up threshold between 70 and 75 GWd/MTU. (author)

  11. Excited cooper pairs

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Arrietea, M. G.; Solis, M. A.; De Llano, M. [Universidad Nacional Autonoma de Mexico, Mexico, D.F (Mexico)

    2001-02-01

    Excited cooper pairs formed in a many-fermion system are those with nonzero total center-of mass momentum (CMM). They are normally neglected in the standard Bardeen-Cooper-Schrieffer (BCS) theory of superconductivity for being too few compared with zero CMM pairs. However, a Bose-Einstein condensation picture requires both zero and nonzero CMM pairs. Assuming a BCS model interaction between fermions we determine the populations for all CMM values of Cooper pairs by actually calculating the number of nonzero-CMM pairs relative to that of zero-CMM ones in both 2D and 3D. Although this ratio decreases rapidly with CMM, the number of Cooper pairs for any specific CMM less than the maximum (or breakup of the pair) momentum turns out to be typically larger than about 95% of those with zero-CMM at zero temperature T. Even at T {approx}100 K this fraction en 2D is still as large as about 70% for typical quasi-2D cuprate superconductor parameters. [Spanish] Los pares de cooper excitados formados en un sistema de muchos electrones, son aquellos con momentos de centro de masa (CMM) diferente de cero. Normalmente estos no son tomados en cuenta en la teoria estandar de la superconductividad de Bardeen-Cooper-Schrieffer (BCS) al suponer que su numero es muy pequeno comparados con los pares de centro de masa igual a cero. Sin embargo, un esquema de condensacion Bose-Einstein requiere de ambos pares, con CMM cero y diferente de cero. Asumiendo una interaccion modelo BCS entre los fermiones, determinamos la poblacion de pares cooper con cada uno de todos los posibles valores del CMM calculando el numero de pares con momentos de centro de masa diferente de cero relativo a los pares de CMM igual a cero, en 2D y 3D. Aunque esta razon decrece rapidamente con el CMM, el numero de pares de cooper para cualquier CMM especifico menor que el momento maximo (o rompimiento de par) es tipicamente mas grande que el 95% de aquellos con CMM cero. Aun a T {approx}100 K esta fraccion en 2D es

  12. High-throughput fragment screening by affinity LC-MS.

    Science.gov (United States)

    Duong-Thi, Minh-Dao; Bergström, Maria; Fex, Tomas; Isaksson, Roland; Ohlson, Sten

    2013-02-01

    Fragment screening, an emerging approach for hit finding in drug discovery, has recently been proven effective by its first approved drug, vemurafenib, for cancer treatment. Techniques such as nuclear magnetic resonance, surface plasmon resonance, and isothemal titration calorimetry, with their own pros and cons, have been employed for screening fragment libraries. As an alternative approach, screening based on high-performance liquid chromatography separation has been developed. In this work, we present weak affinity LC/MS as a method to screen fragments under high-throughput conditions. Affinity-based capillary columns with immobilized thrombin were used to screen a collection of 590 compounds from a fragment library. The collection was divided into 11 mixtures (each containing 35 to 65 fragments) and screened by MS detection. The primary screening was performed in 3500 fragments per day). Thirty hits were defined, which subsequently entered a secondary screening using an active site-blocked thrombin column for confirmation of specificity. One hit showed selective binding to thrombin with an estimated dissociation constant (K (D)) in the 0.1 mM range. This study shows that affinity LC/MS is characterized by high throughput, ease of operation, and low consumption of target and fragments, and therefore it promises to be a valuable method for fragment screening.

  13. Biological effectiveness of high-energy protons - Target fragmentation

    International Nuclear Information System (INIS)

    Cucinotta, F.A.; Katz, R.; Wilson, J.W.; Townsend, L.W.; Shinn, J.; Hajnal, F.

    1991-01-01

    High-energy protons traversing tissue produce local sources of high-linear-energy-transfer ions through nuclear fragmentation. The contribution of these target fragments to the biological effectiveness of high-energy protons using the cellular track model is examined. The effects of secondary ions are treated in terms of the production collision density using energy-dependent parameters from a high-energy fragmentation model. Calculations for mammalian cell cultures show that at high dose, at which intertrack effects become important, protons deliver damage similar to that produced by gamma rays, and with fragmentation the relative biological effectiveness (RBE) of protons increases moderately from unity. At low dose, where sublethal damage is unimportant, the contribution from target fragments dominates, causing the proton effectiveness to be very different from that of gamma rays with a strongly fluence-dependent RBE. At high energies, the nuclear fragmentation cross sections become independent of energy. This leads to a plateau in the proton single-particle-action cross section, below 1 keV/micron, since the target fragments dominate. 29 refs

  14. Bootstrap embedding: An internally consistent fragment-based method

    Energy Technology Data Exchange (ETDEWEB)

    Welborn, Matthew; Tsuchimochi, Takashi; Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139 (United States)

    2016-08-21

    Strong correlation poses a difficult problem for electronic structure theory, with computational cost scaling quickly with system size. Fragment embedding is an attractive approach to this problem. By dividing a large complicated system into smaller manageable fragments “embedded” in an approximate description of the rest of the system, we can hope to ameliorate the steep cost of correlated calculations. While appealing, these methods often converge slowly with fragment size because of small errors at the boundary between fragment and bath. We describe a new electronic embedding method, dubbed “Bootstrap Embedding,” a self-consistent wavefunction-in-wavefunction embedding theory that uses overlapping fragments to improve the description of fragment edges. We apply this method to the one dimensional Hubbard model and a translationally asymmetric variant, and find that it performs very well for energies and populations. We find Bootstrap Embedding converges rapidly with embedded fragment size, overcoming the surface-area-to-volume-ratio error typical of many embedding methods. We anticipate that this method may lead to a low-scaling, high accuracy treatment of electron correlation in large molecular systems.

  15. Experimental investigation of span length for flexural test of fiber reinforced polymer composite laminates

    Directory of Open Access Journals (Sweden)

    Akhil Mehndiratta

    2018-01-01

    Full Text Available Testing and evaluation of mechanical properties for FRP (Fiber Reinforced Polymer composite parts play a significant role to qualify it for the end use. Among the mechanical properties, the flexural strength is significant and vital as it may vary with specimen depth, temperature and the test span length. The flexural strength varies for different materials with varying the test span length hence the current work aims to find an optimum span length to test flexural strength for the specimens made of Glass (7781, EC9756 and Carbon (HTA7, G801 prepreg materials. Experiments are conducted as per the ASTM Standard D 790 for flexural test by varying the span lengths to understand the behavior of the flexural strength and flexural modulus. The experimental data were compared with those obtained from the finite element program software Altair Hyper works 14.0. The results indicate that flexural modulus increases with the span length to a point and then it decreases. Thereby, an optimum span length can be obtained for testing flexural strength, which will be useful to the designers and the composite manufacturers to accomplish better standard testing procedures.

  16. Fragmentation of molten core material by sodium

    International Nuclear Information System (INIS)

    Chu, T.Y.

    1982-01-01

    A series of scoping experiments was performed to study the fragmentation of prototypic high temperature melts in sodium. The quantity of melt involved was at least one order of magnitude larger than previous experiments. Two modes of contact were used: melt streaming into sodium and sodium into melt. The average bulk fragment size distribution was found to be in the range of previous data and the average size distribution was found to be insensitive to mode of contact. SEM studies showed that the metal component typically fragmented in the molten phase while the oxide component fragmented in the solid phase. For UO 2 -ZrO 2 /stainless steel melts no sigificant spatial separation of the metal and oxide was observed. The fragment size distribution was stratified vertically in the debris bed in all cases. While the bulk fragment size showed generally consistent trends, the individual experiments were sufficiently different to cause different degrees of stratification in the debris bed. For the highly stratified beds the permeability can decrease by as much as a factor of 20 from the bottom to the top of the bed

  17. Fragment-based drug discovery using rational design.

    Science.gov (United States)

    Jhoti, H

    2007-01-01

    Fragment-based drug discovery (FBDD) is established as an alternative approach to high-throughput screening for generating novel small molecule drug candidates. In FBDD, relatively small libraries of low molecular weight compounds (or fragments) are screened using sensitive biophysical techniques to detect their binding to the target protein. A lower absolute affinity of binding is expected from fragments, compared to much higher molecular weight hits detected by high-throughput screening, due to their reduced size and complexity. Through the use of iterative cycles of medicinal chemistry, ideally guided by three-dimensional structural data, it is often then relatively straightforward to optimize these weak binding fragment hits into potent and selective lead compounds. As with most other lead discovery methods there are two key components of FBDD; the detection technology and the compound library. In this review I outline the two main approaches used for detecting the binding of low affinity fragments and also some of the key principles that are used to generate a fragment library. In addition, I describe an example of how FBDD has led to the generation of a drug candidate that is now being tested in clinical trials for the treatment of cancer.

  18. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Science.gov (United States)

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  19. A Wide Span Tractor concept developed for efficient and environmental friendly farming

    DEFF Research Database (Denmark)

    Pedersen, Hans Henrik; Grøn Sørensen, Claus; Oudshoorn, Frank W

    2013-01-01

    agricultural machines a new Wide Span (WS) tractor concept has been designed and a prototype tractor with a span of 9.6 m (wheel centre to wheel centre) has been built. It is designed to optimise the Controlled Traffic Farming (CTF) system that is already in place on the vegetable farm where it is being tested....... The tractor is designed to carry out all operations during vegetable production including harvest. Using the tractor means that less than 10% of the field area is affected by compaction due to field traffic. The economical and environmental effects of such a wide span CTF