Ribosomal S6 Kinase Cooperates with Casein Kinase 2 to Modulate the Drosophila Circadian Molecular Oscillator

Science.gov (United States)

Akten, Bikem; Tangredi, Michelle M.; Jauch, Eike; Roberts, Mary A.; Ng, Fanny; Raabe, Thomas; Jackson, F. Rob

2009-01-01

There is a universal requirement for post-translational regulatory mechanisms in circadian clock systems. Previous work in Drosophila has identified several kinases, phosphatases and an E3 ligase that are critical for determining the nuclear translocation and/or stability of clock proteins. The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. In mammals, RSK1 is a light- and clock-regulated kinase known to be activated by the MAPK pathway, but there is no direct evidence that it functions as a component of the circadian system. Here, we show that Drosophila S6KII RNA displays rhythms in abundance, indicative of circadian control. Importantly, an S6KII null mutant exhibits a short-period circadian phenotype that can be rescued by expression of the wild-type gene in clock neurons, indicating a role for S6KII in the molecular oscillator. Peak PER clock protein expression is elevated in the mutant, indicative of enhanced stability, whereas per mRNA level is decreased, consistent with enhanced feedback repression. Gene reporter assays show that decreased S6KII is associated with increased PER repression. Surprisingly, we demonstrate a physical interaction between S6KII and the Casein Kinase 2 regulatory subunit (CK2β), suggesting a functional relationship between the two kinases. In support of such a relationship, there are genetic interactions between S6KII and CK2 mutations, in vivo, which indicate that CK2 activity is required for S6KII action. We propose that the two kinases cooperate within clock neurons to fine-tune circadian period, improving the precision of the clock mechanism. PMID:19144847

Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans.

Science.gov (United States)

Chowdhury, Tahmeena; Köhler, Julia R

2015-10-01

TOR and PKA signaling pathways control eukaryotic cell growth and proliferation. TOR activity in model fungi, such as Saccharomyces cerevisiae, responds principally to nutrients, e.g., nitrogen and phosphate sources, which are incorporated into the growing cell mass; PKA signaling responds to the availability of the cells' major energy source, glucose. In the fungal commensal and pathogen, Candida albicans, little is known of how these pathways interact. Here, the signal from phosphorylated ribosomal protein S6 (P-S6) was defined as a surrogate marker for TOR-dependent anabolic activity in C. albicans. Nutritional, pharmacologic and genetic modulation of TOR activity elicited corresponding changes in P-S6 levels. The P-S6 signal corresponded to translational activity of a GFP reporter protein. Contributions of four PKA pathway components to anabolic activation were then examined. In high glucose concentrations, only Tpk2 was required to upregulate P-S6 to physiologic levels, whereas all four tested components were required to downregulate P-S6 in low glucose. TOR was epistatic to PKA components with respect to P-S6. In many host niches inhabited by C. albicans, glucose is scarce, with protein being available as a nitrogen source. We speculate that PKA may modulate TOR-dependent cell growth to a rate sustainable by available energy sources, when monomers of anabolic processes, such as amino acids, are abundant. © 2015 John Wiley & Sons Ltd.

Comparative Immunohistochemical Analysis of Ochratoxin A Tumourigenesis in Rats and Urinary Tract Carcinoma in Humans; Mechanistic Significance of p-S6 Ribosomal Protein Expression

Directory of Open Access Journals (Sweden)

Sarah Pinder

2012-09-01

Full Text Available Ochratoxin A (OTA is considered to be a possible human urinary tract carcinogen, based largely on a rat model, but no molecular genetic changes in the rat carcinomas have yet been defined. The phosphorylated-S6 ribosomal protein is a marker indicating activity of the mammalian target of rapamycin, which is a serine/threonine kinase with a key role in protein biosynthesis, cell proliferation, transcription, cellular metabolism and apoptosis, while being functionally deregulated in cancer. To assess p-S6 expression we performed immunohistochemistry on formalin-fixed and paraffin-embedded tumours and normal tissues. Marked intensity of p-S6 expression was observed in highly proliferative regions of rat renal carcinomas and a rare angiosarcoma, all of which were attributed to prolonged exposure to dietary OTA. Only very small OTA-generated renal adenomas were negative for p-S6. Examples of rat subcutaneous fibrosarcoma and testicular seminoma, as well as of normal renal tissue, showed no or very weak positive staining. In contrast to the animal model, human renal cell carcinoma, upper urinary tract transitional cell carcinoma from cases of Balkan endemic nephropathy, and a human angiosarcoma were negative for p-S6. The combined findings are reminiscent of constitutive changes in the rat tuberous sclerosis gene complex in the Eker strain correlated with renal neoplasms, Therefore rat renal carcinogenesis caused by OTA does not obviously mimic human urinary tract tumourigenesis.

The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition.

Science.gov (United States)

Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo

2017-01-17

Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

p70S6 kinase signals cell survival as well as growth, inactivating the pro-apoptotic molecule BAD

DEFF Research Database (Denmark)

Harada, H; Andersen, Jens S.; Mann, M

2001-01-01

Cytokines often deliver simultaneous, yet distinct, cell growth and cell survival signals. The 70-kDa ribosomal protein S6 kinase (p70S6K) is known to regulate cell growth by inducing protein synthesis components. We purified membrane-based p70S6K as a kinase responsible for site-specific phospho...

RPS6KA2, a putative tumour suppressor gene at 6q27 in sporadic epithelial ovarian cancer

DEFF Research Database (Denmark)

Bignone, P A; Lee, K Y; Liu, Y

2007-01-01

We had previously defined by allele loss studies a minimal region at 6q27 (between D6S264 and D6S297) to contain a putative tumour suppressor gene. The p90 ribosomal S6 kinase-3 gene (p90 Rsk-3, RPS6KA2) maps in this interval. It is a serine-threonine kinase that signals downstream of the mitogen...

Crystallization of ribosomes from Thermus thermophilus

International Nuclear Information System (INIS)

Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

1987-01-01

An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1997-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

Energy Technology Data Exchange (ETDEWEB)

Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung

1998-12-31

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

The complete structure of the chloroplast 70S ribosome in complex with translation factor pY.

Science.gov (United States)

Bieri, Philipp; Leibundgut, Marc; Saurer, Martin; Boehringer, Daniel; Ban, Nenad

2017-02-15

Chloroplasts are cellular organelles of plants and algae that are responsible for energy conversion and carbon fixation by the photosynthetic reaction. As a consequence of their endosymbiotic origin, they still contain their own genome and the machinery for protein biosynthesis. Here, we present the atomic structure of the chloroplast 70S ribosome prepared from spinach leaves and resolved by cryo-EM at 3.4 Å resolution. The complete structure reveals the features of the 4.5S rRNA, which probably evolved by the fragmentation of the 23S rRNA, and all five plastid-specific ribosomal proteins. These proteins, required for proper assembly and function of the chloroplast translation machinery, bind and stabilize rRNA including regions that only exist in the chloroplast ribosome. Furthermore, the structure reveals plastid-specific extensions of ribosomal proteins that extensively remodel the mRNA entry and exit site on the small subunit as well as the polypeptide tunnel exit and the putative binding site of the signal recognition particle on the large subunit. The translation factor pY, involved in light- and temperature-dependent control of protein synthesis, is bound to the mRNA channel of the small subunit and interacts with 16S rRNA nucleotides at the A-site and P-site, where it protects the decoding centre and inhibits translation by preventing tRNA binding. The small subunit is locked by pY in a non-rotated state, in which the intersubunit bridges to the large subunit are stabilized. © 2016 The Authors. Published under the terms of the CC BY NC ND 4.0 license.

The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6.

Science.gov (United States)

Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian

2016-01-01

Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

International Nuclear Information System (INIS)

Burkhardt, N.

1997-01-01

Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

Directory of Open Access Journals (Sweden)

Mikael S Lindström

Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

Induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway delays the initiation but fails to eradicate established murine acute myeloid leukemia.

Science.gov (United States)

Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D

2017-01-01

Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.

Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32

Science.gov (United States)

Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto

2011-01-01

Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

Interleukin 6 downregulates p53 expression and activity by stimulating ribosome biogenesis: a new pathway connecting inflammation to cancer

Science.gov (United States)

Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M

2014-01-01

Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714

5S rRNA and ribosome.

Science.gov (United States)

Gongadze, G M

2011-12-01

5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

A hexane fraction of guava Leaves (Psidium guajava L.) induces anticancer activity by suppressing AKT/mammalian target of rapamycin/ribosomal p70 S6 kinase in human prostate cancer cells.

Science.gov (United States)

Ryu, Nae Hyung; Park, Kyung-Ran; Kim, Sung-Moo; Yun, Hyung-Mun; Nam, Dongwoo; Lee, Seok-Geun; Jang, Hyeung-Jin; Ahn, Kyoo Seok; Kim, Sung-Hoon; Shim, Bum Sang; Choi, Seung-Hoon; Mosaddik, Ashik; Cho, Somi K; Ahn, Kwang Seok

2012-03-01

This study was carried out to evaluate the anticancer effects of guava leaf extracts and its fractions. The chemical compositions of the active extracts were also determined. In the present study, we set out to determine whether the anticancer effects of guava leaves are linked with their ability to suppress constitutive AKT/mammalian target of rapamycin (mTOR)/ribosomal p70 S6 kinase (S6K1) and mitogen-activated protein kinase (MAPK) activation pathways in human prostate cancer cells. We found that guava leaf hexane fraction (GHF) was the most potent inducer of cytotoxic and apoptotic effects in PC-3 cells. The molecular mechanism or mechanisms of GHF apoptotic potential were correlated with the suppression of AKT/mTOR/S6K1 and MAPK signaling pathways. This effect of GHF correlated with down-regulation of various proteins that mediate cell proliferation, cell survival, metastasis, and angiogenesis. Analysis of GHF by gas chromatography and gas chromatography-mass spectrometry tentatively identified 60 compounds, including β-eudesmol (11.98%), α-copaene (7.97%), phytol (7.95%), α-patchoulene (3.76%), β-caryophyllene oxide (CPO) (3.63%), caryophylla-3(15),7(14)-dien-6-ol (2.68%), (E)-methyl isoeugenol (1.90%), α-terpineol (1.76%), and octadecane (1.23%). Besides GHF, CPO, but not phytol, also inhibited the AKT/mTOR/S6K1 signaling pathway and induced apoptosis in prostate cancer cells. Overall, these findings suggest that guava leaves can interfere with multiple signaling cascades linked with tumorigenesis and provide a source of potential therapeutic compounds for both the prevention and treatment of cancer.

Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

Science.gov (United States)

Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

1979-01-01

The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate.

Science.gov (United States)

Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

2016-09-27

Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate

Science.gov (United States)

Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo

2016-01-01

Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

DEFF Research Database (Denmark)

Tchórzewski, M; Boldyreff, B; Issinger, O

2000-01-01

The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

DEFF Research Database (Denmark)

Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech

2003-01-01

The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

IL-6 Impairs Myogenic Differentiation by Downmodulation of p90RSK/eEF2 and mTOR/p70S6K Axes, without Affecting AKT Activity

Directory of Open Access Journals (Sweden)

Michele Pelosi

2014-01-01

Full Text Available IL-6 is a multifaceted pleiotropic cytokine, which is produced by a variety of cell types and targets different cells and tissues. In physiological conditions, IL-6 can be locally and transiently produced by skeletal muscle and plays an important role in muscle homeostasis. Circulating IL-6 levels are normally very low or undetectable but are dramatically increased in several pathologic conditions. In this study, we aimed to define the potential molecular mechanisms underlying the effects of IL-6 on myogenic program. We explored the molecular mechanisms through which exogenous IL-6, or the conditioned medium from the murine C-26 adenocarcinoma cells (a cellular model that secretes high levels of IL-6 and induces cancer cachexia in mice, interferes with the myogenic program. Our study revealed that IL-6 induces the activation of the Stat3 signaling and promotes the downmodulation of the p90RSK/eEF2 and mTOR/p70S6K axes, while it does not affect the activation of AKT. We thus identified potential molecular mediators of the inhibitory effects of IL-6 on myogenic program.

Mice deficient in ribosomal protein S6 phosphorylation suffer from muscle weakness that reflects a growth defect and energy deficit.

Directory of Open Access Journals (Sweden)

Igor Ruvinsky

Full Text Available BACKGROUND: Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-, are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. METHODOLOGY/PRINCIPAL FINDINGS: A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/- muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG in the muscle. CONCLUSIONS/SIGNIFICANCE: This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar

Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

International Nuclear Information System (INIS)

Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

2005-01-01

Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

Phosphorylation of Ribosomal Protein S6 Mediates Mammalian Target of Rapamycin Complex 1-Induced Parathyroid Cell Proliferation in Secondary Hyperparathyroidism.

Science.gov (United States)

Volovelsky, Oded; Cohen, Gili; Kenig, Ariel; Wasserman, Gilad; Dreazen, Avigail; Meyuhas, Oded; Silver, Justin; Naveh-Many, Tally

2016-04-01

Secondary hyperparathyroidism is characterized by increased serum parathyroid hormone (PTH) level and parathyroid cell proliferation. However, the molecular pathways mediating the increased parathyroid cell proliferation remain undefined. Here, we found that the mTOR pathway was activated in the parathyroid of rats with secondary hyperparathyroidism induced by either chronic hypocalcemia or uremia, which was measured by increased phosphorylation of ribosomal protein S6 (rpS6), a downstream target of the mTOR pathway. This activation correlated with increased parathyroid cell proliferation. Inhibition of mTOR complex 1 by rapamycin decreased or prevented parathyroid cell proliferation in secondary hyperparathyroidism rats and in vitro in uremic rat parathyroid glands in organ culture. Knockin rpS6(p-/-) mice, in which rpS6 cannot be phosphorylated because of substitution of all five phosphorylatable serines with alanines, had impaired PTH secretion after experimental uremia- or folic acid-induced AKI. Uremic rpS6(p-/-) mice had no increase in parathyroid cell proliferation compared with a marked increase in uremic wild-type mice. These results underscore the importance of mTOR activation and rpS6 phosphorylation for the pathogenesis of secondary hyperparathyroidism and indicate that mTORC1 is a significant regulator of parathyroid cell proliferation through rpS6. Copyright © 2016 by the American Society of Nephrology.

The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

Science.gov (United States)

Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

2016-08-15

Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Science.gov (United States)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

2011-07-01

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

Energy Technology Data Exchange (ETDEWEB)

Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B., E-mail: garber@vega.protres.ru [Institute of Protein Research RAS (Russian Federation)

2011-07-15

Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

Post-transcriptional gene silencing of ribosomal protein S6 kinase 1 restores insulin action in leucine-treated skeletal muscle

DEFF Research Database (Denmark)

Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S

2009-01-01

Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....

The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2.

Science.gov (United States)

Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G

2011-05-01

The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

Perturbation of Ribosome Biogenesis Drives Cells into Senescence through 5S RNP-Mediated p53 Activation

Directory of Open Access Journals (Sweden)

Kazuho Nishimura

2015-03-01

Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

Molecular Characterization and Expression Analysis of S6K1 in Cashmere Goats (

Directory of Open Access Journals (Sweden)

Wu Manlin

2013-08-01

Full Text Available p70 ribosomal S6 kinase (p70S6K can integrate nutrient and growth factor signals to promote cell growth and survival. We report our molecular characterization of the complementary DNA (cDNA that encodes the goat p70S6K gene 40S ribosomal S6 kinase 1 (S6K1 (GenBank accession GU144017 and its 3′ noncoding sequence in Inner Mongolia Cashmere goats (Capra hircus. Goat S6K1 cDNA was 2,272 bp and include an open reading frame (ORF of 1,578 bp, corresponding to a polypeptide of 525 amino acids, and a 694-residue 3′ noncoding sequence with a polyadenylation signal at nucleotides 2,218 to 2,223. The relative abundance of S6K1 mRNA was measured by real-time PCR in 6 tissues, and p70S6K expression was examined by immunohistochemistry in heart and testis. The phosphorylation of p70S6K is regulated by mitogen-activated protein kinase (MAPK signaling in fetal fibroblasts.

Rrp12 and the Exportin Crm1 participate in late assembly events in the nucleolus during 40S ribosomal subunit biogenesis.

Science.gov (United States)

Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

2014-12-01

During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.

Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

Energy Technology Data Exchange (ETDEWEB)

Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

2015-09-18

The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

DEFF Research Database (Denmark)

Grankowski, N; Gasior, E; Issinger, O G

1993-01-01

Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

Association between PI3K/Akt/mTOR/p70S6K signaling pathway and hepatic fibrosis

Directory of Open Access Journals (Sweden)

WU Changhui

2015-11-01

Full Text Available Phosphoinositide 3-kinase (PI3K/protein kinase-B (AkT/mammalian target of rapamycin (mTOR/70-kDa ribosomal protein S6 kinase (p70S6K, PI3K/Akt/mTOR/p70S6K, is an important signaling pathway in the life activities of cells, and it plays an important role in promoting the growth, proliferation, invasion, and anti-apoptosis of cells and promoting angiogenesis. It was clarified that the PI3K/Akt/mTOR/p70S6K signaling pathway is involved in regulating the activities of hepatic stellate cell(HSC, thus influencing the development and progression of hepatic fibrosis. Analysis demonstrated that blocking any target of the PI3K/Akt/mTOR/p70S6K signaling pathway can inhibit the activation and proliferation of HSC, promote the apoptosis of HSC, inhibit the extracellular matrix secretion from HSC, and delay the progression of hepatic fibrosis. Blocking the pathway is expected to be a treatment strategy for hepatic fibrosis.

Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

Science.gov (United States)

Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

2015-03-03

The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Tobacco etch virus protein P1 traffics to the nucleolus and associates with the host 60S ribosomal subunits during infection.

Science.gov (United States)

Martínez, Fernando; Daròs, José-Antonio

2014-09-01

The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly

The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins.

Science.gov (United States)

Kimura, J; Kimura, M

1987-09-05

The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

Science.gov (United States)

Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

2015-01-13

Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

Targeting Aberrant p70S6K Activation for Estrogen Receptor-Negative Breast Cancer Prevention.

Science.gov (United States)

Wang, Xiao; Yao, Jun; Wang, Jinyang; Zhang, Qingling; Brady, Samuel W; Arun, Banu; Seewaldt, Victoria L; Yu, Dihua

2017-11-01

The prevention of estrogen receptor-negative (ER-) breast cancer remains a major challenge in the cancer prevention field, although antiestrogen and aromatase inhibitors have shown adequate efficacy in preventing estrogen receptor-positive (ER + ) breast cancer. Lack of commonly expressed, druggable targets is a major obstacle for meeting this challenge. Previously, we detected the activation of Akt signaling pathway in atypical hyperplasic early-stage lesions of patients. In the current study, we found that Akt and the downstream 70 kDa ribosomal protein S6 kinase (p70S6K) signaling pathway was highly activated in ER - premalignant breast lesions and ER - breast cancer. In addition, p70S6K activation induced transformation of ER - human mammary epithelial cells (hMEC). Therefore, we explored the potential of targeting Akt/p70S6K in the p70S6K activated, ER - hMEC models and mouse mammary tumor models for the prevention of ER - breast cancer. We found that a clinically applicable Akt/p70S6K dual inhibitor, LY2780301, drastically decreased proliferation of hMECs with ErbB2-induced p70S6K activation via Cyclin B1 inhibition and cell-cycle blockade at G 0 -G 1 phase, while it did not significantly reverse the abnormal acinar morphology of these hMECs. In addition, a brief treatment of LY2780301 in MMTV- neu mice that developed atypical hyperplasia (ADH) and mammary intraepithelial neoplasia (MIN) lesions with activated p70S6K was sufficient to suppress S6 phosphorylation and decrease cell proliferation in hyperplasic MECs. In summary, targeting the aberrant Akt/p70S6K activation in ER - hMEC models in vitro and in the MMTV- neu transgenic mouse model in vivo effectively inhibited Akt/S6K signaling and reduced proliferation of hMECs in vitro and ADH/MIN lesions in vivo , indicating its potential in prevention of p70S6K activated ER - breast cancer. Cancer Prev Res; 10(11); 641-50. ©2017 AACR . ©2017 American Association for Cancer Research.

The 4p-5d, 6d and 4p-6s, 7s transitions of Mo IX

International Nuclear Information System (INIS)

Khatoon, S.; Chaghtai, M.S.Z.; Rahimullah, K.

1979-01-01

The transitions 4p-5d, 6d and 4p-6s, 7s have been studied for the first time in Mo IX. The authors have identified 42 4p-5d, 36 4p-6d, 22 4p-6s and 22 4p-7s transitions, establishing 16 4p 3 5d, 14 4p 3 6d and all the ten 4p 3 6s, 7s levels of the spectrum concerned. The ionization energy is estimated to be (1 323 700 +- 700)cm -1 or (164.11 +- 0.09)eV. The spectrum was recorded in sliding and open spark discharges with a 5 m grazing incidence spectrograph of Lund University (Sweden) from about 40 A to 440 A. (Auth.)

Spectral analysis of 5s25p2(6p+6d+7s) configurations of Ba VI

International Nuclear Information System (INIS)

Sharma, M.K.; Tauheed, A.; Rahimullah, K.

2014-01-01

The sixth spectrum of barium (Ba VI) has been investigated with the aid of experimental recordings made on a 3-m normal incidence vacuum spectrograph of Antigonish laboratory (Canada) in the wavelength region 300–2080 Å using triggered spark as an excitation source. The spectral analysis has been extended considerably to include new configuration the 5s 2 5p 2 6p in odd parity matrix and the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations in even parity matrix. Previously reported levels of the ground configuration (5s 2 5p 3 ) and three lowest excited configurations the 5s5p 4 , 5s 2 5p 2 5d and 5s 2 5p 2 6s have been confirmed and the two unknown levels of the 5s 2 5p 2 5d configuration with J=9/2, have now been established through the identification of transitions from the 5s 2 5p 2 6p levels. All twenty one levels of the 5s 2 5p 2 6p configuration and twenty nine levels out of thirty six of the 5s 2 5p 2 6d and 5s 2 5p 2 7s configurations have now been established. Hartree–Fock calculations involving configuration interactions support the analyses. The accuracy of our wavelength measurement is ±0.005 Å for sharp lines. - Highlights: • The spectrum of Ba was recorded on a 3-m spectrograph with triggered spark source. • Atomic transitions for Ba VI were identified to established new energy levels. • CI calculations with relativistic corrections were made for theoretical predictions. • Weighted oscillator strength (gf) and transition probabilities (gA) were calculated

HSP90 inhibitors potentiate PGF2α-induced IL-6 synthesis via p38 MAP kinase in osteoblasts.

Directory of Open Access Journals (Sweden)

Kazuhiko Fujita

Full Text Available Heat shock protein 90 (HSP90 that is ubiquitously expressed in various tissues, is recognized to be a major molecular chaperone. We have previously reported that prostaglandin F2α (PGF2α, a potent bone remodeling mediator, stimulates the synthesis of interleukin-6 (IL-6 through p44/p42 mitogen-activated protein (MAP kinase and p38 MAP kinase in osteoblast-like MC3T3-E1 cells, and that Rho-kinase acts at a point upstream of p38 MAP kinase. In the present study, we investigated the involvement of HSP90 in the PGF2α-stimulated IL-6 synthesis and the underlying mechanism in MC3T3-E1 cells. Geldanamycin, an inhibitor of HSP90, significantly amplified both the PGF2α-stimulated IL-6 release and the mRNA expression levels. In addition, other HSP90 inhibitors, 17-allylamino-17demethoxy-geldanamycin (17-AAG and 17-dimethylamino-ethylamino-17-demethoxy-geldanamycin (17-DMAG and onalespib, enhanced the PGF2α-stimulated IL-6 release. Geldanamycin, 17-AAG and onalespib markedly strengthened the PGF2α-induced phosphorylation of p38 MAP kinase. Geldanamycin and 17-AAG did not affect the PGF2α-induced phosphorylation of p44/p42 MAP kinase and myosin phosphatase targeting subunit (MYPT-1, a substrate of Rho-kinase, and the protein levels of RhoA and Rho-kinase. In addition, HSP90-siRNA enhanced the PGF2α-induced phosphorylation of p38 MAP kinase. Furthermore, SB203580, an inhibitor of p38 MAP kinase, significantly suppressed the amplification by geldanamycin, 17-AAG or 17-DMAG of the PGF2α-stimulated IL-6 release. Our results strongly suggest that HSP90 negatively regulates the PGF2α-stimulated IL-6 synthesis in osteoblasts, and that the effect of HSP90 is exerted through regulating p38 MAP kinase activation.

Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

Science.gov (United States)

Kimura, M; Kimura, J; Hatakeyama, T

1988-11-21

The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

2015-04-17

Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice

Directory of Open Access Journals (Sweden)

Mark A. Smith

2015-04-01

Full Text Available Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC and agouti-related protein (AgRP neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons.

A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli.

Science.gov (United States)

Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R

2014-10-14

Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

Science.gov (United States)

Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

2012-02-01

Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

DEFF Research Database (Denmark)

Issinger, O G

1977-01-01

Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

Processing of the 17-S Escherichia coli precursor RNA in the 27-S pre-ribosomal particle

Energy Technology Data Exchange (ETDEWEB)

Hayes, F; Vasseur, M [Institut de Biologie Physico-Chimique, 75 - Paris (France)

1976-01-01

An RNase activity probably involved in the maturation of 16-S pre-ribosomal RNA in Escherichia coli has been partially purified from crude cell extracts. When 27-S ribosome precursor particles are incubated with this enzyme preparation in vitro, their 17-S RNA is converted to a product with the same electrophoretic mobility as mature 16-S rRNA. FingerprS rRNA. Generation of the normal 5'-P terminus seems to require a factor present in cell extracts since incubation of the 27-S precursor particle in an extract obtained after centrifugation at 30,000 x g causes conversion of the 17-S RNA to a 16-S species containing both termini of mature 16-S rRNS. Preliminary experiments suggest that correct maturation of the 5' end of the 17-S precursor RNA requires a system in which protein synthesis can take place.

Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice.

Science.gov (United States)

Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun

2016-07-01

Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.

Tungsten phosphanylarylthiolato complexes [W{PhP(2-SC6H4)2-kappa3S,S',P} 2] and [W{P(2-SC6H4)3-kappa4S,S',S",P}2]: synthesis, structures and redox chemistry.

Science.gov (United States)

Hildebrand, Alexandra; Lönnecke, Peter; Silaghi-Dumitrescu, Luminita; Hey-Hawkins, Evamarie

2008-09-14

PhP(2-SHC6H4)2 (PS2H2) reacts with WCl6 with reduction of tungsten to give the air-sensitive tungsten(IV) complex [W{PhP(2-SC6H4)2-kappa(3)S,S',P}2] (1). 1 is oxidised in air to [WO{PhPO(2-SC6H4)2-kappa(3)S,S',O}{PhP(2-SC6H4)2-kappa(3)S,S',P}] (2). The attempted synthesis of 2 by reaction of 1 with iodosobenzene as oxidising agent was unsuccessful. [W{P(2-SC6H4)3-kappa(4)S,S',S",P}2] (3) was formed in the reaction of P(2-SHC6H4)3 (PS3H3) with WCl6. The W(VI) complex 3 contains two PS3(3-) ligands, each coordinated in a tetradentate fashion resulting in a tungsten coordination number of eight. The reaction of 3 with AgBF4 yields the dinuclear tungsten complex [W2{P(2-SC6H4)3-kappa(4)S,S',S",P}3]BF4 (4). Complexes 1-4 were characterised by spectral methods and X-ray structure determination.

Altered Regulation of Contraction-Induced Akt/mTOR/p70S6k Pathway Signaling in Skeletal Muscle of the Obese Zucker Rat

Directory of Open Access Journals (Sweden)

Anjaiah Katta

2009-01-01

Full Text Available Increased muscle loading results in the phosphorylation of the 70 kDa ribosomal S6 kinase (p70S6k, and this event is strongly correlated with the degree of muscle adaptation following resistance exercise. Whether insulin resistance or the comorbidities associated with this disorder may affect the ability of skeletal muscle to activate p70S6k signaling following an exercise stimulus remains unclear. Here, we compare the contraction-induced activation of p70S6k signaling in the plantaris muscles of lean and insulin resistant obese Zucker rats following a single bout of increased contractile loading. Compared to lean animals, the basal phosphorylation of p70S6k (Thr389; 37.2% and Thr421/Ser424; 101.4%, Akt (Thr308; 25.1%, and mTOR (Ser2448; 63.0% was higher in obese animals. Contraction increased the phosphorylation of p70S6k (Thr389, Akt (Ser473, and mTOR (Ser2448 in both models however the magnitude and kinetics of activation differed between models. These results suggest that contraction-induced activation of p70S6k signaling is altered in the muscle of the insulin resistant obese Zucker rat.

Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice.

Science.gov (United States)

Smith, Mark A; Katsouri, Loukia; Irvine, Elaine E; Hankir, Mohammed K; Pedroni, Silvia M A; Voshol, Peter J; Gordon, Matthew W; Choudhury, Agharul I; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J

2015-04-21

Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

[Protein kinase A inhibitor H-89 blocks polyploidization of SP600125-induced CMK cells by regulating phosphorylation of ribosomal protein S6 kinase 1].

Science.gov (United States)

Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu

2016-10-01

Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.

Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

Directory of Open Access Journals (Sweden)

Anirban Chakraborty

Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

Science.gov (United States)

Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

2016-04-15

We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

5SRNAdb: an information resource for 5S ribosomal RNAs.

Science.gov (United States)

Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

2016-01-04

Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Complete Structure of the Mycobacterium smegmatis 70S Ribosome.

Science.gov (United States)

Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

2017-07-05

The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

KAUST Repository

Zhao, Huayan

2015-08-13

The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

The Arabidopsis gene DIG6 encodes a large 60S subunit nuclear export GTPase 1 that is involved in ribosome biogenesis and affects multiple auxin-regulated development processes

KAUST Repository

Zhao, Huayan; Lü , Shiyou; Li, Ruixi; Chen, Tao; Zhang, Huoming; Cui, Peng; Ding, Feng; Liu, Pei; Wang, Guangchao; Xia, Yiji; Running, Mark P.; Xiong, Liming

2015-01-01

The circularly permuted GTPase large subunit GTPase 1 (LSG1) is involved in the maturation step of the 60S ribosome and is essential for cell viability in yeast. Here, an Arabidopsis mutant dig6 (drought inhibited growth of lateral roots) was isolated. The mutant exhibited multiple auxin-related phenotypes, which included reduced lateral root number, altered leaf veins, and shorter roots. Genetic mapping combined with next-generation DNA sequencing identified that the mutation occurred in AtLSG1-2. This gene was highly expressed in regions of auxin accumulation. Ribosome profiling revealed that a loss of function of AtLSG1-2 led to decreased levels of monosomes, further demonstrating its role in ribosome biogenesis. Quantitative proteomics showed that the expression of certain proteins involved in ribosome biogenesis was differentially regulated, indicating that ribosome biogenesis processes were impaired in the mutant. Further investigations showed that an AtLSG1-2 deficiency caused the alteration of auxin distribution, response, and transport in plants. It is concluded that AtLSG1-2 is integral to ribosome biogenesis, consequently affecting auxin homeostasis and plant development.

Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

International Nuclear Information System (INIS)

Gorelic, L.; Parker, D.

1978-01-01

The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

sORFs.org: a repository of small ORFs identified by ribosome profiling.

Science.gov (United States)

Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

2016-01-04

With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent.

Science.gov (United States)

Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen

2016-07-01

Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

Science.gov (United States)

Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

2014-01-01

We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes.

Science.gov (United States)

Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L

2018-04-24

Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

Directory of Open Access Journals (Sweden)

Arava Yoav

2007-08-01

Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

IgD, cyclooxygenase-2 and ribosomal protein S6-PS240 immune response in a case of early psoriasis

Directory of Open Access Journals (Sweden)

Ana Maria Abreu Velez

2018-02-01

Full Text Available Psoriasis is an inflammatory skin disease. Five classic types of psoriasis have been defined: plaque, inverse, pustular, guttate, and erythrodermic. The early psoriasis immunologic skin immune response is not well understood. Here we aim to show an immune and cell signaling response in a case of early psoriasis. A 56 year old female presented with a desquamative lesion on her right leg. A skin biopsy for hematoxylin and eosin (H&E and immunohistochemistry (IHC staining was taken. The diagnosis indicated early psoriasis, and IHC showed positive IgD staining in the epidermal corneal layer, as well as positive staining with ribosomal protein S6-pS240 (RIBO in the hyperproliferative epidermis. Cyclooxygenase-2 (COX-2 was also very positive in the granular layer in spots, at the basement membrane zone of the skin and in the inflammatory infiltrate in the dermis subjacent to hyperproliferative psoriatic areas. In an early case of psoriasis, we confirmed the presence of IgD, RIBO and COX-2. Each molecule seems to be playing a role in inflammation and intracellular signaling pathways in early psoriasis. The role of IgD is unknown, and this case brings to light the complexity of the pathologic changes occurring in early psoriatic lesions.

Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.

Science.gov (United States)

Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L

2017-11-01

Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or

Architecture of the E.coli 70S ribosome

DEFF Research Database (Denmark)

Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.

1997-01-01

The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

Quasimolecular emission near the Xe(5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance lines induced by collisions with He atoms

Science.gov (United States)

Alekseeva, O. S.; Devdariani, A. Z.; Grigorian, G. M.; Lednev, M. G.; Zagrebin, A. L.

2017-02-01

This study is devoted to the theoretical investigation of the quasimolecular emission of Xe*-He and Kr*-He collision pairs near the Xe (5p 56s 1,3 P 1 - 5p 6 1 S 0) and Kr (4p 55s 1,3 P 1 - 4p 6 1 S 0) resonance atomic lines. The potential curves of the quasimolecules Xe(5p 56s) + He and Kr(4p 55s) + He have been obtained with the use of the effective Hamiltonian and pseudopotential methods. Based on these potential curves the processes of quasimolecular emission of Xe*+He and Kr*+He mixtures have been considered and the spectral distributions I(ħΔω) of photons emitted have been obtained in the framework of quasistatic approximation.

Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

Science.gov (United States)

Cukras, Anthony R; Green, Rachel

2005-05-27

The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Protein-protein interactions within late pre-40S ribosomes.

Directory of Open Access Journals (Sweden)

Melody G Campbell

2011-01-01

Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

Directory of Open Access Journals (Sweden)

Jendrik Hentschel

2017-07-01

Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis.

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad

2012-03-23

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis*

Science.gov (United States)

Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad

2012-01-01

The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

Defective ribosome assembly in Shwachman-Diamond syndrome.

Science.gov (United States)

Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

2011-10-20

Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

The 70S ribosome modulates the ATPase activity of Escherichia coli YchF.

Science.gov (United States)

Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim

2012-10-01

YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

Science.gov (United States)

Galián, J A; Rosato, M; Rosselló, J A

2012-06-01

In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

Role of the ribosomal P-site elements of m²G966, m⁵C967, and the S9 C-terminal tail in maintenance of the reading frame during translational elongation in Escherichia coli.

Science.gov (United States)

Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh

2013-08-01

The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.

The Phosphorylation of Ribosomal Protein in Lemna minor

Science.gov (United States)

Trewavas, A.

1973-01-01

Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

Directory of Open Access Journals (Sweden)

Kiran Hasygar

2014-11-01

Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

Science.gov (United States)

Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

2016-01-14

Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

Directory of Open Access Journals (Sweden)

Mona Hoppenrath

2010-10-01

Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

International Nuclear Information System (INIS)

Gravel, M.; Melancon, P.; Barkier-Gingras, L.

1987-01-01

[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

DEFF Research Database (Denmark)

Rosendahl, G; Douthwaite, S

1993-01-01

RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

Ribosomal proteins S12 and S13 function as control elements for translocation of the mRNA:tRNA complex.

Science.gov (United States)

Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel

2003-08-01

Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.

On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.

Science.gov (United States)

Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T

2009-10-09

The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

Yeast ribosomal proteins

International Nuclear Information System (INIS)

Otaka, E.; Kobata, K.

1978-01-01

The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

The 5s25p2 - (5s25p5d + 5s5p3 + 5s25p6s + 5s25p7s) transitions in Sb II and 5s25p - (5s5p2 + 5s2nl) transitions in Sb III

International Nuclear Information System (INIS)

Arcimowicz, B.; Joshi, Y.N.; Kaufman, V.

1989-01-01

The spectrum of antimony was photographed in the 575-2300 A region (1A 10 -10 m) using a hollow cathode and a triggered spark source. The analysis of the 5s 2 5p 2 - (5s 2 5p5d + 5s5p 3 + 5s 2 5p6s + 5s 2 5p7s) transitions in Sb II spectrum was revised and interpreted on the basis of multiconfiguration interaction calculations. Accurate wavelength measurements of Sb III lines lead to a revised ground-state 5s 2 5p 2 P interval value of 6574.5 cm -1 . (author). 15 refs., 9 tabs., 1 fig

Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.

Science.gov (United States)

Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel

2007-12-07

The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

DEFF Research Database (Denmark)

Richter, W W; Zang, K D; Issinger, O G

1983-01-01

Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Christensen, A; Garrett, R A

1982-01-01

The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

Science.gov (United States)

Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

2010-01-01

Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

5S ribosomal RNA database Y2K.

Science.gov (United States)

Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

2000-01-01

This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

Science.gov (United States)

Al-Hadid, Qais; White, Jonelle; Clarke, Steven

2016-02-12

A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

DEFF Research Database (Denmark)

Douthwaite, S; Garrett, R A

1981-01-01

The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

Science.gov (United States)

Delihas, N.; Fox, G. E.

1987-01-01

In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

Affinity labelling in situ of the bL12 protein on E. coli 70S ribosomes by means of a tRNA dialdehyde derivative.

Science.gov (United States)

Hountondji, Codjo; Créchet, Jean-Bernard; Le Caër, Jean-Pierre; Lancelot, Véronique; Cognet, Jean A H; Baouz, Soria

2017-12-01

In this report, we have used periodate-oxidized tRNA (tRNAox) as an affinity laleling reagent to demonstrate that: (i) the bL12 protein contacts the CCA-arm of P-site bound tRNA on the Escherichia coli 70S ribosomes; (ii) the stoichiometry of labelling is one molecule of tRNAox bound to one polypeptide chain of endogenous bL12; (iii) cross-linking in situ of bL12 with tRNAox on the ribosomes provokes the loss of activity; (iv) intact tRNA protects bL12 in the 70S ribosomes against cross-linking with tRNAox; (v) both tRNAox and pyridoxal 5'-phosphate (PLP) compete for the same or for proximal cross-linking site(s) on bL12 inside the ribosome; (vi) the stoichiometry of cross-linking of PLP to the recombinant E. coli bL12 protein is one molecule of PLP covalently bound per polypeptide chain; (vii) the amino acid residue of recombinant bL12 cross-linked with PLP is Lys-65; (viii) Lys-65 of E. coli bL12 corresponds to Lys-53 of eL42 which was previously shown to cross-link with P-site bound tRNAox on human 80S ribosomes in situ; (ix) finally, E. coli bL12 and human eL42 proteins display significant primary structure similarities, which argues for evolutionary conservation of these two proteins located at the tRNA-CCA binding site on eubacterial and eukaryal ribosomes. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

Science.gov (United States)

Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

1987-08-01

The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

Science.gov (United States)

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

Science.gov (United States)

Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

2015-10-06

The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

Effect of single base changes and the absence of modified bases in 16S RNA on the reconstitution and function of Escherichia coli 30S ribosomes

International Nuclear Information System (INIS)

Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.

1987-01-01

The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly

Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in signal transduction

DEFF Research Database (Denmark)

Frödin, M; Gammeltoft, S

1999-01-01

), which were among the first substrates of ERK to be discovered and which has proven to be a ubiquitous and versatile mediator of ERK signal transduction. RSK is composed of two functional kinase domains that are activated in a sequential manner by a series of phosphorylations. Recently, a family of RSK......-related kinases that are activated by ERK as well as p38 MAPK were discovered and named mitogen- and stress-activated protein kinases (MSK). A number of cellular functions of RSK have been proposed. (1) Regulation of gene expression via association and phosphorylation of transcriptional regulators including c...

Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

Science.gov (United States)

Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

2011-11-01

Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

DEFF Research Database (Denmark)

Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.

2009-01-01

In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

Role of p70S6K1-mediated phosphorylation of eIF4B and PDCD4 proteins in the regulation of protein synthesis.

Science.gov (United States)

Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R

2012-12-14

Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.

Antibodies to ribosomal P proteins of Trypanosoma cruzi in Chagas disease possess functional autoreactivity with heart tissue and differ from anti-P autoantibodies in lupus.

Science.gov (United States)

Kaplan, D; Ferrari, I; Bergami, P L; Mahler, E; Levitus, G; Chiale, P; Hoebeke, J; Van Regenmortel, M H; Levin, M J

1997-09-16

Anti-P antibodies present in sera from patients with chronic Chagas heart disease (cChHD) recognize peptide R13, EEEDDDMGFGLFD, which encompasses the C-terminal region of the Trypanosoma cruzi ribosomal P1 and P2 proteins. This peptide shares homology with the C-terminal region (peptide H13 EESDDDMGFGLFD) of the human ribosomal P proteins, which is in turn the target of anti-P autoantibodies in systemic lupus erythematosus (SLE), and with the acidic epitope, AESDE, of the second extracellular loop of the beta1-adrenergic receptor. Anti-P antibodies from chagasic patients showed a marked preference for recombinant parasite ribosomal P proteins and peptides, whereas anti-P autoantibodies from SLE reacted with human and parasite ribosomal P proteins and peptides to the same extent. A semi-quantitative estimation of the binding of cChHD anti-P antibodies to R13 and H13 using biosensor technology indicated that the average affinity constant was about 5 times higher for R13 than for H13. Competitive enzyme immunoassays demonstrated that cChHD anti-P antibodies bind to the acidic portions of peptide H13, as well as to peptide H26R, encompassing the second extracellular loop of the beta1 adrenoreceptor. Anti-P antibodies isolated from cChHD patients exert a positive chronotropic effect in vitro on cardiomyocytes from neonatal rats, which resembles closely that of anti-beta1 receptor antibodies isolated from the same patient. In contrast, SLE anti-P autoantibodies have no functional effect. Our results suggest that the adrenergic-stimulating activity of anti-P antibodies may be implicated in the induction of functional myocardial impairments observed in cChHD.

The ribosome-bound chaperones RAC and Ssb1/2p are required for accurate translation in Saccharomyces cerevisiae.

Science.gov (United States)

Rakwalska, Magdalena; Rospert, Sabine

2004-10-01

The chaperone homologs RAC (ribosome-associated complex) and Ssb1/2p are anchored to ribosomes; Ssb1/2p directly interacts with nascent polypeptides. The absence of RAC or Ssb1/2p results in a similar set of phenotypes, including hypersensitivity against the aminoglycoside paromomycin, which binds to the small ribosomal subunit and compromises the fidelity of translation. In order to understand this phenomenon we measured the frequency of translation termination and misincorporation in vivo and in vitro with a novel reporter system. Translational fidelity was impaired in the absence of functional RAC or Ssb1/2p, and the effect was further enhanced by paromomycin. The mutant strains suffered primarily from a defect in translation termination, while misincorporation was compromised to a lesser extent. Consistently, a low level of soluble translation termination factor Sup35p enhanced growth defects in the mutant strains. Based on the combined data we conclude that RAC and Ssb1/2p are crucial in maintaining translational fidelity beyond their postulated role as chaperones for nascent polypeptides.

Characterization of the regions from E. coli 16 S RNA covalently linked to ribosomal proteins S4 and S20 after ultraviolet irradiation

International Nuclear Information System (INIS)

Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.

1977-01-01

The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes

Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18

Science.gov (United States)

Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan

2011-01-01

5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA.

Science.gov (United States)

Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R

2008-02-22

The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

Erythroblast differentiation at spleen in Q137E mutant ribosomal protein S19 gene knock-in C57BL/6J mice.

Science.gov (United States)

Yamanegi, Koji; Yamada, Naoko; Nakasho, Keiji; Nishiura, Hiroshi

2018-01-01

We recently found that erythroblast-like cells derived from human leukaemia K562 cells express C5a receptor (C5aR) and produce its antagonistic and agonistic ligand ribosomal protein S19 (RP S19) polymer, which is cross-linked between K122 and Q137 by tissue transglutaminases. RP S19 polymer binds to the reciprocal C5aRs on erythroblast-like cells and macrophage-like cells derived from human monocytic THP-1 cells and promotes differentiation into reticulocyte-like cells through enucleation in vitro. To examine the roles of RP S19 polymer in mouse erythropoiesis, we prepared Q137E mutant RP S19 gene knock-in C57BL/6J mice. In contrast to wild-type mice, erythroblast numbers at the preliminary stage (CD71 high /TER119 low ) in spleen based on transferrin receptor (CD71) and glycophorin A (TER119) values and erythrocyte numbers in orbital artery bloods were not largely changed in knock-in mice. Conversely, erythroblast numbers at the early stage (CD71 high /TER119 high ) were significantly decreased in spleen by knock-in mice. The reduction of early erythroblast numbers in spleen was enhanced by the phenylhydrazine-induced pernicious anemia model knock-in mice and was rescued by a functional analogue of RP S19 dimer S-tagged C5a/RP S19. These data indicated that RP S19 polymer plays the roles in the early erythroblast differentiation of C57BL/6J mouse spleen. Copyright © 2017 Elsevier GmbH. All rights reserved.

Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

Science.gov (United States)

Llanos, Susana; Serrano, Manuel

2010-10-01

Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

Directory of Open Access Journals (Sweden)

Gisela Pöll

Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

[Family of ribosomal proteins S1 contains unique conservative domain].

Science.gov (United States)

Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

2010-01-01

Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

Science.gov (United States)

Poirot, Olivier; Timsit, Youri

2016-05-01

From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

Period1 gates the circadian modulation of memory-relevant signaling in mouse hippocampus by regulating the nuclear shuttling of the CREB kinase pP90RSK.

Science.gov (United States)

Rawashdeh, Oliver; Jilg, Antje; Maronde, Erik; Fahrenkrug, Jan; Stehle, Jörg H

2016-09-01

Memory performance varies over a 24-h day/night cycle. While the detailed underlying mechanisms are yet unknown, recent evidence suggests that in the mouse hippocampus, rhythmic phosphorylation of mitogen-activated protein kinase (MAPK) and cyclic adenosine monophosphate response element-binding protein (CREB) are central to the circadian (~ 24 h) regulation of learning and memory. We recently identified the clock protein PERIOD1 (PER1) as a vehicle that translates information encoding time of day to hippocampal plasticity. We here elaborate how PER1 may gate the sensitivity of memory-relevant hippocampal signaling pathways. We found that in wild-type mice (WT), spatial learning triggers CREB phosphorylation only during the daytime, and that this effect depends on the presence of PER1. The time-of-day-dependent induction of CREB phosphorylation can be reproduced pharmacologically in acute hippocampal slices prepared from WT mice, but is absent in preparations made from Per1-knockout (Per1(-/-) ) mice. We showed that the PER1-dependent CREB phosphorylation is regulated downstream of MAPK. Stimulation of WT hippocampal neurons triggered the co-translocation of PER1 and the CREB kinase pP90RSK (pMAPK-activated ribosomal S6 kinase) into the nucleus. In hippocampal neurons from Per1(-/-) mice, however, pP90RSK remained perinuclear. A co-immunoprecipitation assay confirmed a high-affinity interaction between PER1 and pP90RSK. Knocking down endogenous PER1 in hippocampal cells inhibited adenylyl cyclase-dependent CREB activation. Taken together, the PER1-dependent modulation of cytoplasmic-to-nuclear signaling in the murine hippocampus provides a molecular explanation for how the circadian system potentially shapes a temporal framework for daytime-dependent memory performance, and adds a novel facet to the versatility of the clock gene protein PER1. We provide evidence that the circadian clock gene Period1 (Per1) regulates CREB phosphorylation in the mouse hippocampus

Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates.

Science.gov (United States)

Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S

2004-12-01

The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

Subcellular localization of Bombyx mori ribosomal protein S3a and ...

African Journals Online (AJOL)

USER

2010-04-05

Apr 5, 2010 ... In the present study, using a BV/PH-Bms3a-EGFP, we found that Bombyx mori ribosomal protein S3a. (BmS3a) with EGFP fused to its C-terminal, was predominantly localized in the cytoplasm of B. mori cells. Subsequently, to investigate the effect of BmS3a over-expression on BmNPV infection both at the.

Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

DEFF Research Database (Denmark)

Douthwaite, S; Powers, T; Lee, J Y

1989-01-01

The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

Sequence analysis and over-expression of ribosomal protein S28 ...

African Journals Online (AJOL)

RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions

Science.gov (United States)

Zhang, Yawei; Li, Gang

2018-01-01

Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

Characterisation of ribosomal proteins from HeLa and Krebs II mouse ascites tumor cells by different two-dimensional polyacrylamide gel electrophoresis techniques

DEFF Research Database (Denmark)

Issinger, O G; Beier, H

1978-01-01

Electrophoresis of ribosomal proteins according to Kaltschmidt and Wittmann, 1970a, b (pH 8.6/pH 4.5 urea system) yielded 29 proteins for the small subunits and 35 and 37 proteins for the large subunits of Krebs II ascites and HeLa ribosomes, respectively. Analysis of the proteins according...... to a modified technique by Mets and Bogorad (1974) (pH 4.5/pH 8.6 SDS system) revealed 28 and 29 proteins in the small subunits and 37 and 38 proteins in the large subunits of Krebs II ascites and HeLa ribosomes. The molecular weights of the individual proteins were determined by: 1. "three-dimensional" gel...... using the pH 4.5/pH 8.6 SDS system. The molecular weights Krebs II ascites and HeLa ribosomal proteins are compared with those obtained by other authors for different mammalian species....

Inhibition of peptide bond formation by pleuromutilins: the structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin.

Science.gov (United States)

Schlünzen, Frank; Pyetan, Erez; Fucini, Paola; Yonath, Ada; Harms, Jörg M

2004-12-01

Tiamulin, a prominent member of the pleuromutilin class of antibiotics, is a potent inhibitor of protein synthesis in bacteria. Up to now the effect of pleuromutilins on the ribosome has not been determined on a molecular level. The 3.5 A structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with tiamulin provides for the first time a detailed picture of its interactions with the 23S rRNA, thus explaining the molecular mechanism of the antimicrobial activity of the pleuromutilin class of antibiotics. Our results show that tiamulin is located within the peptidyl transferase center (PTC) of the 50S ribosomal subunit with its tricyclic mutilin core positioned in a tight pocket at the A-tRNA binding site. Also, the extension, which protrudes from its mutilin core, partially overlaps with the P-tRNA binding site. Thereby, tiamulin directly inhibits peptide bond formation. Comparison of the tiamulin binding site with other PTC targeting drugs, like chloramphenicol, clindamycin and streptogramins, may facilitate the design of modified or hybridized drugs that extend the applicability of this class of antibiotics.

Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.

Science.gov (United States)

Schuster, W; Unseld, M; Wissinger, B; Brennicke, A

1990-01-01

The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

Distribution of protein and RNA in the 30S ribosomal subunit

International Nuclear Information System (INIS)

Ramakrishnan, V.

1986-01-01

In Escherichia coli, the small ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21 proteins. Over the last few years, a controversy has emerged regarding the spatial distribution of RNA and protein in the 30S subunit. Contrast variation with neutron scattering was used to suggest that the RNA was located in a central core of the subunit and the proteins mainly in the periphery, with virtually no separation between the centers of mass of protein and RNA. However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements. The conflict between these two views is resolved in this report of small-angle neutron scattering measurements on 30S subunits with and without protein S1, and on subunits reconstituted from deuterated 16S RNA and unlabeled proteins. The results show that (i) the proteins and RNA are intermingled, with neither component dominating at the core or the periphery, and (ii) the spatial distribution of protein and RNA is asymmetrical, with a separation between their centers of mass of about 25 angstroms

Hypoxic stress-induced changes in ribosomes of maize seedling roots

International Nuclear Information System (INIS)

Bailey-Serres, J.; Freeling, M.

1990-01-01

The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

International Nuclear Information System (INIS)

Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

2013-01-01

Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

Anisotropic thermal properties and ferroelectric phase transitions in layered CuInP2S6 and CuInP2Se6 crystals

Science.gov (United States)

Liubachko, V.; Shvalya, V.; Oleaga, A.; Salazar, A.; Kohutych, A.; Pogodin, A.; Vysochanskii, Yu. M.

2017-12-01

Thermal diffusivity and thermal conductivity have been studied for the layered crystals CuInP2S6, CuInP2Se6 from 30 K to 350 K, showing a relevant thermal anisotropy. Heat is much more efficiently transferred within the layers than perpendicular to them. The ferrielectric transition in CuInP2S6 is proven to be clearly first order while the ferroelectric one in CuInP2Se6 has a weak first order character. The behavior of the thermal conductivity as a function of temperature in the ferroelectric phases shows that heat conduction is phonon driven. Disorder in the paraelectric phases due to hopping motions of Cu ions significantly reduces the thermal conductivity to extremely low values.

[SP600125-induced polyploidization of megakaryocytic leukemia cell lines by ribosomal protein S6 kinase 1 depends on the degree of cell differentiation].

Science.gov (United States)

Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu

2016-10-01

Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect

High resolution emission Fourier transform infrared spectra of the 4p-5s and 5p-6s bands of ArH.

Science.gov (United States)

Baskakov, O I; Civis, S; Kawaguchi, K

2005-03-15

In the 2500-8500 cm(-1) region several strong emission bands of (40)ArH were observed by Fourier transform spectroscopy through a dc glow discharge in a mixture of argon and hydrogen. Rotational-electronic transitions of the two previously unstudied 4p-5s and 5p-6s,v = 0-0, bands of (40)ArH were measured and assigned in the 6060 and 3770 cm(-1) regions, respectively. A simultaneous fit of the emission transitions of the 4p-5s and 5p-6s bands and an extended set of transitions of the 6s-4p band observed by Dabrowski, Tokaryk, and Watson [J. Mol. Spectrosc. 189, 95 (1998)] and remeasured in the present work yielded consistent values of the spectroscopic parameters of the electronic states under investigation. In the branch of the 4p-5s band with transitions of type (Q)Q(f(3)e) we observed a narrowing in the linewidths with increasing rotational quantum number N. The rotational dependence of the linewidth is caused by predissociation of the 5s state by the repulsive ground 4s state through homogeneous coupling and changes in overlap integrals of the vibrational wave functions with the rotational level. Analysis was based on the Fermi's golden rule approximation model. In the 4p-5s band region a vibrational sequence ofv(')-v(")=1-1, 2-2, and 3-3 were recorded and a number of transitions belonging to the strongest (Q)Q(f(3)e) form branch of the 1-1 band were analyzed.

Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

Energy Technology Data Exchange (ETDEWEB)

Sameshima, M; Ito, K; Iwabuchi, M

1972-01-01

In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

International Nuclear Information System (INIS)

Dessen, E.M.B.; Perondini, A.L.P.

1979-01-01

Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

Optical frequency measurements of 6s 2S1/2-6p 2P3/2 transition in a 133Cs atomic beam using a femtosecond laser frequency comb

International Nuclear Information System (INIS)

Gerginov, V.; Tanner, C.E.; Diddams, S.; Bartels, A.; Hollberg, L.

2004-01-01

Optical frequencies of the hyperfine components of the D 2 line in 133 Cs are determined using high-resolution spectroscopy and a femtosecond laser frequency comb. A narrow-linewidth probe laser excites the 6s 2 S 1/2 (F=3,4)→6p 2 P 3/2 (F=2,3,4,5) transition in a highly collimated atomic beam. Fluorescence spectra are taken by scanning the laser frequency over the excited-state hyperfine structure. The laser optical frequency is referenced to a Cs fountain clock via a reference laser and a femtosecond laser frequency comb. A retroreflected laser beam is used to estimate and minimize the Doppler shift due to misalignment between the probe laser and the atomic beam. We achieve an angular resolution on the order of 5x10 -6 rad. The final uncertainties (∼±5 kHz) in the frequencies of the optical transitions are a factor of 20 better than previous results [T. Udem et al., Phys. Rev. A 62, 031801 (2000).]. We find the centroid of the 6s 2 S 1/2 →6p 2 P 3/2 transition to be f D2 =351 725 718.4744(51) MHz

Intracellular dynamics of the Hsp90 co-chaperone p23 is dictated by Hsp90

International Nuclear Information System (INIS)

Picard, Didier

2006-01-01

p23 is a component of the Hsp90 molecular chaperone machine. It binds and stabilizes the ATP-bound dimeric form of Hsp90. Since Hsp90 binds protein substrates in the ATP conformation, p23 has been proposed to stabilize Hsp90-substrate complexes. In addition, p23 can also function as a molecular chaperone by itself and even possesses an unrelated enzymatic activity. Whether it fulfills the latter functions in cells while bound to Hsp90 remains unknown and is difficult to extrapolate from cell-free biochemical experiments. Using the 'fluorescence recovery after photobleaching' (FRAP) technology, I have examined the dynamics of human p23, expressed as a fusion protein with the green fluorescent protein (GFP), in living human HeLa cells. GFP-p23 is distributed throughout the cell, and its mobility is identical in the cytoplasm and in the nucleus. When the Hsp90 interaction is disrupted either with the Hsp90 inhibitor geldanamycin or by introduction of point mutations into p23, the mobility of p23 is greatly accelerated. Under these conditions, its intracellular movement may be diffusion-controlled. In contrast, when wild-type p23 is able to bind Hsp90, a more complex FRAP behavior is observed, suggesting that it is quantitatively bound in Hsp90 complexes undergoing a multitude of other interactions

Hsp60 and p70S6K form a complex in human cardiomyocytes

Directory of Open Access Journals (Sweden)

Kroupskaya I. V.

2011-02-01

Full Text Available Molecular chaperon Hsp60 and protein kinase p70S6K play an important functional role in the regulation of cardiomyocytes vital function or apoptosis. Aim. To study a possibility of in vivo complex formation between Hsp60 and p70S6K in cardiomyocytes. Methods. Co-immunoprecipitation, Western-blot analysis. Results. We have identified in vivo interaction between molecular chaperone Hsp60 and two isoforms of proteinkinase p70S6K in human myocardium, normal and affected by cardiomyopathy. Conclusions. The results obtained suggest a possible participation of molecular chaperon Hsp60 in regulation of p70S6K activity in stressinduced apoptotic signaling pathway in cardiomyocytes.

Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

Energy Technology Data Exchange (ETDEWEB)

Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: alin@ym.edu.tw [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)

2013-11-15

Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

Novel Accurate Bacterial Discrimination by MALDI-Time-of-Flight MS Based on Ribosomal Proteins Coding in S10-spc-alpha Operon at Strain Level S10-GERMS

Science.gov (United States)

Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki

2013-08-01

Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.

Baculovirus-mediated expression and isolation of human ribosomal phosphoprotein P0 carrying a GST-tag in a functional state

International Nuclear Information System (INIS)

Abo, Yohichi; Hagiya, Akiko; Naganuma, Takao; Tohkairin, Yukiko; Shiomi, Kunihiro; Kajiura, Zenta; Hachimori, Akira; Uchiumi, Toshio; Nakagaki, Masao

2004-01-01

We constructed an overexpression system for human ribosomal phosphoprotein P0, together with P1 and P2, which is crucially important for translation. Genes for these proteins, fused with the glutathione S-transferase (GST)-tag at the N-terminus, were inserted into baculovirus and introduced to insect cells. The fusion proteins, but not the proteins without the tag, were efficiently expressed into cells as soluble forms. The fusion protein GST.P0 as well as GST.P1/GST.P2 was phosphorylated in cells as detected by incorporation of 32 P and reactivity with monoclonal anti-phosphoserine antibody. GST.P0 expressed in insect cells, but not the protein obtained in Escherichia coli, had the ability to form a complex with P1 and P2 proteins and to bind to 28S rRNA. Moreover, the GST.P0-P1-P2 complex participated in high eEF-2-dependent GTPase activity. Baculovirus expression systems appear to provide recombinant human P0 samples that can be used for studies on the structure and function

A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

Directory of Open Access Journals (Sweden)

Brittany Burton

Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

A bifunctional archaeal protein that is a component of 30S ribosomal subunits and interacts with C/D box small RNAs

Directory of Open Access Journals (Sweden)

Andrea Ciammaruconi

2008-01-01

Full Text Available We have identified a novel archaeal protein that apparently plays two distinct roles in ribosome metabolism. It is a polypeptide of about 18 kDa (termed Rbp18 that binds free cytosolic C/D box sRNAs in vivo and in vitro and behaves as a structural ribosomal protein, specifically a component of the 30S ribosomal subunit. As Rbp18 is selectively present in Crenarcheota and highly thermophilic Euryarchaeota, we propose that it serves to protect C/D box sRNAs from degradation and perhaps to stabilize thermophilic 30S subunits.

S6K1 Is Required for Increasing Skeletal Muscle Force during Hypertrophy.

Science.gov (United States)

Marabita, Manuela; Baraldo, Martina; Solagna, Francesca; Ceelen, Judith Johanna Maria; Sartori, Roberta; Nolte, Hendrik; Nemazanyy, Ivan; Pyronnet, Stéphane; Kruger, Marcus; Pende, Mario; Blaauw, Bert

2016-10-04

Loss of skeletal muscle mass and force aggravates age-related sarcopenia and numerous pathologies, such as cancer and diabetes. The AKT-mTORC1 pathway plays a major role in stimulating adult muscle growth; however, the functional role of its downstream mediators in vivo is unknown. Here, we show that simultaneous inhibition of mTOR signaling to both S6K1 and 4E-BP1 is sufficient to reduce AKT-induced muscle growth and render it insensitive to the mTORC1-inhibitor rapamycin. Surprisingly, lack of mTOR signaling to 4E-BP1 only, or deletion of S6K1 alone, is not sufficient to reduce muscle hypertrophy or alter its sensitivity to rapamycin. However, we report that, while not required for muscle growth, S6K1 is essential for maintaining muscle structure and force production. Hypertrophy in the absence of S6K1 is characterized by compromised ribosome biogenesis and the formation of p62-positive protein aggregates. These findings identify S6K1 as a crucial player for maintaining muscle function during hypertrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

P50/P90 Analysis for Solar Energy Systems Using the System Advisor Model: Preprint

Energy Technology Data Exchange (ETDEWEB)

Dobos, A. P.; Gilman, P.; Kasberg, M.

2012-06-01

To secure competitive financing for a solar energy generation project, the economic risk associated with interannual solar resource variability must be quantified. One way to quantify this risk is to calculate exceedance probabilities representing the amount of energy expected to be produced by a plant. Many years of solar radiation and metereological data are required to determine these values, often called P50 or P90 values for the level of certainty they represent. This paper describes the two methods implemented in the National Renewable Energy Laboratory's System Advisor Model (SAM) to calculate P50 and P90 exceedance probabilities for solar energy projects. The methodology and supporting data sets are applicable to photovoltaic, solar water heating, and concentrating solar power (CSP) systems.

Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

DEFF Research Database (Denmark)

Issinger, O G

1977-01-01

A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

The C-terminal helix of ribosomal P stalk recognizes a hydrophobic groove of elongation factor 2 in a novel fashion.

Science.gov (United States)

Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min

2018-04-06

Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.

The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

Science.gov (United States)

Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

2008-07-01

Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes.

Science.gov (United States)

Crossland, Hannah; Timmons, James A; Atherton, Philip J

2017-12-01

Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).

Non-canonical binding interactions of the RNA recognition motif (RRM) domains of P34 protein modulate binding within the 5S ribonucleoprotein particle (5S RNP).

Science.gov (United States)

Kamina, Anyango D; Williams, Noreen

2017-01-01

RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.

18S Ribosomal RNA Evaluation as Preanalytical Quality Control for Animal DNA

Directory of Open Access Journals (Sweden)

Cory Ann Leonard

2016-01-01

Full Text Available The 18S ribosomal RNA (rRNA gene is present in all eukaryotic cells. In this study, we evaluated the use of this gene to verify the presence of PCR-amplifiable host (animal DNA as an indicator of sufficient sample quality for quantitative real-time PCR (qPCR analysis. We compared (i samples from various animal species, tissues, and sample types, including swabs; (ii multiple DNA extraction methods; and (iii both fresh and formalin-fixed paraffin-embedded (FFPE samples. Results showed that 18S ribosomal RNA gene amplification was possible from all tissue samples evaluated, including avian, reptile, and FFPE samples and most swab samples. A single swine rectal swab, which showed sufficient DNA quantity and the demonstrated lack of PCR inhibitors, nonetheless was negative by 18S qPCR. Such a sample specifically illustrates the improvement of determination of sample integrity afforded by inclusion of 18S rRNA gene qPCR analysis in addition to spectrophotometric analysis and the use of internal controls for PCR inhibition. Other possible applications for the described 18S rRNA qPCR are preselection of optimal tissue specimens for studies or preliminary screening of archived samples prior to acceptance for biobanking projects.

Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis.

Science.gov (United States)

Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip

2018-04-21

Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

Characterization of anti-P monoclonal antibodies directed against the ribosomal protein-RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice.

Science.gov (United States)

Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

2015-02-01

Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. © 2014 British Society for Immunology.

Characterization of anti-P monoclonal antibodies directed against the ribosomal protein–RNA complex antigen and produced using Murphy Roths large autoimmune-prone mice

Science.gov (United States)

Sato, H; Onozuka, M; Hagiya, A; Hoshino, S; Narita, I; Uchiumi, T

2015-01-01

Autoantibodies, including anti-ribosomal P proteins (anti-P), are thought to be produced by an antigen-driven immune response in systemic lupus erythematosus (SLE). To test this hypothesis, we reconstituted the ribosomal antigenic complex in vitro using human P0, phosphorylated P1 and P2 and a 28S rRNA fragment covering the P0 binding site, and immunized Murphy Roths large (MRL)/lrp lupus mice with this complex without any added adjuvant to generate anti-P antibodies. Using hybridoma technology, we subsequently obtained 34 clones, each producing an anti-P monoclonal antibody (mAb) that recognized the conserved C-terminal tail sequence common to all three P proteins. We also obtained two P0-specific monoclonal antibodies, but no antibody specific to P1, P2 or rRNA fragment. Two types of mAbs were found among these anti-P antibodies: one type (e.g. 9D5) reacted more strongly with the phosphorylated P1 and P2 than that with their non-phosphorylated forms, whereas the other type (e.g. 4H11) reacted equally with both phosphorylated and non-phosphorylated forms of P1/P2. Both 9D5 and 4H11 inhibited the ribosome/eukaryotic elongation factor-2 (eEF-2)-coupled guanosine triphosphate (GTP)ase activity. However, preincubation with a synthetic peptide corresponding to the C-terminal sequence common to all three P proteins, but not the peptide that lacked the last three C-terminal amino acids, mostly prevented the mAb-induced inhibition of GTPase activity. Thus, at least two types of anti-P were produced preferentially following the immunization of MRL mice with the reconstituted antigenic complex. Presence of multiple copies of the C-termini, particularly that of the last three C-terminal amino acid residues, in the antigenic complex appears to contribute to the immunogenic stimulus. PMID:25255895

Mutation in ribosomal protein S5 leads to spectinomycin resistance in Neisseria gonorrhoeae.

Directory of Open Access Journals (Sweden)

Elena eIlina

2013-07-01

Full Text Available Spectinomycin remains a useful reserve option for therapy of gonorrhea. The emergence of multidrug-resistant Neisseria gonorrhoeae strains with decreased susceptibility to cefixime and to ceftriaxone makes it the only medicine still effective for treatment of gonorrhea infection in analogous cases. However, adoption of spectinomycin as a routinely used drug of choice was soon followed by reports of spectinomycin resistance. The main molecular mechanism of spectinomycin resistance in N. gonorrhoeae was C1192T substitution in 16S rRNA genes. Here we reported a Thr-24→Pro mutation in ribosomal protein S5 found in spectinomycin resistant clinical N. gonorrhoeae strain, which carried no changes in 16S rRNA. In a series of experiments, the transfer of rpsE gene allele encoding the mutant ribosomal protein S5 to the recipient N. gonorrhoeae strains was analyzed. The relatively high rate of transformation (ca. 10-5 CFUs indicates the possibility of spread of spectinonycin resistance within gonococcal population due to the horizontal gene transfer.

Shake-up transitions in S 2p, S 2s and F 1s photoionization of the SF6 molecule

International Nuclear Information System (INIS)

Decleva, P; Fronzoni, G; Kivimaeki, A; Alvarez Ruiz, J; Svensson, S

2009-01-01

Shake-up transitions occurring upon core photoionization in the SF 6 molecule have been studied experimentally and theoretically. The S 2p, S 2s and F 1s shake-up satellite photoelectron spectra were measured using Al Ka radiation at 1487 eV photon energy. They have been interpreted with the aid of ab initio configuration interaction calculations in the sudden-limit approximation. For the S 2p spectrum, conjugate shake-up transitions were also calculated. Clear evidence of conjugate processes is observed in the S 2p shake-up spectrum measured at 230 eV photon energy. The experimental and theoretical S 2p and S 2s shake-up spectra show very similar structures mainly due to orbital relaxation involving S 3s and 3p participation. For the calculation of the F 1s shake-up spectrum, the symmetry lowering of the molecule in the final states was considered, resulting in a good agreement with the experiment.

Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

Science.gov (United States)

Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

2014-08-01

5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

Quasirelativistic calculation of 4s24p5, 4s24p44d and 4s4p6 configuration spectroscopic parameters for the W39+ ion

International Nuclear Information System (INIS)

Bogdanovich, P; Karpuškienė, R; Kisielius, R

2015-01-01

The ab initio quasirelativistic Hartree–Fock method developed specifically for the calculation of spectral parameters of heavy atoms and highly charged ions is used to derive spectral data for the 4s 2 4p 5 , 4s 2 4p 4 4d and 4s4p 6 configurations of the multicharged tungsten ion W 39+ . The relativistic effects are taken into account in the Breit–Pauli approximation for the quasirelativistic Hartree–Fock radial orbitals. The configuration interaction method is applied to include the electron correlation effects. Produced data are compared with existing experimental measurements and theoretical calculations. (paper)

Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

International Nuclear Information System (INIS)

Nowotny, V.; Nierhaus, K.H.

1988-01-01

A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

Evidence that the primary effect of phosphorylation of eukaryotic initiation factor 2(alpha) in rabbit reticulocyte lysate is inhibition of the release of eukaryotic initiation factor-2.GDP from 60 S ribosomal subunits

International Nuclear Information System (INIS)

Gross, M.; Redman, R.; Kaplansky, D.A.

1985-01-01

The phosphorylation of eukaryotic initiation factor (eIF) 2 alpha that occurs when rabbit reticulocyte lysate is incubated in the absence of hemin or with poly(I.C) causes inhibition of polypeptide chain initiation by preventing a separate factor (termed RF) from promoting the exchange of GTP for GDP on eIF-2. When lysate was incubated in the presence of hemin and [ 14 C] eIF-2 or [alpha- 32 P]GTP, the authors observed binding of eIF-2 and GDP or GTP to 60 S ribosomal subunits that was slightly greater than that bound to 40 S subunits and little binding to 80 S ribosomes. When incubation was in the absence of hemin or in the presence of hemin plus 0.1 microgram/ml poly(I.C), eIF-2 and GDP binding to 60 S subunits was increased 1.5- to 2-fold, that bound to 80 S ribosomes was almost as great as that bound to 60 S subunits, and that bound to 40 S subunits was unchanged. The data indicate that about 40% of the eIF-2 that becomes bound to 60 S subunits and 80 S ribosomes in the absence of hemin or with poly(I.C) is eIF-2(alpha-P) and suggest that the eIF-2 and GDP bound is probably in the form of a binary complex. The rate of turnover of GDP (presumably eIF-2.GDP) on 60 S subunits and 80 S ribosomes in the absence of hemin is reduced to less than 10% the control rate, because the dissociation of eIF-2.GDP is inhibited. Our findings suggest that eIF-2.GTP binding to and eIF-2.GDP release from 60 S subunits may normally occur and serve to promote subunit joining

Critical 23S rRNA interactions for macrolide-dependent ribosome stalling on the ErmCL nascent peptide chain.

Science.gov (United States)

Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert

2017-06-20

The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

Directory of Open Access Journals (Sweden)

Seema Dharni

2014-01-01

Full Text Available 1-Hydroxyphenazine (1-OH-PHZ, a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases.

The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

International Nuclear Information System (INIS)

Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej

2008-01-01

The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome.

Science.gov (United States)

Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen

2012-08-01

Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

Naked mole-rat has increased translational fidelity compared with the mouse, as well as a unique 28S ribosomal RNA cleavage.

Science.gov (United States)

Azpurua, Jorge; Ke, Zhonghe; Chen, Iris X; Zhang, Quanwei; Ermolenko, Dmitri N; Zhang, Zhengdong D; Gorbunova, Vera; Seluanov, Andrei

2013-10-22

The naked mole-rat (Heterocephalus glaber) is a subterranean eusocial rodent with a markedly long lifespan and resistance to tumorigenesis. Multiple data implicate modulation of protein translation in longevity. Here we report that 28S ribosomal RNA (rRNA) of the naked mole-rat is processed into two smaller fragments of unequal size. The two breakpoints are located in the 28S rRNA divergent region 6 and excise a fragment of 263 nt. The excised fragment is unique to the naked mole-rat rRNA and does not show homology to other genomic regions. Because this hidden break site could alter ribosome structure, we investigated whether translation rate and amino acid incorporation fidelity were altered. We report that naked mole-rat fibroblasts have significantly increased translational fidelity despite having comparable translation rates with mouse fibroblasts. Although we cannot directly test whether the unique 28S rRNA structure contributes to the increased fidelity of translation, we speculate that it may change the folding or dynamics of the large ribosomal subunit, altering the rate of GTP hydrolysis and/or interaction of the large subunit with tRNA during accommodation, thus affecting the fidelity of protein synthesis. In summary, our results show that naked mole-rat cells produce fewer aberrant proteins, supporting the hypothesis that the more stable proteome of the naked mole-rat contributes to its longevity.

Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.

Science.gov (United States)

Ahuja, Richa; Kumar, Vijay

2017-07-01

RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.

Miscoding-induced stalling of substrate translocation on the bacterial ribosome.

Science.gov (United States)

Alejo, Jose L; Blanchard, Scott C

2017-10-10

Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

Expression and subcellular localization of p70S6 kinase under heart failure

Directory of Open Access Journals (Sweden)

Usenko V. S.

2010-11-01

Full Text Available The PI3K/PDK/Akt/mTOR/p70S6K signaling pathway is primary associated with the activation of insulin receptors and is important for cardiomyocytes survival. p70S6K is a key regulator of the speed and efficiency of protein biosynthesis within the cell. Recently the pro-apoptotic protein BAD has been identified as a new target for р70S6K1. BAD is inactivated in normal cardiomyocytes by р70S6K1 phosphorylation which prevents the cardiomyocytes apoptosis. Aim. To study possible changes in р70S6K1 expression and/or cellular localization at heart failure progression – in DCM- affected human myocardia and murine hearts with experimental DCM-like pathology. Methods. Western-blot analysis and immunohystochemistry. Results. The substantial decrease in р70S6K1 level was observed at the final stage of pathology progression and in the dynamics of DCM pathogenesis as well. For the first time relocalization of the protein to the connective tissue was shown according to the Western-blot results. Conclusions. The data obtained allow us to understand a possible role of р70S6K1 in the regulation of stress-induced apoptotic signaling in cardiomyocytes.

Ribosomal history reveals origins of modern protein synthesis.

Directory of Open Access Journals (Sweden)

Ajith Harish

Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

Directory of Open Access Journals (Sweden)

Katherine I. Farley-Barnes

2018-02-01

Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

Heat shock protein 90 positively regulates Chikungunya virus replication by stabilizing viral non-structural protein nsP2 during infection.

Directory of Open Access Journals (Sweden)

Indrani Das

Full Text Available BACKGROUND: The high morbidity and socio-economic loss associated with the recent massive global outbreak of Chikungunya virus (CHIKV emphasize the need to understand the biology of the virus for developing effective antiviral therapies. METHODS AND FINDINGS: In this study, an attempt was made to understand the molecular mechanism involved in Heat shock protein 90 (Hsp90 mediated regulation of CHIKV infection in mammalian cells using CHIKV prototype strain (S 27 and Indian outbreak strain of 2006 (DRDE-06. Our results showed that Hsp90 is required at a very early stage of viral replication and Hsp90 inhibitor Geldanamycin (GA can abrogate new virus particle formation more effectively in the case of S 27 than that of DRDE-06. Further analysis revealed that CHIKV nsP2 protein level is specifically reduced by GA treatment as well as HSP90-siRNA transfection; however, viral RNA remains unaltered. Immunoprecipitation analysis showed that nsP2 interacts with Hsp90 during infection; however this interaction is reduced in the presence of GA. In addition, our analysis on Hsp90 associated PI3K/Akt/mTOR signaling pathway demonstrated that CHIKV infection stabilizes Raf1 and activates Hsp90 client protein Akt, which in turn phosphorylates mTOR. Subsequently, this phosphorylation leads to the activation of two important downstream effectors, S6K and 4EBP1, which may facilitate translation of viral as well as cellular mRNAs. Hence, the data suggests that CHIKV infection is regulated by Hsp90 associated Akt phosphorylation and DRDE-06 is more efficient than S 27 in enhancing the activation of host signaling molecules for its efficient replication and virus production. CONCLUSION: Hsp90 positively regulates Chikungunya virus replication by stabilizing CHIKV-nsP2 through its interaction during infection. The study highlights the possible molecular mechanism of GA mediated inhibition of CHIKV replication and differential effect of this drug on S 27 and DRDE-06

Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

International Nuclear Information System (INIS)

Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

1990-01-01

The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

16S/18S ribosomal DNA clone library analysis of rumen microbial diversity

International Nuclear Information System (INIS)

Wright, A.G.; Kiyoshi Tajima; Aminov, R.I.

2005-01-01

The rumen contains a complex ecosystem where billions of bacteria, archaea, protozoa and fungi reside. This diverse microbiota is well adapted to live in the rumen and play an important role in the digestion of feed and nutrient supply to the host in the form of microbial protein and volatile fatty acids. It is estimated that the rumen microbial population consists of about 10 6 protozoa/ml, 10 3 -10 7 fungi/ml, 10 10 bacteria/ml, and 10 9 methanogens/ml. To better understand the complex relationships in the rumen, it is necessary to gain an insight into the diversity of the rumen microbes and how the quantity and composition of rumen micro-organisms are altered by a number of different host factors such as age, genetics and diet. In the past, the diversity of micro-organisms from the digestive tracts of domesticated ruminants has been identified by classical microbiological techniques. However, given the fastidious growth requirements of rumen micro-organisms, it is reasonable to concede that the culture-dependent methods may select against some species, or taxonomic groups, leading researchers to underestimate the microbial diversity that is actually present in the rumen. In fact, it has been speculated that 90% of micro-organisms in nature have escaped traditional cultivation methods. Therefore, a major challenge in microbial ecology has been to assess the diversity and structure of natural microbial communities. The field of molecular biology has advanced with many innovative technological breakthroughs. The ability to extract and to isolate high-molecular weight DNA from rumen digesta, PCR amplify genes from specific microbial groups and obtain gene sequence data is now a routine event. The small subunit ribosomal RNA (SSU-rRNA) gene, called 16S in prokaryotes and 18S in eukaryotes, is the most widely used molecular marker to presumptively identify morphologically indistinguishable species, to infer their phylogenetic relationships, and to elucidate microbial

Molecular mechanism of bacterial Hsp90 pH-dependent ATPase activity.

Science.gov (United States)

Jin, Yi; Hoxie, Reyal S; Street, Timothy O

2017-06-01

Hsp90 is a dimeric molecular chaperone that undergoes an essential and highly regulated open-to-closed-to-open conformational cycle upon ATP binding and hydrolysis. Although it has been established that a large energy barrier to closure is responsible for Hsp90's low ATP hydrolysis rate, the specific molecular contacts that create this energy barrier are not known. Here we discover that bacterial Hsp90 (HtpG) has a pH-dependent ATPase activity that is unique among other Hsp90 homologs. The underlying mechanism is a conformation-specific electrostatic interaction between a single histidine, H255, and bound ATP. H255 stabilizes ATP only while HtpG adopts a catalytically inactive open configuration, resulting in a striking anti-correlation between nucleotide binding affinity and chaperone activity over a wide range of pH. Linkage analysis reveals that the H255-ATP salt bridge contributes 1.5 kcal/mol to the energy barrier of closure. This energetic contribution is structurally asymmetric, whereby only one H255-ATP salt-bridge per dimer of HtpG controls ATPase activation. We find that a similar electrostatic mechanism regulates the ATPase of the endoplasmic reticulum Hsp90, and that pH-dependent activity can be engineered into eukaryotic cytosolic Hsp90. These results reveal site-specific energetic information about an evolutionarily conserved conformational landscape that controls Hsp90 ATPase activity. © 2017 The Protein Society.

The Protein Kinase RSK Family - Roles in Prostate Cancer

National Research Council Canada - National Science Library

Lannigan, Deborah

2006-01-01

The Ser/Thr protein kinase p90-kDa ribosomal S6 kinase (RSK) is an important downstream effector of mitogen-activated protein kinase but its roles in prostate cancer have not been previously examined...

Structure of the hepatitis C virus IRES bound to the human 80S ribosome: remodeling of the HCV IRES.

Science.gov (United States)

Boehringer, Daniel; Thermann, Rolf; Ostareck-Lederer, Antje; Lewis, Joe D; Stark, Holger

2005-11-01

Initiation of translation of the hepatitis C virus (HCV) polyprotein is driven by an internal ribosome entry site (IRES) RNA that bypasses much of the eukaryotic translation initiation machinery. Here, single-particle electron cryomicroscopy has been used to study the mechanism of HCV IRES-mediated initiation. A HeLa in vitro translation system was used to assemble human IRES-80S ribosome complexes under near physiological conditions; these were stalled before elongation. Domain 2 of the HCV IRES is bound to the tRNA exit site, touching the L1 stalk of the 60S subunit, suggesting a mechanism for the removal of the HCV IRES in the progression to elongation. Domain 3 of the HCV IRES positions the initiation codon in the ribosomal mRNA binding cleft by binding helix 28 at the head of the 40S subunit. The comparison with the previously published binary 40S-HCV IRES complex reveals structural rearrangements in the two pseudoknot structures of the HCV IRES in translation initiation.

Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli

Science.gov (United States)

Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.

1982-06-01

This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

Directory of Open Access Journals (Sweden)

Bani Kumar Pathak

Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

Science.gov (United States)

Yu, Shoukai; Lemos, Bernardo

2016-12-31

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

Energy Technology Data Exchange (ETDEWEB)

Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)

1975-06-01

Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

The level of heat shock protein 90 in pig Longissimus dorsi muscle and its relationship with meat pH and quality.

Science.gov (United States)

Zhang, Muhan; Wang, Daoying; Geng, Zhiming; Bian, Huan; Liu, Fang; Zhu, Yongzhi; Xu, Weimin

2014-12-15

The 90 kDa heat shock protein (HSP90) is a molecular chaperone that participates in various cellular processes, the role and significance of HSP90 in postmortem muscle though remains unclear. In the present study, pig Longissimus dorsi muscles, categorized into three pH groups, were tested for HSP90 levels and meat quality parameters (i.e. water holding capacity, colour, tenderness and lipid oxidation). The muscles with a high initial pH (pHi) group (pH>6.4) possessing the greatest water holding capacity and lightness, contained the highest HSP90 level, followed by intermediate (6.0-6.4) and low pHi groups (pHwater retention of meat and may be involved in postmortem meat quality development. Copyright © 2014 Elsevier Ltd. All rights reserved.

Neutron scattering and the 30 S ribosomal subunit of E. coli

International Nuclear Information System (INIS)

Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.

1982-01-01

This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

Emerging functions of ribosomal proteins in gene-specific transcription and translation

International Nuclear Information System (INIS)

Lindstroem, Mikael S.

2009-01-01

Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

IL2-dependent phosphorylation of 40S ribosomal protein S6 is controlled by PI-3K/mTOR signalling in CTLL2 cells

Czech Academy of Sciences Publication Activity Database

Tuháčková, Zdena; Šloncová, Eva; Vojtěchová, Martina; Sovová, Vlasta

2004-01-01

Roč. 13, č. 4 (2004), s. 601-605 ISSN 1107-3756 R&D Projects: GA ČR GA301/00/0269 Institutional research plan: CEZ:AV0Z5052915 Keywords : MTOR /PI3-K signalling, p70 S 6 kinase, interleukin Subject RIV: CE - Biochemistry Impact factor: 3.190, year: 2004

Phosphorylation of ribosomal protein S6 kinase 1 at Thr421/Ser424 and dephosphorylation at Thr389 regulates SP600125-induced polyploidization of megakaryocytic cell lines.

Science.gov (United States)

Li, Chang-Ling; Yang, Jin-Gang; Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu

2014-01-01

Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125

Phosphorylation of ribosomal protein S6 kinase 1 at Thr421/Ser424 and dephosphorylation at Thr389 regulates SP600125-induced polyploidization of megakaryocytic cell lines.

Directory of Open Access Journals (Sweden)

Chang-Ling Li

Full Text Available Megakaryocytes (MKs are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1 at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in

D-Glucosamine inhibits proliferation of human cancer cells through inhibition of p70S6K

International Nuclear Information System (INIS)

Oh, Hyun-Ji; Lee, Jason S.; Song, Dae-Kyu; Shin, Dong-Hoon; Jang, Byeong-Churl; Suh, Seong-Il; Park, Jong-Wook; Suh, Min-Ho; Baek, Won-Ki

2007-01-01

Although D-glucosamine has been reported as an inhibitor of tumor growth both in vivo and in vitro, the mechanism for the anticancer effect of D-glucosamine is still unclear. Since there are several reports suggesting D-glucosamine inhibits protein synthesis, we examined whether D-glucosamine affects p70S6 K activity, an important signaling molecule involved in protein translation. In the present study, we found D-glucosamine inhibited the activity of p70S6K and the proliferation of DU145 prostate cancer cells and MDA-MB-231 breast cancer cells. D-Glucosamine decreased phosphorylation of p70S6K, and its downstream substrates RPS6, and eIF-4B, but not mTOR and 4EBP1 in DU145 cells, suggesting that D-glucosamine induced inhibition of p70S6K is not through the inhibition of mTOR. In addition, D-glucosamine enhanced the growth inhibitory effects of rapamycin, a specific inhibitor of mTOR. These findings suggest that D-glucosamine can inhibit growth of cancer cells through dephosphorylation of p70S6K

S6K1 is involved in polyploidization through its phosphorylation at Thr421/Ser424.

Science.gov (United States)

Ma, Dongchu; Yu, Huiying; Lin, Di; Sun, Yinghui; Liu, Liping; Liu, Yage; Dai, Bing; Chen, Wei; Cao, Jianping

2009-04-01

Studies on polyploidization of megakaryocytes have been hampered by the lack of synchronized polyploid megakaryocytes. In this study, a relatively synchronized polyploid cell model was successfully established by employing Dami cells treated with nocodazole. In nocodazole-induced cells, cyclin B expression oscillated normally as in diploid cells and polyploid megakaryocytes. By using the nocodazole-induced Dami cell model, we found that 4E-BP1 and Thr421/Ser424 of ribosomal S6 kinase 1(S6K1) were phosphorylated mostly at M-phase in cytoplasm and oscillated in nocodazole-induced polyploid Dami cells, concomitant with increased expression of p27 and cyclin D3. However, phosphorylation of 4E-BP1 and S6K1 on Thr421/Ser424 was significantly decreased in differentiated Dami cells induced by phorbol 12-myristate 13-acetate (PMA), concomitant with increased expression of cyclin D1 and p21 and cyclin D3. Overexpression of the kinase dead form of S6K1 containing the mutation Lys 100 --> Gln in PMA-induced Dami cells increased ploidy whereas overexpression of rapamycin-resistant form of S6K1 containing the mutations Thr421 --> Glu and Ser424 --> Asp significantly dephosphorylated 4E-BP1 and reduced expression of cyclin D1, cyclin D3, p21 and p27, and slightly decreased the ploidy of PMA-induced Dami cells, compared with treatment with PMA alone. Moreover, overexpression of rapamycin-resistant form of S6K1 significantly reversed polyploidization of nocodazole-induced Dami cells. Furthermore, MAP (a novel compound synthesized recently) partly blocked the phosphorylation of S6K1 on Thr421/Ser424 and decreased the expression of p27 and polyploidization in nocodazole-induced Dami cells. Taken together, these data suggested that S6K1/4E-BP1 pathway may play an important role in polyploidization of megakaryocytes. (c) 2008 Wiley-Liss, Inc.

The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation

Science.gov (United States)

Alejo, Jose Luis

In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

KAUST Repository

Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.

2015-01-01

We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

HDAC6 inhibition enhances 17-AAG--mediated abrogation of hsp90 chaperone function in human leukemia cells.

Science.gov (United States)

Rao, Rekha; Fiskus, Warren; Yang, Yonghua; Lee, Pearl; Joshi, Rajeshree; Fernandez, Pravina; Mandawat, Aditya; Atadja, Peter; Bradner, James E; Bhalla, Kapil

2008-09-01

Histone deacetylase 6 (HDAC6) is a heat shock protein 90 (hsp90) deacetylase. Treatment with pan-HDAC inhibitors or depletion of HDAC6 by siRNA induces hyperacetylation and inhibits ATP binding and chaperone function of hsp90. Treatment with 17-allylamino-demothoxy geldanamycin (17-AAG) also inhibits ATP binding and chaperone function of hsp90, resulting in polyubiquitylation and proteasomal degradation of hsp90 client proteins. In this study, we determined the effect of hsp90 hyperacetylation on the anti-hsp90 and antileukemia activity of 17-AAG. Hyperacetylation of hsp90 increased its binding to 17-AAG, as well as enhanced 17-AAG-mediated attenuation of ATP and the cochaperone p23 binding to hsp90. Notably, treatment with 17-AAG alone also reduced HDAC6 binding to hsp90 and induced hyperacetylation of hsp90. This promoted the proteasomal degradation of HDAC6. Cotreatment with 17-AAG and siRNA to HDAC6 induced more inhibition of hsp90 chaperone function and depletion of BCR-ABL and c-Raf than treatment with either agent alone. In addition, cotreatment with 17-AAG and tubacin augmented the loss of survival of K562 cells and viability of primary acute myeloid leukemia (AML) and chronic myeloid leukemia (CML) samples. These findings demonstrate that HDAC6 is an hsp90 client protein and hyperacetylation of hsp90 augments the anti-hsp90 and antileukemia effects of 17-AAG.

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong

2009-10-09

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

Overexpression of GmHsp90s, a heat shock protein 90 (Hsp90 gene family cloning from soybean, decrease damage of abiotic stresses in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Jinyan Xu

Full Text Available Hsp90 is one of the most conserved and abundant molecular chaperones and is an essential component of the protective stress response; however, its roles in abiotic stress responses in soybean (Glycine max remain obscure. Here, 12 GmHsp90 genes from soybean were identified and found to be expressed and to function differentially under abiotic stresses. The 12 GmHsp90 genes were isolated and named GmHsp90A1-GmHsp90A6, GmHsp90B1, GmHsp90B2, GmHsp90C1.1, GmHsp90C1.2, GmHsp90C2.1 and GmHsp90C2.2 based on their characteristics and high homology to other Hsp90s according to a new nomenclature system. Quantitative real-time PCR expression data revealed that all the genes exhibited higher transcript levels in leaves and could be strongly induced under heat, osmotic and salt stress but not cold stress. Overexpression of five typical genes (GmHsp90A2, GmHsp90A4, GmHsp90B1, GmHsp90C1.1 and GmHsp90C2.1 in Arabidopsis thaliana provided useful evidences that GmHsp90 genes can decrease damage of abiotic stresses. In addition, an abnormal accumulation of proline was detected in some transgenic Arabidopsis plants suggested overexpressing GmHsp90s may affect the synthesis and response system of proline. Our work represents a systematic determination of soybean genes encoding Hsp90s, and provides useful evidence that GmHsp90 genes function differently in response to abiotic stresses and may affect the synthesis and response system of proline.

A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

NARCIS (Netherlands)

Bruining, J.; Fijnaut, H.M.

We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

Chromophore-assisted light inactivation of pKi-67 leads to inhibition of ribosomal RNA synthesis.

Science.gov (United States)

Rahmanzadeh, R; Hüttmann, G; Gerdes, J; Scholzen, T

2007-06-01

Expression of the nuclear Ki-67 protein (pKi-67) is strongly associated with cell proliferation. For this reason, antibodies against this protein are widely used as prognostic tools for the assessment of cell proliferation in biopsies from cancer patients. Despite this broad application in histopathology, functional evidence for the physiological role of pKi-67 is still missing. Recently, we proposed a function of pKi-67 in the early steps of ribosomal RNA (rRNA) synthesis. Here, we have examined the involvement of pKi-67 in this process by photochemical inhibition using chromophore-assisted light inactivation (CALI). Anti-pKi-67 antibodies were labelled with the fluorochrome fluorescein 5(6)-isothiocyanate and were irradiated after binding to their target protein. Performing CALI in vitro on cell lysates led to specific cross-linking of pKi-67. Moreover, the upstream binding factor (UBF) necessary for rRNA transcription was also partly subjected to cross-link formation, indicating a close spatial proximity of UBF and pKi-67. CALI in living cells, using micro-injected antibody, caused a striking relocalization of UBF from foci within the nucleoli to spots located at the nucleolar rim or within the nucleoplasm. pKi-67-CALI resulted in dramatic inhibition of RNA polymerase I-dependent nucleolar rRNA synthesis, whereas RNA polymerase II-dependent nucleoplasmic RNA synthesis remained almost unaltered. Our data presented here argue for a crucial role of pKi-67 in RNA polymerase I-dependent nucleolar rRNA synthesis.

Searches for $B^0_{(s)} \\to J/\\psi p\\bar{p}$ and $B^+ \\to J/\\psi p\\bar{p}\\pi^+$ decays

CERN Document Server

INSPIRE-00258707; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Di Ruscio, F; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Holtrop, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; Mc Skelly, B; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

The results of searches for $B^0_{(s)} \\to J/\\psi p\\bar{p}$ and $B^+ \\to J/\\psi p\\bar{p}\\pi^+$ decays are reported. The analysis is based on a data sample, corresponding to an integrated luminosity of 1.0 fb$^{-1}$ of $pp$ collisions, collected with the LHCb detector. An excess with 2.8 $\\sigma$ significance is seen for the decay $B^0_{s} \\to J/\\psi p\\bar{p}$ and an upper limit on the branching fraction is set at the 90% confidence level: $B(B^0_s \\to J/\\psi p\\bar{p}) \\lt$ 4.8 x 10$^{-6}$, which is the first such limit. No significant signals are seen for $B^0 \\to J/\\psi p\\bar{p}$ and $B^+ \\to J/\\psi p\\bar{p}\\pi^+$ decays, for which the corresponding limits are set: $B(B^0 \\to J/\\psi p\\bar{p}) \\lt$ 5.2 x 10$^{-7}$, which significantly improves the existing limit; and $B(B^+ \\to J/\\psi p\\bar{p}\\pi^+) \\lt$ 5.0 x 10$^{-7}$, which is the first limit on this branching fraction.

Initiation factor eIF2B not p70 S6 kinase is involved in the activation of the PI-3K signalling pathway induced by the v=src oncogene

Czech Academy of Sciences Publication Activity Database

Vojtěchová, Martina; Šloncová, Eva; Kučerová, Dana; Jiřička, Jaroslav; Sovová, Vlasta; Tuháčková, Zdena

2003-01-01

Roč. 543, 1-3 (2003), s. 81-86 ISSN 0014-5793 R&D Projects: GA ČR GV312/96/K205; GA ČR GA301/00/0269; GA MZd NC5428 Institutional research plan: CEZ:AV0Z5052915 Keywords : phosphoinositide 3-kinase signalling pathway * mRNA translation * 70 kDa ribosomal protein S6 kinase Subject RIV: CE - Biochemistry Impact factor: 3.609, year: 2003

Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit

Energy Technology Data Exchange (ETDEWEB)

Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.

2008-01-01

The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.

Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

Science.gov (United States)

Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

2016-12-01

Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

KAUST Repository

Wang, Yong; Qian, Pei-Yuan

2009-01-01

Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

Growth Inhibition by Bupivacaine Is Associated with Inactivation of Ribosomal Protein S6 Kinase 1

Science.gov (United States)

Beigh, Mushtaq Ahmad; Showkat, Mehvish; Bashir, Basharat; Bashir, Asma; Hussain, Mahboob ul; Andrabi, Khurshid Iqbal

2014-01-01

Bupivacaine is an amide type long acting local anesthetic used for epidural anesthesia and nerve blockade in patients. Use of bupivacaine is associated with severe cytotoxicity and apoptosis along with inhibition of cell growth and proliferation. Although inhibition of Erk, Akt, and AMPK seemingly appears to mediate some of the bupivacaine effects, potential downstream targets that mediate its effect remain unknown. S6 kinase 1 is a common downstream effector of several growth regulatory pathways involved in cell growth and proliferation known to be affected by bupivacaine. We have accordingly attempted to relate the growth inhibitory effects of bupivacaine with the status of S6K1 activity and we present evidence that decrease in cell growth and proliferation by bupivacaine is mediated through inactivation of S6 kinase 1 in a concentration and time dependent manner. We also show that ectopic expression of constitutively active S6 kinase 1 imparts substantial protection from bupivacaine induced cytotoxicity. Inactivation of S6K1 though associated with loss of putative mTOR mediated phosphorylation did not correspond with loss of similar phosphorylations in 4EBP1 indicating that S6K1 inhibition was not mediated through inactivation of mTORC1 signaling pathway or its down regulation. PMID:24605337

Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

Directory of Open Access Journals (Sweden)

Jeffrey R Johansen

Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

Architecture of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad

2014-01-23

Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

Further characterization of ribosome binding to thylakoid membranes

International Nuclear Information System (INIS)

Hurewitz, J.; Jagendorf, A.T.

1987-01-01

Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

Science.gov (United States)

Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

1976-01-01

Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

Caracterización e inmunoreactividad de la proteína acídica Ribosomal P2ß de L. (V. braziliensis

Directory of Open Access Journals (Sweden)

Carlos Padilla R

2003-04-01

Full Text Available Introducción: El diagnóstico serológico de la leishmaniasis usando proteínas totales presenta reacciones cruzadas. La caracterización de nuevos antígenos de Leishmania mejorará el uso de herramientas serológicas en el diagnóstico de esta enfermedad. Objetivo: Caracterizar un nuevo antígeno de Leishmania. Materiales y métodos: Se seleccionó el bacteriófago T166-U19 de una biblioteca de cADN de L. (V. braziliensis el cual es reactivo a mezclas de sueros de leishmaniasis cutánea y mucocutánea. El cADN del clon T166-U19 fue subclonado en el plásmido pGEX, luego secuenciado y la proteína recombinante fue expresada. La reactividad de esta proteína recombinante se evaluó por ELISA. Resultados: El cADN del clon T166- U19 presentó un marco de lectura abierto de 318 pb que traduce una proteína de 105 aminoácidos con 81,1%, 82,9% y 60,7% de identidad total con la proteína acídica ribosomal LiP de L. (L. infantum, P2 de L. (L. donovani, y P2 de T. cruzi, respectivamente. Además, la proteína recombinante presentó baja reactividad (50% con sueros de pacientes con leishmaniosis, mientras que presentó reactividad cruzada con sueros de pacientes chagásicos. Conclusiones: Se caracterizó por primera vez la proteína acídica ribosomal P2B de L. (V. braziliensis, y presentando baja reactividad con sueros de pacientes con leishmaniasis.

Studies on the catalytic rate constant of ribosomal peptidyltransferase.

Science.gov (United States)

Synetos, D; Coutsogeorgopoulos, C

1987-02-20

A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

Overexpression of Notch3 and pS6 Is Associated with Poor Prognosis in Human Ovarian Epithelial Cancer

Directory of Open Access Journals (Sweden)

Zhaoxia Liu

2016-01-01

Full Text Available Notch3 and pS6 play important roles in tumor angiogenesis. To assess the expression of Notch3 and pS6 in Chinese ovarian epithelial cancer patients, a ten-year follow-up study was performed in ovarian epithelial cancer tissues from 120 specimens of human ovarian epithelial cancer, 30 specimens from benign ovarian tumors, and 30 samples from healthy ovaries by immunohistochemistry. The results indicate that the expression of Notch3 and pS6 was higher in ovarian epithelial cancer than in normal ovary tissues and in benign ovarian tumor tissues (p0.05 but positively associated with clinical stage, pathological grading, histologic type, lymph node metastasis, and ascites (p<0.05 or p<0.01. A follow-up survey of 64 patients with ovarian epithelial cancer showed that patients with high Notch3 and pS6 expression had a shorter survival time (p<0.01, in which the clinical stage (p<0.05 and Notch3 expression (p<0.01 played important roles. In conclusion, Notch3 and pS6 are significantly related to ovarian epithelial cancer development and prognosis, and their combination represents a potential biomarker and therapeutic target in ovarian tumor angiogenesis.

Mutation of the key residue for extraribosomal function of ribosomal protein S19 cause increased grooming behaviors in mice.

Science.gov (United States)

Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro

2016-08-26

Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

Czech Academy of Sciences Publication Activity Database

Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.

2017-01-01

Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

International Nuclear Information System (INIS)

Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya

2013-01-01

Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

cDNA, genomic sequence cloning and analysis of the ribosomal ...

African Journals Online (AJOL)

Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

Science.gov (United States)

Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

2016-01-01

Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

Posttranscriptional modifications in the A-loop of 23S rRNAs from selected archaea and eubacteria.

OpenAIRE

Hansen, M A; Kirpekar, F; Ritterbusch, W; Vester, B

2002-01-01

Posttranscriptional modifications were mapped in helices 90-92 of 23S rRNA from the following phylogenetically diverse organisms: Haloarcula marismortui, Sulfolobus acidocaldarius, Bacillus subtilis, and Bacillus stearothermophilus. Helix 92 is a component of the ribosomal A-site, which contacts the aminoacyl-tRNA during protein synthesis, implying that posttranscriptional modifications in helices 90-92 may be important for ribosome function. RNA fragments were isolated from 23S rRNA by site-...

Trapping the ribosome to control gene expression.

Science.gov (United States)

Boehringer, Daniel; Ban, Nenad

2007-09-21

Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

Alignment creation in atomic ensembles by elastic electron scattering; the case of 138Ba(...6s6p 1P1) atoms

International Nuclear Information System (INIS)

Trajmar, S.; Kanik, I.; LeClair, L.R.; Khakoo, M.A.; Bray, I.; Fursa, D.; Csanak, G.

1998-01-01

We describe some of our results from a joint experimental and theoretical program concerning elastic electron scattering by 138 Ba(...6s6p 1 P 1 ) atoms. From the experimental results, we derived various scattering parameters and magnetic sublevel specific differential elastic scattering cross sections at impact energy (E 0 ) of 20.0 eV and at scattering angles (θ) of 10deg, 15deg, and 20deg. The same parameters and cross sections were calculated by the convergent close coupling (CCC) approximation and compared to the experimental results. An excellent agreement, found for the two sets of data, gave us confidence in the CCC method and allowed us to extend the angular and energy ranges for the purpose of generating integral elastic scattering cross sections needed for the deduction of the alignment creation cross sections. (J.P.N.)

An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.

Science.gov (United States)

Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben

2018-01-04

sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

Czech Academy of Sciences Publication Activity Database

Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.

2016-01-01

Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

Science.gov (United States)

Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

2006-01-01

The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

Posttranscriptional modifications in the A-loop of 23S rRNAs from selected archaea and eubacteria.

Science.gov (United States)

Hansen, M A; Kirpekar, F; Ritterbusch, W; Vester, B

2002-02-01

Posttranscriptional modifications were mapped in helices 90-92 of 23S rRNA from the following phylogenetically diverse organisms: Haloarcula marismortui, Sulfolobus acidocaldarius, Bacillus subtilis, and Bacillus stearothermophilus. Helix 92 is a component of the ribosomal A-site, which contacts the aminoacyl-tRNA during protein synthesis, implying that posttranscriptional modifications in helices 90-92 may be important for ribosome function. RNA fragments were isolated from 23S rRNA by site-directed RNase H digestion. A novel method of mapping modifications by analysis of short, nucleotide-specific, RNase digestion fragments with Matrix Assisted Laser Desorption/Ionization Mass Spectrometry (MALDI-MS) was utilized. The MALDI-MS data were complemented by two primer extension techniques using reverse transcriptase. One technique utilizes decreasing concentrations of deoxynucleotide triphosphates to map 2'-O-ribose methylations. In the other, the rRNA is chemically modified, followed by mild alkaline hydrolysis to map pseudouridines (psis). A total of 10 posttranscriptionally methylated nucleotides and 6 psis were detected in the five organisms. Eight of the methylated nucleotides and one psi have not been reported previously. The distribution of modified nucleotides and their locations on the surface of the ribosomal peptidyl transferase cleft suggests functional importance.

The complete structure of the large subunit of the mammalian mitochondrial ribosome.

Science.gov (United States)

Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad

2014-11-13

Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

Energy Technology Data Exchange (ETDEWEB)

Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.

2017-08-28

Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

Expression of the cytochrome P450s, CYP6P3 and CYP6M2 are significantly elevated in multiple pyrethroid resistant populations of Anopheles gambiae s.s. from Southern Benin and Nigeria

Directory of Open Access Journals (Sweden)

Ranson Hilary

2008-11-01

Full Text Available Abstract Background Insecticide resistance in Anopheles mosquitoes is threatening the success of malaria control programmes. This is particularly true in Benin where pyrethroid resistance has been linked to the failure of insecticide treated bed nets. The role of mutations in the insecticide target sites in conferring resistance has been clearly established. In this study, the contribution of other potential resistance mechanisms was investigated in Anopheles gambiae s.s. from a number of localities in Southern Benin and Nigeria. The mosquitoes were sampled from a variety of breeding sites in a preliminary attempt to investigate the role of contamination of mosquito breeding sites in selecting for resistance in adult mosquitoes. Results All mosquitoes sampled belonged to the M form of An. gambiae s.s. There were high levels of permethrin resistance in an agricultural area (Akron and an urban area (Gbedjromede, low levels of resistance in mosquito samples from an oil contaminated site (Ojoo and complete susceptibility in the rural Orogun location. The target site mutation kdrW was detected at high levels in two of the populations (Akron f = 0.86 and Gbedjromede f = 0.84 but was not detected in Ojoo or Orogun. Microarray analysis using the Anopheles gambiae detox chip identified two P450s, CYP6P3 and CYP6M2 up regulated in all three populations, the former was expressed at particularly high levels in the Akron (12.4-fold and Ojoo (7.4-fold populations compared to the susceptible population. Additional detoxification and redox genes were also over expressed in one or more populations including two cuticular pre-cursor genes which were elevated in two of the three resistant populations. Conclusion Multiple resistance mechanisms incurred in the different breeding sites contribute to resistance to permethrin in Benin. The cytochrome P450 genes, CYP6P3 and CYP6M2 are upregulated in all three resistant populations analysed. Several additional potential

Influence of supplementation with branched-chain amino acids in combination with resistance exercise on p70S6 kinase phosphorylation in resting and exercising human skeletal muscle.

Science.gov (United States)

Apró, W; Blomstrand, E

2010-11-01

Skeletal muscle growth is thought to be regulated by the mammalian target of rapamycin (mTOR) pathway, which can be activated by resistance exercise and branched-chain amino acids (BCAA). The major aim of the present study was to distinguish between the influence of resistance exercise and BCAA on key enzymes considered to be involved in the regulation of protein synthesis, including p70(S6) kinase (p70(S6k)). Nine healthy subjects (four men and five women) performed unilateral resistance exercise on two occasions separated by 1 month. Subjects were randomly supplied either a mixture of BCAA or flavoured water. Muscle biopsies were taken from both resting and exercising muscle before, after and 1 h after exercise. Phosphorylation of Akt was unaltered by either resistance exercise and/or BCAA supplementation whereas mTOR phosphorylation was enhanced (Pexercising and resting muscle following exercise in the absence (70-90%) and presence of BCAA supplementation (80-130%). Phosphorylation of p70(S6k) was unaffected by resistance exercise alone; however, BCAA intake increased (Pexercise. In resting muscle, a 5- and 16-fold increase in p70(S6k) was observed immediately after and 1 h after exercise, respectively, as compared to 11- and 30-fold increases in the exercising muscle. Phosphorylation of eukaryotic elongation factor 2 was attenuated 1 h after exercise (Pexercising muscle (30-50%) under both conditions. The present findings indicate that resistance exercise and BCAA exert both separate and combined effects on the p70(S6k) phosphorylation in an Akt-independent manner. © 2010 The Authors. Journal compilation © 2010 Scandinavian Physiological Society.

Topography and stoichiometry of acidic proteins in large ribosomal subunits from Artemia salina as determined by crosslinking

International Nuclear Information System (INIS)

Uchiumi, T.; Wahba, A.J.; Traut, R.R.

1987-01-01

The 60S subunits isolated from Artemia salina ribosomes were treated with the crosslinking reagent 2-iminothiolane under mild conditions. Proteins were extracted and fractions containing crosslinked acidic proteins were obtained by stepwise elution from CM-cellulose. Each fraction was analyzed by diagonal (two-dimensional nonreducing-reducing) NaDodSO 4 /polyacrylamide gel electrophoresis. Crosslinked proteins below the diagonal were radioiodinated and identified by two-dimensional acidic urea-NaDodSO 4 gel electrophoresis. Each of the acidic proteins P1 and P2 was crosslinked individually to the same third protein, PO. The fractions containing acidic proteins were also analyzed by two-dimensional nonequilibrium isoelectric focusing-NaDodSO 4 /polyacrylamide gel electrophoresis. Two crosslinked complexes were observed that coincide in isoelectric positions with monomeric P1 and P2, respectively. Both P1 and P2 appear to form crosslinked homodimers. These results suggest the presence in the 60S subunit of (P1) 2 and (P2) 2 dimers, each of which is anchored to PO. Protein PO appears to play the same role as L10 in Escherichia coli ribosomes and may form a pentameric complex with the two dimers in the 60S subunits

Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells.

Science.gov (United States)

Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong

2016-12-06

Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

Cloning, purification, crystallization and preliminary X-ray analysis of the Burkholderia pseudomallei L1 ribosomal protein

International Nuclear Information System (INIS)

Abd Aziz, Abd Ghani; Ruzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Mohamed, Rahmah; Nathan, Sheila; Baker, Patrick J.; Rice, David W.

2012-01-01

The L1 ribosomal protein from B. pseudomallei has been overexpressed, purified and crystallized in a form suitable for X-ray analysis. The gene encoding the L1 ribosomal protein from Burkholderia pseudomallei strain D286 has been cloned into the pETBLUE-1 vector system, overexpressed in Escherichia coli and purified. Crystals of the native protein were grown by the hanging-drop vapour-diffusion technique using PEG 3350 as a precipitant and diffracted to beyond 1.65 Å resolution. The crystals belonged to space group P2 1 2 1 2, with unit-cell parameters a = 53.6, b = 127.1, c = 31.8 Å and with a single molecule in the asymmetric unit

Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer

Science.gov (United States)

2017-02-01

and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

Interaction of tRNA with Eukaryotic Ribosome

Directory of Open Access Journals (Sweden)

Dmitri Graifer

2015-03-01

Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

DSM - a perspective for the 90's

International Nuclear Information System (INIS)

Mazzo, M.A. Jr.

1993-01-01

Demand Side Management (DSM) Programs are becoming important facets in the resource planning activities of many utilities. These programs have made substantial impacts to some utilities during the late 1980's, especially those in the Northeast. They will continue to play major roles in utility activities through the 90's. There are major issues which will be addressed and answered in the 90's in order for DSM to continue to play a role in the 1990's

The Hsp90 co-chaperones Sti1, Aha1, and P23 regulate adaptive responses to antifungal azoles

Directory of Open Access Journals (Sweden)

Xiaokui Gu

2016-10-01

Full Text Available Heat Shock Protein 90 (Hsp90 is essential for tumor progression in humans and drug resistance in fungi. However, the roles of its many co-chaperones in antifungal resistance are unknown. In this study, by susceptibility test of Neurospora crassa mutants lacking each of 18 Hsp90/Calcineurin system member genes (including 8 Hsp90 co-chaperone genes to antifungal drugs and other stresses, we demonstrate that the Hsp90 co-chaperones Sti1 (Hop1 in yeast, Aha1, and P23 (Sba1 in yeast were required for the basal resistance to antifungal azoles and heat stress. Deletion of any of them resulted in hypersensitivity to azoles and heat. Liquid chromatography–mass spectrometry (LC-MS analysis showed that the toxic sterols eburicol and 14α-methyl-3,6-diol were significantly accumulated in the sti1 and p23 deletion mutants after ketoconazole treatment, which has been shown before to led to cell membrane stress. At the transcriptional level, Aha1, Sti1, and P23 positively regulate responses to ketoconazole stress by erg11 and erg6, key genes in the ergosterol biosynthetic pathway. Aha1, Sti1, and P23 are highly conserved in fungi, and sti1 and p23 deletion also increased the susceptibility to azoles in Fusarium verticillioides. These results indicate that Hsp90-cochaperones Aha1, Sti1, and P23 are critical for the basal azole resistance and could be potential targets for developing new antifungal agents.

Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics.

Science.gov (United States)

Pakula, Kevin K; Hansen, Lykke H; Vester, Birte

2017-09-01

Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

Crystallization and preliminary crystallographic studies of L30e, a ribosomal protein from Methanocaldococcus jannaschii (MJ1044)

International Nuclear Information System (INIS)

Rangarajan, Sarani; Jeyakanthan, Jeyaraman; Mridula, Palappetty; Sakamoto, Keiko; Kitamura, Yoshiaki; Agari, Yoshihiro; Shinkai, Akeo; Ebihara, Akio; Kuramitsu, Seiki; Yokoyama, Shigeyuki; Sekar, Kanagaraj

2008-01-01

The ribosomal protein (L30e) from M. jannaschii was cloned from the gene MJ1044, expressed, purified and crystallized. The crystal belongs to the primitive tetragonal space group P4 3 and diffracted to 1.9 Å resolution. In view of the biological significance of understanding the ribosomal machinery of both prokaryotes and eukaryotes, the L30e ribosomal protein from Methanocaldococcus jannaschii was cloned, overexpressed, purified and crystallized using the microbatch-under-oil method with the crystallization conditions 40% PEG 400, 0.1 M MES pH 6.0 and 5% PEG 3000 at 291 K. A diffraction-quality crystal (0.20 × 0.20 × 0.35 mm) was obtained that belonged to the primitive tetragonal space group P4 3 , with unit-cell parameters a = 46.1, b = 46.1, c = 98.5 Å, and diffracted to a resolution of 1.9 Å. Preliminary calculations reveal that the asymmetric unit contains two monomers with a Matthews coefficient (V M ) of 2.16 Å 3 Da −1

Compact structure of ribosomal protein S4 in solution as revealed by small-angle X-ray scattering

International Nuclear Information System (INIS)

Serdyuk, I.N.; Sarkisyan, M.A.; Gogia, Z.V.

1981-01-01

The authors report the results of a small-angle X-ray scattering study of ribosomal protein preparations obtained by neutron scattering method. The theoretical resolution of the diffractometer (Kratky camera, the entrance slit 80 μm, the receiving slit 190 μm, the sample-detector distance 20.4 cm) was the same as the resolution of X-ray diffractometers, on which high rsub(g) values for ribosomal proteins were obtained. They used protein S4 adjusted to 20 mg/ml without any essential loss of solubility. The scattering indicatrix obtained in a wide range of angles has demonstrated that the X-ray rsub(g) obtained here coincides with the earlier obtained neutron rsub(g) and the outer part of the scattering curve is similar to that of slightly elongated compact bodies. They conclude that all discrepancies between their data on the study of ribosomal protein structure in solution and other data are not connected with the characteristics of the instruments used but only with the quality of the protein preparations. (Auth.)

BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo

DEFF Research Database (Denmark)

Sapkota, Gopal P; Cummings, Lorna; Newell, Felicity S

2007-01-01

), which then mediate many of the physiological processes that are regulated by these extracellular agonists. It can be difficult to assess the individual functions of each AGC kinase because their substrate specificities are similar. Here we describe the small molecule BI-D1870, which inhibits RSK1, RSK2......, RSK3 and RSK4 in vitro with an IC(50) of 10-30 nM, but does not signi-ficantly inhibit ten other AGC kinase members and over 40 other protein kinases tested at 100-fold higher concentrations. BI-D1870 is cell permeant and prevents the RSK-mediated phorbol ester- and EGF (epidermal growth factor......)-induced phosphoryl-ation of glycogen synthase kinase-3beta and LKB1 in human embry-onic kidney 293 cells and Rat-2 cells. In contrast, BI-D1870 does not affect the agonist-triggered phosphorylation of substrates for six other AGC kinases. Moreover, BI-D1870 does not suppress the phorbol ester- or EGF...

Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

Institute of Scientific and Technical Information of China (English)

Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao

2017-01-01

As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

Immunohistochemical Analysis of the Activation Status of the Akt/mTOR/pS6 Signaling Pathway in Oral Lichen Planus

Directory of Open Access Journals (Sweden)

Georgios Prodromidis

2013-01-01

Full Text Available Introduction. Aberrations of the Akt/mTOR/pS6 pathway have been linked to various types of human cancer, including oral squamous cell carcinoma (OSCC. The purpose of this study was to evaluate the activation status of Akt, mTOR, and pS6 in oral lichen planus (OLP in comparison with oral premalignant and malignant lesions and normal oral mucosa (NM. Materials and Methods. Immunohistochemistry for p-Akt, p-mTOR, and phospho-pS6 was performed in 40 OLP, 20 oral leukoplakias (OL, 10 OSCC, and 10 control samples of NM. Results. Nuclear p-Akt expression was detected in the vast majority of cases in all categories, being significantly higher in OL. Cytoplasmic p-Akt and p-mTOR staining was present only in a minority of OLP cases, being significantly lower compared to OL and OSCC. Phospho-pS6 showed cytoplasmic positivity in most OLP cases, which however was significantly lower compared to OL and OSCC. Conclusions. Overall, cytoplasmic p-Akt, p-mTOR, and phospho-pS6 levels appear to be significantly lower in OLP compared to OL and OSCC. However, the expression of these molecules in a subset of OLP cases suggests that activation of Akt/mTOR/pS6 may occur in the context of OLP, possibly contributing to the premalignant potential of individual cases.

Structural and functional implications in the eubacterial ribosome as revealed by protein-rRNA and antibiotic contact sites.

Science.gov (United States)

Wittmann-Liebold, B; Uhlein, M; Urlaub, H; Müller, E C; Otto, A; Bischof, O

1995-01-01

Contact sites between protein and rRNA in 30S and 50S ribosomal subunits of Escherichia coli and Bacillus stearothermophilus were investigated at the molecular level using UV and 2-iminothiolane as cross-linkers. Thirteen ribosomal proteins (S3, S4, S7, S14, S17, L2, L4, L6, L14, L27, L28, L29, and L36) from these organisms were cross-linked in direct contact with the RNAs, and the peptide stretches as well as amino acids involved were identified. Further, the binding sites of puromycin and spiramycin were established at the peptide level in several proteins that were found to constitute the antibiotic-binding sites. Peptide stretches of puromycin binding were identified from proteins S7, S14, S18, L18, AND L29; those of spiramycin attachment were derived from proteins S12, S14, L17, L18, L27, and L35. Comparison of the RNA-peptide contact sites with the peptides identified for antibiotic binding and with those altered in antibiotic-resistant mutants clearly showed identical peptide areas to be involved and, hence, demonstrated the functional importance of these peptides. Further evidence for a functional implication of ribosomal proteins in the translational process came from complementation experiments in which protein L2 from Halobacterium marismortui was incorporated into the E. coli ribosomes that were active. The incorporated protein was present in 50S subunits and 70S particles, in disomes, and in higher polysomes. These results clearly demonstrate the functional implication of protein L2 in protein biosynthesis. Incorporation studies with a mutant of HmaL2 with a replacement of histidine-229 by glycine completely abolished the functional activity of the ribosome. Accordingly, protein L2 with histidine-229 is a crucial element of the translational machinery.

Genome-wide mRNA processing in methanogenic archaea reveals post-transcriptional regulation of ribosomal protein synthesis.

Science.gov (United States)

Qi, Lei; Yue, Lei; Feng, Deqin; Qi, Fengxia; Li, Jie; Dong, Xiuzhu

2017-07-07

Unlike stable RNAs that require processing for maturation, prokaryotic cellular mRNAs generally follow an 'all-or-none' pattern. Herein, we used a 5΄ monophosphate transcript sequencing (5΄P-seq) that specifically captured the 5΄-end of processed transcripts and mapped the genome-wide RNA processing sites (PSSs) in a methanogenic archaeon. Following statistical analysis and stringent filtration, we identified 1429 PSSs, among which 23.5% and 5.4% were located in 5΄ untranslated region (uPSS) and intergenic region (iPSS), respectively. A predominant uridine downstream PSSs served as a processing signature. Remarkably, 5΄P-seq detected overrepresented uPSS and iPSS in the polycistronic operons encoding ribosomal proteins, and the majority upstream and proximal ribosome binding sites, suggesting a regulatory role of processing on translation initiation. The processed transcripts showed increased stability and translation efficiency. Particularly, processing within the tricistronic transcript of rplA-rplJ-rplL enhanced the translation of rplL, which can provide a driving force for the 1:4 stoichiometry of L10 to L12 in the ribosome. Growth-associated mRNA processing intensities were also correlated with the cellular ribosomal protein levels, thereby suggesting that mRNA processing is involved in tuning growth-dependent ribosome synthesis. In conclusion, our findings suggest that mRNA processing-mediated post-transcriptional regulation is a potential mechanism of ribosomal protein synthesis and stoichiometry. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Relationship between organization and function of ribosomal genes in Drosophila melanogaster

International Nuclear Information System (INIS)

Karpen, G.H.

1987-01-01

In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional

Search for b → X μ + μ - and B 0 → μ + μ - decays in p anti p Collisions at √ s= 1.8 TeV

International Nuclear Information System (INIS)

Abachi, S.

1996-08-01

We have searched for the flavor-changing neutral current decays b → Xμ + μ - and B 0 → μ + μ - in p anti p collisions at √s 1.8 TeV with the D0 detector at Fermilab. Using our observed μ + μ - mass spectrum and the measured b production cross section we determine the 90% confidence limit for the branching fraction B(b → sμ + μ - ) -5 . For the exclusive, purely leptonic decay B 0 → μ + μ - we obtain a 90% confidence level limit B(B 0 → μ + μ - ) -6 . 9 refs., 3 figs

Halogenated benzimidazole inhibitors of phosphorylation, ''in vitro'' and ''in vivo'', of the surface acidic proteins of the yeast ribosomal 60S subunit by endogenous protein kinases CK-II and PK60S

International Nuclear Information System (INIS)

Szyszka, Ryszard; Boguszewska, Aleksandra; Grankowski, Nikodem; Shugar, David

1996-01-01

Several halogeno benzimidazoles and 2-azabenzimidazoles, previously shown to be relatively selective inhibitors of protein kinases CK-I and/or CK-II from various sources, including CK-II from yeast [Szyszka et al. (1995) Biochem. Biophys. Res. Commun. 208, 418-424] inhibit also the yeast ribosomal protein kinase PK60S. The most effective inhibitor of CK-II and PK60S was tetrabromo-2-azabenzimidazole (TetraBr-2-azaBz), which was competitive with respect to ATP (and GTP in the case of CK-II) with K i values of 0.7 μM for CK-II, and 0.1 μM for PK60S. PK60S phosphorylates only three (YP1β, YB1β', YP2α) out of five polypeptides of pp13 kDa acidic proteins of 60S subunit phosphorylated by CK-II [Szyszka et al. (1995) Acta Biochim. Polon. 42, 357-362]. Accordingly, TetraBr-azaBz inhibits phosphorylation only of these polypeptides, catalysed by PK60S. Addition of TetraBr-2Bz to cultures of yeast cells, at concentrations which were without effect on cell growth, led to inhibition of intracellular phosphorylation of ribosomal acidic proteins, paralleling that observed ''in vitro''. TetraBr-2-azaBz is shown to be a useful tool for studies on the intracellular regulation of phosphorylation of the ribosomal 60S acidic proteins, which are involved in formation of active ribosomes. (author). 36 refs, 4 figs, 2 tabs

Electron correlation in the 4d-16p→5s-26p and 5s-15p-16p resonance Auger transitions of Xe

International Nuclear Information System (INIS)

Osmekhin, S.; Nikkinen, J.; Sankari, R.; Maeaettae, M.; Kukk, E.; Huttula, M.; Heinaesmaeki, S.; Aksela, H.; Aksela, S.

2007-01-01

The Xe 4d -1 6p→5s 0 5p 6 6p and 5s 1 5p 5 6p resonant Auger transitions have been studied both theoretically and experimentally. High resolution resonant Auger spectra have been recoded with different photon bandwidths which have enabled to separate the first step Auger transition from the overlapping second step transitions. Theoretical calculations using multi-configuration Dirac-Fock approach with different configuration expansions were carried out, compared to each other and to the experiment. The calculations with the largest basis set were found to reproduce the distribution of the intensity to the main and satellite lines in both the 5s 0 5p 6 6p and 5s 1 5p 5 6p Auger groups reasonably well, and to predict the structure of the 4d -1 6p→5s 0 5p 6 6p main lines very well

Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

International Nuclear Information System (INIS)

Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.

1986-01-01

The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

Science.gov (United States)

Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

1987-11-01

Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation

Science.gov (United States)

Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A

2011-01-01

The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906

Microglia P2Y6 receptor is related to Parkinson’s disease through neuroinflammatory process

Directory of Open Access Journals (Sweden)

Xiaodong Yang

2017-02-01

Full Text Available Abstract Background Microglia in the central nervous system (CNS were reported to play crucial role in neurodegeneration. Previous studies showed that P2Y6 receptor (P2Y6R mainly contributed to microglia activation and phagocytosis in CNS. However, the level of P2Y6R in Parkinson’s disease (PD patients is unclear. Therefore, we measured the level of P2Y6R in PD patients and speculated whether it could be a potential biomarker for PD. Given on the basis that P2Y6R was higher in PD patients, we further explored the mechanisms underlying P2Y6R in the pathogenesis of PD. Methods We tested the expression level of P2Y6R in the peripheral blood mononuclear cells (PBMCs among 145 PD patients, 170 healthy controls, and 30 multiple system atrophy (MSA patients. We also used a lipopolysaccharide (LPS-stimulated microglial cell culture model to investigate (i the effects of LPS on P2Y6R expression with western blot and RT-PCR, (ii the effects of LPS on UDP expression using HPLC, (iii the effects of UDP/P2Y6R signaling on cytokine expression using western blot, RT-PCR, and ELISA, and (iv the signaling pathways activated by the P2Y6R involved in the neuroinflammation. Results Expression levels of P2Y6R in PD patients were higher than healthy controls and MSA patients. P2Y6R could be a good biomarker of PD. P2Y6R was also upregulated in LPS-treated BV-2 cells and involved in proinflammatory cytokine release through an autocrine loop based on LPS-triggered UDP secretion and accelerated neuroinflammatory responses through the ERK1/2 pathway. Importantly, blocking UDP/P2Y6R signaling could reverse these pathological processes. Conclusions P2Y6R may be a potential clinical biomarker of PD. Blocking P2Y6R may be a potential therapeutic approach to the treatment of PD patients through inhibition of microglia-activated neuroinflammation.

Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

International Nuclear Information System (INIS)

Boehm, H.; Stahl, J.; Bielka, H.

1979-01-01

N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

Macrolide antibiotic interaction and resistance on the bacterial ribosome.

Science.gov (United States)

Poehlsgaard, Jacob; Douthwaite, Stephen

2003-02-01

Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

Cis-regulatory RNA elements that regulate specialized ribosome activity.

Science.gov (United States)

Xue, Shifeng; Barna, Maria

2015-01-01

Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

Role of blood ribosomal protein S19 in coagulum resorption: a study using Gln137Glu-ribosomal protein S19 gene knock-in mouse.

Science.gov (United States)

Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro

2014-11-01

Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.

Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor

Energy Technology Data Exchange (ETDEWEB)

Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr

2016-03-25

TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. - Highlights: • Multiple regions on the Arabidopsis Raptor protein were found to be involved in substrate binding. • N-terminal end of the Arabidopsis ribosomal S6 kinase 1 (AtS6K1) was responsible for interacting with AtRaptor1. • The Raptor-interacting fragment of AtS6K1 could be utilized as an effective inhibitor of plant TOR signaling.

Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor

International Nuclear Information System (INIS)

Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill

2016-01-01

TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. - Highlights: • Multiple regions on the Arabidopsis Raptor protein were found to be involved in substrate binding. • N-terminal end of the Arabidopsis ribosomal S6 kinase 1 (AtS6K1) was responsible for interacting with AtRaptor1. • The Raptor-interacting fragment of AtS6K1 could be utilized as an effective inhibitor of plant TOR signaling.

Limit on the $B^0_s \\bar{B}^0_s$ meson oscillation frequency from $p\\bar{p}$ collision data at $\\sqrt{s} = 1.8$-TeV

Energy Technology Data Exchange (ETDEWEB)

Niu, Hong-quan [Brandeis Univ., Waltham, MA (United States)

2003-01-01

This thesis presents a limit on the B$0\\atop{s}$$\\bar{B}$$0\\atop{s}$ oscillation frequency from p$\\bar{p}$ collision data at √s = 1.8 TeV at CDF. The data sample used is the inclusive electron and muon trigger data of approximately 90 pb^-1 collected during the 1993-95 run.

Theory of the (n,p) reaction on /sup 90/Zr

International Nuclear Information System (INIS)

Yabe, M.

1987-01-01

A theoretical study of the /sup 90/Zr(n,p) reaction is performed at an incident energy of 200 MeV. The forward angle /sup 90/Zr(n,p)= spectra are calculated within a microscopic model using random phase approximation transition densities for the description of the nuclear excited states. The calculated spectra are compared to those published previously by Klein, Love, and Auerbach

Emergence of Tetracycline Resistance in Helicobacter pylori: Multiple Mutational Changes in 16S Ribosomal DNA and Other Genetic Loci

Science.gov (United States)

Dailidiene, Daiva; Bertoli, M. Teresita; Miciuleviciene, Jolanta; Mukhopadhyay, Asish K.; Dailide, Giedrius; Pascasio, Mario Alberto; Kupcinskas, Limas; Berg, Douglas E.

2002-01-01

Tetracycline is useful in combination therapies against the gastric pathogen Helicobacter pylori. We found 6 tetracycline-resistant (Tetr) strains among 159 clinical isolates (from El Salvador, Lithuania, and India) and obtained the following four results: (i) 5 of 6 Tetr isolates contained one or two nucleotide substitutions in one part of the primary tetracycline binding site in 16S rRNA (AGA965-967 [Escherichia coli coordinates] changed to gGA, AGc, guA, or gGc [lowercase letters are used to represent the base changes]), whereas the sixth (isolate Ind75) retained AGA965-967; (ii) PCR products containing mutant 16S ribosomal DNA (rDNA) alleles transformed recipient strains to Tetr phenotypes, but transformants containing alleles with single substitutions (gGA and AGc) were less resistant than their Tetr parents; (iii) each of 10 Tetr mutants of reference strain 26695 (in which mutations were induced with metronidazole, a mutagenic anti-H. pylori agent) contained the normal AGA965-967 sequence; and (iv) transformant derivatives of Ind75 and of one of the Tetr 26695 mutants that had acquired mutant rDNA alleles were resistant to tetracycline at levels higher than those to which either parent strain was resistant. Thus, tetracycline resistance in H. pylori results from an accumulation of changes that may affect tetracycline-ribosome affinity and/or other functions (perhaps porins or efflux pumps). We suggest that the rarity of tetracycline resistance among clinical isolates reflects this need for multiple mutations and perhaps also the deleterious effects of such mutations on fitness. Formally equivalent mutations with small but additive effects are postulated to contribute importantly to traits such as host specificity and virulence and to H. pylori's great genetic diversity. PMID:12435699

γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

International Nuclear Information System (INIS)

Suessmuth, R.; Widmann, A.

1979-01-01

γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

[Role and related mechanism of S1P/S1P1 signal pathway during post conditioning of hypertrophic cardiomyocytes].

Science.gov (United States)

Bao, X H; Li, H X; Tao, J; Li, X M; Yang, Y N; Ma, Y T; Chen, B D

2016-05-24

To study the role and mechanism of sphingosine-1-phosphate (S1P)/ sphingosine-1-phosphate receptor 1(S1P1) signal pathway during post conditioning of hypertrophic cardiomyocytes. Neonatal rat cardiomyocytes were isolated and cultured, then stimulated by norepinephrine (NE) to induce cardiomyocytes hypertrophy. Using tri-gas incubator to create hypoxia and reoxygenation enviroment to mimic ischemia-reperfusion and postconditioning. Hypertrophic cardiomyoctyes were divided into five groups according to the presence or absence of various drugs and postconditiong and relevant signal pathways changes were detected: (1) IPost group (hypoxia+ postconditioning); (2) IPost+ S1P group (cells were pretreated with S1P (1 μmol/L) for 2 h before IPost); (3) IPost+ W-146+ S1P group (cells in IPost+ W-146+ S1P group were pretreated with S1P1 inhibitor W-146 (0.4 μmol/L) for 20 min); (4) IPost+ PD98059+ S1P group (cells in IPost+ S1P group were pretreated with MAPK antagonist PD98059 (125 μmol/L) for 20 min); (5) IPost+ LY-294002+ S1P group (cells in IPost+ S1P group were pretreated with PI3K antagonist LY294002 (0.1 μmol/L) for 20 min). Apoptosis was detected by flow cytometry and protein expression of relevant signal pathways were detected by Western blot. (1)Apoptosis rate was significantly increased in hypoxia/reoxygenation (27.90±4.49)% group compared with normal control group (7.97±2.18)%, which could be significantly reduced in IPost group (15.90±1.77)% (all PS1P and IPost+ S1P+ LY-294002 groups than in IPost and IPost+ S1P+ W-146 and IPost+ S1P+ PD98059 group (all PS1P and IPost+ S1P+ LY-294002 group than in IPost and IPost+ S1P+ W-146 group and IPost+ S1P+ PD98059 group (all PS1P+ W-146 and IPost+ S1P+ PD98059 groups. p-ERK1/2 and p-Akt levels in IPost+ S1P+ W-146 group and IPost+ S1P+ PD98059 were similar as in IPost group. S1P can play protective role on NE induced cardiomyocytes hypertrophy during post conditioning through downregulating caspase-3 expression and

Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

International Nuclear Information System (INIS)

Tejedor, F.; Ballesta, J.P.

1986-01-01

Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

EST Table: FS869999 [KAIKOcDNA[Archive

Lifescience Database Archive (English)

Full Text Available FS869999 E_FL_fner_41G01_R_0 10/09/28 90 %/258 aa ref|NP_001037132.1| ribosomal pro...6-PB 10/08/29 38 %/244 aa R151.3#CE00744#WBGene00004417#locus:rpl-6#Ribosomal protein ML16#status:Confirmed#UniProt:P4799

In vitro degradation of ribosomes.

Science.gov (United States)

Mora, G; Rivas, A

1976-12-01

The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

Directory of Open Access Journals (Sweden)

Sayaka Tsuji

2017-07-01

Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

Structural basis for ribosome protein S1 interaction with RNA in trans-translation of Mycobacterium tuberculosis.

Science.gov (United States)

Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli

2017-05-27

Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.

(Ph4P)S6—A Compound Containing the Cyclic Radical Anion S6.−

NARCIS (Netherlands)

Neumuller, F.; Schmock, R.; Kirmse, A.; Voigt, A.; Diefenbach, A.; Bickelhaupt, F.M.; Dehnicke, K.

2000-01-01

Two long S−S bonds link the two S3 fragments in the cyclic radical anion S6.−. This forms as orange‐red crystals with PPh4+ as the counterion in the reaction of sulfane with (tetraphenylphosphonium) hydrogen diazide. The anion has a chair conformation with C2h symmetry (see picture).

Differential extracellular signal-regulated kinases 1 and 2 activation by the angiotensin type 1 receptor supports distinct phenotypes of cardiac myocytes

DEFF Research Database (Denmark)

Aplin, Mark; Christensen, Gitte Lund; Schneider, Mikael

2007-01-01

that phosphorylates p90 Ribosomal S6 Kinase, a ubiquitous and versatile mediator of ERK1/2 signal transduction. Moreover, the beta-arrestin2-dependent ERK1/2 signal supports intact proliferation of cardiac myocytes. In contrast to G(q)-activated ERK1/2, and in keeping with its failure to translocate to the nucleus...

Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

Science.gov (United States)

Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2015-06-01

Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events

DEFF Research Database (Denmark)

Jackers, P; Clausse, N; Fernandez, M

1996-01-01

A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed...

Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

DEFF Research Database (Denmark)

Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

2015-01-01

The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA

Science.gov (United States)

Andreeva, Irena

2018-01-01

During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

Energy Technology Data Exchange (ETDEWEB)

Barrow, W; Himmel, M; Squire, P G; Tornabene, T G

1978-01-01

Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

V0 production in p+A collisions at √(s)=41.6 GeV

International Nuclear Information System (INIS)

Abt, I.; Kisel, I.; Adams, M.; Cruse, C.; Ehret, K.; Funcke, M.; Schwenninger, B.; Wegener, D.; Agari, M.; Bauer, C.; Braeuer, M.; Hofmann, W.; Jagla, T.; Knoepfle, K.T.; Pleier, M.A.; Reeves, K.; Sanchez, F.; Schmelling, M.; Schwingenheuer, B.; Sciacca, F.; Albrecht, H.; Aplin, S.J.; Bagaturia, Y.; Egorytchev, V.; Emeliyanov, D.; Flammer, J.; Goloubkov, D.; Golubkov, Y.; Hohlmann, M.; Lewendel, B.; Lomonosov, B.; Masciocchi, S.; Medinnis, M.; Mevius, M.; Michetti, A.; Negodaev, M.; Noerenberg, M.; Nunez Pardo de Vera, M.T.; Padilla, C.; Ressing, D.; Riu, I.; Rybnikov, V.; Schmidt, B.; Schwarz, A.S.; Soezueer, L.; Somov, A.; Somov, S.; Spengler, J.; Wurth, R.; Aleksandrov, A.; Bohm, G.; Gellrich, A.; Hernandez, J.M.; Mankel, R.; Nowak, S.; Schreiner, A.; Schwanke, U.; Walter, M.; Amaral, V.; Amorim, A.; Bastos, J.; Batista, J.; Carvalho, J.; Silva, L.; Wolters, H.; Aushev, V.; Prystupa, S.; Pugatch, V.; Vassiliev, Yu.; Balagura, V.; Bobchenko, B.; Bogatyrev, A.; Danilov, M.; Essenov, S.; Fominykh, B.; Golutvin, A.; Gouchtchine, O.; Guilitsky, Yu.; Igonkina, O.; Khasanov, F.; Kvaratskheliia, T.; Matchikhilian, I.; Mikhailov, Yu.; Mizuk, R.; Popov, V.; Rostovtseva, I.; Tikhomirov, I.; Titov, M.; Zaitsev, Yu.; Zhelezov, A.; Bargiotti, M.; Bertin, A.; Bruschi, M.; De Castro, S.; Fabbri, L.; Faccioli, P.; Giacobbe, B.; Grimaldi, F.; Massa, I.; Piccinini, M.; Poli, M.; Semprini-Cesari, N.; Spighi, R.; Villa, M.; Vitale, A.; Zoccoli, A.; Barsukova, O.; Belkov, A.; Belkov, Ar.; Belotelov, I.; Golutvin, I.; Karpenko, N.; Kiryushin, Yu.; Lanyov, A.; Solunin, S.; Bauer, T.S.; Hulsbergen, W.; Sbrizzi, A.; Boecker, M.; Buchholz, P.; Husemann, U.; Keller, S.; Walenta, A.H.; Werthenbach, U.; Bruinsma, M.; Ouchrif, M.; Buran, T.; Danielsen, K.M.; Ould-Saada, F.; Pylypchenko, Y.; Conde, P.; Dam, M.; Groth-Jensen, J.; Hansen, J.D.; Klinkby, E.; Muresan, R.; Petersen, B.A.; Xella-Hansen, S.; Deppe, H.; Dreis, H.B.; Eisele, F.; Feuerstack-Raible, M.; Gradl, S.; Gradl, W.; Hott, T.; Kessler, J.; Krauss, C.; Rick, H.; Uwer, U.; Dong, X.; Jiang, C.; Zheng, Z.; Garrido, Ll.; Peralta, D.; Glaess, J.; Maenner, R.; Wurz, A.; Gorbounov, I.; Zeuner, T.; Gorisek, A.; Kupper, S.; Pestotnik, R.; Staric, M.; Zivko, T.; Goulart, D.C.; Schwartz, A.J.; Ispiryan, M.; Lau, K.; Pyrlik, J.; Subramania, H.S.; Kapitza, H.; Symalla, M.; Eldik, C. van; Karabekyan, S.; Pernack, R.; Schroeder, H.; Zimmermann, R.; Kolanoski, H.; Kruecker, D.; Lohse, T.; Medin, G.; Nedden, M. zur; Stegmann, C.; Korpar, S.; Kreuzer, P.; Krizan, P.; Stanovnik, A.; Pose, D.; Robmann, P.; Shuvalov, S.; Spiridonov, A.; Tsakov, I.; Vukotic, I.; Wahlberg, H.; Wang, J.J.; Zavertyaev, M.

2009-01-01

Inclusive doubly differential cross sections d 2 σ pA /dx F dp T 2 as a function of Feynman-x(x F ) and transverse momentum (p T ) for the production of K S 0 , Λ and anti Λ in proton-nucleus interactions at 920 GeV are presented. The measurements were performed by HERA-B in the negative x F range (-0.12 F T =1.6 GeV/c. Results for three target materials: carbon, titanium and tungsten are given. The ratios of production cross sections are presented and discussed. The Cronin effect is clearly observed for all three V 0 species. The atomic number dependence is parameterized as σ pA =σ pN .A α where σ pN is the proton-nucleon cross section. The measured values of α are all near one. The results are compared with EPOS 1.67 and PYTHIA 6.3. EPOS reproduces the data to within ∼20% except at very low transverse momentum. (orig.)

Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter.

Science.gov (United States)

Huang, Shijie; Zhu, Xuechen; Melançon, Charles E

2016-01-15

The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

A poly (U) polymerase in ribosome preparations from Ehrlich ascites tumor cells

International Nuclear Information System (INIS)

Guimaraes, R.C.; Bloch, D.P.

1981-01-01

A ribosome-bound poly (U) polymerase from Ehrlich ascites tumor cells is partially characterized. It adds UMPs to RNAs terminating in U-(3')-OH. The UMP-rich segments added reach average sizes of up to 18 nucleotides. CTP is strongly inhibitory to the enzyme. The main endogenous primers are low molecular weight RNAs which are found, after the addition of UMPs, mostly in the 6-8 S range. Some evidence suggests that a 5 S rRNA or polysome-associated 7 S RNA could be the main endogenous primers. (Author) [pt

Transduced PEP-1-ribosomal protein S3 (rpS3) ameliorates 12-O-tetradecanoylphorbol-13-acetate-induced inflammation in mice

International Nuclear Information System (INIS)

Ahn, Eun Hee; Kim, Dae Won; Kang, Hye Won; Shin, Min Jae; Won, Moo Ho; Kim, Joon; Kim, Dong Joon; Kwon, Oh-Shin; Kang, Tae-Cheon; Han, Kyu Hyung; Park, Jinseu; Eum, Won Sik; Choi, Soo Young

2010-01-01

This study investigated the preventive effect of ribosomal protein S3 (rpS3) on 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced ear edema in mice. A cell permeable expression vector PEP-1-rpS3 was constructed. Topical application of the vector markedly inhibited TPA-induced expression levels of cyclooxygenase-2 (COX-2) and pro-inflammatory cytokines. Application of PEP-1-rpS3 also resulted in a significant reduction in the activation of nuclear factor-kappa B (NF-kB) and mitogen-activated protein kinase (MAPK) in TPA-treated ears. These results indicate that PEP-1-rpS3 inhibits inflammatory response cytokines and enzymes by blocking NF-kB and MAPK, prompting the suggestion that PEP-1-rpS3 can be used as a therapeutic agent against skin inflammation.

Karyotypic evolution of ribosomal sites in buffalo subspecies and their crossbreed

Directory of Open Access Journals (Sweden)

Tiago Marafiga Degrandi

2014-06-01

Full Text Available Domestic buffaloes are divided into two group based on cytogenetic characteristics and habitats: the "river buffaloes" with 2n = 50 and the "swamp buffaloes", 2n = 48. Nevertheless, their hybrids are viable, fertile and identified by a 2n = 49. In order to have a better characterization of these different cytotypes of buffaloes, and considering that NOR-bearing chromosomes are involved in the rearrangements responsible for the karyotypic differences, we applied silver staining (Ag-NOR and performed fluorescent in situ hybridization (FISH experiments using 18S rDNA as probe. Metaphases were obtained through blood lymphocyte culture of 21 individuals, including river, swamp and hybrid cytotypes. Ag-NOR staining revealed active NORs on six chromosome pairs (3p, 4p, 6, 21, 23, 24 in the river buffaloes, whereas the swamp buffaloes presented only five NOR-bearing pairs (4p, 6, 20, 22, 23. The F1 crossbreed had 11 chromosomes with active NORs, indicating expression of both parental chromosomes. FISH analysis confirmed the numerical divergence identified with Ag-NOR. This result is explained by the loss of the NOR located on chromosome 4p in the river buffalo, which is involved in the tandem fusion with chromosome 9 in this subspecies. A comparison with the ancestral cattle karyotype suggests that the NOR found on the 3p of the river buffalo may have originated from a duplication of ribosomal genes, resulting in the formation of new NOR sites in this subspecies.

Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms*

Science.gov (United States)

Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia

2014-01-01

Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction.

Science.gov (United States)

Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S

2018-03-15

Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

Directory of Open Access Journals (Sweden)

Silar Philippe

2000-11-01

Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

Science.gov (United States)

Lalucque, Hervé; Silar, Philippe

2000-01-01

Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

Inhibition of p70S6K2 down-regulates Hedgehog/GLI pathway in non-small cell lung cancer cell lines

Directory of Open Access Journals (Sweden)

Kotani Hidehito

2009-07-01

Full Text Available Abstract Background The Hedgehog (HH pathway promotes tumorigenesis in a diversity of cancers. Activation of the HH signaling pathway is caused by overexpression of HH ligands or mutations in the components of the HH/GLI1 cascade, which lead to increased transactivation of GLI transcription factors. Although negative kinase regulators that antagonize the activity of GLI transcription factors have been reported, including GSK3β, PKA and CK1s, little is known regarding positive kinase regulators that are suitable for use on cancer therapeutic targets. The present study attempted to identify kinases whose silencing inhibits HH/GLI signalling in non-small cell lung cancer (NSCLC. Results To find positive kinase regulators in the HH pathway, kinome-wide siRNA screening was performed in a NSCLC cell line, A549, harboring the GLI regulatory reporter gene. This showed that p70S6K2-silencing remarkably reduced GLI reporter gene activity. The decrease in the activity of the HH pathway caused by p70S6K2-inhibition was accompanied by significant reduction in cell viability. We next investigated the mechanism for p70S6K2-mediated inhibition of GLI1 transcription by hypothesizing that GSK3β, a negative regulator of the HH pathway, is activated upon p70S6K2-silencing. We found that phosphorylated-GSK3β (Ser9 was reduced by p70S6K2-silencing, causing a decreased level of GLI1 protein. Finally, to further confirm the involvement of p70S6K2 in GLI1 signaling, down-regulation in GLI-mediated transcription by PI3KCA-inhibition was confirmed, establishing the pivotal role of the PI3K/p70S6K2 pathway in GLI1 cascade regulation. Conclusion We report herein that inhibition of p70S6K2, known as a downstream effector of the PI3K pathway, remarkably decreases GLI-mediated transactivation in NSCLC by reducing phosphorylated-GSK3β followed by GLI1 degradation. These results infer that p70S6K2 is a potential therapeutic target for NSCLC with hyperactivated HH/GLI pathway.

Potential roles for ubiquitin and the proteasome during ribosome biogenesis

Czech Academy of Sciences Publication Activity Database

Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.

2006-01-01

Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

International Nuclear Information System (INIS)

Tejedor, F.; Amils, R.; Ballesta, J.P.

1985-01-01

Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

Directory of Open Access Journals (Sweden)

Rawnak Laila

2017-01-01

Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs.

Science.gov (United States)

Högenauer, G; Ruf, C

1981-01-01

Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

Science.gov (United States)

Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

1998-01-01

Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

Small-angle X-ray titration study on the complex formation between 5-S RNA and the L18 protein of the Escherichia coli 50-S ribosome particle

International Nuclear Information System (INIS)

Oesterberg, R.; Garrett, A.

1977-01-01

The 5-S RNA (A) and the L 18 protein (B) from Escherichia coli ribosomes form one single AB complex in the concentration ranges supposed to prevail in vivo; at concentrations of L 18 higher than 40 mM there is some indication for a minor species, most probably an AB 2 species. This is indicated from the X-ray scattering titration data of the 5-S RNA/L 18 system recorded at 21 0 C in ribosomal reconstitution buffer. As a result of the 1 : 1 complex formation, there is a relatively small but defined increase in the radius of gyration from 3.61 to 3.85 nm. This result as well as the experimental scattering curve can be explained by models where it is assumed that the elongated L 18 model is quite far from the electron density centre and where protein L 18 interacts with one or both of the minor arms of the supposed Y-shaped 5-S RNA molecule. (orig.) [de

GTPases and the origin of the ribosome

Directory of Open Access Journals (Sweden)

Smith Temple F

2010-05-01

Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

Science.gov (United States)

Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

2002-12-01

The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

Science.gov (United States)

Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

2000-07-01

The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

Science.gov (United States)

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

A ribosome without RNA

Directory of Open Access Journals (Sweden)

Harold S Bernhardt

2015-11-01

Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

Isotope Shifts and Hyperfine Structure in the[Xe]4f(7)5d 6s(2) D-2(J)->[Xe]4f(7)5d 6s 6p F-9(J+1) Transitions of Gadolinium

International Nuclear Information System (INIS)

Blaum, K.; Bushaw, Bruce A.; Diel, S; Geppert, Ch; Kuschnick, A; Muller, P.; Nortershauser, W.; Schmitt, A.; Wendt, K.