
Sample records for p90 ribosomal s6

  1. Hypoxia-induced invadopodia formation involves activation of NHE-1 by the p90 ribosomal S6 kinase (p90RSK.

    Directory of Open Access Journals (Sweden)

    Fabrice Lucien

    Full Text Available The hypoxic and acidic microenvironments in tumors are strongly associated with malignant progression and metastasis, and have thus become a central issue in tumor physiology and cancer treatment. Despite this, the molecular links between acidic pH- and hypoxia-mediated cell invasion/metastasis remain mostly unresolved. One of the mechanisms that tumor cells use for tissue invasion is the generation of invadopodia, which are actin-rich invasive plasma membrane protrusions that degrade the extracellular matrix. Here, we show that hypoxia stimulates the formation of invadopodia as well as the invasive ability of cancer cells. Inhibition or shRNA-based depletion of the Na(+/H(+ exchanger NHE-1, along with intracellular pH monitoring by live-cell imaging, revealed that invadopodia formation is associated with alterations in cellular pH homeostasis, an event that involves activation of the Na(+/H(+ exchange rate by NHE-1. Further characterization indicates that hypoxia triggered the activation of the p90 ribosomal S6 kinase (p90 RSK, which resulted in invadopodia formation and site-specific phosphorylation and activation of NHE-1. This study reveals an unsuspected role of p90RSK in tumor cell invasion and establishes p90RS kinase as a link between hypoxia and the acidic microenvironment of tumors.

  2. Identification of p90 Ribosomal S6 Kinase 2 as a Novel Host Protein in HBx Augmenting HBV Replication by iTRAQ-Based Quantitative Comparative Proteomics. (United States)

    Yan, Li-Bo; Yu, You-Jia; Zhang, Qing-Bo; Tang, Xiao-Qiong; Bai, Lang; Huang, FeiJun; Tang, Hong


    The aim of this study was to screen for novel host proteins that play a role in HBx augmenting Hepatitis B virus (HBV) replication. Three HepG2 cell lines stably harboring different functional domains of HBx (HBx, HBx-Cm6, and HBx-Cm16) were cultured. ITRAQ technology integrated with LC-MS/MS analysis was applied to identify the proteome differences among these three cell lines. In brief, a total of 70 different proteins were identified among HepG2-HBx, HepG2-HBx-Cm6, and HepG2-HBx-Cm16 by double repetition. Several differentially expressed proteins, including p90 ribosomal S6 kinase 2 (RSK2), were further validated. RSK2 was expressed at higher levels in HepG2-HBx and HepG2-HBx-Cm6 compared with HepG2-HBx-Cm16. Furthermore, levels of HBV replication intermediates were decreased after silencing RSK2 in HepG2.2.15. An HBx-minus HBV mutant genome led to decreased levels of HBV replication intermediates and these decreases were restored to levels similar to wild-type HBV by transient ectopic expression of HBx. After silencing RSK2 expression, the levels of HBV replication intermediates synthesized from the HBx-minus HBV mutant genome were not restored to levels that were observed with wild-type HBV by transient HBx expression. Based on iTRAQ quantitative comparative proteomics, RSK2 was identified as a novel host protein that plays a role in HBx augmenting HBV replication. © 2018 The Authors. Proteomics - Clinical Application Published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Insights into the Inhibition of the p90 Ribosomal S6 Kinase (RSK) by the Flavonol Glycoside SL0101 from the 1.5 Å Crystal Structure of the N-Terminal Domain of RSK2 with Bound Inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Utepbergenov, Darkhan; Derewenda, Urszula; Olekhnovich, Natalya; Szukalska, Gabriela; Banerjee, Budhaditya; Hilinski, Michael K.; Lannigan, Deborah A.; Stukenberg, P. Todd; Derewenda, Zygmunt S. (Lodz - Poland); (UV)


    The p90 ribosomal S6 family of kinases (RSK) are potential drug targets, due to their involvement in cancer and other pathologies. There are currently only two known selective inhibitors of RSK, but the basis for selectivity is not known. One of these inhibitors is a naturally occurring kaempferol-a-l-diacetylrhamnoside, SL0101. Here, we report the crystal structure of the complex of the N-terminal kinase domain of the RSK2 isoform with SL0101 at 1.5 {angstrom} resolution. The refined atomic model reveals unprecedented structural reorganization of the protein moiety, as compared to the nucleotide-bound form. The entire N-lobe, the hinge region, and the aD-helix undergo dramatic conformational changes resulting in a rearrangement of the nucleotide binding site with concomitant formation of a highly hydrophobic pocket spatially suited to accommodate SL0101. These unexpected results will be invaluable in further optimization of the SL0101 scaffold as a promising lead for a novel class of kinase inhibitors.

  4. IL-3 Maintains Activation of the p90S6K/RPS6 Pathway and Increases Translation in Human Eosinophils. (United States)

    Esnault, Stephane; Kelly, Elizabeth A B; Shen, Zhong-Jian; Johansson, Mats W; Malter, James S; Jarjour, Nizar N


    IL-5 is a major therapeutic target to reduce eosinophilia. However, all of the eosinophil-activating cytokines, such as IL-5, IL-3, and GM-CSF, are typically present in atopic diseases, including allergic asthma. As a result of the functional redundancy of these three cytokines on eosinophils and the loss of IL-5R on airway eosinophils, it is important to take IL-3 and GM-CSF into account to efficiently reduce tissue eosinophil functions. Moreover, these three cytokines signal through a common β-chain receptor but yet differentially affect protein production in eosinophils. Notably, the increased ability of IL-3 to induce the production of proteins, such as semaphorin-7A, without affecting mRNA levels suggests a unique influence of IL-3 on translation. The purpose of this study was to identify the mechanisms by which IL-3 distinctively affects eosinophil function compared with IL-5 and GM-CSF, with a focus on protein translation. Peripheral blood eosinophils were used to study intracellular signaling and protein translation in cells activated with IL-3, GM-CSF, or IL-5. We establish that, unlike GM-CSF or IL-5, IL-3 triggers prolonged signaling through activation of ribosomal protein S6 (RPS6) and the upstream kinase 90-kDa ribosomal S6 kinase (p90S6K). Blockade of p90S6K activation inhibited phosphorylation of RPS6 and IL-3-enhanced semaphorin-7A translation. Furthermore, in an allergen-challenged environment, in vivo phosphorylation of RPS6 and p90S6K was enhanced in human airway compared with circulating eosinophils. Our findings provide new insights into the mechanisms underlying differential activation of eosinophils by IL-3, GM-CSF, and IL-5. These observations identify IL-3 and its downstream intracellular signals as novel targets that should be considered to modulate eosinophil functions. Copyright © 2015 by The American Association of Immunologists, Inc.

  5. IL-3 maintains activation of the P90S6K/RPS6 pathway and increases translation in human eosinophils1 (United States)

    Esnault, Stephane; Kelly, Elizabeth A.B.; Shen, Zhong-Jian; Johansson, Mats W.; Malter, James S.; Jarjour, Nizar N.


    IL-5 is a major therapeutic target to reduce eosinophilia. However, all of the eosinophil-activating cytokines IL-5, IL-3, and GM-CSF are typically present in atopic diseases including allergic asthma. Due to the functional redundancy of these 3 cytokines on eosinophils and the loss of IL-5 receptor on airway eosinophils, it is important to take IL-3 and GM-CSF into account to efficiently reduce tissue eosinophil functions. Moreover, these 3 cytokines signal through a common β-chain receptor, and yet differentially affect protein production in eosinophils. Notably, the increased ability of IL-3 to induce production of proteins such as semaphorin-7A without affecting mRNA level suggests a unique influence by IL-3 on translation. The purpose of this study is to identify the mechanisms by which IL-3 distinctively affects eosinophil function compared to IL-5 and GM-CSF, with a focus on protein translation. Peripheral blood eosinophils were used to study intracellular signaling and protein translation in cells activated with IL-3, GM-CSF or IL-5. We establish that, unlike GM-CSF or IL-5, IL-3 triggers prolonged signaling through activation of ribosomal protein (RP) S6 and the upstream kinase, p90S6K. Blockade of p90S6K activation inhibited phosphorylation of RPS6 and IL-3-enhanced semaphorin-7A translation. Furthermore, in an allergen-challenged environment, in vivo phosphorylation of RPS6 and p90S6K was enhanced in human airway compared to circulating eosinophils. Our findings provide new insights into the mechanisms underlying differential activation of eosinophils by IL-3, GM-CSF, and IL-5. These observations place IL-3 and its downstream intracellular signals as novel targets that should be considered to modulate eosinophil functions. PMID:26276876

  6. Ribosomal S6 Kinase Cooperates with Casein Kinase 2 to Modulate the Drosophila Circadian Molecular Oscillator (United States)

    Akten, Bikem; Tangredi, Michelle M.; Jauch, Eike; Roberts, Mary A.; Ng, Fanny; Raabe, Thomas; Jackson, F. Rob


    There is a universal requirement for post-translational regulatory mechanisms in circadian clock systems. Previous work in Drosophila has identified several kinases, phosphatases and an E3 ligase that are critical for determining the nuclear translocation and/or stability of clock proteins. The present study evaluated the function of p90 ribosomal S6 kinase (RSK) in the Drosophila circadian system. In mammals, RSK1 is a light- and clock-regulated kinase known to be activated by the MAPK pathway, but there is no direct evidence that it functions as a component of the circadian system. Here, we show that Drosophila S6KII RNA displays rhythms in abundance, indicative of circadian control. Importantly, an S6KII null mutant exhibits a short-period circadian phenotype that can be rescued by expression of the wild-type gene in clock neurons, indicating a role for S6KII in the molecular oscillator. Peak PER clock protein expression is elevated in the mutant, indicative of enhanced stability, whereas per mRNA level is decreased, consistent with enhanced feedback repression. Gene reporter assays show that decreased S6KII is associated with increased PER repression. Surprisingly, we demonstrate a physical interaction between S6KII and the Casein Kinase 2 regulatory subunit (CK2β), suggesting a functional relationship between the two kinases. In support of such a relationship, there are genetic interactions between S6KII and CK2 mutations, in vivo, which indicate that CK2 activity is required for S6KII action. We propose that the two kinases cooperate within clock neurons to fine-tune circadian period, improving the precision of the clock mechanism. PMID:19144847

  7. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim


    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  8. Ribosomal protein S6 phosphorylation is controlled by TOR and modulated by PKA in Candida albicans. (United States)

    Chowdhury, Tahmeena; Köhler, Julia R


    TOR and PKA signaling pathways control eukaryotic cell growth and proliferation. TOR activity in model fungi, such as Saccharomyces cerevisiae, responds principally to nutrients, e.g., nitrogen and phosphate sources, which are incorporated into the growing cell mass; PKA signaling responds to the availability of the cells' major energy source, glucose. In the fungal commensal and pathogen, Candida albicans, little is known of how these pathways interact. Here, the signal from phosphorylated ribosomal protein S6 (P-S6) was defined as a surrogate marker for TOR-dependent anabolic activity in C. albicans. Nutritional, pharmacologic and genetic modulation of TOR activity elicited corresponding changes in P-S6 levels. The P-S6 signal corresponded to translational activity of a GFP reporter protein. Contributions of four PKA pathway components to anabolic activation were then examined. In high glucose concentrations, only Tpk2 was required to upregulate P-S6 to physiologic levels, whereas all four tested components were required to downregulate P-S6 in low glucose. TOR was epistatic to PKA components with respect to P-S6. In many host niches inhabited by C. albicans, glucose is scarce, with protein being available as a nitrogen source. We speculate that PKA may modulate TOR-dependent cell growth to a rate sustainable by available energy sources, when monomers of anabolic processes, such as amino acids, are abundant. © 2015 John Wiley & Sons Ltd.

  9. Ribosomal protein mutations induce autophagy through S6 kinase inhibition of the insulin pathway.

    Directory of Open Access Journals (Sweden)

    Harry F Heijnen

    Full Text Available Mutations affecting the ribosome lead to several diseases known as ribosomopathies, with phenotypes that include growth defects, cytopenia, and bone marrow failure. Diamond-Blackfan anemia (DBA, for example, is a pure red cell aplasia linked to the mutation of ribosomal protein (RP genes. Here we show the knock-down of the DBA-linked RPS19 gene induces the cellular self-digestion process of autophagy, a pathway critical for proper hematopoiesis. We also observe an increase of autophagy in cells derived from DBA patients, in CD34+ erythrocyte progenitor cells with RPS19 knock down, in the red blood cells of zebrafish embryos with RP-deficiency, and in cells from patients with Shwachman-Diamond syndrome (SDS. The loss of RPs in all these models results in a marked increase in S6 kinase phosphorylation that we find is triggered by an increase in reactive oxygen species (ROS. We show that this increase in S6 kinase phosphorylation inhibits the insulin pathway and AKT phosphorylation activity through a mechanism reminiscent of insulin resistance. While stimulating RP-deficient cells with insulin reduces autophagy, antioxidant treatment reduces S6 kinase phosphorylation, autophagy, and stabilization of the p53 tumor suppressor. Our data suggest that RP loss promotes the aberrant activation of both S6 kinase and p53 by increasing intracellular ROS levels. The deregulation of these signaling pathways is likely playing a major role in the pathophysiology of ribosomopathies.

  10. The Р60-S6K1 isoform of ribosomal protein S6 kinase 1 is a product of alternative mRNA translation

    Directory of Open Access Journals (Sweden)

    I. V. Zaiets


    Full Text Available Ribosomal protein S6 kinase 1 (S6K1 is a well-known downstream effector of mTORC1 (mechanistic target of rapamycin complex 1 participating primarily in the regulation of cell growth and metabolism. Deregulation of mTOR/S6K1 signaling can promote numerous human pathologies, including cancer, neurodegeneration, cardiovascular disease, and metabolic disorders. As existing data suggest, the S6K1 gene encodes several protein isoforms, including p85-S6K1, p70-S6K1, and p60-S6K1. The two of these isoforms, p85-S6K1 and p70-S6K1, were extensively studied to date. The origin and functional significance of the p60-S6K1 isoform remains a mystery, however, it was suggested that the isoform could be a product of alternative S6K1 mRNA translation. Herein we report the generation of HEK-293 cells exclusively expressing p60-S6K1 as a result of CRISPR/Cas9-mediated inactivation of p85/p70-S6K1 translation. Moreover, the generated modified cells displayed the elevated level of p60-S6K1 expression compared to that in wild-type HEK-293 cells. Our data confirm an assumption that p60-S6K1 is alternatively translated, most probably, from the common for both p70- and p85-S6K1 mRNA transcript and reveal a link between p60-S6K1 expression and such cellular processes as cell proliferation and motility. In addition, our findings indicate that the p60-S6K1 isoform of S6K1 may undergo a mode of regulation distinct from p70- and p85-S6K1 due to the absence of mTOR-regulated p60-S6K1 phosphorylation at T389 that is important for S6K1 activation.

  11. BI-D1870 is a specific inhibitor of the p90 RSK (ribosomal S6 kinase) isoforms in vitro and in vivo

    DEFF Research Database (Denmark)

    Sapkota, Gopal P; Cummings, Lorna; Newell, Felicity S


    ), which then mediate many of the physiological processes that are regulated by these extracellular agonists. It can be difficult to assess the individual functions of each AGC kinase because their substrate specificities are similar. Here we describe the small molecule BI-D1870, which inhibits RSK1, RSK2......, RSK3 and RSK4 in vitro with an IC(50) of 10-30 nM, but does not signi-ficantly inhibit ten other AGC kinase members and over 40 other protein kinases tested at 100-fold higher concentrations. BI-D1870 is cell permeant and prevents the RSK-mediated phorbol ester- and EGF (epidermal growth factor......)-induced phosphoryl-ation of glycogen synthase kinase-3beta and LKB1 in human embry-onic kidney 293 cells and Rat-2 cells. In contrast, BI-D1870 does not affect the agonist-triggered phosphorylation of substrates for six other AGC kinases. Moreover, BI-D1870 does not suppress the phorbol ester- or EGF...

  12. The Arabidopsis TOR Kinase Specifically Regulates the Expression of Nuclear Genes Coding for Plastidic Ribosomal Proteins and the Phosphorylation of the Cytosolic Ribosomal Protein S6. (United States)

    Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A; Hanson, Johannes; Meyer, Christian


    Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5' untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5' terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase.

  13. Haloperidol Regulates the State of Phosphorylation of Ribosomal Protein S6 via Activation of PKA and Phosphorylation of DARPP-32 (United States)

    Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto


    Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187

  14. Phosphorylation of Ribosomal Protein S6 Mediates Mammalian Target of Rapamycin Complex 1-Induced Parathyroid Cell Proliferation in Secondary Hyperparathyroidism. (United States)

    Volovelsky, Oded; Cohen, Gili; Kenig, Ariel; Wasserman, Gilad; Dreazen, Avigail; Meyuhas, Oded; Silver, Justin; Naveh-Many, Tally


    Secondary hyperparathyroidism is characterized by increased serum parathyroid hormone (PTH) level and parathyroid cell proliferation. However, the molecular pathways mediating the increased parathyroid cell proliferation remain undefined. Here, we found that the mTOR pathway was activated in the parathyroid of rats with secondary hyperparathyroidism induced by either chronic hypocalcemia or uremia, which was measured by increased phosphorylation of ribosomal protein S6 (rpS6), a downstream target of the mTOR pathway. This activation correlated with increased parathyroid cell proliferation. Inhibition of mTOR complex 1 by rapamycin decreased or prevented parathyroid cell proliferation in secondary hyperparathyroidism rats and in vitro in uremic rat parathyroid glands in organ culture. Knockin rpS6(p-/-) mice, in which rpS6 cannot be phosphorylated because of substitution of all five phosphorylatable serines with alanines, had impaired PTH secretion after experimental uremia- or folic acid-induced AKI. Uremic rpS6(p-/-) mice had no increase in parathyroid cell proliferation compared with a marked increase in uremic wild-type mice. These results underscore the importance of mTOR activation and rpS6 phosphorylation for the pathogenesis of secondary hyperparathyroidism and indicate that mTORC1 is a significant regulator of parathyroid cell proliferation through rpS6. Copyright © 2016 by the American Society of Nephrology.

  15. IL-6 Impairs Myogenic Differentiation by Downmodulation of p90RSK/eEF2 and mTOR/p70S6K Axes, without Affecting AKT Activity

    Directory of Open Access Journals (Sweden)

    Michele Pelosi


    Full Text Available IL-6 is a multifaceted pleiotropic cytokine, which is produced by a variety of cell types and targets different cells and tissues. In physiological conditions, IL-6 can be locally and transiently produced by skeletal muscle and plays an important role in muscle homeostasis. Circulating IL-6 levels are normally very low or undetectable but are dramatically increased in several pathologic conditions. In this study, we aimed to define the potential molecular mechanisms underlying the effects of IL-6 on myogenic program. We explored the molecular mechanisms through which exogenous IL-6, or the conditioned medium from the murine C-26 adenocarcinoma cells (a cellular model that secretes high levels of IL-6 and induces cancer cachexia in mice, interferes with the myogenic program. Our study revealed that IL-6 induces the activation of the Stat3 signaling and promotes the downmodulation of the p90RSK/eEF2 and mTOR/p70S6K axes, while it does not affect the activation of AKT. We thus identified potential molecular mediators of the inhibitory effects of IL-6 on myogenic program.

  16. Ribosomal protein S6 kinase1 coordinates with TOR-Raptor2 to regulate thylakoid membrane biosynthesis in rice. (United States)

    Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun


    Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Mice deficient in ribosomal protein S6 phosphorylation suffer from muscle weakness that reflects a growth defect and energy deficit.

    Directory of Open Access Journals (Sweden)

    Igor Ruvinsky

    Full Text Available BACKGROUND: Mice, whose ribosomal protein S6 cannot be phosphorylated due to replacement of all five phosphorylatable serine residues by alanines (rpS6(P-/-, are viable and fertile. However, phenotypic characterization of these mice and embryo fibroblasts derived from them, has established the role of these modifications in the regulation of the size of several cell types, as well as pancreatic beta-cell function and glucose homeostasis. A relatively passive behavior of these mice has raised the possibility that they suffer from muscle weakness, which has, indeed, been confirmed by a variety of physical performance tests. METHODOLOGY/PRINCIPAL FINDINGS: A large variety of experimental methodologies, including morphometric measurements of histological preparations, high throughput proteomic analysis, positron emission tomography (PET and numerous biochemical assays, were used in an attempt to establish the mechanism underlying the relative weakness of rpS6(P-/- muscles. Collectively, these experiments have demonstrated that the physical inferiority appears to result from two defects: a a decrease in total muscle mass that reflects impaired growth, rather than aberrant differentiation of myofibers, as well as a diminished abundance of contractile proteins; and b a reduced content of ATP and phosphocreatine, two readily available energy sources. The abundance of three mitochondrial proteins has been shown to diminish in the knockin mouse. However, the apparent energy deficiency in this genotype does not result from a lower mitochondrial mass or compromised activity of enzymes of the oxidative phosphorylation, nor does it reflect a decline in insulin-dependent glucose uptake, or diminution in storage of glycogen or triacylglycerol (TG in the muscle. CONCLUSIONS/SIGNIFICANCE: This study establishes rpS6 phosphorylation as a determinant of muscle strength through its role in regulation of myofiber growth and energy content. Interestingly, a similar

  18. Growth Inhibition by Bupivacaine Is Associated with Inactivation of Ribosomal Protein S6 Kinase 1 (United States)

    Beigh, Mushtaq Ahmad; Showkat, Mehvish; Bashir, Basharat; Bashir, Asma; Hussain, Mahboob ul; Andrabi, Khurshid Iqbal


    Bupivacaine is an amide type long acting local anesthetic used for epidural anesthesia and nerve blockade in patients. Use of bupivacaine is associated with severe cytotoxicity and apoptosis along with inhibition of cell growth and proliferation. Although inhibition of Erk, Akt, and AMPK seemingly appears to mediate some of the bupivacaine effects, potential downstream targets that mediate its effect remain unknown. S6 kinase 1 is a common downstream effector of several growth regulatory pathways involved in cell growth and proliferation known to be affected by bupivacaine. We have accordingly attempted to relate the growth inhibitory effects of bupivacaine with the status of S6K1 activity and we present evidence that decrease in cell growth and proliferation by bupivacaine is mediated through inactivation of S6 kinase 1 in a concentration and time dependent manner. We also show that ectopic expression of constitutively active S6 kinase 1 imparts substantial protection from bupivacaine induced cytotoxicity. Inactivation of S6K1 though associated with loss of putative mTOR mediated phosphorylation did not correspond with loss of similar phosphorylations in 4EBP1 indicating that S6K1 inhibition was not mediated through inactivation of mTORC1 signaling pathway or its down regulation. PMID:24605337

  19. Generation and characterization of polyclonal antibodies specific to N-terminal extension of p85 isoform of ribosomal protein S6 kinase 1 (p85 S6K1

    Directory of Open Access Journals (Sweden)

    Savinska L. O.


    Full Text Available Aim. Generation of polyclonal antibodies specific to the ribosomal protein S6 kinase isoform – p85S6K1 and directed to the N-terminal (1–23 aa extension of p85S6K1. Methods. Animal immunization with synthetic (1–23 aa peptide, ELISA, Western blot, Immunoprecipitation, immunofluorescent analysis. Results. Polyclonal antibodies have been generated, which specifically recognize only p85 but not p70 isoform of S6K1 in western blot, immunoprecipitation and immunofluorescence analysis. Conclusions. The obtained antibodies can be recommended for studies on the p85S6K1 and other S6K1 isoforms possessing the N-terminal extension – the identification of binding protein partners, analysis of subcellular localization under different physiological conditions, elucidation of the signal transduction pathways involving different S6K1 isoforms.

  20. Insulin receptors mediate growth effects in cultured fetal neurons. II. Activation of a protein kinase that phosphorylates ribosomal protein S6

    International Nuclear Information System (INIS)

    Heidenreich, K.A.; Toledo, S.P.


    As an initial attempt to identify early steps in insulin action that may be involved in the growth responses of neurons to insulin, we investigated whether insulin receptor activation increases the phosphorylation of ribosomal protein S6 in cultured fetal neurons and whether activation of a protein kinase is involved in this process. When neurons were incubated for 2 h with 32Pi, the addition of insulin (100 ng/ml) for the final 30 min increased the incorporation of 32Pi into a 32K microsomal protein. The incorporation of 32Pi into the majority of other neuronal proteins was unaltered by the 30-min exposure to insulin. Cytosolic extracts from insulin-treated neurons incubated in the presence of exogenous rat liver 40S ribosomes and [gamma-32P]ATP displayed a 3- to 8-fold increase in the phosphorylation of ribosomal protein S6 compared to extracts from untreated cells. Inclusion of cycloheximide during exposure of the neurons to insulin did not inhibit the increased cytosolic kinase activity. Activation of S6 kinase activity by insulin was dose dependent (seen at insulin concentration as low as 0.1 ng/ml) and reached a maximum after 20 min of incubation. Addition of phosphatidylserine, diolein, and Ca2+ to the in vitro kinase reaction had no effect on the phosphorylation of ribosomal protein S6. Likewise, treatment of neurons with (Bu)2cAMP did not alter the phosphorylation of ribosomal protein S6 by neuronal cytosolic extracts. We conclude that insulin activates a cytosolic protein kinase that phosphorylates ribosomal S6 in neurons and is distinct from protein kinase-C and cAMP-dependent protein kinase. Stimulation of this kinase may play a role in insulin signal transduction in neurons

  1. IgD, cyclooxygenase-2 and ribosomal protein S6-PS240 immune response in a case of early psoriasis

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez


    Full Text Available Psoriasis is an inflammatory skin disease. Five classic types of psoriasis have been defined: plaque, inverse, pustular, guttate, and erythrodermic. The early psoriasis immunologic skin immune response is not well understood. Here we aim to show an immune and cell signaling response in a case of early psoriasis. A 56 year old female presented with a desquamative lesion on her right leg. A skin biopsy for hematoxylin and eosin (H&E and immunohistochemistry (IHC staining was taken. The diagnosis indicated early psoriasis, and IHC showed positive IgD staining in the epidermal corneal layer, as well as positive staining with ribosomal protein S6-pS240 (RIBO in the hyperproliferative epidermis. Cyclooxygenase-2 (COX-2 was also very positive in the granular layer in spots, at the basement membrane zone of the skin and in the inflammatory infiltrate in the dermis subjacent to hyperproliferative psoriatic areas. In an early case of psoriasis, we confirmed the presence of IgD, RIBO and COX-2. Each molecule seems to be playing a role in inflammation and intracellular signaling pathways in early psoriasis. The role of IgD is unknown, and this case brings to light the complexity of the pathologic changes occurring in early psoriatic lesions.

  2. Post-transcriptional gene silencing of ribosomal protein S6 kinase 1 restores insulin action in leucine-treated skeletal muscle

    DEFF Research Database (Denmark)

    Deshmukh, A; Salehzadeh, F; Metayer-Coustard, S


    Excessive nutrients, especially amino acids, impair insulin action on glucose metabolism in skeletal muscle. We tested the hypothesis that the branched-chain amino acid leucine reduces acute insulin action in primary myotubes via a negative feedback mechanism involving ribosomal protein S6 kinase 1...... to excessive leucine. In conclusion, S6K1 plays an important role in the regulation of insulin action on glucose metabolism in skeletal muscle....

  3. Influence of hyperthermia on the phosphorylation of ribosomal protein S6 from human skin fibroblasts and meningioma cells

    DEFF Research Database (Denmark)

    Richter, W W; Zang, K D; Issinger, O G


    Skin fibroblasts and meningioma cells, derived from primary cultures of the same patients have been used to study the influence of hyperthermia on (i) cell morphology and (ii) phosphorylation pattern of ribosomal and ribosome-associated proteins. Incubation of tumour cells and fibroblasts up to 7...

  4. PF-4708671, a specific inhibitor of p70 ribosomal S6 kinase 1, activates Nrf2 by promoting p62-dependent autophagic degradation of Keap1

    Energy Technology Data Exchange (ETDEWEB)

    Park, Jeong Su [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kang, Dong Hoon [Department of Life Science and Ewha Research Center for Systems Biology (Korea, Republic of); The Research Center for Cell Homeostasis, Ewha Womans University, Seoul 127-750 (Korea, Republic of); Lee, Da Hyun [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Bae, Soo Han, E-mail: [Severance Biomedical Science Institute (Korea, Republic of); Yonsei Biomedical Research Institute, Yonsei University College of Medicine, 50 Yonsei-ro, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)


    p70 ribosomal S6 kinase 1 (S6K1) is an important serine/threonine kinase and downstream target of the mechanistic target of rapamycin complex 1 (mTORC1) signaling pathway. PF-4708671 is a specific inhibitor of S6K1, and prevents S6K1-mediated phosphorylation of the S6 protein. PF-4708671 treatment often leads to apoptotic cell death. However, the protective mechanism against PF-4708671-induced cell death has not been elucidated. The nuclear factor erythroid 2-related factor 2 (Nrf2)-Kelch-like ECH-associated protein 1 (Keap1) pathway is essential for protecting cells against oxidative stress. p62, an adaptor protein in the autophagic process, enhances Nrf2 activation through the impairment of Keap1 activity. In this study, we showed that PF-4708671 induces autophagic Keap1 degradation-mediated Nrf2 activation in p62-dependent manner. Furthermore, p62-dependent Nrf2 activation plays a crucial role in protecting cells from PF-4708671-mediated apoptosis. - Highlights: • PF-4708671, a S6K1-specific inhibitor, prevents S6K1-mediated S6 phosphorylation. • However, PF-4708671 treatment often leads to apoptotic cell death. • Protective mechanism against PF-4708671-induced cell death remains to be elucidated. • PF-4708671 induced p62-dependent, autophagic Keap1 degradation-mediated Nrf2 activation. • p62-dependent Nrf2 activation protects cells from PF-4708671-mediated apoptosis.

  5. [Protein kinase A inhibitor H-89 blocks polyploidization of SP600125-induced CMK cells by regulating phosphorylation of ribosomal protein S6 kinase 1]. (United States)

    Zhao, Song; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Pu, Feifei; Ma, Dongchu


    Objective To investigate the regulatory effect of post-translation modification of ribosomal protein S6 kinase 1 (S6K1) on the polyploidization of megakaryocytes. Methods SP600125, a c-Jun N-terminal kinase (JNK) inhibitor, and H-89, a cAMP-dependent protein kinase (PKA) inhibitor, were used to treat CMK cells separately or in combination. With propidium iodide (PI) to dye DNA in the treated cells, the relative DNA content was detected by flow cytometry, and then the DNA polyploidy was analyzed. The change of expression and phosphorylation of ribosomal protein S6 kinase 1 (S6K1), an important mammalian target of rapamycin (mTOR) downstream target molecule, was analyzed by Western blotting. Molecular docking study and kinase activity assay were performed to analyze the combination of H-89 with S6K1 and the effect of H-89 on the activity of S6K1 kinase. Results SP600125 induced CMK cell polyploidization in a time-dependent and dose-dependent manner. At the same time, it increased the phosphorylation of S6K1 at Thr421/Ser424 and decreased the phosphorylation of S6K1 at Thr389. H-89 not only blocked polyploidization, but also decreased the phosphorylation of S6K1 at Thr421/Ser424 and increased the phosphorylation of S6K1 at Thr389. Molecular docking and kinase activity assay showed that H-89 occupied the ATP binding sites of S6K1 and inhibited its activity. Noticeably, both H-89 and SP600125 inhibited the activity of PKA. Moreover, the two drugs further inhibited the activity of PKA when used together. Therefore, these data indicated that H-89 blocked the SP600125-induced polyploidization of CMK cells mainly by changing S6K1 phosphorylation state, rather than its inhibitory effect on PKA. Conclusion H-89 can block the polyploidization of SP600125-induced CMK cells by regulating S6K1 phosphorylation state.

  6. Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice

    Directory of Open Access Journals (Sweden)

    Mark A. Smith


    Full Text Available Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC and agouti-related protein (AgRP neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons.

  7. Ribosomal S6K1 in POMC and AgRP Neurons Regulates Glucose Homeostasis but Not Feeding Behavior in Mice. (United States)

    Smith, Mark A; Katsouri, Loukia; Irvine, Elaine E; Hankir, Mohammed K; Pedroni, Silvia M A; Voshol, Peter J; Gordon, Matthew W; Choudhury, Agharul I; Woods, Angela; Vidal-Puig, Antonio; Carling, David; Withers, Dominic J


    Hypothalamic ribosomal S6K1 has been suggested as a point of convergence for hormonal and nutrient signals in the regulation of feeding behavior, bodyweight, and glucose metabolism. However, the long-term effects of manipulating hypothalamic S6K1 signaling on energy homeostasis and the cellular mechanisms underlying these roles are unclear. We therefore inactivated S6K1 in pro-opiomelanocortin (POMC) and agouti-related protein (AgRP) neurons, key regulators of energy homeostasis, but in contrast to the current view, we found no evidence that S6K1 regulates food intake and bodyweight. In contrast, S6K1 signaling in POMC neurons regulated hepatic glucose production and peripheral lipid metabolism and modulated neuronal excitability. S6K1 signaling in AgRP neurons regulated skeletal muscle insulin sensitivity and was required for glucose sensing by these neurons. Our findings suggest that S6K1 signaling is not a general integrator of energy homeostasis in the mediobasal hypothalamus but has distinct roles in the regulation of glucose homeostasis by POMC and AgRP neurons. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Comparative Immunohistochemical Analysis of Ochratoxin A Tumourigenesis in Rats and Urinary Tract Carcinoma in Humans; Mechanistic Significance of p-S6 Ribosomal Protein Expression

    Directory of Open Access Journals (Sweden)

    Sarah Pinder


    Full Text Available Ochratoxin A (OTA is considered to be a possible human urinary tract carcinogen, based largely on a rat model, but no molecular genetic changes in the rat carcinomas have yet been defined. The phosphorylated-S6 ribosomal protein is a marker indicating activity of the mammalian target of rapamycin, which is a serine/threonine kinase with a key role in protein biosynthesis, cell proliferation, transcription, cellular metabolism and apoptosis, while being functionally deregulated in cancer. To assess p-S6 expression we performed immunohistochemistry on formalin-fixed and paraffin-embedded tumours and normal tissues. Marked intensity of p-S6 expression was observed in highly proliferative regions of rat renal carcinomas and a rare angiosarcoma, all of which were attributed to prolonged exposure to dietary OTA. Only very small OTA-generated renal adenomas were negative for p-S6. Examples of rat subcutaneous fibrosarcoma and testicular seminoma, as well as of normal renal tissue, showed no or very weak positive staining. In contrast to the animal model, human renal cell carcinoma, upper urinary tract transitional cell carcinoma from cases of Balkan endemic nephropathy, and a human angiosarcoma were negative for p-S6. The combined findings are reminiscent of constitutive changes in the rat tuberous sclerosis gene complex in the Eker strain correlated with renal neoplasms, Therefore rat renal carcinogenesis caused by OTA does not obviously mimic human urinary tract tumourigenesis.

  9. Aggregation of Ribosomal Protein S6 at Nucleolus Is Cell Cycle-Controlled and Its Function in Pre-rRNA Processing Is Phosphorylation Dependent. (United States)

    Zhang, Duo; Chen, Hui-Peng; Duan, Hai-Feng; Gao, Li-Hua; Shao, Yong; Chen, Ke-Yan; Wang, You-Liang; Lan, Feng-Hua; Hu, Xian-Wen


    Ribosomal protein S6 (rpS6) has long been regarded as one of the primary r-proteins that functions in the early stage of 40S subunit assembly, but its actual role is still obscure. The correct forming of 18S rRNA is a key step in the nuclear synthesis of 40S subunit. In this study, we demonstrate that rpS6 participates in the processing of 30S pre-rRNA to 18S rRNA only when its C-terminal five serines are phosphorylated, however, the process of entering the nucleus and then targeting the nucleolus does not dependent its phosphorylation. Remarkably, we also find that the aggregation of rpS6 at the nucleolus correlates to the phasing of cell cycle, beginning to concentrate in the nucleolus at later S phase and disaggregate at M phase. J. Cell. Biochem. 117: 1649-1657, 2016. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  10. Identification of quercitrin as an inhibitor of the p90 S6 ribosomal kinase (RSK): structure of its complex with the N-terminal domain of RSK2 at 1.8 Å resolution

    Energy Technology Data Exchange (ETDEWEB)

    Derewenda, Urszula; Artamonov, Mykhaylo; Szukalska, Gabriela; Utepbergenov, Darkhan; Olekhnovich, Natalya [University of Virginia, Charlottesville, VA 22908-0736 (United States); Parikh, Hardik I.; Kellogg, Glen E. [Virginia Commonwealth University, Richmond, VA 23298-0540 (United States); Somlyo, Avril V.; Derewenda, Zygmunt S., E-mail: [University of Virginia, Charlottesville, VA 22908-0736 (United States)


    The crystal structure of quercitrin, a naturally occurring flavonol glycoside, has been determined in a complex with the N-terminal kinase domain of murine RSK2. The structure revealed that quercitrin inhibits the RSK2 kinase in the same fashion as another known inhibitor, SL0101. Members of the RSK family of kinases constitute attractive targets for drug design, but a lack of structural information regarding the mechanism of selective inhibitors impedes progress in this field. The crystal structure of the N-terminal kinase domain (residues 45–346) of mouse RSK2, or RSK2{sup NTKD}, has recently been described in complex with one of only two known selective inhibitors, a rare naturally occurring flavonol glycoside, kaempferol 3-O-(3′′,4′′-di-O-acetyl-α-l-rhamnopyranoside), known as SL0101. Based on this structure, it was hypothesized that quercitrin (quercetin 3-O-α-l-rhamnopyranoside), a related but ubiquitous and inexpensive compound, might also act as an RSK inhibitor. Here, it is demonstrated that quercitrin binds to RSK2{sup NTKD} with a dissociation constant (K{sub d}) of 5.8 µM as determined by isothermal titration calorimetry, and a crystal structure of the binary complex at 1.8 Å resolution is reported. The crystal structure reveals a very similar mode of binding to that recently reported for SL0101. Closer inspection shows a number of small but significant differences that explain the slightly higher K{sub d} for quercitrin compared with SL0101. It is also shown that quercitrin can effectively substitute for SL0101 in a biological assay, in which it significantly suppresses the contractile force in rabbit pulmonary artery smooth muscle in response to Ca{sup 2+}.

  11. Identification of quercitrin as an inhibitor of the p90 S6 ribosomal kinase (RSK): structure of its complex with the N-terminal domain of RSK2 at 1.8 Å resolution

    International Nuclear Information System (INIS)

    Derewenda, Urszula; Artamonov, Mykhaylo; Szukalska, Gabriela; Utepbergenov, Darkhan; Olekhnovich, Natalya; Parikh, Hardik I.; Kellogg, Glen E.; Somlyo, Avril V.; Derewenda, Zygmunt S.


    The crystal structure of quercitrin, a naturally occurring flavonol glycoside, has been determined in a complex with the N-terminal kinase domain of murine RSK2. The structure revealed that quercitrin inhibits the RSK2 kinase in the same fashion as another known inhibitor, SL0101. Members of the RSK family of kinases constitute attractive targets for drug design, but a lack of structural information regarding the mechanism of selective inhibitors impedes progress in this field. The crystal structure of the N-terminal kinase domain (residues 45–346) of mouse RSK2, or RSK2 NTKD , has recently been described in complex with one of only two known selective inhibitors, a rare naturally occurring flavonol glycoside, kaempferol 3-O-(3′′,4′′-di-O-acetyl-α-l-rhamnopyranoside), known as SL0101. Based on this structure, it was hypothesized that quercitrin (quercetin 3-O-α-l-rhamnopyranoside), a related but ubiquitous and inexpensive compound, might also act as an RSK inhibitor. Here, it is demonstrated that quercitrin binds to RSK2 NTKD with a dissociation constant (K d ) of 5.8 µM as determined by isothermal titration calorimetry, and a crystal structure of the binary complex at 1.8 Å resolution is reported. The crystal structure reveals a very similar mode of binding to that recently reported for SL0101. Closer inspection shows a number of small but significant differences that explain the slightly higher K d for quercitrin compared with SL0101. It is also shown that quercitrin can effectively substitute for SL0101 in a biological assay, in which it significantly suppresses the contractile force in rabbit pulmonary artery smooth muscle in response to Ca 2+

  12. Phosphorylation of ribosomal protein S6 kinase 1 at Thr421/Ser424 and dephosphorylation at Thr389 regulates SP600125-induced polyploidization of megakaryocytic cell lines. (United States)

    Li, Chang-Ling; Yang, Jin-Gang; Lin, Di; Zhao, Yong-Shan; Liu, Shuo; Xing, Si-Ning; Zhao, Song; Chen, Cong-Qin; Jiang, Zhi-Ming; Pu, Fei-Fei; Cao, Jian-Ping; Ma, Dong-Chu


    Megakaryocytes (MKs) are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1) at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL) and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in the SP600125

  13. Phosphorylation of ribosomal protein S6 kinase 1 at Thr421/Ser424 and dephosphorylation at Thr389 regulates SP600125-induced polyploidization of megakaryocytic cell lines.

    Directory of Open Access Journals (Sweden)

    Chang-Ling Li

    Full Text Available Megakaryocytes (MKs are one of the few cell types that become polyploid; however, the mechanisms by which these cells are designated to become polyploid are not fully understood. In this investigation, we successfully established two relatively synchronous polyploid cell models by inducing Dami and CMK cells with SP600125. We found that SP600125 induced the polyploidization of Dami and CMK cells, concomitant with the phosphorylation of ribosomal protein S6 kinase 1 (S6K1 at Thr421/Ser424 and dephosphorylation at Thr389. The polyploidization was partially blocked by H-89, a cAMP-dependent protein kinase (PKA inhibitor, through direct binding to S6K1, leading to dephosphorylation at Thr421/Ser424 and phosphorylation at Thr389, independent of PKA. Overexpression of a rapamycin-resistant mutant of S6K1 further enhanced the inhibitory effect of LY294002 on the SP600125-induced polyploidization of Dami and CMK cells. SP600125 also induced the polyploidization of Meg-01 cells, which are derived from a patient with chronic myelogenous leukemia, without causing a significant change in S6K1 phosphorylation. Additionally, SP600125 induced the polyploidization of HEL cells, which are derived from a patient with erythroleukemia, and phosphorylation at Thr389 of S6K1 was detected. However, the polyploidization of both Meg-01 cells and HEL cells as a result of SP600125 treatment was lower than that of SP600125-induced Dami and CMK cells, and it was not blocked by H-89 despite the increased phosphorylation of S6K1 at Thr389 in both cell lines in response to H-89. Given that the Dami and CMK cell lines were derived from patients with acute megakaryocytic leukemia (AMKL and expressed high levels of platelet-specific antigens, our data suggested that SP600125-induced polyploidization is cell-type specific, that these cell lines were more differentiated, and that phosphorylation at Thr421/Ser424 and dephosphorylation at Thr389 of S6K1 may play an important role in

  14. [SP600125-induced polyploidization of megakaryocytic leukemia cell lines by ribosomal protein S6 kinase 1 depends on the degree of cell differentiation]. (United States)

    Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu


    Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect

  15. Chronic Alcohol Consumption Alters Mammalian Target of Rapamycin (mTOR), Reduces Ribosomal p70S6 Kinase and p4E-BP1 Levels in Mouse Cerebral Cortex


    Li, Qun; Ren, Jun


    Reduced insulin sensitivity following chronic alcohol consumption may contribute to alcohol-induced brain damage although the underlying mechanism(s) has not been elucidated. This study was designed to examine the effect of chronic alcohol intake on insulin signaling in mouse cerebral cortex. FVB mice were fed with a 4% alcohol diet for 16 weeks. Insulin receptor substrates (IRS-1, IRS-2) and post-receptor signaling molecules Akt, mammalian target of rapamycin (mTOR), ribosomal p70s6 kinase (...

  16. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)


    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  17. Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39. (United States)

    Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G


    The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

  18. IL2-dependent phosphorylation of 40S ribosomal protein S6 is controlled by PI-3K/mTOR signalling in CTLL2 cells

    Czech Academy of Sciences Publication Activity Database

    Tuháčková, Zdena; Šloncová, Eva; Vojtěchová, Martina; Sovová, Vlasta


    Roč. 13, č. 4 (2004), s. 601-605 ISSN 1107-3756 R&D Projects: GA ČR GA301/00/0269 Institutional research plan: CEZ:AV0Z5052915 Keywords : MTOR /PI3-K signalling, p70 S 6 kinase, interleukin Subject RIV: CE - Biochemistry Impact factor: 3.190, year: 2004

  19. A hexane fraction of guava Leaves (Psidium guajava L.) induces anticancer activity by suppressing AKT/mammalian target of rapamycin/ribosomal p70 S6 kinase in human prostate cancer cells. (United States)

    Ryu, Nae Hyung; Park, Kyung-Ran; Kim, Sung-Moo; Yun, Hyung-Mun; Nam, Dongwoo; Lee, Seok-Geun; Jang, Hyeung-Jin; Ahn, Kyoo Seok; Kim, Sung-Hoon; Shim, Bum Sang; Choi, Seung-Hoon; Mosaddik, Ashik; Cho, Somi K; Ahn, Kwang Seok


    This study was carried out to evaluate the anticancer effects of guava leaf extracts and its fractions. The chemical compositions of the active extracts were also determined. In the present study, we set out to determine whether the anticancer effects of guava leaves are linked with their ability to suppress constitutive AKT/mammalian target of rapamycin (mTOR)/ribosomal p70 S6 kinase (S6K1) and mitogen-activated protein kinase (MAPK) activation pathways in human prostate cancer cells. We found that guava leaf hexane fraction (GHF) was the most potent inducer of cytotoxic and apoptotic effects in PC-3 cells. The molecular mechanism or mechanisms of GHF apoptotic potential were correlated with the suppression of AKT/mTOR/S6K1 and MAPK signaling pathways. This effect of GHF correlated with down-regulation of various proteins that mediate cell proliferation, cell survival, metastasis, and angiogenesis. Analysis of GHF by gas chromatography and gas chromatography-mass spectrometry tentatively identified 60 compounds, including β-eudesmol (11.98%), α-copaene (7.97%), phytol (7.95%), α-patchoulene (3.76%), β-caryophyllene oxide (CPO) (3.63%), caryophylla-3(15),7(14)-dien-6-ol (2.68%), (E)-methyl isoeugenol (1.90%), α-terpineol (1.76%), and octadecane (1.23%). Besides GHF, CPO, but not phytol, also inhibited the AKT/mTOR/S6K1 signaling pathway and induced apoptosis in prostate cancer cells. Overall, these findings suggest that guava leaves can interfere with multiple signaling cascades linked with tumorigenesis and provide a source of potential therapeutic compounds for both the prevention and treatment of cancer.

  20. Period1 gates the circadian modulation of memory-relevant signaling in mouse hippocampus by regulating the nuclear shuttling of the CREB kinase pP90RSK. (United States)

    Rawashdeh, Oliver; Jilg, Antje; Maronde, Erik; Fahrenkrug, Jan; Stehle, Jörg H


    Memory performance varies over a 24-h day/night cycle. While the detailed underlying mechanisms are yet unknown, recent evidence suggests that in the mouse hippocampus, rhythmic phosphorylation of mitogen-activated protein kinase (MAPK) and cyclic adenosine monophosphate response element-binding protein (CREB) are central to the circadian (~ 24 h) regulation of learning and memory. We recently identified the clock protein PERIOD1 (PER1) as a vehicle that translates information encoding time of day to hippocampal plasticity. We here elaborate how PER1 may gate the sensitivity of memory-relevant hippocampal signaling pathways. We found that in wild-type mice (WT), spatial learning triggers CREB phosphorylation only during the daytime, and that this effect depends on the presence of PER1. The time-of-day-dependent induction of CREB phosphorylation can be reproduced pharmacologically in acute hippocampal slices prepared from WT mice, but is absent in preparations made from Per1-knockout (Per1(-/-) ) mice. We showed that the PER1-dependent CREB phosphorylation is regulated downstream of MAPK. Stimulation of WT hippocampal neurons triggered the co-translocation of PER1 and the CREB kinase pP90RSK (pMAPK-activated ribosomal S6 kinase) into the nucleus. In hippocampal neurons from Per1(-/-) mice, however, pP90RSK remained perinuclear. A co-immunoprecipitation assay confirmed a high-affinity interaction between PER1 and pP90RSK. Knocking down endogenous PER1 in hippocampal cells inhibited adenylyl cyclase-dependent CREB activation. Taken together, the PER1-dependent modulation of cytoplasmic-to-nuclear signaling in the murine hippocampus provides a molecular explanation for how the circadian system potentially shapes a temporal framework for daytime-dependent memory performance, and adds a novel facet to the versatility of the clock gene protein PER1. We provide evidence that the circadian clock gene Period1 (Per1) regulates CREB phosphorylation in the mouse hippocampus

  1. p70S6 kinase signals cell survival as well as growth, inactivating the pro-apoptotic molecule BAD

    DEFF Research Database (Denmark)

    Harada, H; Andersen, Jens S.; Mann, M


    Cytokines often deliver simultaneous, yet distinct, cell growth and cell survival signals. The 70-kDa ribosomal protein S6 kinase (p70S6K) is known to regulate cell growth by inducing protein synthesis components. We purified membrane-based p70S6K as a kinase responsible for site-specific phospho...

  2. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering

    International Nuclear Information System (INIS)

    Burkhardt, N.


    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ( 1 H) for deuterium ( 2 H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [de

  3. Molecular Characterization and Expression Analysis of S6K1 in Cashmere Goats (

    Directory of Open Access Journals (Sweden)

    Wu Manlin


    Full Text Available p70 ribosomal S6 kinase (p70S6K can integrate nutrient and growth factor signals to promote cell growth and survival. We report our molecular characterization of the complementary DNA (cDNA that encodes the goat p70S6K gene 40S ribosomal S6 kinase 1 (S6K1 (GenBank accession GU144017 and its 3′ noncoding sequence in Inner Mongolia Cashmere goats (Capra hircus. Goat S6K1 cDNA was 2,272 bp and include an open reading frame (ORF of 1,578 bp, corresponding to a polypeptide of 525 amino acids, and a 694-residue 3′ noncoding sequence with a polyadenylation signal at nucleotides 2,218 to 2,223. The relative abundance of S6K1 mRNA was measured by real-time PCR in 6 tissues, and p70S6K expression was examined by immunohistochemistry in heart and testis. The phosphorylation of p70S6K is regulated by mitogen-activated protein kinase (MAPK signaling in fetal fibroblasts.

  4. P50/P90 Analysis for Solar Energy Systems Using the System Advisor Model: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Dobos, A. P.; Gilman, P.; Kasberg, M.


    To secure competitive financing for a solar energy generation project, the economic risk associated with interannual solar resource variability must be quantified. One way to quantify this risk is to calculate exceedance probabilities representing the amount of energy expected to be produced by a plant. Many years of solar radiation and metereological data are required to determine these values, often called P50 or P90 values for the level of certainty they represent. This paper describes the two methods implemented in the National Renewable Energy Laboratory's System Advisor Model (SAM) to calculate P50 and P90 exceedance probabilities for solar energy projects. The methodology and supporting data sets are applicable to photovoltaic, solar water heating, and concentrating solar power (CSP) systems.

  5. Samsung Galaxy S6 for dummies

    CERN Document Server

    Hughes, Bill


    Explore the capabilities of your Samsung Galaxy S 6 with this definitive guide! Learning to use a new phone can be both difficult and frustrating. With confusing documentation and baffling support, the references provided by phone manufacturers can be intimidating. Enter Samsung Galaxy S 6 For Dummies! This extensive yet practical guide walks you through the most useful features of your new Samsung Galaxy S 6-and it shows you all the best tricks to getting the most out of your device. With an accessible and fun, yet informative writing style, this is a text that you'll refer to again and agai

  6. Role and regulation of 90 kDa ribosomal S6 kinase (RSK) in signal transduction

    DEFF Research Database (Denmark)

    Frödin, M; Gammeltoft, S


    ), which were among the first substrates of ERK to be discovered and which has proven to be a ubiquitous and versatile mediator of ERK signal transduction. RSK is composed of two functional kinase domains that are activated in a sequential manner by a series of phosphorylations. Recently, a family of RSK......-related kinases that are activated by ERK as well as p38 MAPK were discovered and named mitogen- and stress-activated protein kinases (MSK). A number of cellular functions of RSK have been proposed. (1) Regulation of gene expression via association and phosphorylation of transcriptional regulators including c...

  7. A ribosome without RNA

    Directory of Open Access Journals (Sweden)

    Harold S Bernhardt


    Full Text Available It was Francis Crick who first asked why the ribosome contains so much RNA, and discussed the implications of this for the direct flow of genetic information from DNA to protein. Remarkable advances in our understanding of the ribosome and protein synthesis, including the recent publication of two mammalian mitochondrial ribosome structures, have shed new light on this intriguing aspect of evolution in molecular biology. We examine here whether RNA is indispensable for coded protein synthesis, or whether an all-protein ‘ribosome’ (or ‘synthosome’ might be possible, with a protein enzyme catalyzing peptide synthesis, and release factor-like protein adaptors able to read a message composed of deoxyribonucleotides. We also compare the RNA world hypothesis with the alternative ‘proteins first’ hypothesis in terms of their different understandings of the evolution of the ribosome, and whether this might have been preceded by an ancestral form of nonribosomal peptide synthesis catalyzed by protein enzymes.

  8. Ribosomal Antibiotics: Contemporary Challenges

    Directory of Open Access Journals (Sweden)

    Tamar Auerbach-Nevo


    Full Text Available Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  9. Expanding the ribosomal universe. (United States)

    Dinman, Jonathan D; Kinzy, Terri Goss


    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  10. Comparative evaluation of microleakage in class II cavities restored with Ceram X and Filtek P-90: An in vitro study

    Directory of Open Access Journals (Sweden)

    Poonam Bogra


    Full Text Available Context: Polymerization shrinkage in composite resins is responsible for microleakage. Methacrylate-based composite resins have linear reactive groups resulting in high polymerization shrinkage. A recently introduced composite resin Filtek P90 is based on siloxanes and oxiranes which polymerize by cationic "ring opening" polymerization resulting in reduced polymerization shrinkage. Objectives: Aim of this study was to compare microleakage in class II cavities restored with a nanoceramic restorative (Ceram X and a silorane composite (Filtek P90. Materials and Methods: Standardized class II box type cavities were prepared on mesial (Groups Ia and IIa and distal (Groups Ib and IIb surfaces of twenty extracted permanent molar teeth with gingival floor ending 1 mm coronal and apical to the cementoenamel junction, respectively. The teeth in Group Ia and Ib were restored with Ceram X and Group IIa and IIb with Filtek P90. The specimens were thermocycled and microleakage evaluated. Statistical Analysis Used: The data were statistically analyzed using Wilcoxon Signed-Rank test at the 0.05 level of significance. Results: Mean microleakage score of group la and lb was 1 ± 2.260 and 2.8 ± 1.229, respectively. And that of group Ila and llb was 0.2 ± .869 and 0.3 ± .588, respectively. When groups I and II were compared, results were statistically significant (P<0.05. Conclusion: It was concluded that silorane-based composite may be a better substitute for methacrylate-based composites.

  11. Skeletal myocyte hypertrophy requires mTOR kinase activity and S6K1

    International Nuclear Information System (INIS)

    Park, In-Hyun; Erbay, Ebru; Nuzzi, Paul; Chen Jie


    The protein kinase mammalian target of rapamycin (mTOR) is a central regulator of cell proliferation and growth, with the ribosomal subunit S6 kinase 1 (S6K1) as one of the key downstream signaling effectors. A critical role of mTOR signaling in skeletal muscle differentiation has been identified recently, and an unusual regulatory mechanism independent of mTOR kinase activity and S6K1 is revealed. An mTOR pathway has also been reported to regulate skeletal muscle hypertrophy, but the regulatory mechanism is not completely understood. Here, we report the investigation of mTOR's function in insulin growth factor I (IGF-I)-induced C2C12 myotube hypertrophy. Added at a later stage when rapamycin no longer had any effect on normal myocyte differentiation, rapamycin completely blocked myocyte hypertrophy as measured by myotube diameter. Importantly, a concerted increase of average myonuclei per myotube was observed in IGF-I-stimulated myotubes, which was also inhibited by rapamycin added at a time when it no longer affected normal differentiation. The mTOR protein level, its catalytic activity, its phosphorylation on Ser2448, and the activity of S6K1 were all found increased in IGF-I-stimulated myotubes compared to unstimulated myotubes. Using C2C12 cells stably expressing rapamycin-resistant forms of mTOR and S6K1, we provide genetic evidence for the requirement of mTOR and its downstream effector S6K1 in the regulation of myotube hypertrophy. Our results suggest distinct mTOR signaling mechanisms in different stages of skeletal muscle development: While mTOR regulates the initial myoblast differentiation in a kinase-independent and S6K1-independent manner, the hypertrophic function of mTOR requires its kinase activity and employs S6K1 as a downstream effector

  12. S6K1 Is Required for Increasing Skeletal Muscle Force during Hypertrophy. (United States)

    Marabita, Manuela; Baraldo, Martina; Solagna, Francesca; Ceelen, Judith Johanna Maria; Sartori, Roberta; Nolte, Hendrik; Nemazanyy, Ivan; Pyronnet, Stéphane; Kruger, Marcus; Pende, Mario; Blaauw, Bert


    Loss of skeletal muscle mass and force aggravates age-related sarcopenia and numerous pathologies, such as cancer and diabetes. The AKT-mTORC1 pathway plays a major role in stimulating adult muscle growth; however, the functional role of its downstream mediators in vivo is unknown. Here, we show that simultaneous inhibition of mTOR signaling to both S6K1 and 4E-BP1 is sufficient to reduce AKT-induced muscle growth and render it insensitive to the mTORC1-inhibitor rapamycin. Surprisingly, lack of mTOR signaling to 4E-BP1 only, or deletion of S6K1 alone, is not sufficient to reduce muscle hypertrophy or alter its sensitivity to rapamycin. However, we report that, while not required for muscle growth, S6K1 is essential for maintaining muscle structure and force production. Hypertrophy in the absence of S6K1 is characterized by compromised ribosome biogenesis and the formation of p62-positive protein aggregates. These findings identify S6K1 as a crucial player for maintaining muscle function during hypertrophy. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Targeting Aberrant p70S6K Activation for Estrogen Receptor-Negative Breast Cancer Prevention. (United States)

    Wang, Xiao; Yao, Jun; Wang, Jinyang; Zhang, Qingling; Brady, Samuel W; Arun, Banu; Seewaldt, Victoria L; Yu, Dihua


    The prevention of estrogen receptor-negative (ER-) breast cancer remains a major challenge in the cancer prevention field, although antiestrogen and aromatase inhibitors have shown adequate efficacy in preventing estrogen receptor-positive (ER + ) breast cancer. Lack of commonly expressed, druggable targets is a major obstacle for meeting this challenge. Previously, we detected the activation of Akt signaling pathway in atypical hyperplasic early-stage lesions of patients. In the current study, we found that Akt and the downstream 70 kDa ribosomal protein S6 kinase (p70S6K) signaling pathway was highly activated in ER - premalignant breast lesions and ER - breast cancer. In addition, p70S6K activation induced transformation of ER - human mammary epithelial cells (hMEC). Therefore, we explored the potential of targeting Akt/p70S6K in the p70S6K activated, ER - hMEC models and mouse mammary tumor models for the prevention of ER - breast cancer. We found that a clinically applicable Akt/p70S6K dual inhibitor, LY2780301, drastically decreased proliferation of hMECs with ErbB2-induced p70S6K activation via Cyclin B1 inhibition and cell-cycle blockade at G 0 -G 1 phase, while it did not significantly reverse the abnormal acinar morphology of these hMECs. In addition, a brief treatment of LY2780301 in MMTV- neu mice that developed atypical hyperplasia (ADH) and mammary intraepithelial neoplasia (MIN) lesions with activated p70S6K was sufficient to suppress S6 phosphorylation and decrease cell proliferation in hyperplasic MECs. In summary, targeting the aberrant Akt/p70S6K activation in ER - hMEC models in vitro and in the MMTV- neu transgenic mouse model in vivo effectively inhibited Akt/S6K signaling and reduced proliferation of hMECs in vitro and ADH/MIN lesions in vivo , indicating its potential in prevention of p70S6K activated ER - breast cancer. Cancer Prev Res; 10(11); 641-50. ©2017 AACR . ©2017 American Association for Cancer Research.

  14. In vitro degradation of ribosomes. (United States)

    Mora, G; Rivas, A


    The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.

  15. P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae

    Directory of Open Access Journals (Sweden)

    Michael Widjaja


    Full Text Available Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i provides cell polarity, (ii directs adherence to receptors presented on respiratory epithelium, and (iii plays a major role in cell motility. The major adhesins, P1 (Mpn141 and P30 (Mpn453, are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28 during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457 generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30.

  16. P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae (United States)

    Widjaja, Michael; Berry, Iain J.; Pont, Elsa J.; Padula, Matthew P.; Djordjevic, Steven P.


    Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i) provides cell polarity, (ii) directs adherence to receptors presented on respiratory epithelium, and (iii) plays a major role in cell motility. The major adhesins, P1 (Mpn141) and P30 (Mpn453), are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28) during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457) generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS) analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30. PMID:28248283

  17. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.


    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  18. Design of Hybrid Gels Based on Gellan-Cholesterol Derivative and P90G Liposomes for Drug Depot Applications

    Directory of Open Access Journals (Sweden)

    Nicole Zoratto


    Full Text Available Gels are extensively studied in the drug delivery field because of their potential benefits in therapeutics. Depot gel systems fall in this area, and the interest in their development has been focused on long-lasting, biocompatible, and resorbable delivery devices. The present work describes a new class of hybrid gels that stem from the interaction between liposomes based on P90G phospholipid and the cholesterol derivative of the polysaccharide gellan. The mechanical properties of these gels and the delivery profiles of the anti-inflammatory model drug diclofenac embedded in such systems confirmed the suitability of these hybrid gels as a good candidate for drug depot applications.

  19. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill, E-mail:


    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. - Highlights: • Multiple regions on the Arabidopsis Raptor protein were found to be involved in substrate binding. • N-terminal end of the Arabidopsis ribosomal S6 kinase 1 (AtS6K1) was responsible for interacting with AtRaptor1. • The Raptor-interacting fragment of AtS6K1 could be utilized as an effective inhibitor of plant TOR signaling.

  20. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor

    International Nuclear Information System (INIS)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill


    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. - Highlights: • Multiple regions on the Arabidopsis Raptor protein were found to be involved in substrate binding. • N-terminal end of the Arabidopsis ribosomal S6 kinase 1 (AtS6K1) was responsible for interacting with AtRaptor1. • The Raptor-interacting fragment of AtS6K1 could be utilized as an effective inhibitor of plant TOR signaling.

  1. Hydrogen peroxide mediates Rac1 activation of S6K1

    International Nuclear Information System (INIS)

    Bae, Gyu-Un; Kim, Yong Kee; Kwon, Hyoung-Keun; Park, Jong Woo; Lee, Eun Kyung; Paek, Se Jin; Choi, Wahn Soo; Jung, In Duk; Lee, Hoi Young; Cho, Eun-Jung; Lee, Hyang Woo; Han, Jeung-Whan


    We previously reported that hydrogen peroxide (H 2 O 2 ) mediates mitogen activation of ribosomal protein S6 kinase 1 (S6K1) which plays an important role in cell proliferation and growth. In this study, we investigated a possible role of H 2 O 2 as a molecular linker in Rac1 activation of S6K1. Overexpression of recombinant catalase in NIH-3T3 cells led to the drastic inhibition of H 2 O 2 production by PDGF, which was accompanied by a decrease in S6K1 activity. Similarly, PDGF activation of S6K1 was significantly inhibited by transient transfection or stable transfection of the cells with a dominant-negative Rac1 (Rac1N17), while overexpression of constitutively active Rac1 (Rac1V12) in the cells led to an increase in basal activity of S6K1. In addition, stable transfection of Rat2 cells with Rac1N17 dramatically attenuated the H 2 O 2 production by PDGF as compared with that in the control cells. In contrast, Rat2 cells stably transfected with Rac1V12 produced high level of H 2 O 2 in the absence of PDGF, comparable to that in the control cells stimulated with PDGF. More importantly, elimination of H 2 O 2 produced in Rat2 cells overexpressing Rac1V12 inhibited the Rac1V12 activation of S6K1, indicating the possible role of H 2 O 2 as a mediator in the activation of S6K1 by Rac1. However, H 2 O 2 could be also produced via other pathway, which is independent of Rac1 or PI3K, because in Rat2 cells stably transfected with Rac1N17, H 2 O 2 could be produced by arsenite, which has been shown to be a stimulator of H 2 O 2 production. Taken together, these results suggest that H 2 O 2 plays a pivotal role as a mediator in Rac1 activation of S6K1

  2. Metabolic control by S6 kinases depends on dietary lipids.

    Directory of Open Access Journals (Sweden)

    Tamara R Castañeda

    Full Text Available Targeted deletion of S6 kinase (S6K 1 in mice leads to higher energy expenditure and improved glucose metabolism. However, the molecular mechanisms controlling these effects remain to be fully elucidated. Here, we analyze the potential role of dietary lipids in regulating the mTORC1/S6K system. Analysis of S6K phosphorylation in vivo and in vitro showed that dietary lipids activate S6K, and this effect is not dependent upon amino acids. Comparison of male mice lacking S6K1 and 2 (S6K-dko with wt controls showed that S6K-dko mice are protected against obesity and glucose intolerance induced by a high-fat diet. S6K-dko mice fed a high-fat diet had increased energy expenditure, improved glucose tolerance, lower fat mass gain, and changes in markers of lipid metabolism. Importantly, however, these metabolic phenotypes were dependent upon dietary lipids, with no such effects observed in S6K-dko mice fed a fat-free diet. These changes appear to be mediated via modulation of cellular metabolism in skeletal muscle, as shown by the expression of genes involved in energy metabolism. Taken together, our results suggest that the metabolic functions of S6K in vivo play a key role as a molecular interface connecting dietary lipids to the endogenous control of energy metabolism.

  3. S6K1 is involved in polyploidization through its phosphorylation at Thr421/Ser424. (United States)

    Ma, Dongchu; Yu, Huiying; Lin, Di; Sun, Yinghui; Liu, Liping; Liu, Yage; Dai, Bing; Chen, Wei; Cao, Jianping


    Studies on polyploidization of megakaryocytes have been hampered by the lack of synchronized polyploid megakaryocytes. In this study, a relatively synchronized polyploid cell model was successfully established by employing Dami cells treated with nocodazole. In nocodazole-induced cells, cyclin B expression oscillated normally as in diploid cells and polyploid megakaryocytes. By using the nocodazole-induced Dami cell model, we found that 4E-BP1 and Thr421/Ser424 of ribosomal S6 kinase 1(S6K1) were phosphorylated mostly at M-phase in cytoplasm and oscillated in nocodazole-induced polyploid Dami cells, concomitant with increased expression of p27 and cyclin D3. However, phosphorylation of 4E-BP1 and S6K1 on Thr421/Ser424 was significantly decreased in differentiated Dami cells induced by phorbol 12-myristate 13-acetate (PMA), concomitant with increased expression of cyclin D1 and p21 and cyclin D3. Overexpression of the kinase dead form of S6K1 containing the mutation Lys 100 --> Gln in PMA-induced Dami cells increased ploidy whereas overexpression of rapamycin-resistant form of S6K1 containing the mutations Thr421 --> Glu and Ser424 --> Asp significantly dephosphorylated 4E-BP1 and reduced expression of cyclin D1, cyclin D3, p21 and p27, and slightly decreased the ploidy of PMA-induced Dami cells, compared with treatment with PMA alone. Moreover, overexpression of rapamycin-resistant form of S6K1 significantly reversed polyploidization of nocodazole-induced Dami cells. Furthermore, MAP (a novel compound synthesized recently) partly blocked the phosphorylation of S6K1 on Thr421/Ser424 and decreased the expression of p27 and polyploidization in nocodazole-induced Dami cells. Taken together, these data suggested that S6K1/4E-BP1 pathway may play an important role in polyploidization of megakaryocytes. (c) 2008 Wiley-Liss, Inc.

  4. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome (United States)

    Poirot, Olivier; Timsit, Youri


    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.

  5. A single 60-min bout of peristaltic pulse external pneumatic compression transiently upregulates phosphorylated ribosomal protein s6. (United States)

    Martin, J S; Kephart, W C; Mobley, C B; Wilson, T J; Goodlett, M D; Roberts, M D


    We investigated whether a single 60-min bout of whole leg, peristaltic pulse external pneumatic compression (EPC) altered select growth factor-related mRNAs and/or various phospho(p)-proteins related to cell growth, proliferation, inflammation and apoptosis signalling (e.g. Akt-mTOR, Jak-Stat). Ten participants (8 males, 2 females; aged 22·2 ± 0·4 years) reported to the laboratory 4 h post-prandial, and vastus lateralis muscle biopsies were obtained prior to (PRE), 1 h and 4 h post-EPC treatment. mRNA expression was analysed using real-time RT-PCR and phosphophorylated and cleaved proteins were analysed using an antibody array. No changes in selected growth factor-related mRNAs were observed following EPC. All p-proteins significantly altered by EPC decreased, except for p-rps6 (Ser235/236) which increased 31% 1 h post-EPC compared to PRE levels (P = 0·016). Notable decreases also included p-BAD (Ser112; -28%, P = 0·004) at 4 h post-EPC compared to PRE levels. In summary, an acute bout of EPC transiently upregulates p-rps6 as well as affecting other markers in the Akt-mTOR signalling cascade. Future research should characterize whether chronic EPC application promotes alterations in lower-limb musculature and/or enhances exercise-induced training adaptations. © 2016 Scandinavian Society of Clinical Physiology and Nuclear Medicine. Published by John Wiley & Sons Ltd.

  6. Mutagenic and Cytotoxic Properties of 6-Thioguanine, S6-Methylthioguanine, and Guanine-S6-sulfonic Acid*S⃞


    Yuan, Bifeng; Wang, Yinsheng


    Thiopurine drugs, including 6-thioguanine (SG), 6-mercaptopurine, and azathioprine, are widely employed anticancer agents and immunosuppressants. The formation of SG nucleotides from the thiopurine prodrugs and their subsequent incorporation into nucleic acids are important for the drugs to exert their cytotoxic effects. SG in DNA can be methylated by S-adenosyl-l-methionine to give S6-methylthioguanine (S6mG) and oxidized by UVA light to render guanine-S6-sulfonic acid ...

  7. Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation (United States)

    Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A


    The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906

  8. Association between PI3K/Akt/mTOR/p70S6K signaling pathway and hepatic fibrosis

    Directory of Open Access Journals (Sweden)

    WU Changhui


    Full Text Available Phosphoinositide 3-kinase (PI3K/protein kinase-B (AkT/mammalian target of rapamycin (mTOR/70-kDa ribosomal protein S6 kinase (p70S6K, PI3K/Akt/mTOR/p70S6K, is an important signaling pathway in the life activities of cells, and it plays an important role in promoting the growth, proliferation, invasion, and anti-apoptosis of cells and promoting angiogenesis. It was clarified that the PI3K/Akt/mTOR/p70S6K signaling pathway is involved in regulating the activities of hepatic stellate cell(HSC, thus influencing the development and progression of hepatic fibrosis. Analysis demonstrated that blocking any target of the PI3K/Akt/mTOR/p70S6K signaling pathway can inhibit the activation and proliferation of HSC, promote the apoptosis of HSC, inhibit the extracellular matrix secretion from HSC, and delay the progression of hepatic fibrosis. Blocking the pathway is expected to be a treatment strategy for hepatic fibrosis.

  9. Inhibition of mammalian S6 kinase by resveratrol suppresses autophagy. (United States)

    Armour, Sean M; Baur, Joseph A; Hsieh, Sherry N; Land-Bracha, Abigail; Thomas, Sheila M; Sinclair, David A


    Resveratrol is a plant-derived polyphenol that promotes health and disease resistance in rodent models, and extends lifespan in lower organisms. A major challenge is to understand the biological processes and molecular pathways by which resveratrol induces these beneficial effects. Autophagy is a critical process by which cells turn over damaged components and maintain bioenergetic requirements. Disruption of the normal balance between pro- and anti-autophagic signals is linked to cancer, liver disease, and neurodegenerative disorders. Here we show that resveratrol attenuates autophagy in response to nutrient limitation or rapamycin in multiple cell lines through a pathway independent of a known target, SIRT1. In a large-scalein vitro kinase screen we identified p70 S6 kinase (S6K1) as a target of resveratrol. Blocking S6K1 activity by expression of a dominant-negative mutant or RNA interference is sufficient to disrupt autophagy to a similar extent as resveratrol. Furthermore, co-administration of resveratrol with S6K1 knockdown does not produce an additive effect. These data indicate that S6K1 is important for the full induction of autophagy in mammals and raise the possibility that some of the beneficial effects of resveratrol are due to modulation of S6K1 activity.

  10. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome. (United States)

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C


    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. 5S rRNA and ribosome. (United States)

    Gongadze, G M


    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  12. Control of ribosome formation in rat heart

    International Nuclear Information System (INIS)

    Russo, L.A.


    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 μU/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of [ 3 H]phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation

  13. (Ph4P)S6—A Compound Containing the Cyclic Radical Anion S6.−

    NARCIS (Netherlands)

    Neumuller, F.; Schmock, R.; Kirmse, A.; Voigt, A.; Diefenbach, A.; Bickelhaupt, F.M.; Dehnicke, K.


    Two long S−S bonds link the two S3 fragments in the cyclic radical anion S6.−. This forms as orange‐red crystals with PPh4+ as the counterion in the reaction of sulfane with (tetraphenylphosphonium) hydrogen diazide. The anion has a chair conformation with C2h symmetry (see picture).

  14. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N. [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung


    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  15. Ribosomal studies on the 70S ribosome of E.coli by means of neutron scattering; Strukturuntersuchungen am 70S-Ribosom von E.coli unter Anwendung von Neutronenstreuung

    Energy Technology Data Exchange (ETDEWEB)

    Burkhardt, N [GKSS-Forschungszentrum Geesthacht GmbH (Germany). Inst. fuer Werkstofforschung


    Ribosomes are ribonucleo-protein complexes, which catalyse proteinbiosynthesis in all living organisms. Currently, most of the structural models of the prokaryotic 70S ribosome rely on electron microscopy and describe mainly the outer shape of the particle. Neutron scattering can provide information on the internal structure of the ribosome. Parts of the structure can be contrasted for neutrons by means of an isotopic exchange of the naturally occurring hydrogen ({sup 1}H) for deuterium ({sup 2}H), allowing direct measurements in situ. Specifically deuterium-labeled ribosomes (E. coli) were prepared and analysed with neutron scattering. The biochemical methods were established and combined to a generally applicable preparation system. This allows labeling of all ribosomal components in any combination. A systematic analysis of the protein and RNA phases resulted in the development of a new model for the 70S ribosome. This model describes not only the outer shape of the particle, but displays also an experimentally determined internal protein-RNA distribution and the border of subunits for the first time (four-phase model; resolution: 50A). Models of the 70S ribosome from other studies were evaluated and ranked according to consistency with the measured scattering data. Applying a new neutron scattering technique of particular sensitivity, the proton-spin contrast-variation, single proteins could be measured and localized. The positions of the proteins S6 and S10 were determined, providing the first coordinates of protein mass centers within the 70S ribosome. (orig.) [Deutsch] Ribosomen sind Ribonukleinsaeure-Protein Komplexe, die in allen lebenden Organismen die Proteinbiosynthese katalysieren. Strukturmodelle fuer das prokaryontische 70S-Ribosom beruhen derzeit vorwiegend auf elektronenmikroskopischen Untersuchungen und beschreiben im wesentlichen die aeussere Oberflaeche des Partikels. Informationen ueber die innere Struktur des Ribosoms koennen Messungen mit

  16. Altered Regulation of Contraction-Induced Akt/mTOR/p70S6k Pathway Signaling in Skeletal Muscle of the Obese Zucker Rat

    Directory of Open Access Journals (Sweden)

    Anjaiah Katta


    Full Text Available Increased muscle loading results in the phosphorylation of the 70 kDa ribosomal S6 kinase (p70S6k, and this event is strongly correlated with the degree of muscle adaptation following resistance exercise. Whether insulin resistance or the comorbidities associated with this disorder may affect the ability of skeletal muscle to activate p70S6k signaling following an exercise stimulus remains unclear. Here, we compare the contraction-induced activation of p70S6k signaling in the plantaris muscles of lean and insulin resistant obese Zucker rats following a single bout of increased contractile loading. Compared to lean animals, the basal phosphorylation of p70S6k (Thr389; 37.2% and Thr421/Ser424; 101.4%, Akt (Thr308; 25.1%, and mTOR (Ser2448; 63.0% was higher in obese animals. Contraction increased the phosphorylation of p70S6k (Thr389, Akt (Ser473, and mTOR (Ser2448 in both models however the magnitude and kinetics of activation differed between models. These results suggest that contraction-induced activation of p70S6k signaling is altered in the muscle of the insulin resistant obese Zucker rat.

  17. Mutagenic and cytotoxic properties of 6-thioguanine, S6-methylthioguanine, and guanine-S6-sulfonic acid. (United States)

    Yuan, Bifeng; Wang, Yinsheng


    Thiopurine drugs, including 6-thioguanine ((S)G), 6-mercaptopurine, and azathioprine, are widely employed anticancer agents and immunosuppressants. The formation of (S)G nucleotides from the thiopurine prodrugs and their subsequent incorporation into nucleic acids are important for the drugs to exert their cytotoxic effects. (S)G in DNA can be methylated by S-adenosyl-l-methionine to give S(6)-methylthioguanine (S(6)mG) and oxidized by UVA light to render guanine-S(6)-sulfonic acid ((SO3H)G). Here, we constructed single-stranded M13 shuttle vectors carrying a (S)G, S(6)mG, or (SO3H)G at a unique site and allowed the vectors to propagate in wild-type and bypass polymerase-deficient Escherichia coli cells. Analysis of the replication products by using the competitive replication and adduct bypass and a slightly modified restriction enzyme digestion and post-labeling assays revealed that, although none of the three thionucleosides considerably blocked DNA replication in all transfected E. coli cells, both S(6)mG and (SO3H)G were highly mutagenic, which resulted in G-->A mutation at frequencies of 94 and 77%, respectively, in wild-type E. coli cells. Deficiency in bypass polymerases does not result in alteration of mutation frequencies of these two lesions. In contrast to what was found from previous steady-state kinetic analysis, our data demonstrated that 6-thioguanine is mutagenic, with G-->A transition occurring at a frequency of approximately 10%. The mutagenic properties of 6-thioguanine and its derivatives revealed in the present study offered important knowledge about the biological implications of these thionucleosides.

  18. Supersymmetric AdS6 solutions of type IIB supergravity

    International Nuclear Information System (INIS)

    Kim, Hyojoong; Kim, Nakwoo; Suh, Minwoo


    We study the general requirement for supersymmetric AdS 6 solutions in type IIB supergravity. We employ the Killing spinor technique and study the differential and algebraic relations among various Killing spinor bilinears to find the canonical form of the solutions. Our result agrees precisely with the work of Apruzzi et al. (JHEP 1411:099, 2014), which used the pure spinor technique. Hoping to identify the geometry of the problem, we also computed four-dimensional theory through the dimensional reduction of type IIB supergravity on AdS 6 . This effective action is essentially a non-linear sigma model with five scalar fields parametrizing SL(3,ℝ)/SO(2,1), modified by a scalar potential and coupled to Einstein gravity in Euclidean signature. We argue that the scalar potential can be explained by a subgroup CSO(1,1,1) ⊂SL(3,ℝ) in a way analogous to gauged supergravity

  19. Electronic structure of Ag8GeS6

    Directory of Open Access Journals (Sweden)

    D.I. Bletskan


    Full Text Available For the first time, the energy band structure, total and partial densities of states of Ag8GeS6 crystal were calculated using the ab initio density functional method in LDA and LDA+U approximations. Argyrodite is direct-gap semiconductor with the calculated band gap width Egd = 1.46 eV in the LDA+U approximation. The valence band of argyrodite contains four energy separated groups of occupied subzones. The unique feature of electron-energy structure of Ag8GeS6 crystal is the energy overlapping between the occupied d-states of Ag atoms and the delocalized valence p-states of S atoms in relatively close proximity to the valence band top.

  20. Constructing a folding model for protein S6 guided by native fluctuations deduced from NMR structures

    International Nuclear Information System (INIS)

    Lammert, Heiko; Noel, Jeffrey K.; Haglund, Ellinor; Onuchic, José N.; Schug, Alexander


    The diversity in a set of protein nuclear magnetic resonance (NMR) structures provides an estimate of native state fluctuations that can be used to refine and enrich structure-based protein models (SBMs). Dynamics are an essential part of a protein’s functional native state. The dynamics in the native state are controlled by the same funneled energy landscape that guides the entire folding process. SBMs apply the principle of minimal frustration, drawn from energy landscape theory, to construct a funneled folding landscape for a given protein using only information from the native structure. On an energy landscape smoothed by evolution towards minimal frustration, geometrical constraints, imposed by the native structure, control the folding mechanism and shape the native dynamics revealed by the model. Native-state fluctuations can alternatively be estimated directly from the diversity in the set of NMR structures for a protein. Based on this information, we identify a highly flexible loop in the ribosomal protein S6 and modify the contact map in a SBM to accommodate the inferred dynamics. By taking into account the probable native state dynamics, the experimental transition state is recovered in the model, and the correct order of folding events is restored. Our study highlights how the shared energy landscape connects folding and function by showing that a better description of the native basin improves the prediction of the folding mechanism

  1. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation. (United States)

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven


    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. In vitro Comparison of the Effct Cola Beverage on Surface Hardness of Siloran-Based (p90 and Methyl Methacrylate-Based (p60 Composites

    Directory of Open Access Journals (Sweden)



    Full Text Available Introduction: Th characteristics of a suitable restoration material is having acceptable mechanical properties, protecting teeth against decay and ease of use in clinics. Diet can affct properties of restorative materials in the mouth. Since amongst important properties of composite restorations are mechanical properties such as hardness, the aim of this study was evaluation of the effct of Coca-Cola Beverages on surface hardness of a silorane based p90( and methyl methacrylate p60( composites. Methods: In this experimental study, thirty disc-shaped specimens 5 × 2 mm( of each of methyl methacrylate based Filtek p60, 3M Dental Products, USA( and a silorane based Filtek p90, 3M Dental Products, USA( composite resins were prepared, according to manufacturers' instructions. Specimens were randomly divided to four groups as follows N = 15(: G1: Filtek p90 without exposure to Coca-Cola, G2: Filtek p90 with exposure to Coca-Cola, G3: Filtek p60 without expure to Coca-Cola, G4: Filtek p60 with expure to Coca-Cola. Th specimens were exposed to regular sof drinks Coca-Cola, Khoshgovar, Tehran, Iran( at room temperature for seven days with a frequency of three times daily for 20 minutes at a time. In the remaining times of the day, they were kept in distilled water. Thn, micro hardness measurements were made for each specimen with a Vickers hardness testing machine Buehler, Lake Bluff IL, USA( under 500 g of force for 15 seconds. Data were analyzed using SPSS 18 and independent t-test at a signifiance level of 0.05. Results: Micro hardness values of four groups were G1: 68.28 ± 2.65; G2:59.56 ± 6.61; G3: 93.5 ± 2.38; and G4:86.76 ± 5.47, respectively. Th results of this study showed that Coca-Cola reduces the surface hardness of the two composite materials P > 0.05(. Conclusions: Th results showed the hardness of both Filtek p90 and Filtek p60 composite signifiantly decreases with Coca-Cola but the reduction was equal.

  3. Trapping the ribosome to control gene expression. (United States)

    Boehringer, Daniel; Ban, Nenad


    Protein synthesis is often regulated by structured mRNAs that interact with ribosomes. In this issue of Cell, Marzi et al. (2007) provide insights into the autoregulation of protein S15 by visualizing the folded repressor mRNA on the ribosome stalled in the preinitiation state. These results have implications for our understanding of the mechanism of translation initiation in general.

  4. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.


    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  5. Differential Stoichiometry among Core Ribosomal Proteins

    Directory of Open Access Journals (Sweden)

    Nikolai Slavov


    Full Text Available Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs, some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function.

  6. Molecular mechanisms mediating the neuroproyective effects of quinacrine and minocycline on cell death induced by the prion protein fragment 90-231 (hPrP90-231

    Directory of Open Access Journals (Sweden)

    V. Villa


    Full Text Available The effects of quinacrine and minocycline on the toxicity induced by hPrP90-231 were studied. By mild thermal denaturation, hPrP90-231 can be converted in a toxic PrPSc-like structure affecting the survival of SH-SY5Y cells. Quinacrine and minocycline prevented hPrP90-231-induced toxicity interfering with different mechanisms: protective effects of quinacrine are mediated by the binding to the fragment that abolished hPrP90-231 structural changes and cell internalization, whereas, minocycline reverted MAP kinase neurotoxic signaling exerted by the prion fragment.

  7. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori; Takagi, Fumiko; Shimada, Takashi; Ito, Nobuyasu


    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We

  8. Ribosome evolution: Emergence of peptide synthesis machinery

    Indian Academy of Sciences (India)

    suggested the dynamic movement of ribosomal proteins. The L2 protein (a .... Such kinds of interactions are important in elucidating the evolution of RNA .... Tamura K 2009 Molecular handedness of life: significance of RNA aminoacylation.

  9. Is The Ribosome Targeted By Adaptive Mutations

    DEFF Research Database (Denmark)

    Jimenez Fernandez, Alicia; Molin, Søren; Johansen, Helle Krogh


    Introduction: RNA polymerase and ribosomes, composing the macromolecular synthesis machinery (MMSM), carry out the central processes of transcription and translation, but are usually seen as mechanical elements with no regulatory function. Extensive investigations of gene regulation and the high ...

  10. Synthetic peptides and ribosomal proteins as substrate for 60S ribosomal protein kinase from yeast cells

    DEFF Research Database (Denmark)

    Grankowski, N; Gasior, E; Issinger, O G


    Kinetic studies on the 60S protein kinase were conducted with synthetic peptides and ribosomal proteins as substrate. Peptide RRREEESDDD proved to be the best synthetic substrate for this enzyme. The peptide has a sequence of amino acids which most closely resembles the structure of potential...... phosphorylation sites in natural substrates, i.e., acidic ribosomal proteins. The superiority of certain kinetic parameters for 60S kinase obtained with the native whole 80S ribosomes over those of the isolated fraction of acidic ribosomal proteins indicates that the affinity of 60S kinase to the specific protein...

  11. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.


    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  12. Period1 gates the circadian modulation of memory-relevant signaling in mouse hippocampus by regulating the nuclear shuttling of the CREB kinase pP90RSK

    DEFF Research Database (Denmark)

    Rawashdeh, Oliver; Jilg, Antje; Maronde, Erik


    , the presence of PER1 in hippocampal neurons is a prerequisite for the time-of-day-dependent phosphorylation of CREB, as it regulates the shuttling of pP90RSK into the nucleus. Representative immunofluorescence images show a temporal difference in phosphorylated cAMP response element-binding protein (p...... activation. Taken together, the PER1-dependent modulation of cytoplasmic-to-nuclear signaling in the murine hippocampus provides a molecular explanation for how the circadian system potentially shapes a temporal framework for daytime-dependent memory performance, and adds a novel facet to the versatility......CREB; green color) levels in all regions of the dorsal hippocampus between a wild-type C3H mouse (WT; left) and a Period1-knockout (Per1−/−; right) mouse. Images were taken 2 h after lights on, thus, when fluctuating levels of pCREB peak in WT mouse hippocampus. Insets show a representative hippocampal neuron...

  13. Spin-flip isovector giant resonances from the 90Zr (n,p) 90Y reaction at 200 MeV

    International Nuclear Information System (INIS)

    Raywood, K.J.; Spicer, B.M.


    Doubly differential cross sections of the reaction 90 Zr(n,p) 90 Y have been measured at 200 MeV for excitations up to 38 MeV in the residual nucleus. An overall resolution of 1.3 MeV was achieved. The spectra show qualitative agreement in shape and magnitude with recent RPA calculations; however all of the calculations underestimate the high excitation region of the spectra. A multipole decomposition of the data has been performed using differential cross sections calculated in the DWIA. An estimate of the Gamow-Teller strength in the reaction is given. The isovector spin-flip dipole giant resonance has been identified and there is also an indication of isovector monopole strength. 39 refs., 16 figs., 1 tab

  14. Identification of the Raptor-binding motif on Arabidopsis S6 kinase and its use as a TOR signaling suppressor. (United States)

    Son, Ora; Kim, Sunghan; Hur, Yoon-Sun; Cheon, Choong-Ill


    TOR (target of rapamycin) kinase signaling plays central role as a regulator of growth and proliferation in all eukaryotic cells and its key signaling components and effectors are also conserved in plants. Unlike the mammalian and yeast counterparts, however, we found through yeast two-hybrid analysis that multiple regions of the Arabidopsis Raptor (regulatory associated protein of TOR) are required for binding to its substrate. We also identified that a 44-amino acid region at the N-terminal end of Arabidopsis ribosomal S6 kinase 1 (AtS6K1) specifically interacted with AtRaptor1, indicating that this region may contain a functional equivalent of the TOS (TOR-Signaling) motif present in the mammalian TOR substrates. Transient over-expression of this 44-amino acid fragment in Arabidopsis protoplasts resulted in significant decrease in rDNA transcription, demonstrating a feasibility of developing a new plant-specific TOR signaling inhibitor based upon perturbation of the Raptor-substrate interaction. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. The ribosome can prevent aggregation of partially folded protein intermediates: studies using the Escherichia coli ribosome.

    Directory of Open Access Journals (Sweden)

    Bani Kumar Pathak

    Full Text Available BACKGROUND: Molecular chaperones that support de novo folding of proteins under non stress condition are classified as chaperone 'foldases' that are distinct from chaperone' holdases' that provide high affinity binding platform for unfolded proteins and prevent their aggregation specifically under stress conditions. Ribosome, the cellular protein synthesis machine can act as a foldase chaperone that can bind unfolded proteins and release them in folding competent state. The peptidyl transferase center (PTC located in the domain V of the 23S rRNA of Escherichia coli ribosome (bDV RNA is the chaperoning center of the ribosome. It has been proposed that via specific interactions between the RNA and refolding proteins, the chaperone provides information for the correct folding of unfolded polypeptide chains. RESULTS: We demonstrate using Escherichia coli ribosome and variants of its domain V RNA that the ribosome can bind to partially folded intermediates of bovine carbonic anhydrase II (BCAII and lysozyme and suppress aggregation during their refolding. Using mutants of domain V RNA we demonstrate that the time for which the chaperone retains the bound protein is an important factor in determining its ability to suppress aggregation and/or support reactivation of protein. CONCLUSION: The ribosome can behave like a 'holdase' chaperone and has the ability to bind and hold back partially folded intermediate states of proteins from participating in the aggregation process. Since the ribosome is an essential organelle that is present in large numbers in all living cells, this ability of the ribosome provides an energetically inexpensive way to suppress cellular aggregation. Further, this ability of the ribosome might also be crucial in the context that the ribosome is one of the first chaperones to be encountered by a large nascent polypeptide chains that have a tendency to form partially folded intermediates immediately following their synthesis.

  16. Initiation factor eIF2B not p70 S6 kinase is involved in the activation of the PI-3K signalling pathway induced by the v=src oncogene

    Czech Academy of Sciences Publication Activity Database

    Vojtěchová, Martina; Šloncová, Eva; Kučerová, Dana; Jiřička, Jaroslav; Sovová, Vlasta; Tuháčková, Zdena


    Roč. 543, 1-3 (2003), s. 81-86 ISSN 0014-5793 R&D Projects: GA ČR GV312/96/K205; GA ČR GA301/00/0269; GA MZd NC5428 Institutional research plan: CEZ:AV0Z5052915 Keywords : phosphoinositide 3-kinase signalling pathway * mRNA translation * 70 kDa ribosomal protein S6 kinase Subject RIV: CE - Biochemistry Impact factor: 3.609, year: 2003

  17. Detection and Quantification of Ribosome Inhibition by Aminoglycoside Antibiotics in Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter. (United States)

    Huang, Shijie; Zhu, Xuechen; Melançon, Charles E


    The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.

  18. Effect of primary and secondary radicals on chain breaks in ribosomal RNA in E. coli ribosomes

    International Nuclear Information System (INIS)

    Singh, H.; Bishop, J.


    It has been shown previously that, in dilute aerated solutions, ribosomes are inactivated by OH radicals and by secondary radicals produced from added alcohols (Singh and Vadasz 1983 a). In de-aerated solutions, both radicalH and e - sub(aq) also inactivate ribosomes (Singh and Vadasz 1983 b). The results of these studies and other on different systems (Adams et al. 1973, Aldrich and Cundall 1969, Dewey and Stein 1970, Masuda et al. 1971, Nabben et al. 1982, 1983, Samuni et al. 1980, Singh and Singh 1982) have shown that damage to biological systems occurs by diverse mechanisms. One of these mechanisms involves chain breaks in RNA (Pollard and Weller 1967). The purpose of this study was to determine which of the primary and secondary radicals cause chain breaks in ribosomal RNA (rRNA) within the ribosomes. (author)

  19. Functional characterization of human RSK4, a new 90-kDa ribosomal S6 kinase, reveals constitutive activation in most cell types

    DEFF Research Database (Denmark)

    Dümmler, Bettina A; Hauge, Camilla; Silber, Joachim


    characterization of a predicted new human RSK homologue, RSK4. We showed that RSK4 is a predominantly cytosolic protein with very low expression and several characteristics of the RSK family kinases, including the presence of two functional kinase domains and a C-terminal docking site for ERK. Surprisingly......, however, in all cell types analyzed, endogenous RSK4 was maximally (constitutively) activated under serum-starved conditions where other RSKs are inactive due to their requirement for growth factor stimulation. Constitutive activation appeared to result from constitutive phosphorylation of Ser232, Ser372...

  20. Ribosomal Protein S6 Kinase (RSK-2 as a central effector molecule in RON receptor tyrosine kinase mediated epithelial to mesenchymal transition induced by macrophage-stimulating protein

    Directory of Open Access Journals (Sweden)

    Zhang Rui-Wen


    Full Text Available Abstract Background Epithelial to mesenchymal transition (EMT occurs during cancer cell invasion and malignant metastasis. Features of EMT include spindle-like cell morphology, loss of epithelial cellular markers and gain of mesenchymal phenotype. Activation of the RON receptor tyrosine kinase by macrophage-stimulating protein (MSP has been implicated in cellular EMT program; however, the major signaling determinant(s responsible for MSP-induced EMT is unknown. Results The study presented here demonstrates that RSK2, a downstream signaling protein of the Ras-Erk1/2 pathway, is the principal molecule that links MSP-activated RON signaling to complete EMT. Using MDCK cells expressing RON as a model, a spindle-shape based screen was conducted, which identifies RSK2 among various intracellular proteins as a potential signaling molecule responsible for MSP-induced EMT. MSP stimulation dissociated RSK2 with Erk1/2 and promoted RSK2 nuclear translocation. MSP strongly induced RSK2 phosphorylation in a dose-dependent manner. These effects relied on RON and Erk1/2 phosphorylation, which is significantly potentiated by transforming growth factor (TGF-β1, an EMT-inducing cytokine. Specific RSK inhibitor SL0101 completely prevented MSP-induced RSK phosphorylation, which results in inhibition of MSP-induced spindle-like morphology and suppression of cell migration associated with EMT. In HT-29 cancer cells that barely express RSK2, forced RSK2 expression results in EMT-like phenotype upon MSP stimulation. Moreover, specific siRNA-mediated silencing of RSK2 but not RSK1 in L3.6pl pancreatic cancer cells significantly inhibited MSP-induced EMT-like phenotype and cell migration. Conclusions MSP-induced RSK2 activation is a critical determinant linking RON signaling to cellular EMT program. Inhibition of RSK2 activity may provide a therapeutic opportunity for blocking RON-mediated cancer cell migration and subsequent invasion.

  1. GTPases and the origin of the ribosome

    Directory of Open Access Journals (Sweden)

    Smith Temple F


    Full Text Available Abstract Background This paper is an attempt to trace the evolution of the ribosome through the evolution of the universal P-loop GTPases that are involved with the ribosome in translation and with the attachment of the ribosome to the membrane. The GTPases involved in translation in Bacteria/Archaea are the elongation factors EFTu/EF1, the initiation factors IF2/aeIF5b + aeIF2, and the elongation factors EFG/EF2. All of these GTPases also contain the OB fold also found in the non GTPase IF1 involved in initiation. The GTPase involved in the signal recognition particle in most Bacteria and Archaea is SRP54. Results 1 The Elongation Factors of the Archaea based on structural considerations of the domains have the following evolutionary path: EF1→ aeIF2 → EF2. The evolution of the aeIF5b was a later event; 2 the Elongation Factors of the Bacteria based on the topological considerations of the GTPase domain have a similar evolutionary path: EFTu→ IF→2→EFG. These evolutionary sequences reflect the evolution of the LSU followed by the SSU to form the ribosome; 3 the OB-fold IF1 is a mimic of an ancient tRNA minihelix. Conclusion The evolution of translational GTPases of both the Archaea and Bacteria point to the evolution of the ribosome. The elongation factors, EFTu/EF1, began as a Ras-like GTPase bringing the activated minihelix tRNA to the Large Subunit Unit. The initiation factors and elongation factor would then have evolved from the EFTu/EF1 as the small subunit was added to the evolving ribosome. The SRP has an SRP54 GTPase and a specific RNA fold in its RNA component similar to the PTC. We consider the SRP to be a remnant of an ancient form of an LSU bound to a membrane. Reviewers This article was reviewed by George Fox, Leonid Mirny and Chris Sander.

  2. Absorbed dose profiles for 32P, 90Y, 188Re, 177Lu, 51Cr, 153Sm and 169Er: radionuclides used in radiosynoviortheses treatment

    International Nuclear Information System (INIS)

    Torres, M.; Ayra, E.; Albuerne, O.; Delgado, M.


    The remarkable advances in the design and synthesis of radiopharmaceuticals has created the opportunity of generating new agents for the treatment of radiosynoviortheses (RSV) which exhibit a minimum leakage from the synovial joint reducing, this way, the non desired absorbed doses to non target organs such as liver, spleen, kidney. Nowadays, the variety of beta emitters used in RSV ranges between 0.34 MeV - 0.33 mm penetration in tissue ( 169 Er) and 2.27 MeV - 3.6 mm penetration in tissue ( 90 Y). The half life of these isotopes goes from 2.3 hours ( 165 Dy) to 27.8 days ( 51 Cr). The selection criterion on which radionuclide should be used, in modern clinics, depends on which joints are to be treated. Thus, the smaller the joint, the lowest should be the energy of the beta emitted and the penetration in soft tissue of these particles. This leads to the use of fixed radionuclides and doses for each kind of joint. In the Isotopes Centre, we've been carrying on studies for the development of radiopharmaceuticals for the radiosynoviortheses treatment and focused our attention in the following radionuclides: 32 P, 90 Y, 188 Re, 177 Lu, 51 Cr, 153 Sm and 169 Er. The main objective of this paper was to obtain the absorbed dose profiles for radionuclides of frequent or potential use in radiosynoviortheses. These profiles reveal the absorbed dose imparted per unit activity of injected radionuclide (Gy/h*MBq) in the synovial membrane and the articular cartilage. The researched radionuclides were those previously mentioned. Also were calculated the therapeutic range of each radionuclides in synovial tissue. The therapeutic range is defined as the deepness at which the absorbed dose equals the 10 % of the maximum dose deposited in the synovial surface. This range determines the synovial thickness that can be sufficiently irradiated and thus successfully treated. The synovial membrane model consisted on a cylinder with the source uniformly distributed in its volume. This

  3. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site. (United States)

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D


    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  4. Ribosomal history reveals origins of modern protein synthesis.

    Directory of Open Access Journals (Sweden)

    Ajith Harish

    Full Text Available The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17 and the oldest substructure (the ribosomal ratchet in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world.

  5. Phosphorylation of acidic ribosomal proteins from rabbit reticulocytes by a ribosome-associated casein kinase

    DEFF Research Database (Denmark)

    Issinger, O G


    Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate polyacryl......Two acidic proteins from 80-S ribosomes were isolated and purified to homogeneity. The purified acidic proteins could be phosphorylated by casein kinase using [gamma-32P]ATP and [gamma-32P]GTP as a phosphoryl donor. The proteins became phosphorylated in situ, too. Sodium dodecyl sulfate...

  6. The ribosomal protein Rpl22 controls ribosome composition by directly repressing expression of its own paralog, Rpl22l1.

    Directory of Open Access Journals (Sweden)

    Monique N O'Leary

    Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.

  7. Architecture of the large subunit of the mammalian mitochondrial ribosome. (United States)

    Greber, Basil J; Boehringer, Daniel; Leitner, Alexander; Bieri, Philipp; Voigts-Hoffmann, Felix; Erzberger, Jan P; Leibundgut, Marc; Aebersold, Ruedi; Ban, Nenad


    Mitochondrial ribosomes synthesize a number of highly hydrophobic proteins encoded on the genome of mitochondria, the organelles in eukaryotic cells that are responsible for energy conversion by oxidative phosphorylation. The ribosomes in mammalian mitochondria have undergone massive structural changes throughout their evolution, including ribosomal RNA shortening and acquisition of mitochondria-specific ribosomal proteins. Here we present the three-dimensional structure of the 39S large subunit of the porcine mitochondrial ribosome determined by cryo-electron microscopy at 4.9 Å resolution. The structure, combined with data from chemical crosslinking and mass spectrometry experiments, reveals the unique features of the 39S subunit at near-atomic resolution and provides detailed insight into the architecture of the polypeptide exit site. This region of the mitochondrial ribosome has been considerably remodelled compared to its bacterial counterpart, providing a specialized platform for the synthesis and membrane insertion of the highly hydrophobic protein components of the respiratory chain.

  8. Placeholder factors in ribosome biogenesis: please, pave my way

    Directory of Open Access Journals (Sweden)

    Francisco J. Espinar-Marchena


    Full Text Available The synthesis of cytoplasmic eukaryotic ribosomes is an extraordinarily energy-demanding cellular activity that occurs progressively from the nucleolus to the cytoplasm. In the nucleolus, precursor rRNAs associate with a myriad of trans-acting factors and some ribosomal proteins to form pre-ribosomal particles. These factors include snoRNPs, nucleases, ATPases, GTPases, RNA helicases, and a vast list of proteins with no predicted enzymatic activity. Their coordinate activity orchestrates in a spatiotemporal manner the modification and processing of precursor rRNAs, the rearrangement reactions required for the formation of productive RNA folding intermediates, the ordered assembly of the ribosomal proteins, and the export of pre-ribosomal particles to the cytoplasm; thus, providing speed, directionality and accuracy to the overall process of formation of translation-competent ribosomes. Here, we review a particular class of trans-acting factors known as “placeholders”. Placeholder factors temporarily bind selected ribosomal sites until these have achieved a structural context that is appropriate for exchanging the placeholder with another site-specific binding factor. By this strategy, placeholders sterically prevent premature recruitment of subsequently binding factors, premature formation of structures, avoid possible folding traps, and act as molecular clocks that supervise the correct progression of pre-ribosomal particles into functional ribosomal subunits. We summarize the current understanding of those factors that delay the assembly of distinct ribosomal proteins or subsequently bind key sites in pre-ribosomal particles. We also discuss recurrent examples of RNA-protein and protein-protein mimicry between rRNAs and/or factors, which have clear functional implications for the ribosome biogenesis pathway.

  9. The architecture of mammalian ribosomal protein promoters

    Directory of Open Access Journals (Sweden)

    Perry Robert P


    Full Text Available Abstract Background Mammalian ribosomes contain 79 different proteins encoded by widely scattered single copy genes. Coordinate expression of these genes at transcriptional and post-transcriptional levels is required to ensure a roughly equimolar accumulation of ribosomal proteins. To date, detailed studies of only a very few ribosomal protein (rp promoters have been made. To elucidate the general features of rp promoter architecture, I made a detailed sequence comparison of the promoter regions of the entire set of orthologous human and mouse rp genes. Results A striking evolutionarily conserved feature of most rp genes is the separation by an intron of the sequences involved in transcriptional and translational regulation from the sequences with protein encoding function. Another conserved feature is the polypyrimidine initiator, which conforms to the consensus (Y2C+1TY(T2(Y3. At least 60 % of the rp promoters contain a largely conserved TATA box or A/T-rich motif, which should theoretically have TBP-binding capability. A remarkably high proportion of the promoters contain conserved binding sites for transcription factors that were previously implicated in rp gene expression, namely upstream GABP and Sp1 sites and downstream YY1 sites. Over 80 % of human and mouse rp genes contain a transposable element residue within 900 bp of 5' flanking sequence; very little sequence identity between human and mouse orthologues was evident more than 200 bp upstream of the transcriptional start point. Conclusions This analysis has provided some valuable insights into the general architecture of mammalian rp promoters and has identified parameters that might coordinately regulate the transcriptional activity of certain subsets of rp genes.

  10. Molecular dynamics simulation of ribosome jam

    KAUST Repository

    Matsumoto, Shigenori


    We propose a coarse-grained molecular dynamics model of ribosome molecules to study the dependence of translation process on environmental parameters. We found the model exhibits traffic jam property, which is consistent with an ASEP model. We estimated the influence of the temperature and concentration of molecules on the hopping probability used in the ASEP model. Our model can also treat environmental effects on the translation process that cannot be explained by such cellular automaton models. © 2010 Elsevier B.V. All rights reserved.

  11. Ribosomal RNA: a key to phylogeny (United States)

    Olsen, G. J.; Woese, C. R.


    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  12. Eukaryotic ribosome display with in situ DNA recovery. (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J


    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  13. The Protein Kinase RSK Family - Roles in Prostate Cancer

    National Research Council Canada - National Science Library

    Lannigan, Deborah


    The Ser/Thr protein kinase p90-kDa ribosomal S6 kinase (RSK) is an important downstream effector of mitogen-activated protein kinase but its roles in prostate cancer have not been previously examined...

  14. Involvement of S6K1 in mitochondria function and structure in HeLa cells. (United States)

    Park, Jisoo; Tran, Quangdon; Mun, Kisun; Masuda, Kouhei; Kwon, So Hee; Kim, Seon-Hwan; Kim, Dong-Hoon; Thomas, George; Park, Jongsun


    The major biological function of mitochondria is to generate cellular energy through oxidative phosphorylation. Apart from cellular respiration, mitochondria also play a key role in signaling processes, including aging and cancer metabolism. It has been shown that S6K1-knockout mice are resistant to obesity due to enhanced beta-oxidation, with an increased number of large mitochondria. Therefore, in this report, the possible involvement of S6K1 in regulating mitochondria dynamics and function has been investigated in stable lenti-shS6K1-HeLa cells. Interestingly, S6K1-stably depleted HeLa cells showed phenotypical changes in mitochondria morphology. This observation was further confirmed by detailed image analysis of mitochondria shape. Corresponding molecular changes were also observed in these cells, such as the induction of mitochondrial fission proteins (Drp1 and Fis1). Oxygen consumption is elevated in S6K1-depeleted HeLa cells and FL5.12 cells. In addition, S6K1 depletion leads to enhancement of ATP production in cytoplasm and mitochondria. However, the relative ratio of mitochondrial ATP to cytoplasmic ATP is actually decreased in lenti-shS6K1-HeLa cells compared to control cells. Lastly, induction of mitophagy was found in lenti-shS6K1-HeLa cells with corresponding changes of mitochondria shape on electron microscope analysis. Taken together, our results indicate that S6K1 is involved in the regulation of mitochondria morphology and function in HeLa cells. This study will provide novel insights into S6K1 function in mitochondria-mediated cellular signaling. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. In Profile: Models of Ribosome Biogenesis Defects and Regulation of Protein Synthesis

    NARCIS (Netherlands)

    Essers, P.B.M.


    Ribosomes are the mediators of protein synthesis in the cell and therefore crucial to proper cell function. In addition, ribosomes are highly abundant, with ribosomal RNA making up 80% of the RNA in the cell. A large amount of resources go into maintaining this pool of ribosomes, so ribosome

  16. A computational investigation on the connection between dynamics properties of ribosomal proteins and ribosome assembly.

    Directory of Open Access Journals (Sweden)

    Brittany Burton

    Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.

  17. Defining the bacteroides ribosomal binding site. (United States)

    Wegmann, Udo; Horn, Nikki; Carding, Simon R


    The human gastrointestinal tract, in particular the colon, hosts a vast number of commensal microorganisms. Representatives of the genus Bacteroides are among the most abundant bacterial species in the human colon. Bacteroidetes diverged from the common line of eubacterial descent before other eubacterial groups. As a result, they employ unique transcription initiation signals and, because of this uniqueness, they require specific genetic tools. Although some tools exist, they are not optimal for studying the roles and functions of these bacteria in the human gastrointestinal tract. Focusing on translation initiation signals in Bacteroides, we created a series of expression vectors allowing for different levels of protein expression in this genus, and we describe the use of pepI from Lactobacillus delbrueckii subsp. lactis as a novel reporter gene for Bacteroides. Furthermore, we report the identification of the 3' end of the 16S rRNA of Bacteroides ovatus and analyze in detail its ribosomal binding site, thus defining a core region necessary for efficient translation, which we have incorporated into the design of our expression vectors. Based on the sequence logo information from the 5' untranslated region of other Bacteroidales ribosomal protein genes, we conclude that our findings are relevant to all members of this order.

  18. Expression and subcellular localization of p70S6 kinase under heart failure

    Directory of Open Access Journals (Sweden)

    Usenko V. S.


    Full Text Available The PI3K/PDK/Akt/mTOR/p70S6K signaling pathway is primary associated with the activation of insulin receptors and is important for cardiomyocytes survival. p70S6K is a key regulator of the speed and efficiency of protein biosynthesis within the cell. Recently the pro-apoptotic protein BAD has been identified as a new target for р70S6K1. BAD is inactivated in normal cardiomyocytes by р70S6K1 phosphorylation which prevents the cardiomyocytes apoptosis. Aim. To study possible changes in р70S6K1 expression and/or cellular localization at heart failure progression – in DCM- affected human myocardia and murine hearts with experimental DCM-like pathology. Methods. Western-blot analysis and immunohystochemistry. Results. The substantial decrease in р70S6K1 level was observed at the final stage of pathology progression and in the dynamics of DCM pathogenesis as well. For the first time relocalization of the protein to the connective tissue was shown according to the Western-blot results. Conclusions. The data obtained allow us to understand a possible role of р70S6K1 in the regulation of stress-induced apoptotic signaling in cardiomyocytes.

  19. Structure of the S6 spirel arm in the Andromeda galaxy

    International Nuclear Information System (INIS)

    Efremov, Yu.N.


    The distribution of stars across the spiral arm S6 in M 31 within Baade's Field 4 is investigated. It is found that the brightest stars are concentrated to the middle line of the arm where the maximal star density is also observed. The symmetry of the arm S6 may be explained by its position near the corotation radius that followed from the spiral pattern velocity Ωsub(P) approximately 10 km/s kpc determined by the age gradient in the arm S4. The similarity between the structure of the arm S6 and that of the spiral arms near the Sun is pointed out [ru

  20. Mechanism of recycling of post-termination ribosomal complexes in ...

    Indian Academy of Sciences (India)


    all pathway of ribosome recycling in eubacteria with especial reference to the important role of the initiation factor ... [Seshadri A and Varshney U 2006 Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3 .... RRF binding results in a remarkable conformational change.

  1. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik


    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  2. Proto-ribosome: a theoretical approach based on RNA relics


    Demongeot, Jacques


    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  3. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo


    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes. PMID:27557515

  4. Therapeutic dosages of aspirin counteract the IL-6 induced pro-tumorigenic effects by slowing down the ribosome biogenesis rate. (United States)

    Brighenti, Elisa; Giannone, Ferdinando Antonino; Fornari, Francesca; Onofrillo, Carmine; Govoni, Marzia; Montanaro, Lorenzo; Treré, Davide; Derenzini, Massimo


    Chronic inflammation is a risk factor for the onset of cancer and the regular use of aspirin reduces the risk of cancer development. Here we showed that therapeutic dosages of aspirin counteract the pro-tumorigenic effects of the inflammatory cytokine interleukin(IL)-6 in cancer and non-cancer cell lines, and in mouse liver in vivo. We found that therapeutic dosages of aspirin prevented IL-6 from inducing the down-regulation of p53 expression and the acquisition of the epithelial mesenchymal transition (EMT) phenotypic changes in the cell lines. This was the result of a reduction in c-Myc mRNA transcription which was responsible for a down-regulation of the ribosomal protein S6 expression which, in turn, slowed down the rRNA maturation process, thus reducing the ribosome biogenesis rate. The perturbation of ribosome biogenesis hindered the Mdm2-mediated proteasomal degradation of p53, throughout the ribosomal protein-Mdm2-p53 pathway. P53 stabilization hindered the IL-6 induction of the EMT changes. The same effects were observed in livers from mice stimulated with IL-6 and treated with aspirin. It is worth noting that aspirin down-regulated ribosome biogenesis, stabilized p53 and up-regulated E-cadherin expression in unstimulated control cells also. In conclusion, these data showed that therapeutic dosages of aspirin increase the p53-mediated tumor-suppressor activity of the cells thus being in this way able to reduce the risk of cancer onset, either or not linked to chronic inflammatory processes.

  5. Role of p70S6K1-mediated phosphorylation of eIF4B and PDCD4 proteins in the regulation of protein synthesis. (United States)

    Dennis, Michael D; Jefferson, Leonard S; Kimball, Scot R


    Modulation of mRNA binding to the 40 S ribosomal subunit during translation initiation controls not only global rates of protein synthesis but also regulates the pattern of protein expression by allowing for selective inclusion, or exclusion, of mRNAs encoding particular proteins from polysomes. The mRNA binding step is modulated by signaling through a protein kinase known as the mechanistic target of rapamycin complex 1 (mTORC1). mTORC1 directly phosphorylates the translational repressors eIF4E binding proteins (4E-BP) 1 and 2, releasing them from the mRNA cap binding protein eIF4E, thereby promoting assembly of the eIF4E·eIF4G complex. mTORC1 also phosphorylates the 70-kDa ribosomal protein S6 kinase 1 (p70S6K1), which subsequently phosphorylates eIF4B, and programmed cell death 4 (PDCD4), which sequesters eIF4A from the eIF4E·eIF4G complex, resulting in repressed translation of mRNAs with highly structured 5'-untranslated regions. In the present study, we compared the role of the 4E-BPs in the regulation of global rates of protein synthesis to that of eIF4B and PDCD4. We found that maintenance of eIF4E interaction with eIF4G was not by itself sufficient to sustain global rates of protein synthesis in the absence of mTORC1 signaling to p70S6K1; phosphorylation of both eIF4B and PDCD4 was additionally required. We also found that the interaction of eIF4E with eIF4G was maintained in the liver of fasted rats as well as in serum-deprived mouse embryo fibroblasts lacking both 4E-BP1 and 4E-BP2, suggesting that the interaction of eIF4G with eIF4E is controlled primarily through the 4E-BPs.

  6. Hsp60 and p70S6K form a complex in human cardiomyocytes

    Directory of Open Access Journals (Sweden)

    Kroupskaya I. V.


    Full Text Available Molecular chaperon Hsp60 and protein kinase p70S6K play an important functional role in the regulation of cardiomyocytes vital function or apoptosis. Aim. To study a possibility of in vivo complex formation between Hsp60 and p70S6K in cardiomyocytes. Methods. Co-immunoprecipitation, Western-blot analysis. Results. We have identified in vivo interaction between molecular chaperone Hsp60 and two isoforms of proteinkinase p70S6K in human myocardium, normal and affected by cardiomyopathy. Conclusions. The results obtained suggest a possible participation of molecular chaperon Hsp60 in regulation of p70S6K activity in stressinduced apoptotic signaling pathway in cardiomyocytes.

  7. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome

    Directory of Open Access Journals (Sweden)

    Jendrik Hentschel


    Full Text Available The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics.

  8. Macrolide antibiotic interaction and resistance on the bacterial ribosome. (United States)

    Poehlsgaard, Jacob; Douthwaite, Stephen


    Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.

  9. Cis-regulatory RNA elements that regulate specialized ribosome activity. (United States)

    Xue, Shifeng; Barna, Maria


    Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.

  10. Control of Ribosome Synthesis in Escherichia coli

    DEFF Research Database (Denmark)

    Molin, Søren; Meyenburg, K. von; Måløe, O.


    The rate of ribosome synthesis and accumulation in Escherichia coli during the transition after an energy source shift-down was analyzed. The shift was imposed on cultures of stringent and relaxed strains growing in glucose minimal medium by the addition of the glucose analogue {alpha...... and to estimate the transcription time for the rRNA operon under different conditions. In steady states of growth with growth rates ranging from 0.75 to 2.3 doublings/h, as well as during the transition after a shift-down, the transcription time of the rRNA operon was constant. The rate of synthesis of r......RNA correlated during this transition – in contrast to the rate of accumulation (M. T. Hansen et al., J. Bacteriol. 122: 585-591, 1975) – with the ppGpp pool in the same way as has been observed during partial amino acid starvation....

  11. Hierarchical recruitment of ribosomal proteins and assembly factors remodels nucleolar pre-60S ribosomes. (United States)

    Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L


    Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.

  12. A comparative study of ribosomal proteins: linkage between amino acid distribution and ribosomal assembly

    International Nuclear Information System (INIS)

    Lott, Brittany Burton; Wang, Yongmei; Nakazato, Takuya


    Assembly of the ribosome from its protein and RNA constituents must occur quickly and efficiently in order to synthesize the proteins necessary for all cellular activity. Since the early 1960’s, certain characteristics of possible assembly pathways have been elucidated, yet the mechanisms that govern the precise recognition events remain unclear. We utilize a comparative analysis to investigate the amino acid composition of ribosomal proteins (r-proteins) with respect to their role in the assembly process. We compared small subunit (30S) r-protein sequences to those of other housekeeping proteins from 560 bacterial species and searched for correlations between r-protein amino acid content and factors such as assembly binding order, environmental growth temperature, protein size, and contact with ribosomal RNA (rRNA) in the 30S complex. We find r-proteins have a significantly high percent of positive residues, which are highly represented at rRNA contact sites. An inverse correlation between the percent of positive residues and r-protein size was identified and is mainly due to the content of Lysine residues, rather than Arginine. Nearly all r-proteins carry a net positive charge, but no statistical correlation between the net charge and the binding order was detected. Thermophilic (high-temperature) r-proteins contain increased Arginine, Isoleucine, and Tyrosine, and decreased Serine and Threonine compared to mesophilic (lower-temperature), reflecting a known distinction between thermophiles and mesophiles, possibly to account for protein thermostability. However, this difference in amino acid content does not extend to rRNA contact sites, as the proportions of thermophilic and mesophilic contact residues are not significantly different. Given the significantly higher level of positively charged residues in r-proteins and at contact sites, we conclude that ribosome assembly relies heavily on an electrostatic component of interaction. However, the binding order of

  13. On the control of ribosomal protein biosynthesis in Escherichia coli

    International Nuclear Information System (INIS)

    Pichon, J.; Marvaldi, J.; Coeroli, C.; Cozzone, A.; Marchis-Mouren, G.


    The rate of individual ribosomal protein synthesis relative to total protein synthesis has been determined in Escherichia coli rel + and rel - cells, under valyl-tRNA deprivation. These strains have a temperature-sensitive valyl-tRNA synthetase. Starvation was obtained following transfer of the cells to non-permissive temperature. Ribosomal proteins were obtained by treatment of either total lysates of freeze-thawed lysozyme spheroplasts or ammonium sulphate precipitate of ribosomes, with acetic acid. Differential labelling of the ribosomal proteins was observed in both strains: proteins from the rel + strain appear more labelled than those from the rel - strain, the rate of labelling of individual proteins being about the same in both strains. Moreover ribosomal proteins were found as stable during starvation as total protein. It is thus concluded that in starving cells individual ribosomal proteins are not synthesized at equal rates. This indicates that the synthesis of ribosomal proteins is not only under the control of the rel gene

  14. Post-transcriptional regulation of ribosome biogenesis in yeast

    Directory of Open Access Journals (Sweden)

    Isabelle C. Kos-Braun


    Full Text Available Most microorganisms are exposed to the constantly and often rapidly changing environment. As such they evolved mechanisms to balance their metabolism and energy expenditure with the resources available to them. When resources become scarce or conditions turn out to be unfavourable for growth, cells reduce their metabolism and energy usage to survive. One of the major energy consuming processes in the cell is ribosome biogenesis. Unsurprisingly, cells encountering adverse conditions immediately shut down production of new ribosomes. It is well established that nutrient depletion leads to a rapid repression of transcription of the genes encoding ribosomal proteins, ribosome biogenesis factors as well as ribosomal RNA (rRNA. However, if pre-rRNA processing and ribosome assembly are regulated post-transcriptionally remains largely unclear. We have recently uncovered that the yeast Saccharomyces cerevisiae rapidly switches between two alternative pre-rRNA processing pathways depending on the environmental conditions. Our findings reveal a new level of complexity in the regulation of ribosome biogenesis.

  15. The Unexplored Mechanisms and Regulatory Functions of Ribosomal Translocation (United States)

    Alejo, Jose Luis

    In every cell, protein synthesis is carried out by the ribosome, a complex macromolecular RNA-protein assembly. Decades of structural and kinetic studies have increased our understanding of ribosome initiation, decoding, translocation and termination. Yet, the underlying mechanism of these fundamental processes has yet to be fully delineated. Hence, the molecular basis of regulation remains obscure. Here, single-molecule fluorescence methods are applied to decipher the mechanism and regulatory roles of the multi-step process of directional substrate translocation on the ribosome that accompanies every round of protein synthesis. In Chapter 1, single-molecule fluorescence resonance energy transfer (smFRET) is introduced as a tool for studying bacterial ribosome translocation. Chapter 2 details the experimental methods. In Chapter 3, the elongation factor G(EF-G)-catalyzed movement of substrates through the ribosome is examined from several perspectives or signals reporting on various degrees of freedom of ribosome dynamics. Two ribosomal states interconvert in the presence of EF-G(GDP), displaying novel head domain motions, until relocking takes place. In Chapter 4, in order to test if the mentioned fluctuations leading to relocking are correlated to the engagement of the P-site by the peptidyl-tRNA, the translocation of miscoded tRNAs is studied. Severe defects in the relocking stages of translocation reveal the correlation between this new stage of translocation and P-site tRNA engagement.

  16. Fe-solubility of Ni7S6 and Ni9S8: Thermodynamic analysis

    International Nuclear Information System (INIS)

    Waldner, P.


    Experimental data on phase equilibria have been used for thermodynamic analysis of the iron solubility of the nickel sulfides Ni 7 S 6 and Ni 9 S 8 . For both compounds, a two-sublattice approach within the framework of the compound energy formalism has been applied to perform Gibbs free energy modelling at 0.1 MPa total pressure consistently embedded in recent thermodynamic assessment studies of other iron-nickel-sulfides. The predicted maxima of iron solubility around 3 at% of Ni 7 S 6 and 5.5 at% of Ni 9 S 8 are confirmed by experimental data. The calculations of complex ternary phase relations with Fe-bearing Ni 7 S 6 and Ni 9 S 8 gain further improvement. The first internally consistent description of all thermodynamically stable phases known in the literature for the iron-nickel-sulfur system is completed.

  17. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    Directory of Open Access Journals (Sweden)

    Gayani N. P. Dedduwa-Mudalige


    Full Text Available Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human.

  18. Organization of Replication of Ribosomal DNA in Saccharomyces cerevisiae

    NARCIS (Netherlands)

    Linskens, Maarten H.K.; Huberman, Joel A.


    Using recently developed replicon mapping techniques, we have analyzed the replication of the ribosomal DNA in Saccharomyces cerevisiae. The results show that (i) the functional origin of replication colocalizes with an autonomously replicating sequence element previously mapped to the

  19. Ribosome slowed by mutation to streptomycin resistance. [Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Galas, D J; Branscomb, E W


    The effect of mutation to streptomycin resistance on the speed of polypeptide elongation in Escherichia coli was investigated. Translation speed was determined by measuring the time required for the first newly synthesized ..beta..-galactosidase molecules to appear after induction of the lactose operon. The results showed that ribosome speed is not a fixed parameter inherent to the protein synthetic apparatus, but a variable determined by the kinetics of translation and ultimately by the structure of the ribosome. (HLW)

  20. S6Ks isoforms contribute to viability, migration, docetaxel resistance and tumor formation of prostate cancer cells

    International Nuclear Information System (INIS)

    Amaral, Camila L.; Freitas, Lidia B.; Tamura, Rodrigo E.; Tavares, Mariana R.; Pavan, Isadora C. B.; Bajgelman, Marcio C.; Simabuco, Fernando M.


    The S6 Kinase (S6K) proteins are some of the main downstream effectors of the mammalian Target Of Rapamycin (mTOR) and act as key regulators of protein synthesis and cell growth. S6K is overexpressed in a variety of human tumors and is correlated to poor prognosis in prostate cancer. Due to the current urgency to identify factors involved in prostate cancer progression, we aimed to reveal the cellular functions of three S6K isoforms–p70-S6K1, p85-S6K1 and p54-S6K2–in prostate cancer, as well as their potential as therapeutic targets. In this study we performed S6K knockdown and overexpression and investigated its role in prostate cancer cell proliferation, colony formation, viability, migration and resistance to docetaxel treatment. In addition, we measured tumor growth in Nude mice injected with PC3 cells overexpressing S6K isoforms and tested the efficacy of a new available S6K1 inhibitor in vitro. S6Ks overexpression enhanced PC3-luc cell line viability, migration, resistance to docetaxel and tumor formation in Nude mice. Only S6K2 knockdown rendered prostate cancer cells more sensitive to docetaxel. S6K1 inhibitor PF-4708671 was particularly effective for reducing migration and proliferation of PC3 cell line. These findings demonstrate that S6Ks play an important role in prostate cancer progression, enhancing cell viability, migration and chemotherapy resistance, and place both S6K1 and S6K2 as a potential targets in advanced prostate cancer. We also provide evidence that S6K1 inhibitor PF-4708671 may be considered as a potential drug for prostate cancer treatment. The online version of this article (doi:10.1186/s12885-016-2629-y) contains supplementary material, which is available to authorized users

  1. Defective ribosome assembly in Shwachman-Diamond syndrome. (United States)

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J


    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  2. Emerging functions of ribosomal proteins in gene-specific transcription and translation

    International Nuclear Information System (INIS)

    Lindstroem, Mikael S.


    Ribosomal proteins have remained highly conserved during evolution presumably reflecting often critical functions in ribosome biogenesis or mature ribosome function. In addition, several ribosomal proteins possess distinct extra-ribosomal functions in apoptosis, DNA repair and transcription. An increasing number of ribosomal proteins have been shown to modulate the trans-activation function of important regulatory proteins such as NF-κB, p53, c-Myc and nuclear receptors. Furthermore, a subset of ribosomal proteins can bind directly to untranslated regions of mRNA resulting in transcript-specific translational control outside of the ribosome itself. Collectively, these findings suggest that ribosomal proteins may have a wider functional repertoire within the cell than previously thought. The future challenge is to identify and validate these novel functions in the background of an often essential primary function in ribosome biogenesis and cell growth.

  3. Phosphorylation of mTOR and S6RP predicts the efficacy of everolimus in patients with metastatic renal cell carcinoma

    International Nuclear Information System (INIS)

    Li, Siming; Kong, Yan; Si, Lu; Chi, Zhihong; Cui, Chuanliang; Sheng, Xinan; Guo, Jun


    The incidence of renal cell cancer (RCC) has been increasing for the past decade, and the 5-year survival for patients with metastatic RCC (mRCC) is rather low. Everolimus (RAD001), a new inhibitor for mammalian target of rapamycin (mTOR), is generally well tolerated, and demonstrates clinical benefit to patients with anti-VEGF-refractory mRCC. However, factors for selection of patients who may benefit from everolimus remain largely unknown. Here we aimed to explore potential molecular indicators for mRCC patients who may benefit from everolimus treatment. Paraffin-embedded tumor tissue specimens derived from 18 mRCC patients before everolimus treatment, who participated the phase 1b trial of everolimus in VEGF receptor (VEGFR)-tyrosine kinase inhibitor (TKI)-refractory Chinese patients with mRCC (, NCT01152801), were examined for the expression levels of phosphorylated AKT, mTOR, eukaryotic initiation factor 4E (eIF4E) binding protein-1 (4EBP1) and 40S ribosomal protein S6 (S6RP) by immunohistochemistry. Clinical benefit rate (complete response [CR], partial response [PR], plus stable disease [SD] ≥ 6 months) and progression-free survival time (PFS) were correlated with expression levels of these mTOR-associated molecules. In these 18 patients, there were 1 PR, 15 SDs (including 9 SDs ≥ 6 months), and 2 progressive diseases (PD). The clinical benefit rate (CBR) was 55.6% (10/18), and the median PFS time was 8.4 months. Patients with positive expression of phospho-mTOR showed a better CBR (71.4% versus 0%, P = 0.023) and PFS time (11.3 versus 3.7 months, P = 0.001) than those patients with negative expression. The median PFS of patients with positive phospho-S6RP expression was longer (11.3 versus 3.7 months, P = 0.002) than that of patients negative for phospho-S6RP expression. However, expression levels of phospho-4EBP1 and phospho-AKT were unassociated to efficacy of everolimus treatment with respect to CBR and PFS. Co-expression of

  4. Effect of sodium fluoride on the amount of polyribosomes, single ribosomes and ribosomal subunits in a cellular slime mold, Dictyostelium discoideum

    Energy Technology Data Exchange (ETDEWEB)

    Sameshima, M; Ito, K; Iwabuchi, M


    In the slime mold, Dictyostelium discoideum, when the rate of protein synthesis was decreased by NaF, free 80-S ribosomes accumulated at the expense of polyribosomes, while 60-S and 40-S ribosomal subunits remained almost constant. The same level of ribosomal subunits was also maintained in cells after incubation with cycloheximide or at the stationary phase of growth.

  5. On supersymmetric AdS6 solutions in 10 and 11 dimensions (United States)

    Gutowski, J.; Papadopoulos, G.


    We prove a non-existence theorem for smooth, supersymmetric, warped AdS 6 solutions with connected, compact without boundary internal space in D = 11 and (massive) IIA supergravities. In IIB supergravity we show that if such AdS 6 solutions exist, then the NSNS and RR 3-form fluxes must be linearly independent and certain spinor bilinears must be appropriately restricted. Moreover we demonstrate that the internal space admits an so(3) action which leaves all the fields invariant and for smooth solutions the principal orbits must have co-dimension two. We also describe the topology and geometry of internal spaces that admit such a so(3) action and show that there are no solutions for which the internal space has topology F × S 2, where F is an oriented surface.

  6. Optimization of Thixoforging Parameters for C70S6 Steel Connecting Rods (United States)

    Özkara, İsa Metin; Baydoğan, Murat


    A microalloyed steel, C70S6, with a solidification interval of 1390-1479 °C, was thixoforged in the semisolid state in a closed die at temperatures in the range 1400-1475 °C to form a 1/7 scaled-down model of a passenger vehicle connecting rod. Die design and an optimized thixoforging temperature eliminated the excessive flash and other problems during forging. Tension test samples from connecting rods thixoforged at the optimum temperature of 1440 °C exhibited nearly the same hardness, yield strength, and ultimate tensile strength as conventional hot forged samples but ductility decreased by about 45% due to grain boundary ferrite network formed during cooling from the thixoforging temperature. Thus, C70S6-grade steel can be thixoforged at 1440 °C to form flash-free connecting rods. This conclusion was also validated using FEA analysis.

  7. Final report of APMP.QM-S6: clenbuterol in porcine meat (United States)

    Sin, D. W.-M.; Ho, C.; Yip, Y.-C.


    At the CCQM Organic Analysis Working Group (OAWG) Meeting held in April 2012 and the APMP TCQM Meeting held in November 2012, an APMP supplementary comparison (APMP.QM-S6) on the determination of clenbuterol in porcine meat was supported by the OAWG and APMP TCQM. This comparison was organized by the Government Laboratory, Hong Kong. In order to accommodate a wider participation, a pilot study (APMP.QM-P22) was run in parallel to APMP.QM-S6. This study provided the means for assessing the measurement capabilities for determination of low-polarity measurands in a procedure that requires extraction, clean-up, analytical separation, and selective detection in a food matrix. A total of 7 institutes registered for the supplementary comparison and 6 of them submitted their results. 4 results were included for SCRV calculation. All participating laboratories applied Isotope Dilution Liquid Chromatography-Tandem Mass Spectrometry (ID-LCMS/MS) technique with clenbuterol-d9 as internal standard spiked for quantitation in this programme. KEY WORDS FOR SEARCH APMP.QM-S6 and Clenbuterol Main text To reach the main text of this paper, click on Final Report. Note that this text is that which appears in Appendix B of the BIPM key comparison database The final report has been peer-reviewed and approved for publication by the CCQM, according to the provisions of the CIPM Mutual Recognition Arrangement (CIPM MRA).

  8. Room-Temperature Synthesis of Thiostannates from {[Ni(tren)]2[Sn2S6]}n. (United States)

    Hilbert, Jessica; Näther, Christian; Weihrich, Richard; Bensch, Wolfgang


    The compound {[Ni(tren)]2[Sn2S6]}n (1) (tren = tris(2-aminoethyl)amine, C6H18N4) was successfully applied as source for the room-temperature synthesis of the new thiostannates [Ni(tren)(ma)(H2O)]2[Sn2S6]·4H2O (2) (ma = methylamine, CH5N) and [Ni(tren)(1,2-dap)]2[Sn2S6]·2H2O (3) (1,2-dap = 1,2-diaminopropane, C3H10N2). The Ni-S bonds in the Ni2S2N8 bioctahedron in the structure of 1 are analyzed with density functional theory calculations demonstrating significantly differing Ni-S bond strengths. Because of this asymmetry they are easily broken in the presence of an excess of ma or 1,2-dap immediately followed by Ni-N bond formation to N donor atoms of the amine ligands thus generating [Ni(tren)(amine)](2+) complexes. The chemical reactions are fast, and compounds 2 and 3 are formed within 1 h. The synthesis concept presented here opens hitherto unknown possibilities for preparation of new thiostannates.

  9. High Glucose Concentration Stimulates NHE-1 Activity in Distal Nephron Cells: the Role of the Mek/Erk1/2/p90RSK and p38MAPK Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Juliana Martins da Costa-Pessoa


    Full Text Available Aims: In models of diabetes, distal nephron cells contribute to glucose uptake and oxidation. How these cells contribute to the use of glucose for the regulation of H+ extrusion remains unknown. We used Madin-Darby Canine Kidney (MDCK cells to investigate the effect of acute or chronic high glucose concentration on the abundance and activity of the Na+/H+ exchanger (NHE-1. Methods: Using RT-PCR, we also evaluated the mRNA expression for sodium glucose co-transporters SGLT1 and SGLT2. Protein abundance was analyzed using immunoblotting, and intracellular pH (pHi recovery was evaluated using microscopy in conjunction with the fluorescent probe BCECF/AM. The Na+-dependent pHi recovery rate was monitored with HOE-694 (50 µM and/or S3226 (10 µM, specific NHE-1 and NHE-3 inhibitors. Results: MDCK cells did not express the mRNA for SGLT1 or SGLT2 but did express the GLUT2, NHE-1 and NHE-3 proteins. Under control conditions, we observed a greater contribution of NHE-1 to pHi recovery relative to the other H+ transporters. Acute high glucose treatment increased the HOE-694-sensitive pHi recovery rate and p-Erk1/2 and p90RSK abundance. These parameters were reduced by PD-98059, a Mek inhibitor (1 µM. Chronic high glucose treatment also increased the HOE-694-sensitive pHi recovery rate and p-p38MAPK abundance. Both parameters were reduced by SB-203580, a p38MAPK inhibitor (10 µM. Conclusion: These results suggested that extracellular high glucose stimulated NHE-1 acutely and chronically through Mek/Erk1/2/p90RSK and p38MAPK pathways, respectively.

  10. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome. (United States)

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad


    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. Copyright © 2015, American Association for the Advancement of Science.

  11. The Complete Structure of the Mycobacterium smegmatis 70S Ribosome. (United States)

    Hentschel, Jendrik; Burnside, Chloe; Mignot, Ingrid; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad


    The ribosome carries out the synthesis of proteins in every living cell. It consequently represents a frontline target in anti-microbial therapy. Tuberculosis ranks among the leading causes of death worldwide, due in large part to the combination of difficult-to-treat latency and antibiotic resistance. Here, we present the 3.3-Å cryo-EM structure of the 70S ribosome of Mycobacterium smegmatis, a close relative to the human pathogen Mycobacterium tuberculosis. The structure reveals two additional ribosomal proteins and localizes them to the vicinity of drug-target sites in both the catalytic center and the decoding site of the ribosome. Furthermore, we visualized actinobacterium-specific rRNA and protein expansions that extensively remodel the ribosomal surface with implications for polysome organization. Our results provide a foundation for understanding the idiosyncrasies of mycobacterial translation and reveal atomic details of the structure that will facilitate the design of anti-tubercular therapeutics. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Ribosomes slide on lysine-encoding homopolymeric A stretches (United States)

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel


    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: PMID:25695637

  13. The Phosphorylation of Ribosomal Protein in Lemna minor (United States)

    Trewavas, A.


    Sterile cultures of Lemna minor have been labeled with 32P1, and the ribosomal proteins have been examined for radioactivity. In relatively short term labeling a radioactive protein was found which ran as a single component in both urea/acetic acid and sodium lauryl sulfate gel electrophoresis. Acid hydrolysis of the labeled protein permitted the isolation of serine phosphate. After labeling to equilibrium with 32P1, calculation indicated only 0.6 to 0.75 atom of this protein phosphorus per ribosome. The phosphorylated protein is found in both polysomes and “derived” monomers and appears to be located in the ribosomal small subunit. Its apparent molecular weight is 42,000. Addition of growth-inhibiting concentrations of abscisic acid does not alter the apparent degree of labeling of this protein in 5 hours, but after 24 hours of treatment the total protein phosphorus was reduced from 0.75 atom of phosphorus per ribosome to 0.36 atom of phosphorus per ribosome. PMID:16658405

  14. Label-Free Quantitation of Ribosomal Proteins from Bacillus subtilis for Antibiotic Research. (United States)

    Schäkermann, Sina; Prochnow, Pascal; Bandow, Julia E


    Current research is focusing on ribosome heterogeneity as a response to changing environmental conditions and stresses, such as antibiotic stress. Altered stoichiometry and composition of ribosomal proteins as well as association of additional protein factors are mechanisms for shaping the protein expression profile or hibernating ribosomes. Here, we present a method for the isolation of ribosomes to analyze antibiotic-induced changes in the composition of ribosomes in Bacillus subtilis or other bacteria. Ribosomes and associated proteins are isolated by ultracentrifugation and proteins are identified and quantified using label-free mass spectrometry.

  15. Cryo-EM structure of the archaeal 50S ribosomal subunit in complex with initiation factor 6 and implications for ribosome evolution

    DEFF Research Database (Denmark)

    Greber, Basil J; Boehringer, Daniel; Godinic-Mikulcic, Vlatka


    additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter...... between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes......, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea....

  16. Interaction of tRNA with Eukaryotic Ribosome

    Directory of Open Access Journals (Sweden)

    Dmitri Graifer


    Full Text Available This paper is a review of currently available data concerning interactions of tRNAs with the eukaryotic ribosome at various stages of translation. These data include the results obtained by means of cryo-electron microscopy and X-ray crystallography applied to various model ribosomal complexes, site-directed cross-linking with the use of tRNA derivatives bearing chemically or photochemically reactive groups in the CCA-terminal fragment and chemical probing of 28S rRNA in the region of the peptidyl transferase center. Similarities and differences in the interactions of tRNAs with prokaryotic and eukaryotic ribosomes are discussed with concomitant consideration of the extent of resemblance between molecular mechanisms of translation in eukaryotes and bacteria.

  17. 5SRNAdb: an information resource for 5S ribosomal RNAs. (United States)

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Structural basis for precursor protein-directed ribosomal peptide macrocyclization (United States)

    Li, Kunhua; Condurso, Heather L.; Li, Gengnan; Ding, Yousong; Bruner, Steven D.


    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides whose members target proteases with potent reversible inhibition. The product structure is constructed by three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here, we describe the detailed structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases, MdnC and MdnB, interact with a conserved α-helix of the precursor peptide using a novel precursor peptide recognition mechanism. The results provide insight into the unique protein/protein interactions key to the chemistry, suggest an origin of the natural combinatorial synthesis of microviridin peptides and provide a framework for future engineering efforts to generate designed compounds. PMID:27669417

  19. Structural basis for precursor protein-directed ribosomal peptide macrocyclization. (United States)

    Li, Kunhua; Condurso, Heather L; Li, Gengnan; Ding, Yousong; Bruner, Steven D


    Macrocyclization is a common feature of natural product biosynthetic pathways including the diverse family of ribosomal peptides. Microviridins are architecturally complex cyanobacterial ribosomal peptides that target proteases with potent reversible inhibition. The product structure is constructed via three macrocyclizations catalyzed sequentially by two members of the ATP-grasp family, a unique strategy for ribosomal peptide macrocyclization. Here we describe in detail the structural basis for the enzyme-catalyzed macrocyclizations in the microviridin J pathway of Microcystis aeruginosa. The macrocyclases MdnC and MdnB interact with a conserved α-helix of the precursor peptide using a novel precursor-peptide recognition mechanism. The results provide insight into the unique protein-protein interactions that are key to the chemistry, suggest an origin for the natural combinatorial synthesis of microviridin peptides, and provide a framework for future engineering efforts to generate designed compounds.

  20. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell


    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  1. Acoustic and elastic properties of Sn2P2S6 crystals

    International Nuclear Information System (INIS)

    Mys, O; Martynyuk-Lototska, I; Vlokh, R; Grabar, A


    We present the results concerned with acoustic and elastic properties of Sn 2 P 2 S 6 crystals. The complete matrices of elastic stiffness and compliance coefficients are determined in both the crystallographic coordinate system and the system associated with eigenvectors of the elastic stiffness tensor. The acoustic slowness surfaces are constructed and the propagation and polarization directions of the slowest acoustic waves promising for acousto-optic interactions are determined on this basis. The acoustic obliquity angle and the deviation of polarization of the acoustic waves from purely transverse or longitudinal states are quantitatively analysed.

  2. Acoustic and elastic properties of Sn(2)P(2)S(6) crystals. (United States)

    Mys, O; Martynyuk-Lototska, I; Grabar, A; Vlokh, R


    We present the results concerned with acoustic and elastic properties of Sn(2)P(2)S(6) crystals. The complete matrices of elastic stiffness and compliance coefficients are determined in both the crystallographic coordinate system and the system associated with eigenvectors of the elastic stiffness tensor. The acoustic slowness surfaces are constructed and the propagation and polarization directions of the slowest acoustic waves promising for acousto-optic interactions are determined on this basis. The acoustic obliquity angle and the deviation of polarization of the acoustic waves from purely transverse or longitudinal states are quantitatively analysed.

  3. A streamlined ribosome profiling protocol for the characterization of microorganisms

    DEFF Research Database (Denmark)

    Latif, Haythem; Szubin, Richard; Tan, Justin


    Ribosome profiling is a powerful tool for characterizing in vivo protein translation at the genome scale, with multiple applications ranging from detailed molecular mechanisms to systems-level predictive modeling. Though highly effective, this intricate technique has yet to become widely used...... in the microbial research community. Here we present a streamlined ribosome profiling protocol with reduced barriers to entry for microbial characterization studies. Our approach provides simplified alternatives during harvest, lysis, and recovery of monosomes and also eliminates several time-consuming steps...

  4. Interaction of pleuromutilin derivatives with the ribosomal peptidyl transferase center

    DEFF Research Database (Denmark)

    Long, K. S.; Hansen, L. K.; Jakobsen, L.


    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design...... mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding...

  5. Charge Segregation and Low Hydrophobicity Are Key Features of Ribosomal Proteins from Different Organisms* (United States)

    Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia


    Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678

  6. Safety test No. S-6, launch pad abort sequential test Phase II: solid propellant fire

    International Nuclear Information System (INIS)

    Snow, E.C.


    In preparation for the Lincoln Laboratory's LES 8/9 space mission, a series of tests was performed to evaluate the nuclear safety capability of the Multi-Hundred Watt (MHW) Radioisotope Thermoelectric Generator (RTG) to be used to supply power for the satellite. One such safety test is Test No. S-6, Launch Pad Abort Sequential Test. The objective of this test was to subject the RTG and its components to the sequential environments characteristic of a catastrophic launch pad accident to evaluate their capability to contain the 238 PuO 2 fuel. This sequence of environments was to have consisted of the blast overpressure and fragments, followed by the fireball, low velocity impact on the launch pad, and solid propellant fire. The blast overpressure and fragments were subsequently eliminated from this sequence. The procedures and results of Phase II of Test S-6, Solid Propellant Fire are presented. In this phase of the test, a simulant Fuel Sphere Assembly (FSA) and a mockup of a damaged Heat Source Assembly (HSA) were subjected to single proximity solid propellant fires of approximately 10-min duration. Steel was introduced into both tests to simulate the effects of launch pad debris and the solid rocket motor (SRM) casing that might be present in the fire zone. (TFD)

  7. Cryo-EM Structure of the Archaeal 50S Ribosomal Subunit in Complex with Initiation Factor 6 and Implications for Ribosome Evolution (United States)

    Greber, Basil J.; Boehringer, Daniel; Godinic-Mikulcic, Vlatka; Crnkovic, Ana; Ibba, Michael; Weygand-Durasevic, Ivana; Ban, Nenad


    Translation of mRNA into proteins by the ribosome is universally conserved in all cellular life. The composition and complexity of the translation machinery differ markedly between the three domains of life. Organisms from the domain Archaea show an intermediate level of complexity, sharing several additional components of the translation machinery with eukaryotes that are absent in bacteria. One of these translation factors is initiation factor 6 (IF6), which associates with the large ribosomal subunit. We have reconstructed the 50S ribosomal subunit from the archaeon Methanothermobacter thermautotrophicus in complex with archaeal IF6 at 6.6 Å resolution using cryo-electron microscopy (EM). The structure provides detailed architectural insights into the 50S ribosomal subunit from a methanogenic archaeon through identification of the rRNA expansion segments and ribosomal proteins that are shared between this archaeal ribosome and eukaryotic ribosomes but are mostly absent in bacteria and in some archaeal lineages. Furthermore, the structure reveals that, in spite of highly divergent evolutionary trajectories of the ribosomal particle and the acquisition of novel functions of IF6 in eukaryotes, the molecular binding of IF6 on the ribosome is conserved between eukaryotes and archaea. The structure also provides a snapshot of the reductive evolution of the archaeal ribosome and offers new insights into the evolution of the translation system in archaea. PMID:22306461

  8. Nuclear ribosomal DNA diversity of a cotton pest ( Rotylenchulus ...

    African Journals Online (AJOL)

    The reniform nematode (Rotylenchulus reniformis) has emerged as a major cotton pest in the United States. A recent analysis of over 20 amphimictic populations of this pest from the US and three other countries has shown no sequence variation at the nuclear ribosomal internal transcribed spacer (ITS) despite the region's ...

  9. The ribosome-associated complex antagonizes prion formation in yeast. (United States)

    Amor, Alvaro J; Castanzo, Dominic T; Delany, Sean P; Selechnik, Daniel M; van Ooy, Alex; Cameron, Dale M


    The number of known fungal proteins capable of switching between alternative stable conformations is steadily increasing, suggesting that a prion-like mechanism may be broadly utilized as a means to propagate altered cellular states. To gain insight into the mechanisms by which cells regulate prion formation and toxicity we examined the role of the yeast ribosome-associated complex (RAC) in modulating both the formation of the [PSI(+)] prion - an alternative conformer of Sup35 protein - and the toxicity of aggregation-prone polypeptides. The Hsp40 RAC chaperone Zuo1 anchors the RAC to ribosomes and stimulates the ATPase activity of the Hsp70 chaperone Ssb. We found that cells lacking Zuo1 are sensitive to over-expression of some aggregation-prone proteins, including the Sup35 prion domain, suggesting that co-translational protein misfolding increases in Δzuo1 strains. Consistent with this finding, Δzuo1 cells exhibit higher frequencies of spontaneous and induced prion formation. Cells expressing mutant forms of Zuo1 lacking either a C-terminal charged region required for ribosome association, or the J-domain responsible for Ssb ATPase stimulation, exhibit similarly high frequencies of prion formation. Our findings are consistent with a role for the RAC in chaperoning nascent Sup35 to regulate folding of the N-terminal prion domain as it emerges from the ribosome.

  10. Ribosomal DNA internal transcribed spacer 1 and internal ...

    African Journals Online (AJOL)



    Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...

  11. cDNA, genomic sequence cloning and overexpression of ribosomal ...

    African Journals Online (AJOL)

    RPS16 of eukaryote is a component of the 40S small ribosomal subunit encoded by RPS16 gene and is also a homolog of prokaryotic RPS9. The cDNA and genomic sequence of RPS16 was cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) using reverse transcription-polymerase chain ...

  12. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  13. Expression of a ribosome inactivating protein (curcin 2) in Jatropha ...

    Indian Academy of Sciences (India)


    mechanisms employed by a number of higher-plant species involve defensive ... of RIPs in the same plant species. ..... Lam C J, Ryals J A, Ward E R and Dixon R A 1992 Emerging ... against insect pests and diseases of plants: ribosome in-.

  14. Protein folding on the ribosome studied using NMR spectroscopy (United States)

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John


    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  15. Architecture of the E.coli 70S ribosome

    DEFF Research Database (Denmark)

    Burkhardt, N.; Diedrich, G.; Nierhaus, K.H.


    The 70S ribosome from E.coli was analysed by neutron scattering focusing on the shape and the internal protein-RNA-distribution of the complex. Measurements on selectively deuterated 70S particles and free 30S and 50S subunits applying conventional contrast variation and proton-spin contrast...

  16. Structure based hypothesis of a mitochondrial ribosome rescue mechanism

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A


    Full Text Available Abstract Background mtRF1 is a vertebrate mitochondrial protein with an unknown function that arose from a duplication of the mitochondrial release factor mtRF1a. To elucidate the function of mtRF1, we determined the positions that are conserved among mtRF1 sequences but that are different in their mtRF1a paralogs. We subsequently modeled the 3D structure of mtRF1a and mtRF1 bound to the ribosome, highlighting the structural implications of these differences to derive a hypothesis for the function of mtRF1. Results Our model predicts, in agreement with the experimental data, that the 3D structure of mtRF1a allows it to recognize the stop codons UAA and UAG in the A-site of the ribosome. In contrast, we show that mtRF1 likely can only bind the ribosome when the A-site is devoid of mRNA. Furthermore, while mtRF1a will adopt its catalytic conformation, in which it functions as a peptidyl-tRNA hydrolase in the ribosome, only upon binding of a stop codon in the A-site, mtRF1 appears specifically adapted to assume this extended, peptidyl-tRNA hydrolyzing conformation in the absence of mRNA in the A-site. Conclusions We predict that mtRF1 specifically recognizes ribosomes with an empty A-site and is able to function as a peptidyl-tRNA hydrolase in those situations. Stalled ribosomes with empty A-sites that still contain a tRNA bound to a peptide chain can result from the translation of truncated, stop-codon less mRNAs. We hypothesize that mtRF1 recycles such stalled ribosomes, performing a function that is analogous to that of tmRNA in bacteria. Reviewers This article was reviewed by Dr. Eugene Koonin, Prof. Knud H. Nierhaus (nominated by Dr. Sarah Teichmann and Dr. Shamil Sunyaev.

  17. A 2-GS/s 6-bit self-calibrated flash ADC

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Youtao; Chen Chen [National Key Laboratory of Monolithic Integrated Circuits and Modules, Nanjing Electronic Devices Institute, Nanjing 210016 (China); Li Xiaopeng; Zhang Min; Liu Ao, E-mail: [Nanjing Electronic Devices Institute, Nanjing 210016 (China)


    A single channel 2-GS/s 6-bit ADC with cascade resistive averaging and self foreground calibration is demonstrated in 0.18-{mu}m CMOS. The calibration method based on DAC trimming improves the linearity and dynamic performance further. The peak DNL and INL are measured as 0.34 and 0.22 LSB, respectively. The SNDR and SFDR have achieved 36.5 and 45.9 dB, respectively, with 1.22 MHz input signal and 2 GS/s. The proposed ADC, including on-chip track-and-hold amplifiers and clock buffers, consumes 570 mW from a single 1.8 V supply while operating at 2 GS/s. (semiconductor integrated circuits)

  18. High-pressure anisotropic distortion of Pb3Bi2S6

    DEFF Research Database (Denmark)

    Olsen, Lars Arnskov; Balic Zunic, Tonci; Makovicky, Emil


    The compound Pb3Bi2S6 is investigated by X-ray diffraction on single crystals in a diamond-anvil cell between 0.0001 and 10.5 GPa. It undergoes a first-order phase transition at hydrostatic pressure between 3.7 and 4.9 Gpa. The space group symmetry changes from Bbmm to Pbnm, and the unit......-cell volume decreases by 4%. The transition is strongly anisotropic, with a contraction along one of the crystal axes by 16% and expansion along another one by 14%. This is a piezoplastic phase transition, a displacive pressure-induced phase transition with systematic shearing of atomic planes and a migration...

  19. Differential antibiotic sensitivity determined by the large ribosomal subunit in thermophilic archaea.


    Ruggero, D; Londei, P


    Hybrid ribosomes obtained by mixing the ribosomal subunits of the extremely thermophilic archaea Sulfolobus solfataricus and Desulfurococcus mobilis were tested for their sensitivity to selected antibiotics. It is shown that structural differences in the large ribosomal subunits determine qualitatively and quantitatively the patterns of response to alpha-sarcin and paromomycin in these species.

  20. cDNA, genomic sequence cloning and analysis of the ribosomal ...

    African Journals Online (AJOL)

    Ribosomal protein L37A (RPL37A) is a component of 60S large ribosomal subunit encoded by the RPL37A gene, which belongs to the family of ribosomal L37AE proteins, located in the cytoplasm. The complementary deoxyribonucleic acid (cDNA) and the genomic sequence of RPL37A were cloned successfully from giant ...

  1. DNA replication stress restricts ribosomal DNA copy number (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin


    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  2. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection. (United States)

    Sharkey, Liam K R; Edwards, Thomas A; O'Neill, Alex J


    Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to anin vitrotranslation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosomein vitro To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection.IMPORTANCEAntimicrobial resistance ranks among the greatest threats currently facing human health. Elucidation of the mechanisms by which microorganisms resist the effect of antibiotics is central to understanding the biology of this phenomenon and has the potential to inform the development of new drugs capable of blocking or circumventing resistance. Members of the ABC-F family, which includelsa(A),msr(A),optr(A), andvga(A), collectively yield resistance to a broader range of clinically significant antibiotic classes than any other family of resistance determinants, although their mechanism of action has been controversial since their discovery 25 years ago. Here we present the first direct evidence that proteins of the ABC-F family act to protect the bacterial ribosome from antibiotic-mediated inhibition. Copyright © 2016 Sharkey et al.

  3. DNA replication stress restricts ribosomal DNA copy number. (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L


    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  4. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim


    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  5. Studies on the catalytic rate constant of ribosomal peptidyltransferase. (United States)

    Synetos, D; Coutsogeorgopoulos, C


    A detailed kinetic analysis of a model reaction for the ribosomal peptidyltransferase is described, using fMet-tRNA or Ac-Phe-tRNA as the peptidyl donor and puromycin as the acceptor. The initiation complex (fMet-tRNA X AUG X 70 S ribosome) or (Ac-Phe-tRNA X poly(U) X 70 S ribosome) (complex C) is isolated and then reacted with excess puromycin (S) to give fMet-puromycin or Ac-Phe-puromycin. This reaction (puromycin reaction) is first order at all concentrations of S tested. An important asset of this kinetic analysis is the fact that the relationship between the first order rate constant kobs and [S] shows hyperbolic saturation and that the value of kobs at saturating [S] is a measure of the catalytic rate constant (k cat) of peptidyltransferase in the puromycin reaction. With fMet-tRNA as the donor, this kcat of peptidyltransferase is 8.3 min-1 when the 0.5 M NH4Cl ribosomal wash is present, compared to 3.8 min-1 in its absence. The kcat of peptidyltransferase is 2.0 min-1 when Ac-Phe-tRNA replaces fMet-tRNA in the presence of the ribosomal wash and decreases to 0.8 min-1 in its absence. This kinetic procedure is the best method available for evaluating changes in the activity of peptidyltransferase in vitro. The results suggest that peptidyltransferase is subjected to activation by the binding of fMet-tRNA to the 70 S initiation complex.

  6. Is there a channel in the ribosome for nascent peptide. Labellimg of translating ribosomes with atomar tritium

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, V A; Kammer, A A; Spirin, A S


    The method of tritium bombardment was applied to investigate exposure of growing peptide on the surface of ribsome E.coli. Distribution of radioactivity by fractions is presented. Tritium inclusion in all the aminoacid residues of heteropeptide testifies to its exposure on the surface of the ribosome.

  7. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription* (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.


    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  8. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription. (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I


    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  9. Photoaffinity labeling of rat liver ribosomes by N-(2-Nitro-4-azidobenzoyl)puromycin

    International Nuclear Information System (INIS)

    Boehm, H.; Stahl, J.; Bielka, H.


    N-(2-nitro-4-azidobenzoyl)-[ 3 H]puromycin (NAB-puromycin) was synthesized as a photoreactive derivative of puromycin in order to detect ribosomal proteins located near the peptidyltransferase centre of rat liver ribosomes. Irradiation of ribosome-NAB-puromycin complexes leads to covalent attachment of the affinity label to proteins of the large ribosomal subunit, in particular to proteins L28/29, and, to a somewhat lower extent, to proteins L4, L6, L10 and L24. The results are discussed in the light of earlier studies performed with other affinity labels that attacked the peptidyltransferase region of rat liver ribosomes. (author)

  10. Translation activity of chimeric ribosomes composed of Escherichia coli and Bacillus subtilis or Geobacillus stearothermophilus subunits

    Directory of Open Access Journals (Sweden)

    Sayaka Tsuji


    Full Text Available Ribosome composition, consisting of rRNA and ribosomal proteins, is highly conserved among a broad range of organisms. However, biochemical studies focusing on ribosomal subunit exchangeability between organisms remain limited. In this study, we show that chimeric ribosomes, composed of Escherichia coli and Bacillus subtilis or E. coli and Geobacillus stearothermophilus subunits, are active for β-galactosidase translation in a highly purified E. coli translation system. Activities of the chimeric ribosomes showed only a modest decrease when using E. coli 30 S subunits, indicating functional conservation of the 50 S subunit between these bacterial species.

  11. Unstable structure of ribosomal particles synthesized in. gamma. -irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Fujita, H; Morita, K [National Inst. of Radiological Sciences, Chiba (Japan)


    Stability of Escherichia coli ribosomes newly synthesized after ..gamma..-irradiation was compared with that of normal ribosomes. The ribosomal particles around 70-S synthesized in irradiated cells were more sensitive to digestion by pancreatic ribonuclease A. A larger number of the salt-unstable '50-S' precursor particles existed in the extract from irradiated cells than in the extract from unirradiated cells. These facts suggest that ribosomal particles, synthesized during an earlier stage in irradiated cells, maintain an incomplete structure even though they are not distinguishable from normal ribosomes by means of sucrose density-gradient centrifugation.

  12. Using the Ribodeblur pipeline to recover A-sites from yeast ribosome profiling data. (United States)

    Wang, Hao; Kingsford, Carl; McManus, C Joel


    Ribosome profiling has emerged as a powerful technique to study mRNA translation. Ribosome profiling has the potential to determine the relative quantities and locations of ribosomes on mRNA genome wide. Taking full advantage of this approach requires accurate measurement of ribosome locations. However, experimental inconsistencies often obscure the positional information encoded in ribosome profiling data. Here, we describe the Ribodeblur pipeline, a computational analysis tool that uses a maximum likelihood framework to infer ribosome positions from heterogeneous datasets. Ribodeblur is simple to install, and can be run on an average modern Mac or Linux-based laptop. We detail the process of applying the pipeline to high-coverage ribosome profiling data in yeast, and discuss important considerations for potential extension to other organisms. Copyright © 2018 Elsevier Inc. All rights reserved.

  13. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina

    Directory of Open Access Journals (Sweden)

    Silar Philippe


    Full Text Available Abstract Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division.

  14. In vivo labelling of functional ribosomes reveals spatial regulation during starvation in Podospora anserina (United States)

    Lalucque, Hervé; Silar, Philippe


    Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985

  15. Non-intubated uniportal left-lower lobe upper segmentectomy (S6). (United States)

    Galvez, Carlos; Navarro-Martinez, Jose; Bolufer, Sergio; Sesma, Julio; Lirio, Francisco; Galiana, Maria; Rivera, Maria Jesus


    Worldwide accepted indications of anatomical segmentectomies are mainly early stage primary adenocarcinomas, pulmonary metastasis and benign conditions. Their performance through uniportal VATS has become more and more popular due to the less invasiveness of the whole procedure under this approach. Recently, many efforts have focused on non-intubated spontaneously breathing management of lobectomies and anatomical segmentectomies, although specific selection criteria and main advantages are not completely standardized. In a 62-year-old thin man with two pulmonary residual metastasis from sigma adenocarcinoma, after chemotherapy plus antiangiogenic treatment, we indicated a single-incision video-assisted left-lower lobe (LLL) upper segmentectomy (S6) under spontaneous breathing and intercostal blockade. Total operation time was 240 minutes. Chest tube was removed at 24 hours and the patient was discharge on postoperative day 2 without any complication. Non-intubated uniportal VATS is a safe and reasonable approach for lung-sparing resections in selected patients, although more evidence is required for selecting which patients can benefit more over standard intubated procedures.

  16. Pactamycin binding site on archaebacterial and eukaryotic ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.G.


    The presence of a photoreactive acetophenone group in the protein synthesis inhibitor pactamycin and the possibility of obtaining active iodinated derivatives that retain full biological activity allow the antibiotic binding site on Saccharomyces cerevisiae and archaebacterium Sulfolobus solfataricus ribosomes to be photoaffinity labeled. Four major labeled proteins have been identified in the yeast ribosomes, i.e., YS10, YS18, YS21/24, and YS30, while proteins AL1a, AS10/L8, AS18/20, and AS21/22 appeared as radioactive spots in S. solfataricus. There seems to be a correlation between some of the proteins labeled in yeast and those previously reported in Escherichia coli indicating that the pactamycin binding sites of both species, which are in the small subunit close to the initiation factors and mRNA binding sites, must have similar characteristics

  17. Ribosome-catalyzed formation of an abnormal peptide analogue

    International Nuclear Information System (INIS)

    Roesser, J.R.; Chorghade, M.S.; Hecht, S.M.


    The peptidyl-tRNA analogue N-(chloracetyl) phenylalanyl-tRNA/sup Phe/ was prepared by chemical aminoacylation and prebound to the P site of Escherichia coli ribosomes in response to poly(uridylic acid). Admixture of phenylalanyl-tRNA/sup Phe/ to the A site resulted in the formation of two dipeptides, one of which was found by displacement of chloride ion from the peptidyl-tRNA. This constitutes the first example of ribosome-mediated formation of a peptide of altered connectivity and suggests a need for revision of the current model of peptide bond formation. Also suggested by the present finding is the feasibility of utilizing tRNAs to prepare polypeptides of altered connectivity in an in vitro protein biosynthesizing system. [ 32 P]-oligo(rA), [ 3 H]- and [ 14 C] phenylalanines were used in the assay of the peptidye-tRNA analogue

  18. Transcriptional activation of ribosomal RNA genes during compensatory renal hypertrophy

    International Nuclear Information System (INIS)

    Ouellette, A.J.; Moonka, R.; Zelenetz, A.; Malt, R.A.


    The overall rate of rDNA transcription increases by 50% during the first 24 hours of compensatory renal hypertrophy in the mouse. To study mechanisms of ribosome accumulation after uninephrectomy, transcription rates were measured in isolated kidneys by transcriptional runoff. 32 P-labeled nascent transcripts were hybridized to blots containing linearized, denatured cloned rDNA, and hybridization was quantitated autoradiographically and by direct counting. Overall transcriptional activity of rDNA was increased by 30% above control levels at 6 hrs after nephrectomy and by 50% at 12, 18, and 24 hrs after operation. Hybridizing RNA was insensitive to inhibiby alpha-amanitin, and no hybridization was detected to vector DNA. Thus, accelerated rDNA transcription is one regulatory element in the accretion of ribosomes in renal growth, and the regulatory event is an early event. Mechanisms of activation may include enhanced transcription of active genes or induction of inactive DNA

  19. Ribosomal protein S14 transcripts are edited in Oenothera mitochondria. (United States)

    Schuster, W; Unseld, M; Wissinger, B; Brennicke, A


    The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162

  20. The subcellular distribution of the human ribosomal "stalk" components: P1, P2 and P0 proteins

    DEFF Research Database (Denmark)

    Tchórzewski, Marek; Krokowski, Dawid; Rzeski, Wojciech


    The ribosomal "stalk" structure is a distinct lateral protuberance located on the large ribosomal subunit in prokaryotic, as well as in eukaryotic cells. In eukaryotes, this ribosomal structure is composed of the acidic ribosomal P proteins, forming two hetero-dimers (P1/P2) attached...

  1. Assembly constraints drive co-evolution among ribosomal constituents. (United States)

    Mallik, Saurav; Akashi, Hiroshi; Kundu, Sudip


    Ribosome biogenesis, a central and essential cellular process, occurs through sequential association and mutual co-folding of protein-RNA constituents in a well-defined assembly pathway. Here, we construct a network of co-evolving nucleotide/amino acid residues within the ribosome and demonstrate that assembly constraints are strong predictors of co-evolutionary patterns. Predictors of co-evolution include a wide spectrum of structural reconstitution events, such as cooperativity phenomenon, protein-induced rRNA reconstitutions, molecular packing of different rRNA domains, protein-rRNA recognition, etc. A correlation between folding rate of small globular proteins and their topological features is known. We have introduced an analogous topological characteristic for co-evolutionary network of ribosome, which allows us to differentiate between rRNA regions subjected to rapid reconstitutions from those hindered by kinetic traps. Furthermore, co-evolutionary patterns provide a biological basis for deleterious mutation sites and further allow prediction of potential antibiotic targeting sites. Understanding assembly pathways of multicomponent macromolecules remains a key challenge in biophysics. Our study provides a 'proof of concept' that directly relates co-evolution to biophysical interactions during multicomponent assembly and suggests predictive power to identify candidates for critical functional interactions as well as for assembly-blocking antibiotic target sites. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Photoaffinity labeling of the pactamycin binding site on eubacterial ribosomes

    International Nuclear Information System (INIS)

    Tejedor, F.; Amils, R.; Ballesta, J.P.


    Pactamycin, an inhibitor of the initial steps of protein synthesis, has an acetophenone group in its chemical structure that makes the drug a potentially photoreactive molecule. In addition, the presence of a phenolic residue makes it easily susceptible to radioactive labeling. Through iodination, one radioactive derivative of pactamycin has been obtained with biological activities similar to the unmodified drug when tested on in vivo and cell-free systems. With the use of [ 125 I]iodopactamycin, ribosomes of Escherichia coli have been photolabeled under conditions that preserve the activity of the particles and guarantee the specificity of the binding sites. Under these conditions, RNA is preferentially labeled when free, small ribosomal subunits are photolabeled, but proteins are the main target in the whole ribosome. This indicates that an important conformational change takes place in the binding site on association of the two subunits. The major labeled proteins are S2, S4, S18, S21, and L13. These proteins in the pactamycin binding site are probably related to the initiation step of protein synthesis

  3. Further characterization of ribosome binding to thylakoid membranes

    International Nuclear Information System (INIS)

    Hurewitz, J.; Jagendorf, A.T.


    Previous work indicated more polysomes bound to pea (Pisum sativum cv Progress No. 9) thylakoids in light than in the dark, in vivo. With isolated intact chloroplasts incubated in darkness, addition of MgATP had no effect but 24 to 74% more RNA was thylakoid-bound at pH 8.3 than at pH 7. Thus, the major effect of light on ribosome-binding in vivo may be due to higher stroma pH. In isolated pea chloroplasts, initiation inhibitors (pactamycin and kanamycin) decreased the extent of RNA binding, and elongation inhibitors (lincomycin and streptomycin) increased it. Thus, cycling of ribosomes is controlled by translation, initiation, and termination. Bound RNA accounted for 19 to 24% of the total chloroplast RNA and the incorporation of [ 3 H]leucine into thylakoids was proportional to the amount of this bound RNA. These data support the concept that stroma ribosomes are recruited into thylakoid polysomes, which are active in synthesizing thylakoid proteins

  4. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.


    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  5. A new version of the RDP (Ribosomal Database Project) (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide


    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW ( The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  6. Simulation and analysis of single-ribosome translation

    International Nuclear Information System (INIS)

    Tinoco, Ignacio Jr; Wen, Jin-Der


    In the cell, proteins are synthesized by ribosomes in a multi-step process called translation. The ribosome translocates along the messenger RNA to read the codons that encode the amino acid sequence of a protein. Elongation factors, including EF-G and EF-Tu, are used to catalyze the process. Recently, we have shown that translation can be followed at the single-molecule level using optical tweezers; this technique allows us to study the kinetics of translation by measuring the lifetime the ribosome spends at each codon. Here, we analyze the data from single-molecule experiments and fit the data with simple kinetic models. We also simulate the translation kinetics based on a multi-step mechanism from ensemble kinetic measurements. The mean lifetimes from the simulation were consistent with our experimental single-molecule measurements. We found that the calculated lifetime distributions were fit in general by equations with up to five rate-determining steps. Two rate-determining steps were only obtained at low concentrations of elongation factors. These analyses can be used to design new single-molecule experiments to better understand the kinetics and mechanism of translation

  7. A genome-wide siRNA screen in mammalian cells for regulators of S6 phosphorylation.

    Directory of Open Access Journals (Sweden)

    Angela Papageorgiou

    Full Text Available mTOR complex1, the major regulator of mRNA translation in all eukaryotic cells, is strongly activated in most cancers. We performed a genome-wide RNAi screen in a human cancer cell line, seeking genes that regulate S6 phosphorylation, readout of mTORC1 activity. Applying a stringent selection, we retrieved nearly 600 genes wherein at least two RNAis gave significant reduction in S6-P. This cohort contains known regulators of mTOR complex 1 and is significantly enriched in genes whose depletion affects the proliferation/viability of the large set of cancer cell lines in the Achilles database in a manner paralleling that caused by mTOR depletion. We next examined the effect of RNAi pools directed at 534 of these gene products on S6-P in TSC1 null mouse embryo fibroblasts. 76 RNAis reduced S6 phosphorylation significantly in 2 or 3 replicates. Surprisingly, among this cohort of genes the only elements previously associated with the maintenance of mTORC1 activity are two subunits of the vacuolar ATPase and the CUL4 subunit DDB1. RNAi against a second set of 84 targets reduced S6-P in only one of three replicates. However, an indication that this group also bears attention is the presence of rpS6KB1 itself, Rac1 and MAP4K3, a protein kinase that supports amino acid signaling to rpS6KB1. The finding that S6 phosphorylation requires a previously unidentified, functionally diverse cohort of genes that participate in fundamental cellular processes such as mRNA translation, RNA processing, DNA repair and metabolism suggests the operation of feedback pathways in the regulation of mTORC1 operating through novel mechanisms.

  8. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide. (United States)

    Shi, Zhen; Fujii, Kotaro; Kovary, Kyle M; Genuth, Naomi R; Röst, Hannes L; Teruel, Mary N; Barna, Maria


    Emerging studies have linked the ribosome to more selective control of gene regulation. However, an outstanding question is whether ribosome heterogeneity at the level of core ribosomal proteins (RPs) exists and enables ribosomes to preferentially translate specific mRNAs genome-wide. Here, we measured the absolute abundance of RPs in translating ribosomes and profiled transcripts that are enriched or depleted from select subsets of ribosomes within embryonic stem cells. We find that heterogeneity in RP composition endows ribosomes with differential selectivity for translating subpools of transcripts, including those controlling metabolism, cell cycle, and development. As an example, mRNAs enriched in binding to RPL10A/uL1-containing ribosomes are shown to require RPL10A/uL1 for their efficient translation. Within several of these transcripts, this level of regulation is mediated, at least in part, by internal ribosome entry sites. Together, these results reveal a critical functional link between ribosome heterogeneity and the post-transcriptional circuitry of gene expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Ribosomal protein S6 phosphorylation and morphological changes in response to the tumour promoter 12-O-tetradecanoylphorbol 13-acetate in primary human tumour cells, established and transformed cell lines

    DEFF Research Database (Denmark)

    Rance, A J; Thönnes, M; Issinger, O G


    lifespan (fibroblasts, primary human tumour cells) can be mimicked by unknown steps also associated with immortalization (establishment function) and the transformed state of the tumour cells. Another interesting observation were morphological changes of the established and SV40-transformed cells which...

  10. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    International Nuclear Information System (INIS)

    Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi


    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  11. Involvement of ribosomal protein L6 in assembly of functional 50S ribosomal subunit in Escherichia coli cells

    Energy Technology Data Exchange (ETDEWEB)

    Shigeno, Yuta [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan); Uchiumi, Toshio [Department of Biology, Faculty of Science, Niigata University, Niigata 950-2181 (Japan); Nomura, Takaomi, E-mail: [Division of Applied Biology, Faculty of Textile Science and Technology, Shinshu University, Ueda 386-8567 (Japan)


    Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly, cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.

  12. gamma. radiation effect on the functional properties of the cotton ribosomes

    Energy Technology Data Exchange (ETDEWEB)

    Ibragimov, A P; Safarov, Sh


    A study is made of the action of radiation on the functional properties of ribosomes in irradiated organisms and on isolated ribosomes exposed to different doses. With increase in dose there occurs a reduction in the incorporation of labelled amino acids by the ribosomes released from irradiated sprouts and also during irradiation of isolated ribosomes. The study covered the functional activity of ribosomes irradiated at different doses with the use of synthetic poly-U and poly-A matrices synthesizing polyphenylalanine and polylysine, depending on the irradiation dose. The inhibition of the activity of the protein synthesis system at high doses is due to structural and functional changes in ribosomes and also to disturbance in the biosynthesis and functions of the messenger RNA.

  13. Computational resources for ribosome profiling: from database to Web server and software. (United States)

    Wang, Hongwei; Wang, Yan; Xie, Zhi


    Ribosome profiling is emerging as a powerful technique that enables genome-wide investigation of in vivo translation at sub-codon resolution. The increasing application of ribosome profiling in recent years has achieved remarkable progress toward understanding the composition, regulation and mechanism of translation. This benefits from not only the awesome power of ribosome profiling but also an extensive range of computational resources available for ribosome profiling. At present, however, a comprehensive review on these resources is still lacking. Here, we survey the recent computational advances guided by ribosome profiling, with a focus on databases, Web servers and software tools for storing, visualizing and analyzing ribosome profiling data. This review is intended to provide experimental and computational biologists with a reference to make appropriate choices among existing resources for the question at hand. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  14. Senescent changes in the ribosomes of animal cells in vivo and in vitro (United States)

    Miquel, J.; Johnson, J. E., Jr.


    The paper examines RNA-ribosomal changes observed in protozoa and fixed postmitotic cells, as well as the characteristics of intermitotic cells. Attention is given to a discussion of the implications of the reported ribosomal changes as to the senescent deterioration of protein synthesis and physiological functions. A survey of the literature suggests that, while the data on ribosomal change in dividing cells both in vivo and in vitro are inconclusive, there is strong histological and biochemical evidence in favor of some degree of quantitative ribosomal loss in fixed postmitotic cells. Since these decreases in ribosomes are demonstrated in differential cells from nematodes, insects and mammals, they may represent a universal manifestation of cytoplasmic senescence in certain types of fixed postmitotic animal cells. The observed variability in ribosomal loss for cells belonging to the same type suggests that this involution phenomenon is rather related to the wear and tear suffered by a particular cell.

  15. Control of ribosome traffic by position-dependent choice of synonymous codons

    DEFF Research Database (Denmark)

    Mitarai, Namiko; Pedersen, Steen


    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino...... acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby...... ribosomes by affecting the appearance of 'traffic jams' where multiple ribosomes collide and form queues. To test this 'context effect' further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated...

  16. Prolonged activation of S6K1 does not suppress IRS or PI-3 kinase signaling during muscle cell differentiation

    Directory of Open Access Journals (Sweden)

    MacKenzie Matthew G


    Full Text Available Abstract Background Myogenesis in C2C12 cells requires the activation of the PI3K/mTOR signaling pathways. Since mTOR signaling can feedback through S6K1 to inhibit the activation of PI3K, the aim of this work was to assess whether feedback from S6K1 played a role in myogenesis and determine whether siRNA mediated knockdown of S6K1 would lead to an increased rate of myotube formation. Results S6K1 activity increased in a linear fashion following plating and was more than 3-fold higher after Day 3 of differentiation (subconfluent = 11.09 ± 3.05, Day 3 = 29.34 ± 3.58. IRS-1 levels tended to increase upon serum withdrawal but decreased approximately 2-fold (subconfluent = 0.88 ± 0.10, Day 3 = 0.42 ± 0.06 3 days following differentiation whereas IRS-2 protein remained stable. IRS-1 associated p85 was significantly reduced upon serum withdrawal (subconfluent = 0.86 ± 0.07, Day 0 = 0.31 ± 0.05, remaining low through day 1. IRS-2 associated p85 decreased following serum withdrawal (subconfluent = 0.96 ± 0.05, Day 1 = 0.56 ± 0.08 and remained suppressed up to Day 3 following differentiation (0.56 ± 0.05. Phospho-tyrosine associated p85 increased significantly from subconfluent to Day 0 and remained elevated throughout differentiation. siRNA directed against S6K1 and S6K2 did not result in changes in IRS-1 levels after either 48 or 96 hrs. Furthermore, neither 48 nor 96 hrs of S6K1 knockdown caused a change in myotube formation. Conclusions Even though S6K1 activity increases throughout muscle cell differentiation and IRS-1 levels decrease over this period, siRNA suggests that S6K1 is not mediating the decrease in IRS-1. The decrease in IRS-1/2 associated p85 together with the increase in phospho-tyrosine associated p85 suggests that PI3K associates primarily with scaffolds other than IRS-1/2 during muscle cell differentiation.

  17. D-Glucosamine inhibits proliferation of human cancer cells through inhibition of p70S6K

    International Nuclear Information System (INIS)

    Oh, Hyun-Ji; Lee, Jason S.; Song, Dae-Kyu; Shin, Dong-Hoon; Jang, Byeong-Churl; Suh, Seong-Il; Park, Jong-Wook; Suh, Min-Ho; Baek, Won-Ki


    Although D-glucosamine has been reported as an inhibitor of tumor growth both in vivo and in vitro, the mechanism for the anticancer effect of D-glucosamine is still unclear. Since there are several reports suggesting D-glucosamine inhibits protein synthesis, we examined whether D-glucosamine affects p70S6 K activity, an important signaling molecule involved in protein translation. In the present study, we found D-glucosamine inhibited the activity of p70S6K and the proliferation of DU145 prostate cancer cells and MDA-MB-231 breast cancer cells. D-Glucosamine decreased phosphorylation of p70S6K, and its downstream substrates RPS6, and eIF-4B, but not mTOR and 4EBP1 in DU145 cells, suggesting that D-glucosamine induced inhibition of p70S6K is not through the inhibition of mTOR. In addition, D-glucosamine enhanced the growth inhibitory effects of rapamycin, a specific inhibitor of mTOR. These findings suggest that D-glucosamine can inhibit growth of cancer cells through dephosphorylation of p70S6K

  18. Overexpression of Notch3 and pS6 Is Associated with Poor Prognosis in Human Ovarian Epithelial Cancer

    Directory of Open Access Journals (Sweden)

    Zhaoxia Liu


    Full Text Available Notch3 and pS6 play important roles in tumor angiogenesis. To assess the expression of Notch3 and pS6 in Chinese ovarian epithelial cancer patients, a ten-year follow-up study was performed in ovarian epithelial cancer tissues from 120 specimens of human ovarian epithelial cancer, 30 specimens from benign ovarian tumors, and 30 samples from healthy ovaries by immunohistochemistry. The results indicate that the expression of Notch3 and pS6 was higher in ovarian epithelial cancer than in normal ovary tissues and in benign ovarian tumor tissues (p0.05 but positively associated with clinical stage, pathological grading, histologic type, lymph node metastasis, and ascites (p<0.05 or p<0.01. A follow-up survey of 64 patients with ovarian epithelial cancer showed that patients with high Notch3 and pS6 expression had a shorter survival time (p<0.01, in which the clinical stage (p<0.05 and Notch3 expression (p<0.01 played important roles. In conclusion, Notch3 and pS6 are significantly related to ovarian epithelial cancer development and prognosis, and their combination represents a potential biomarker and therapeutic target in ovarian tumor angiogenesis.

  19. Genome-wide polysomal analysis of a yeast strain with mutated ribosomal protein S9

    Directory of Open Access Journals (Sweden)

    Arava Yoav


    Full Text Available Abstract Background The yeast ribosomal protein S9 (S9 is located at the entrance tunnel of the mRNA into the ribosome. It is known to play a role in accurate decoding and its bacterial homolog (S4 has recently been shown to be involved in opening RNA duplexes. Here we examined the effects of changing the C terminus of S9, which is rich in acidic amino acids and extends out of the ribosome surface. Results We performed a genome-wide analysis to reveal effects at the transcription and translation levels of all yeast genes. While negligible relative changes were observed in steady-state mRNA levels, a significant number of mRNAs appeared to have altered ribosomal density. Notably, 40% of the genes having reliable signals changed their ribosomal association by more than one ribosome. Yet, no general correlations with physical or functional features of the mRNA were observed. Ribosome Density Mapping (RDM along four of the mRNAs with increased association revealed an increase in ribosomal density towards the end of the coding region for at least two of them. Read-through analysis did not reveal any increase in read-through of a premature stop codon by the mutant strain. Conclusion The ribosomal protein rpS9 appears to be involved in the translation of many mRNAs, since altering its C terminus led to a significant change in ribosomal association of many mRNAs. We did not find strong correlations between these changes and several physical features of the mRNA, yet future studies with advanced tools may allow such correlations to be determined. Importantly, our results indicate an accumulation of ribosomes towards the end of the coding regions of some mRNAs. This suggests an involvement of S9 in ribosomal dissociation during translation termination.

  20. Human nucleolus organizers on nonhomologous chromosomes can share the same ribosomal gene variants. (United States)

    Krystal, M; D'Eustachio, P; Ruddle, F H; Arnheim, N


    The distributions of three human ribosomal gene polymorphisms among individual chromosomes containing nucleolus organizers were analyzed by using mouse--human hybrid cells. Different nucleolus organizers can contain the same variant, suggesting the occurrence of genetic exchanges among ribosomal gene clusters on nonhomologous chromosomes. Such exchanges appear to occur less frequently in mice. This difference is discussed in terms of the nucleolar organization and chromosomal location of ribosomal gene clusters in humans and mice. Images PMID:6272316

  1. The primary structures of ribosomal proteins S14 and S16 from the archaebacterium Halobacterium marismortui. Comparison with eubacterial and eukaryotic ribosomal proteins. (United States)

    Kimura, J; Kimura, M


    The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.

  2. 5S ribosomal RNA database Y2K. (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A


    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  3. mRNA decapping enzyme from ribosomes of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Stevens, A.


    By use of [ 3 H]methyl-5'-capped [ 14 C]mRNA from yeast as a substrate, a decapping enzyme activity has been detected in enzyme fractions derived from a high salt wash of ribosomes of Saccharomyces cerevisiae. The product of the decapping reaction is [ 3 H]m 7 GDP. That the enzyme is not a non-specific pyrophosphatase is suggested by the finding that the diphosphate product, m 7 GpppA(G), and UDP-glucose are not hydrolyzed

  4. Potential roles for ubiquitin and the proteasome during ribosome biogenesis

    Czech Academy of Sciences Publication Activity Database

    Stavreva, D. A.; Kawasaki, M.; Dundr, M.; Koberna, Karel; Müller, W. G.; Tsujimura-Takahashi, T.; Komatsu, W.; Hayano, T.; Isobe, T.; Raška, Ivan; Misteli, T.; Takahashi, N.; McNally, J. G.


    Roč. 26, č. 13 (2006), s. 5131-5145 ISSN 0270-7306 R&D Projects: GA MŠk(CZ) LC535; GA ČR(CZ) GA304/05/0374; GA ČR(CZ) GA304/04/0692 Grant - others:NIH(US) Intramural Research Program; Ministry of Education(JP) Pioneer Research grant Institutional research plan: CEZ:AV0Z50110509 Keywords : the role of the ubikvitin * proteasome system in ribosome biogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.773, year: 2006

  5. γ-irradiated ribosomes from Micrococcus radiodurans in a cell-free protein synthesizing system

    International Nuclear Information System (INIS)

    Suessmuth, R.; Widmann, A.


    γ-irradiation inactivation of isolated ribosomes of Micrococcus radiodurans was studied by examining poly U directed synthesis of polyphenylalanine. Ribosomes of M. radiodurans did not show significant γ-radiation sensitivity up to a dose of approx. 11.6 k Gy. Cells of M. radiodurans take up more magnesium than E. coli cells under the same conditions. The magnesium content of ribosomes of M. radiodurans was 18% higher than that of E.coli ribosomes. A possible relation between Mg 2+ -content and γ-resistance is discussed. (orig.) [de

  6. Ribosome dynamics and tRNA movement by time-resolved electron cryomicroscopy. (United States)

    Fischer, Niels; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V; Stark, Holger


    The translocation step of protein synthesis entails large-scale rearrangements of the ribosome-transfer RNA (tRNA) complex. Here we have followed tRNA movement through the ribosome during translocation by time-resolved single-particle electron cryomicroscopy (cryo-EM). Unbiased computational sorting of cryo-EM images yielded 50 distinct three-dimensional reconstructions, showing the tRNAs in classical, hybrid and various novel intermediate states that provide trajectories and kinetic information about tRNA movement through the ribosome. The structures indicate how tRNA movement is coupled with global and local conformational changes of the ribosome, in particular of the head and body of the small ribosomal subunit, and show that dynamic interactions between tRNAs and ribosomal residues confine the path of the tRNAs through the ribosome. The temperature dependence of ribosome dynamics reveals a surprisingly flat energy landscape of conformational variations at physiological temperature. The ribosome functions as a Brownian machine that couples spontaneous conformational changes driven by thermal energy to directed movement.

  7. Ribosomes: Ribozymes that Survived Evolution Pressures but Is Paralyzed by Tiny Antibiotics (United States)

    Yonath, Ada

    An impressive number of crystal structures of ribosomes, the universal cellular machines that translate the genetic code into proteins, emerged during the last decade. The determination of ribosome high resolution structure, which was widely considered formidable, led to novel insights into the ribosomal function, namely, fidelity, catalytic mechanism, and polymerize activities. They also led to suggestions concerning its origin and shed light on the action, selectivity and synergism of ribosomal antibiotics; illuminated mechanisms acquiring bacterial resistance and provided structural information for drug improvement and design. These studies required the pioneering and implementation of advanced technologies, which directly influenced the remarkable increase of the number of structures deposited in the Protein Data Bank.

  8. Expression of ribosomal genes in pea cotyledons at the initial stages of germination

    International Nuclear Information System (INIS)

    Gumilevskaya, N.A.; Chumikhina, L.V.; Akhmatova, A.T.; Kretovich, V.L.


    The time of appearance of newly synthesized rRNAs and ribosomal proteins (r-proteins) in the ribosomes of pea cotyledons (Pisum sativum L.) during germination was investigated. The ribosomal fraction was isolated and analyzed according to the method of germination of the embryo in the presence of labeled precursors or after pulse labeling of the embryos at different stages of germination. For the identification of newly synthesized rRNAs in the ribosomes we estimated the relative stability of labeled RNAs to the action of RNase, the sedimentation rate, the ability to be methylated in vivo in the presence of [ 14 C]CH 3 -methionine, and the localization in the subunits of dissociated ribosomes. The presence of newly synthesized r-proteins in the ribosomes was judged on the basis of the electrophoretic similarity in SDS-disc electrophoresis of labeled polypeptides of purified ribosome preparations and of genuine r-proteins, as well as according to the localization of labeled proteins in the subunits of the dissociated ribosomes. It was shown that the expression of the ribosomal genes in highly specialized cells of pea cotyledons that have completed their growth occurs at very early stages of germination

  9. Crystal structure of the Hg4SiS6 and Hg4SiSe6 compounds

    International Nuclear Information System (INIS)

    Gulay, L.D.; Olekseyuk, I.D.; Parasyuk, O.V.


    The crystal structures of Hg 4 SiS 6 and Hg 4 SiSe 6 compounds were investigated using X-ray powder diffraction. These compounds crystallize in the monoclinic Cc space group with the lattice parameters a=1.23020(5), b=0.71031(4), c=1.22791(4) nm, β=109.721(3) deg. for Hg 4 SiS 6 and a=1.28110(4), b=0.74034(4), c=1.27471(1) nm, β=109.605(3) deg. for Hg 4 SiSe 6 . Atomic parameters were refined in the isotropic approximation (R I =0.0571 and R I =0.0555 for the Hg 4 SiS 6 and Hg 4 SiSe 6 , respectively)

  10. FXR blocks the growth of liver cancer cells through inhibiting mTOR-s6K pathway

    International Nuclear Information System (INIS)

    Huang, Xiongfei; Zeng, Yeting; Wang, Xinrui; Ma, Xiaoxiao; Li, Qianqian; Li, Ningbo; Su, Hongying; Huang, Wendong


    The nuclear receptor Farnesoid X Receptor (FXR) is likely a tumor suppressor in liver tissue but its molecular mechanism of suppression is not well understood. In this study, the gene expression profile of human liver cancer cells was investigated by microarray. Bioinformatics analysis of these data revealed that FXR might regulate the mTOR/S6K signaling pathway. This was confirmed by altering the expression level of FXR in liver cancer cells. Overexpression of FXR prevented the growth of cells and induced cell cycle arrest, which was enhanced by the mTOR/S6K inhibitor rapamycin. FXR upregulation also intensified the inhibition of cell growth by rapamycin. Downregulation of FXR produced the opposite effect. Finally, we found that ectopic expression of FXR in SK-Hep-1 xenografts inhibits tumor growth and reduces expression of the phosphorylated protein S6K. Taken together, our data provide the first evidence that FXR suppresses proliferation of human liver cancer cells via the inhibition of the mTOR/S6K signaling pathway. FXR expression can be used as a biomarker of personalized mTOR inhibitor treatment assessment for liver cancer patients. -- Highlights: •FXR inhibits the proliferation of liver cancer cells by prolonging G0/G1 phase. •Microarray results indicate that mTOR-S6k signaling is involved in cellular processes in which FXR plays an important role. •FXR blocks the growth of liver cancer cells via the inhibition of the mTOR/S6K signaling pathway in vitro and in vivo.

  11. FXR blocks the growth of liver cancer cells through inhibiting mTOR-s6K pathway

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xiongfei, E-mail: [Department of Pathology and Institute of Oncology, Preclinical School, Fujian Medical University, Fuzhou 350108, Fujian (China); Key Laboratory of Ministry of Education for Gastrointestinal Cancer, Fujian Medical University, Fuzhou 350108, Fujian (China); Zeng, Yeting [Department of Pathology and Institute of Oncology, Preclinical School, Fujian Medical University, Fuzhou 350108, Fujian (China); Wang, Xinrui [Department of Biochemistry and Molecular Biology, Fujian Medical University, Fuzhou 350108, Fujian (China); Ma, Xiaoxiao [Department of Diabetes Complications and Metabolism, Diabetes & Metabolism Research Institute, Beckman Research Institute, City of Hope, CA 91010 (United States); Li, Qianqian; Li, Ningbo; Su, Hongying [Department of Pathology and Institute of Oncology, Preclinical School, Fujian Medical University, Fuzhou 350108, Fujian (China); Huang, Wendong [Department of Diabetes Complications and Metabolism, Diabetes & Metabolism Research Institute, Beckman Research Institute, City of Hope, CA 91010 (United States)


    The nuclear receptor Farnesoid X Receptor (FXR) is likely a tumor suppressor in liver tissue but its molecular mechanism of suppression is not well understood. In this study, the gene expression profile of human liver cancer cells was investigated by microarray. Bioinformatics analysis of these data revealed that FXR might regulate the mTOR/S6K signaling pathway. This was confirmed by altering the expression level of FXR in liver cancer cells. Overexpression of FXR prevented the growth of cells and induced cell cycle arrest, which was enhanced by the mTOR/S6K inhibitor rapamycin. FXR upregulation also intensified the inhibition of cell growth by rapamycin. Downregulation of FXR produced the opposite effect. Finally, we found that ectopic expression of FXR in SK-Hep-1 xenografts inhibits tumor growth and reduces expression of the phosphorylated protein S6K. Taken together, our data provide the first evidence that FXR suppresses proliferation of human liver cancer cells via the inhibition of the mTOR/S6K signaling pathway. FXR expression can be used as a biomarker of personalized mTOR inhibitor treatment assessment for liver cancer patients. -- Highlights: •FXR inhibits the proliferation of liver cancer cells by prolonging G0/G1 phase. •Microarray results indicate that mTOR-S6k signaling is involved in cellular processes in which FXR plays an important role. •FXR blocks the growth of liver cancer cells via the inhibition of the mTOR/S6K signaling pathway in vitro and in vivo.

  12. Combined Effect of the Cfr Methyltransferase and Ribosomal Protein L3 Mutations on Resistance to Ribosome-Targeting Antibiotics. (United States)

    Pakula, Kevin K; Hansen, Lykke H; Vester, Birte


    Several groups of antibiotics inhibit bacterial growth by binding to bacterial ribosomes. Mutations in ribosomal protein L3 have been associated with resistance to linezolid and tiamulin, which both bind at the peptidyl transferase center in the ribosome. Resistance to these and other antibiotics also occurs through methylation of 23S rRNA at position A2503 by the methyltransferase Cfr. The mutations in L3 and the cfr gene have been found together in clinical isolates, raising the question of whether they have a combined effect on antibiotic resistance or growth. We transformed a plasmid-borne cfr gene into a uL3-depleted Escherichia coli strain containing either wild-type L3 or L3 with one of seven mutations, G147R, Q148F, N149S, N149D, N149R, Q150L, or T151P, expressed from plasmid-carried rplC genes. The L3 mutations are well tolerated, with small to moderate growth rate decreases. The presence of Cfr has a very minor influence on the growth rate. The resistance of the transformants to linezolid, tiamulin, florfenicol, and Synercid (a combination of quinupristin and dalfopristin [Q-D]) was measured by MIC assays. The resistance from Cfr was, in all cases, stronger than the effects of the L3 mutations, but various effects were obtained with the combinations of Cfr and L3 mutations ranging from a synergistic to an antagonistic effect. Linezolid and tiamulin susceptibility varied greatly among the L3 mutations, while no significant effects on florfenicol and Q-D susceptibility were seen. This study underscores the complex interplay between various resistance mechanisms and cross-resistance, even from antibiotics with overlapping binding sites. Copyright © 2017 American Society for Microbiology.

  13. Ribosome-Inactivating Proteins from Plants: A Historical Overview

    Directory of Open Access Journals (Sweden)

    Andrea Bolognesi


    Full Text Available This review provides a historical overview of the research on plant ribosome-inactivating proteins (RIPs, starting from the first studies at the end of eighteenth century involving the purification of abrin and ricin, as well as the immunological experiments of Paul Erlich. Interest in these plant toxins was revived in 1970 by the observation of their anticancer activity, which has given rise to a large amount of research contributing to the development of various scientific fields. Biochemistry analyses succeeded in identifying the enzymatic activity of RIPs and allowed for a better understanding of the ribosomal machinery. Studies on RIP/cell interactions were able to detail the endocytosis and intracellular routing of ricin, thus increasing our knowledge of how cells handle exogenous proteins. The identification of new RIPs and the finding that most RIPs are single-chain polypeptides, together with their genetic sequencing, has aided in the development of new phylogenetic theories. Overall, the biological properties of these proteins, including their abortifacient, anticancer, antiviral and neurotoxic activities, suggest that RIPs could be utilized in agriculture and in many biomedical fields, including clinical drug development.

  14. Analysis of ribosomal protein gene structures: implications for intron evolution.

    Directory of Open Access Journals (Sweden)


    Full Text Available Many spliceosomal introns exist in the eukaryotic nuclear genome. Despite much research, the evolution of spliceosomal introns remains poorly understood. In this paper, we tried to gain insights into intron evolution from a novel perspective by comparing the gene structures of cytoplasmic ribosomal proteins (CRPs and mitochondrial ribosomal proteins (MRPs, which are held to be of archaeal and bacterial origin, respectively. We analyzed 25 homologous pairs of CRP and MRP genes that together had a total of 527 intron positions. We found that all 12 of the intron positions shared by CRP and MRP genes resulted from parallel intron gains and none could be considered to be "conserved," i.e., descendants of the same ancestor. This was supported further by the high frequency of proto-splice sites at these shared positions; proto-splice sites are proposed to be sites for intron insertion. Although we could not definitively disprove that spliceosomal introns were already present in the last universal common ancestor, our results lend more support to the idea that introns were gained late. At least, our results show that MRP genes were intronless at the time of endosymbiosis. The parallel intron gains between CRP and MRP genes accounted for 2.3% of total intron positions, which should provide a reliable estimate for future inferences of intron evolution.

  15. [Family of ribosomal proteins S1 contains unique conservative domain]. (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N


    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  16. Interaction of Pleuromutilin Derivatives with the Ribosomal Peptidyl Transferase Center (United States)

    Long, Katherine S.; Hansen, Lykke H.; Jakobsen, Lene; Vester, Birte


    Tiamulin is a pleuromutilin antibiotic that is used in veterinary medicine. The recently published crystal structure of a tiamulin-50S ribosomal subunit complex provides detailed information about how this drug targets the peptidyl transferase center of the ribosome. To promote rational design of pleuromutilin-based drugs, the binding of the antibiotic pleuromutilin and three semisynthetic derivatives with different side chain extensions has been investigated using chemical footprinting. The nucleotides A2058, A2059, G2505, and U2506 are affected in all of the footprints, suggesting that the drugs are similarly anchored in the binding pocket by the common tricyclic mutilin core. However, varying effects are observed at U2584 and U2585, indicating that the side chain extensions adopt distinct conformations within the cavity and thereby affect the rRNA conformation differently. An Escherichia coli L3 mutant strain is resistant to tiamulin and pleuromutilin, but not valnemulin, implying that valnemulin is better able to withstand an altered rRNA binding surface around the mutilin core. This is likely due to additional interactions made between the valnemulin side chain extension and the rRNA binding site. The data suggest that pleuromutilin drugs with enhanced antimicrobial activity may be obtained by maximizing the number of interactions between the side chain moiety and the peptidyl transferase cavity. PMID:16569865

  17. Genetic diversity of Entamoeba: Novel ribosomal lineages from cockroaches.

    Directory of Open Access Journals (Sweden)

    Tetsuro Kawano

    Full Text Available Our current taxonomic perspective on Entamoeba is largely based on small-subunit ribosomal RNA genes (SSU rDNA from Entamoeba species identified in vertebrate hosts with minor exceptions such as E. moshkovskii from sewage water and E. marina from marine sediment. Other Entamoeba species have also been morphologically identified and described from non-vertebrate species such as insects; however, their genetic diversity remains unknown. In order to further disclose the diversity of the genus, we investigated Entamoeba spp. in the intestines of three cockroach species: Periplaneta americana, Blaptica dubia, and Gromphadorhina oblongonota. We obtained 134 Entamoeba SSU rDNA sequences from 186 cockroaches by direct nested PCR using the DNA extracts of intestines from cockroaches, followed by scrutinized BLASTn screening and phylogenetic analyses. All the sequences identified in this study were distinct from those reported from known Entamoeba species, and considered as novel Entamoeba ribosomal lineages. Furthermore, they were positioned at the base of the clade of known Entamoeba species and displayed remarkable degree of genetic diversity comprising nine major groups in the three cockroach species. This is the first report of the diversity of SSU rDNA sequences from Entamoeba in non-vertebrate host species, and should help to understand the genetic diversity of the genus Entamoeba.

  18. Correlation between Ribosome Biogenesis and the Magnitude of Hypertrophy in Overloaded Skeletal Muscle. (United States)

    Nakada, Satoshi; Ogasawara, Riki; Kawada, Shigeo; Maekawa, Takahiro; Ishii, Naokata


    External loads applied to skeletal muscle cause increases in the protein translation rate, which leads to muscle hypertrophy. Although some studies have demonstrated that increases in the capacity and efficiency of translation are involved in this process, it remains unclear how these two factors are related to the magnitude of muscle hypertrophy. The present study aimed to clarify the roles played by the capacity and efficiency of translation in muscle hypertrophy. We used an improved synergist ablation in which the magnitude of compensatory hypertrophy could be controlled by partial removal of synergist muscles. Male rats were assigned to four groups in which the plantaris muscle was unilaterally subjected to weak (WK), moderate (MO), middle (MI), and strong (ST) overloading by four types of synergist ablation. Fourteen days after surgery, the weight of the plantaris muscle per body weight increased by 8%, 22%, 32% and 45%, in the WK, MO, MI and ST groups, respectively. Five days after surgery, 18+28S rRNA content (an indicator of translational capacity) increased with increasing overload, with increases of 1.8-fold (MO), 2.2-fold (MI), and 2.5-fold (ST), respectively, relative to non-overloaded muscle (NL) in the WK group. rRNA content showed a strong correlation with relative muscle weight measured 14 days after surgery (r = 0.98). The phosphorylated form of p70S6K (a positive regulator of translational efficiency) showed a marked increase in the MO group, but no further increase was observed with further increase in overload (increases of 22.6-fold (MO), 17.4-fold (MI), and 18.2-fold (ST), respectively, relative to NL in the WK group). These results indicate that increases in ribosome biogenesis at the early phase of overloading are strongly dependent on the amount of overloading, and may play an important role in increasing the translational capacity for further gain of muscular size.

  19. Correlation between Ribosome Biogenesis and the Magnitude of Hypertrophy in Overloaded Skeletal Muscle.

    Directory of Open Access Journals (Sweden)

    Satoshi Nakada

    Full Text Available External loads applied to skeletal muscle cause increases in the protein translation rate, which leads to muscle hypertrophy. Although some studies have demonstrated that increases in the capacity and efficiency of translation are involved in this process, it remains unclear how these two factors are related to the magnitude of muscle hypertrophy. The present study aimed to clarify the roles played by the capacity and efficiency of translation in muscle hypertrophy. We used an improved synergist ablation in which the magnitude of compensatory hypertrophy could be controlled by partial removal of synergist muscles. Male rats were assigned to four groups in which the plantaris muscle was unilaterally subjected to weak (WK, moderate (MO, middle (MI, and strong (ST overloading by four types of synergist ablation. Fourteen days after surgery, the weight of the plantaris muscle per body weight increased by 8%, 22%, 32% and 45%, in the WK, MO, MI and ST groups, respectively. Five days after surgery, 18+28S rRNA content (an indicator of translational capacity increased with increasing overload, with increases of 1.8-fold (MO, 2.2-fold (MI, and 2.5-fold (ST, respectively, relative to non-overloaded muscle (NL in the WK group. rRNA content showed a strong correlation with relative muscle weight measured 14 days after surgery (r = 0.98. The phosphorylated form of p70S6K (a positive regulator of translational efficiency showed a marked increase in the MO group, but no further increase was observed with further increase in overload (increases of 22.6-fold (MO, 17.4-fold (MI, and 18.2-fold (ST, respectively, relative to NL in the WK group. These results indicate that increases in ribosome biogenesis at the early phase of overloading are strongly dependent on the amount of overloading, and may play an important role in increasing the translational capacity for further gain of muscular size.

  20. In situ reverse transcription-PCR for monitoring gene expression in individual Methanosarcina mazei S-6 cells

    DEFF Research Database (Denmark)

    Lange, Marianne; Tolker-Nielsen, Tim; Molin, Søren


    An in situ reverse transcription-PCR protocol for detecting specific mRNA in Methanosarcina mazei S-6 is described. This method allowed us to detect heat shock-induced increases in the intracellular levels of the transcript of the universal stress gene dnaK. The cell walls of paraformaldehyde...

  1. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins. (United States)

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B


    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  2. A Listeria monocytogenes RNA helicase essential for growth and ribosomal maturation at low temperatures uses its C terminus for appropriate interaction with the ribosome. (United States)

    Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen


    Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.

  3. Hypoxic stress-induced changes in ribosomes of maize seedling roots

    International Nuclear Information System (INIS)

    Bailey-Serres, J.; Freeling, M.


    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with [ 35 S]methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with [ 32 P]orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress

  4. The activity of the acidic phosphoproteins from the 80 S rat liver ribosome. (United States)

    MacConnell, W P; Kaplan, N O


    The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.

  5. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants (United States)

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter


    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  6. Control of ribosome traffic by position-dependent choice of synonymous codons

    International Nuclear Information System (INIS)

    Mitarai, Namiko; Pedersen, Steen


    Messenger RNA (mRNA) encodes a sequence of amino acids by using codons. For most amino acids, there are multiple synonymous codons that can encode the amino acid. The translation speed can vary from one codon to another, thus there is room for changing the ribosome speed while keeping the amino acid sequence and hence the resulting protein. Recently, it has been noticed that the choice of the synonymous codon, via the resulting distribution of slow- and fast-translated codons, affects not only on the average speed of one ribosome translating the mRNA but also might have an effect on nearby ribosomes by affecting the appearance of ‘traffic jams’ where multiple ribosomes collide and form queues. To test this ‘context effect’ further, we here investigate the effect of the sequence of synonymous codons on the ribosome traffic by using a ribosome traffic model with codon-dependent rates, estimated from experiments. We compare the ribosome traffic on wild-type (WT) sequences and sequences where the synonymous codons were swapped randomly. By simulating translation of 87 genes, we demonstrate that the WT sequences, especially those with a high bias in codon usage, tend to have the ability to reduce ribosome collisions, hence optimizing the cellular investment in the translation apparatus. The magnitude of such reduction of the translation time might have a significant impact on the cellular growth rate and thereby have importance for the survival of the species. (paper)

  7. Plastid ribosome pausing is induced by multiple features and is linked to protein complex assembly

    DEFF Research Database (Denmark)

    Gawroński, Piotr; Jensen, Poul Erik; Karpinski, Stanislaw


    Many mRNAs contain pause sites that briefly interrupt the progress of translation. Specific features that induce ribosome pausing have been described; however, their individual contributions to pause-site formation, and the overall biological significance of ribosome pausing, remain largely uncle...

  8. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues

    International Nuclear Information System (INIS)

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.


    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of [ 32 P] ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of 32 P incorporation and the electrophoretic patterns were dependent on 32 P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K m values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins

  9. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments


    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.


    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  10. Replication and meiotic transmission of yeast ribosomal RNA genes. (United States)

    Brewer, B J; Zakian, V A; Fangman, W L


    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  11. Globular conformation of some ribosomal proteins in solution

    International Nuclear Information System (INIS)

    Serdyuk, I.N.; Spirin, A.S.


    The possibility that such RNA-binding proteins of the 30 S subparticle as S4, S7, S8 and S16 exist in the form of compact globules in solution has been explored experimentally. These proteins have been studied in D 2 O solution by neutron scattering to measure their radii of gyration. This type of radiation using D 2 O as a solvent provides the maximum 'contrast', that is the maximum difference between the scattering of the protein and the solvent. It allowed measurements to be made using protein at <= 1.5 mg/ml. The radii of gyration for the ribosomal proteins S4, S7, S8 and S16 were found to be relatively small corresponding to the radii of gyration of compact globular proteins of the same molecular weights. (Auth.)

  12. Heavy ion effects on yeast: Inhibition of ribosomal RNA synthesis

    International Nuclear Information System (INIS)

    Weber, K.J.; Schneider, E.; Kiefer, J.; Kraft, G.


    Diploid wild-type yeast cells were exposed to beams of heavy ions covering a wide range of linear energy transfer (LET) (43-13,700 keV/microns). Synthesis of ribosomal RNA (rRNA) was assessed as a functional measure of damage produced by particle radiation. An exponential decrease of relative rRNA synthesis with particle fluence was demonstrated in all cases. The inactivation cross sections derived were found to increase with LET over the entire range of LET studied. The corresponding values for relative biological effectiveness were slightly less than unity. Maximum cross sections measured were close to 1 micron 2, implying that some larger structure within the yeast nucleus (e.g., the nucleolus) might represent the target for an impairment of synthetic activity by very heavy ions rather than the genes coding for rRNA. Where tested, an oxygen effect for rRNA synthesis could not be demonstrated

  13. Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages. (United States)

    Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham


    Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  14. Cross-species functionality of pararetroviral elements driving ribosome shunting.

    Directory of Open Access Journals (Sweden)

    Mikhail M Pooggin

    Full Text Available BACKGROUND: Cauliflower mosaic virus (CaMV and Rice tungro bacilliform virus (RTBV belong to distinct genera of pararetroviruses infecting dicot and monocot plants, respectively. In both viruses, polycistronic translation of pregenomic (pg RNA is initiated by shunting ribosomes that bypass a large region of the pgRNA leader with several short (sORFs and a stable stem-loop structure. The shunt requires translation of a 5'-proximal sORF terminating near the stem. In CaMV, mutations knocking out this sORF nearly abolish shunting and virus viability. METHODOLOGY/PRINCIPAL FINDINGS: Here we show that two distant regions of the CaMV leader that form a minimal shunt configuration comprising the sORF, a bottom part of the stem, and a shunt landing sequence can be replaced by heterologous sequences that form a structurally similar configuration in RTBV without any dramatic effect on shunt-mediated translation and CaMV infectivity. The CaMV-RTBV chimeric leader sequence was largely stable over five viral passages in turnip plants: a few alterations that did eventually occur in the virus progenies are indicative of fine tuning of the chimeric sequence during adaptation to a new host. CONCLUSIONS/SIGNIFICANCE: Our findings demonstrate cross-species functionality of pararetroviral cis-elements driving ribosome shunting and evolutionary conservation of the shunt mechanism. We are grateful to Matthias Müller and Sandra Pauli for technical assistance. This work was initiated at Friedrich Miescher Institute (Basel, Switzerland. We thank Prof. Thomas Boller for hosting the group at the Institute of Botany.

  15. Ribosomal protein gene knockdown causes developmental defects in zebrafish.

    Directory of Open Access Journals (Sweden)

    Tamayo Uechi

    Full Text Available The ribosomal proteins (RPs form the majority of cellular proteins and are mandatory for cellular growth. RP genes have been linked, either directly or indirectly, to various diseases in humans. Mutations in RP genes are also associated with tissue-specific phenotypes, suggesting a possible role in organ development during early embryogenesis. However, it is not yet known how mutations in a particular RP gene result in specific cellular changes, or how RP genes might contribute to human diseases. The development of animal models with defects in RP genes will be essential for studying these questions. In this study, we knocked down 21 RP genes in zebrafish by using morpholino antisense oligos to inhibit their translation. Of these 21, knockdown of 19 RPs resulted in the development of morphants with obvious deformities. Although mutations in RP genes, like other housekeeping genes, would be expected to result in nonspecific developmental defects with widespread phenotypes, we found that knockdown of some RP genes resulted in phenotypes specific to each gene, with varying degrees of abnormality in the brain, body trunk, eyes, and ears at about 25 hours post fertilization. We focused further on the organogenesis of the brain. Each knocked-down gene that affected the morphogenesis of the brain produced a different pattern of abnormality. Among the 7 RP genes whose knockdown produced severe brain phenotypes, 3 human orthologs are located within chromosomal regions that have been linked to brain-associated diseases, suggesting a possible involvement of RP genes in brain or neurological diseases. The RP gene knockdown system developed in this study could be a powerful tool for studying the roles of ribosomes in human diseases.

  16. Heat shock protein 70 promotes coxsackievirus B3 translation initiation and elongation via Akt-mTORC1 pathway depending on activation of p70S6K and Cdc2. (United States)

    Wang, Fengping; Qiu, Ye; Zhang, Huifang M; Hanson, Paul; Ye, Xin; Zhao, Guangze; Xie, Ronald; Tong, Lei; Yang, Decheng


    We previously demonstrated that coxsackievirus B3 (CVB3) infection upregulated heat shock protein 70 (Hsp70) and promoted CVB3 multiplication. Here, we report the underlying mechanism by which Hsp70 enhances viral RNA translation. By using an Hsp70-overexpressing cell line infected with CVB3, we found that Hsp70 enhanced CVB3 VP1 translation at two stages. First, Hsp70 induced upregulation of VP1 translation at the initiation stage via upregulation of internal ribosome entry site trans-acting factor lupus autoantigen protein and activation of eIF4E binding protein 1, a cap-dependent translation suppressor. Second, we found that Hsp70 increased CVB3 VP1 translation by enhancing translation elongation. This was mediated by the Akt-mammalian target of rapamycin complex 1 signal cascade, which led to the activation of eukaryotic elongation factor 2 via p70S6K- and cell division cycle protein 2 homolog (Cdc2)-mediated phosphorylation and inactivation of eukaryotic elongation factor 2 kinase. We also determined the position of Cdc2 in this signal pathway, indicating that Cdc2 is regulated by mammalian target of rapamycin complex 1. This signal transduction pathway was validated using a number of specific pharmacological inhibitors, short interfering RNAs (siRNAs) and a dominant negative Akt plasmid. Because Hsp70 is a central component of the cellular network of molecular chaperones enhancing viral replication, these data may provide new strategies to limit this viral infection. © 2017 John Wiley & Sons Ltd.

  17. The Concept of the Luxury Branding in Samsung Galaxy S6 Edge Series Through Triadic Modes of Sign


    Paksi, Tiyo; Gunawan, Samuel


    This thesis mainly deals with the iconisation of signs and naturalisation process in order to reveal the way Samsung Galaxy S6 Edge is naturalised as a luxury product. This thesis also involves analysis of the luxury branding concept through the analysis of a product which conceptualises its advertisement using the concept of luxury identifiers. The focus of the writer's analysis is the advertisements themselves as the writer will use the triadic modes of signs, naturalisation process, and th...

  18. S6K1 and 4E-BP1 are independent regulated and control cellular growth in bladder cancer.

    Directory of Open Access Journals (Sweden)

    Roman Nawroth

    Full Text Available Aberrant activation and mutation status of proteins in the phosphatidylinositol-3-kinase (PI3K/Akt/mammalian target of rapamycin (mTOR and the mitogen activated protein kinase (MAPK signaling pathways have been linked to tumorigenesis in various tumors including urothelial carcinoma (UC. However, anti-tumor therapy with small molecule inhibitors against mTOR turned out to be less successful than expected. We characterized the molecular mechanism of this pathway in urothelial carcinoma by interfering with different molecular components using small chemical inhibitors and siRNA technology and analyzed effects on the molecular activation status, cell growth, proliferation and apoptosis. In a majority of tested cell lines constitutive activation of the PI3K was observed. Manipulation of mTOR or Akt expression or activity only regulated phosphorylation of S6K1 but not 4E-BP1. Instead, we provide evidence for an alternative mTOR independent but PI3K dependent regulation of 4E-BP1. Only the simultaneous inhibition of both S6K1 and 4E-BP1 suppressed cell growth efficiently. Crosstalk between PI3K and the MAPK signaling pathway is mediated via PI3K and indirect by S6K1 activity. Inhibition of MEK1/2 results in activation of Akt but not mTOR/S6K1 or 4E-BP1. Our data suggest that 4E-BP1 is a potential new target molecule and stratification marker for anti cancer therapy in UC and support the consideration of a multi-targeting approach against PI3K, mTORC1/2 and MAPK.

  19. Arsenite induces cell transformation by reactive oxygen species, AKT, ERK1/2, and p70S6K1

    International Nuclear Information System (INIS)

    Carpenter, Richard L.; Jiang, Yue; Jing, Yi; He, Jun; Rojanasakul, Yon; Liu, Ling-Zhi; Jiang, Bing-Hua


    Highlights: ► Chronic exposure to arsenite induces cell proliferation and transformation. ► Arsenite-induced transformation increases ROS production and downstream signalings. ► Inhibition of ROS levels via catalase reduces arsenite-induced cell transformation. ► Interruption of AKT, ERK, or p70S6K1 inhibits arsenite-induced cell transformation. -- Abstract: Arsenic is naturally occurring element that exists in both organic and inorganic formulations. The inorganic form arsenite has a positive association with development of multiple cancer types. There are significant populations throughout the world with high exposure to arsenite via drinking water. Thus, human exposure to arsenic has become a significant public health problem. Recent evidence suggests that reactive oxygen species (ROS) mediate multiple changes to cell behavior after acute arsenic exposure, including activation of proliferative signaling and angiogenesis. However, the role of ROS in mediating cell transformation by chronic arsenic exposure is unknown. We found that cells chronically exposed to sodium arsenite increased proliferation and gained anchorage-independent growth. This cell transformation phenotype required constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. We also observed these cells constitutively produce ROS, which was required for the constitutive activation of AKT, ERK1/2, mTOR, and p70S6K1. Suppression of ROS levels by forced expression of catalase also reduced cell proliferation and anchorage-independent growth. These results indicate cell transformation induced by chronic arsenic exposure is mediated by increased cellular levels of ROS, which mediates activation of AKT, ERK1/2, and p70S6K1.

  20. Translation initiation in bacterial polysomes through ribosome loading on a standby site on a highly translated mRNA (United States)

    Andreeva, Irena


    During translation, consecutive ribosomes load on an mRNA and form a polysome. The first ribosome binds to a single-stranded mRNA region and moves toward the start codon, unwinding potential mRNA structures on the way. In contrast, the following ribosomes can dock at the start codon only when the first ribosome has vacated the initiation site. Here we show that loading of the second ribosome on a natural 38-nt-long 5′ untranslated region of lpp mRNA, which codes for the outer membrane lipoprotein from Escherichia coli, takes place before the leading ribosome has moved away from the start codon. The rapid formation of this standby complex depends on the presence of ribosomal proteins S1/S2 in the leading ribosome. The early recruitment of the second ribosome to the standby site before translation by the leading ribosome and the tight coupling between translation elongation by the first ribosome and the accommodation of the second ribosome can contribute to high translational efficiency of the lpp mRNA. PMID:29632209

  1. Exploring the ϒ (4 S ,5 S ,6 S )→hb(1 P )η hidden-bottom hadronic transitions (United States)

    Zhang, Yawei; Li, Gang


    Recently, the Belle Collaboration has reported the measurement of the spin-flipping transition ϒ (4 S )→hb(1 P )η with an unexpectedly large branching ratio: B (ϒ (4 S )→hb(1 P )η )=(2.18 ±0.11 ±0.18 )×10-3 . Such a large branching fraction contradicts with the anticipated suppression for the spin flip. In this work, we examine the effects induced by intermediate bottomed meson loops and point out that these effects are significantly important. Using the effective Lagrangian approach (ELA), we find the experimental data on ϒ (4 S )→hb(1 P )η can be accommodated with the reasonable inputs. We then explore the decays ϒ (5 S ,6 S )→hb(1 P )η and find that these two channels also have sizable branching fractions. We also calculate these processes in the framework of nonrelativistic effective field theory (NREFT). For the decays ϒ (4 S )→hb(1 P )η , the NREFT results are at the same order of magnitude but smaller than the ELA results by a factor of 2 to 5. For the decays ϒ (5 S ,6 S )→hb(1 P )η , the NREFT results are smaller than the ELA results by approximately 1 order of magnitude. We suggest a future experiment Belle-II to search for the ϒ (5 S ,6 S )→hb(1 P )η decays, which will be helpful for understanding the transition mechanism.

  2. Studies of the effects of ultraviolet radiation on the structural integrities of ribosomal RNA components of the Escherichia coli 50S ribosomal subunit

    International Nuclear Information System (INIS)

    Gorelic, L.; Parker, D.


    The effects of 254-nm radiation on the structural integrities of free and 50S ribosome-bound 5S and 23S ribosomal ribonucleic acids (rRNA) have been elucidated. Irradiation of aqueous solutions of Escherichia coli 50S ribosomes with 253.7-nm radiation results in the formation of single-strand breaks in double-stranded regions of the 23S rRNA component, but not in rRNA chain scission, and destabilization of the secondary structure of the 23S rRNA toward denaturation. The minimum doses of 253.7-nm radiation required for the first detection of the two effects are 7 x 10 19 quanta for the production of single-strand breaks in double-stranded regions of the 23S rRNA, and 19 quanta for destabilization of the 23S rRNA secondary structure. Free 23S rRNA is resistant toward photoinduced chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 and is much less sensitive toward destabilization of secondary structure than ribosome-bound 23S rRNA. In contrast to the photosensitivity of 50S ribosome-bound 23S rRNA toward chain breakage, 50S ribosome-bound 5S rRNA is resistant toward chain breakage at doses of 253.7-nm radiation up to at least 2.3 x 10 20 quanta. Ribosome-bound 5S and 23S rRNA are also not photosensitive toward intermolecular 5S/23S rRNA cross-linkage

  3. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins. (United States)

    Lin, A; McNally, J; Wool, I G


    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  4. Understanding Biases in Ribosome Profiling Experiments Reveals Signatures of Translation Dynamics in Yeast.

    Directory of Open Access Journals (Sweden)

    Jeffrey A Hussmann


    Full Text Available Ribosome profiling produces snapshots of the locations of actively translating ribosomes on messenger RNAs. These snapshots can be used to make inferences about translation dynamics. Recent ribosome profiling studies in yeast, however, have reached contradictory conclusions regarding the average translation rate of each codon. Some experiments have used cycloheximide (CHX to stabilize ribosomes before measuring their positions, and these studies all counterintuitively report a weak negative correlation between the translation rate of a codon and the abundance of its cognate tRNA. In contrast, some experiments performed without CHX report strong positive correlations. To explain this contradiction, we identify unexpected patterns in ribosome density downstream of each type of codon in experiments that use CHX. These patterns are evidence that elongation continues to occur in the presence of CHX but with dramatically altered codon-specific elongation rates. The measured positions of ribosomes in these experiments therefore do not reflect the amounts of time ribosomes spend at each position in vivo. These results suggest that conclusions from experiments in yeast using CHX may need reexamination. In particular, we show that in all such experiments, codons decoded by less abundant tRNAs were in fact being translated more slowly before the addition of CHX disrupted these dynamics.

  5. Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory. (United States)

    Suarez, Stéphanie; Ferroni, Agnès; Lotz, Aurélie; Jolley, Keith A; Guérin, Philippe; Leto, Julie; Dauphin, Brunhilde; Jamet, Anne; Maiden, Martin C J; Nassif, Xavier; Armengaud, Jean


    Whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) is a rapid method for identification of microorganisms that is increasingly used in microbiology laboratories. This identification is based on the comparison of the tested isolate mass spectrum with reference databases. Using Neisseria meningitidis as a model organism, we showed that in one of the available databases, the Andromas database, 10 of the 13 species-specific biomarkers correspond to ribosomal proteins. Remarkably, one biomarker, ribosomal protein L32, was subject to inter-strain variability. The analysis of the ribosomal protein patterns of 100 isolates for which whole genome sequences were available, confirmed the presence of inter-strain variability in the molecular weight of 29 ribosomal proteins, thus establishing a correlation between the sequence type (ST) and/or clonal complex (CC) of each strain and its ribosomal protein pattern. Since the molecular weight of three of the variable ribosomal proteins (L30, L31 and L32) was included in the spectral window observed by MALDI-TOF MS in clinical microbiology, i.e., 3640-12000 m/z, we were able by analyzing the molecular weight of these three ribosomal proteins to classify each strain in one of six subgroups, each of these subgroups corresponding to specific STs and/or CCs. Their detection by MALDI-TOF allows therefore a quick typing of N. meningitidis isolates. © 2013 Elsevier B.V. All rights reserved.

  6. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells. (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel


    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  7. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana. (United States)

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian


    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.

  8. A Numbers Game: Ribosome Densities, Bacterial Growth, and Antibiotic-Mediated Stasis and Death

    Directory of Open Access Journals (Sweden)

    Bruce R. Levin


    Full Text Available We postulate that the inhibition of growth and low rates of mortality of bacteria exposed to ribosome-binding antibiotics deemed bacteriostatic can be attributed almost uniquely to these drugs reducing the number of ribosomes contributing to protein synthesis, i.e., the number of effective ribosomes. We tested this hypothesis with Escherichia coli K-12 MG1655 and constructs that had been deleted for 1 to 6 of the 7 rRNA (rrn operons. In the absence of antibiotics, constructs with fewer rrn operons have lower maximum growth rates and longer lag phases than those with more ribosomal operons. In the presence of the ribosome-binding “bacteriostatic” antibiotics tetracycline, chloramphenicol, and azithromycin, E. coli strains with 1 and 2 rrn operons are killed at a substantially higher rate than those with more rrn operons. This increase in the susceptibility of E. coli with fewer rrn operons to killing by ribosome-targeting bacteriostatic antibiotics is not reflected in their greater sensitivity to killing by the bactericidal antibiotic ciprofloxacin, which does not target ribosomes, but also to killing by gentamicin, which does. Finally, when such strains are exposed to these ribosome-targeting bacteriostatic antibiotics, the time before these bacteria start to grow again when the drugs are removed, referred to as the post-antibiotic effect (PAE, is markedly greater for constructs with fewer rrn operons than for those with more rrn operons. We interpret the results of these other experiments reported here as support for the hypothesis that the reduction in the effective number of ribosomes due to binding to these structures provides a sufficient explanation for the action of bacteriostatic antibiotics that target these structures.

  9. Ribosomal trafficking is reduced in Schwann cells following induction of myelination

    Directory of Open Access Journals (Sweden)

    James M. Love


    Full Text Available Local synthesis of proteins within the Schwann cell periphery is extremely important for efficient process extension and myelination, when cells undergo dramatic changes in polarity and geometry. Still, it is unclear how ribosomal distributions are developed and maintained within Schwann cell projections to sustain local translation. In this multi-disciplinary study, we expressed a plasmid encoding a fluorescently labeled ribosomal subunit (L4-GFP in cultured primary rat Schwann cells. This enabled the generation of high-resolution, quantitative data on ribosomal distributions and trafficking dynamics within Schwann cells during early stages of myelination, induced by ascorbic acid treatment. Ribosomes were distributed throughout Schwann cell projections, with ~2-3 bright clusters along each projection. Clusters emerged within 1 day of culture and were maintained throughout early stages of myelination. Three days after induction of myelination, net ribosomal movement remained anterograde (directed away from the Schwann cell body, but ribosomal velocity decreased to about half the levels of the untreated group. Statistical and modeling analysis provided additional insight into key factors underlying ribosomal trafficking. Multiple regression analysis indicated that net transport at early time points was dependent on anterograde velocity, but shifted to dependence on anterograde duration at later time points. A simple, data-driven rate kinetics model suggested that the observed decrease in net ribosomal movement was primarily dictated by an increased conversion of anterograde particles to stationary particles, rather than changes in other directional parameters. These results reveal the strength of a combined experimental and theoretical approach in examining protein localization and transport, and provide evidence of an early establishment of ribosomal populations within Schwann cell projections with a reduction in trafficking following

  10. Mutations in ribosomal protein L3 and 23S ribosomal RNA at the peptidyl transferase centre are associated with reduced susceptibility to tiamulin in Brachyspira spp. isolates. (United States)

    Pringle, Märit; Poehlsgaard, Jacob; Vester, Birte; Long, Katherine S


    The pleuromutilin antibiotic tiamulin binds to the ribosomal peptidyl transferase centre. Three groups of Brachyspira spp. isolates with reduced tiamulin susceptibility were analysed to define resistance mechanisms to the drug. Mutations were identified in genes encoding ribosomal protein L3 and 23S rRNA at positions proximal to the peptidyl transferase centre. In two groups of laboratory-selected mutants, mutations were found at nucleotide positions 2032, 2055, 2447, 2499, 2504 and 2572 of 23S rRNA (Escherichia coli numbering) and at amino acid positions 148 and 149 of ribosomal protein L3 (Brachyspira pilosicoli numbering). In a third group of clinical B. hyodysenteriae isolates, only a single mutation at amino acid 148 of ribosomal protein L3 was detected. Chemical footprinting experiments show a reduced binding of tiamulin to ribosomal subunits from mutants with decreased susceptibility to the drug. This reduction in drug binding is likely the resistance mechanism for these strains. Hence, the identified mutations located near the tiamulin binding site are predicted to be responsible for the resistance phenotype. The positions of the mutated residues relative to the bound drug advocate a model where the mutations affect tiamulin binding indirectly through perturbation of nucleotide U2504.

  11. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria. (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G


    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  12. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs (United States)

    Delihas, N.; Fox, G. E.


    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  13. Purification and properties of a ribosomal casein kinase from rabbit reticulocytes

    DEFF Research Database (Denmark)

    Issinger, O G


    A casein kinase was isolated and purifed from rabbit reticulocytes. About 90% of the enzyme activity co-sedimented with the ribosomal fraction, whereas about 10% of the enzyme activity was found in the ribosome-free supernatant. Both casein kinases (the ribosome-bound enzyme as well as the free...... suggested that the casein kinase is a dimer composed of subunits of identical molecular weight. The enzyme utilizes GTP as well as ATP as a phosphoryl donor. It preferentially phosphorylates acidic proteins, in particular the model substrates casein and phosvitin. Casein kinase is cyclic AMP...

  14. RPS6KA2, a putative tumour suppressor gene at 6q27 in sporadic epithelial ovarian cancer

    DEFF Research Database (Denmark)

    Bignone, P A; Lee, K Y; Liu, Y


    We had previously defined by allele loss studies a minimal region at 6q27 (between D6S264 and D6S297) to contain a putative tumour suppressor gene. The p90 ribosomal S6 kinase-3 gene (p90 Rsk-3, RPS6KA2) maps in this interval. It is a serine-threonine kinase that signals downstream of the mitogen...

  15. Dietary ascorbic acid normalizes ribosomal efficiency for collagen production in skin of streptozotocin-induced diabetic rats

    International Nuclear Information System (INIS)

    Schneir, M.; Imberman, M.; Ramamurthy, N.; Golub, L.


    The objective of this study was to quantify the contribution of both ribosome amount and ribosomal efficiency to decreased collagen production in skin of diabetic rats and diabetic rats treated with dietary ascorbic acid. Male Sprague-Dawley rats were distributed equally into the following categories: non-diabetic controls; diabetics; ascorbic acid-treated diabetics. On day-20, all rats were injected with ( 3 H)proline and killed after 2 h. Absolute rate of collagen production, ribosome content, and ribosomal efficiency of collagen production were quantified. Also ribosomal efficiency was quantified for ribosomes in sucrose-gradient fractionated post-mitochondrial supernatants. The results indicate that decreased ribosomal efficiency was responsible for 70% of the decreased collagen production with 30% caused by decreased ribosome content, when measured for total skin or sucrose gradient-isolated ribosomes. At both levels of analysis, ascorbic acid treatment normalized ribosomal efficiency, indicating diabetes-mediated decreased ribosomal efficiency for collagen production is related to a co-translational event, such as procollagen underhydroxylation

  16. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family. (United States)

    Kimura, M; Kimura, J; Hatakeyama, T


    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  17. Inhibition of ribosomal RNA synthesis in yeast by ionizing radiations

    Energy Technology Data Exchange (ETDEWEB)

    Weber, K; Kiefer, J [Giessen Univ. (Germany, F.R.). Strahlenzentrum


    Synthesis of ribosomal RNA(r-RNA) was measured for 1 h after exposure of Saccharomyces cerevisiae to ..gamma..-rays, X-rays or ..cap alpha.. particles. ..gamma..- or X-ray induced transcription inhibition was always found to decrease exponentially with dose. D/sub 0/ values of 2150 or 1950 Gy were determined in wild-type cells, corresponding to a mean energy of about 60 eV per r-RNA gene. The finding of differential sensitivities of the two high molecular-weight r-RNA species which are cotranscribed from r-DNA is compatible with the existence of a transcription terminating mechanism. Cells from a mutant strain (rad-9), radiation sensitive to colony forming ability, showed an approximately equal sensitivity for transcription inhibition compared to the wild-type (D/sub 0/ (2095) = 2400 Gy). Inactivation of r-RNA synthesis in cells exposed to ..cap alpha..-particles at room-temperature showed a decreased sensitivity with higher particle fluences ('resistant tail'). This phenomenon was drastically reduced if the temperature during irradiation was lowered to 4/sup 0/C and completely abolished when dried cells were used. An inactivation cross-section for ..cap alpha..-particle induced transcription inhibition of about 0.02 2/ can be derived from the experimental data.

  18. Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach (United States)

    Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.


    In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.

  19. Automated genome mining of ribosomal peptide natural products

    Energy Technology Data Exchange (ETDEWEB)

    Mohimani, Hosein; Kersten, Roland; Liu, Wei; Wang, Mingxun; Purvine, Samuel O.; Wu, Si; Brewer, Heather M.; Pasa-Tolic, Ljiljana; Bandeira, Nuno; Moore, Bradley S.; Pevzner, Pavel A.; Dorrestein, Pieter C.


    Ribosomally synthesized and posttranslationally modified peptides (RiPPs), especially from microbial sources, are a large group of bioactive natural products that are a promising source of new (bio)chemistry and bioactivity (1). In light of exponentially increasing microbial genome databases and improved mass spectrometry (MS)-based metabolomic platforms, there is a need for computational tools that connect natural product genotypes predicted from microbial genome sequences with their corresponding chemotypes from metabolomic datasets. Here, we introduce RiPPquest, a tandem mass spectrometry database search tool for identification of microbial RiPPs and apply it for lanthipeptide discovery. RiPPquest uses genomics to limit search space to the vicinity of RiPP biosynthetic genes and proteomics to analyze extensive peptide modifications and compute p-values of peptide-spectrum matches (PSMs). We highlight RiPPquest by connection of multiple RiPPs from extracts of Streptomyces to their gene clusters and by the discovery of a new class III lanthipeptide, informatipeptin, from Streptomyces viridochromogenes DSM 40736 as the first natural product to be identified in an automated fashion by genome mining. The presented tool is available at

  20. Ribosome reinitiation at leader peptides increases translation of bacterial proteins. (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A


    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  1. Structure of the quaternary complex between SRP, SR, and translocon bound to the translating ribosome. (United States)

    Jomaa, Ahmad; Fu, Yu-Hsien Hwang; Boehringer, Daniel; Leibundgut, Marc; Shan, Shu-Ou; Ban, Nenad


    During co-translational protein targeting, the signal recognition particle (SRP) binds to the translating ribosome displaying the signal sequence to deliver it to the SRP receptor (SR) on the membrane, where the signal peptide is transferred to the translocon. Using electron cryo-microscopy, we have determined the structure of a quaternary complex of the translating Escherichia coli ribosome, the SRP-SR in the 'activated' state and the translocon. Our structure, supported by biochemical experiments, reveals that the SRP RNA adopts a kinked and untwisted conformation to allow repositioning of the 'activated' SRP-SR complex on the ribosome. In addition, we observe the translocon positioned through interactions with the SR in the vicinity of the ribosome exit tunnel where the signal sequence is extending beyond its hydrophobic binding groove of the SRP M domain towards the translocon. Our study provides new insights into the mechanism of signal sequence transfer from the SRP to the translocon.

  2. Generation of monoclonal antibodies for the assessment of protein purification by recombinant ribosomal coupling

    DEFF Research Database (Denmark)

    Kristensen, Janni; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk


    We recently described a conceptually novel method for the purification of recombinant proteins with a propensity to form inclusion bodies in the cytoplasm of Escherichia coli. Recombinant proteins were covalently coupled to the E. coli ribosome by fusing them to ribosomal protein 23 (rpL23...... therefore purified rpL23-GFP-His, rpL23-His and GFP from E. coli recombinants using affinity, ion exchange and hydrophobic interaction chromatography. These proteins could be purified with yields of 150, 150 and 1500 microg per gram cellular wet weight, respectively. However, rpL23-GFP-His could only...... proteolytic cleavage sites. We conclude that the generated antibodies can be used to evaluate ribosomal coupling of recombinant target proteins as well as the efficiency of their separation from the ribosome....

  3. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    DEFF Research Database (Denmark)

    Østrup, Olga; Hyttel, Poul; Klærke, Dan Arne


    Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression....... This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling...... and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation...

  4. Mitochondrial ribosomal protein S18-2 evokes chromosomal instability and transforms primary rat skin fibroblasts

    KAUST Repository

    Kashuba, Elena; Carbone, Ennio; Di Fabrizio, Enzo M.; Tirinato, Luca; Petruchek, Maria; Drummond, Catherine; Kovalevska, Larysa; Gurrapu, Sreeharsha; Mushtaq, Muhammad; Darekar, Suhas D.


    We have shown earlier that overexpression of the human mitochondrial ribosomal protein MRPS18-2 (S18-2) led to immortalization of primary rat embryonic fibroblasts. The derived cells expressed the embryonic stem cell markers, and cellular pathways

  5. Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding. (United States)

    Sandikci, Arzu; Gloge, Felix; Martinez, Michael; Mayer, Matthias P; Wade, Rebecca; Bukau, Bernd; Kramer, Günter


    Newly synthesized polypeptides undergo various cotranslational maturation steps, including N-terminal enzymatic processing, chaperone-assisted folding and membrane targeting, but the spatial and temporal coordination of these steps is unclear. We show that Escherichia coli methionine aminopeptidase (MAP) associates with ribosomes through a charged loop that is crucial for nascent-chain processing and cell viability. MAP competes with peptide deformylase (PDF), the first enzyme to act on nascent chains, for binding sites at the ribosomal tunnel exit. PDF has extremely fast association and dissociation kinetics, which allows it to frequently sample ribosomes and ensure the processing of nascent chains after their emergence. Premature recruitment of the chaperone trigger factor, or polypeptide folding, negatively affect processing efficiency. Thus, the fast ribosome association kinetics of PDF and MAP are crucial for the temporal separation of nascent-chain processing from later maturation events, including chaperone recruitment and folding.

  6. Probing the structure of ribosome assembly intermediates in vivo using DMS and hydroxyl radical footprinting. (United States)

    Hulscher, Ryan M; Bohon, Jen; Rappé, Mollie C; Gupta, Sayan; D'Mello, Rhijuta; Sullivan, Michael; Ralston, Corie Y; Chance, Mark R; Woodson, Sarah A


    The assembly of the Escherichia coli ribosome has been widely studied and characterized in vitro. Despite this, ribosome biogenesis in living cells is only partly understood because assembly is coupled with transcription, modification and processing of the pre-ribosomal RNA. We present a method for footprinting and isolating pre-rRNA as it is synthesized in E. coli cells. Pre-rRNA synthesis is synchronized by starvation, followed by nutrient upshift. RNA synthesized during outgrowth is metabolically labeled to facilitate isolation of recent transcripts. Combining this technique with two in vivo RNA probing methods, hydroxyl radical and DMS footprinting, allows the structure of nascent RNA to be probed over time. Together, these can be used to determine changes in the structures of ribosome assembly intermediates as they fold in vivo. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Ribosomal mutations promote the evolution of antibiotic resistance in a multidrug environment. (United States)

    Gomez, James E; Kaufmann-Malaga, Benjamin B; Wivagg, Carl N; Kim, Peter B; Silvis, Melanie R; Renedo, Nikolai; Ioerger, Thomas R; Ahmad, Rushdy; Livny, Jonathan; Fishbein, Skye; Sacchettini, James C; Carr, Steven A; Hung, Deborah T


    Antibiotic resistance arising via chromosomal mutations is typically specific to a particular antibiotic or class of antibiotics. We have identified mutations in genes encoding ribosomal components in Mycobacterium smegmatis that confer resistance to several structurally and mechanistically unrelated classes of antibiotics and enhance survival following heat shock and membrane stress. These mutations affect ribosome assembly and cause large-scale transcriptomic and proteomic changes, including the downregulation of the catalase KatG, an activating enzyme required for isoniazid sensitivity, and upregulation of WhiB7, a transcription factor involved in innate antibiotic resistance. Importantly, while these ribosomal mutations have a fitness cost in antibiotic-free medium, in a multidrug environment they promote the evolution of high-level, target-based resistance. Further, suppressor mutations can then be easily acquired to restore wild-type growth. Thus, ribosomal mutations can serve as stepping-stones in an evolutionary path leading to the emergence of high-level, multidrug resistance.

  8. Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation (United States)

    Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.


    Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435

  9. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation. (United States)

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C


    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position.

  10. Huaier Extract Induces Autophagic Cell Death by Inhibiting the mTOR/S6K Pathway in Breast Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Xiaolong Wang

    Full Text Available Huaier extract is attracting increased attention due to its biological activities, including antitumor, anti-parasite and immunomodulatory effects. Here, we investigated the role of autophagy in Huaier-induced cytotoxicity in MDA-MB-231, MDA-MB-468 and MCF7 breast cancer cells. Huaier treatment inhibited cell viability in all three cell lines and induced various large membranous vacuoles in the cytoplasm. In addition, electron microscopy, MDC staining, accumulated expression of autophagy markers and flow cytometry revealed that Huaier extract triggered autophagy. Inhibition of autophagy attenuated Huaier-induced cell death. Furthermore, Huaier extract inhibited the mammalian target of the rapamycin (mTOR/S6K pathway in breast cancer cells. After implanting MDA-MB-231 cells subcutaneously into the right flank of BALB/c nu/nu mice, Huaier extract induced autophagy and effectively inhibited xenograft tumor growth. This study is the first to show that Huaier-induced cytotoxicity is partially mediated through autophagic cell death in breast cancer cells through suppression of the mTOR/S6K pathway.

  11. Comments on the symmetry of AdS6 solutions in string/M-theory and Killing spinor equations

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim


    Full Text Available It was recently pointed out in [1] that AdS6 solutions in IIB theory enjoy an extended symmetry structure and the consistent truncation to D=4 internal space leads to a nonlinear sigma model with target SL(3,R/SO(2,1. We continue to study the purely bosonic D=4 effective action, and elucidate how the addition of scalar potential term still allows Killing spinor equations in the absence of gauge fields. In particular, the potential turns out to be a single diagonal component of the coset representative. Furthermore, we perform a general analysis of the integrability conditions of Killing spinor equations and establish that the effective action can be in fact generalized to arbitrary sizes and signatures, e.g. with target SL(n,R/SO(p,n−p and the scalar potential expressible by a single diagonal component of the coset representative. We also comment on a similar construction and its generalizations of effective D=5 purely bosonic non-linear sigma model action related to AdS6 in M-theory.

  12. Low Amount of Salinomycin Greatly Increases Akt Activation, but Reduces Activated p70S6K Levels

    Directory of Open Access Journals (Sweden)

    Sungpil Yoon


    Full Text Available The present study identified a novel salinomycin (Sal-sensitization mechanism in cancer cells. We analyzed the signal proteins Akt, Jnk, p38, Jak, and Erk1/2 in cancer cell lines that had arrested growth following low amounts of Sal treatment. We also tested the signal molecules PI3K, PDK1, GSK3β, p70S6K, mTOR, and PTEN to analyze the PI3K/Akt/mTOR pathway. The results showed that Sal sensitization positively correlates with large reductions in p70S6K activation. Interestingly, Akt was the only signal protein to be significantly activated by Sal treatment. The Akt activation appeared to require the PI3K pathway as its activation was abolished by the PI3K inhibitors LY294002 and wortmannin. The Akt activation by Sal was conserved in the other cell lines analyzed, which originated from other organs. Both Akt activation and C-PARP production were proportionally increased with increased doses of Sal. In addition, the increased levels of pAkt were not reduced over the time course of the experiment. Co-treatment with Akt inhibitors sensitized the Sal-treated cancer cells. The results thereby suggest that Akt activation is increased in cells that survive Sal treatment and resist the cytotoxic effect of Sal. Taken together; these results indicate that Akt activation may promote the resistance of cancer cells to Sal.

  13. The ribosome uses two active mechanisms to unwind messenger RNA during translation. (United States)

    Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio


    The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved

  14. Kinase-Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer (United States)


    and will assess if this resistance involves gain-of-function mutations in Ltv1, and if resistance can be overcome with drugs that direct...ribosome assembly factor Ltv1 in both yeast and TNBC cells, and that selective knockdown or silencing of CK1δ, or forced expression of Ltv1 mutant that...cannot be phosphorylated by CK1δ, blocks ribosome assembly in yeast and compromises the growth and survival of TNBC cells. Further, we have shown that

  15. A conserved chloramphenicol binding site at the entrance to the ribosomal peptide exit tunnel

    DEFF Research Database (Denmark)

    Long, Katherine S; Porse, Bo T


    , of E.coli 23S rRNA and G2084 (2058 in E.coli numbering) in domain V of H.halobium 23S rRNA. The modification sites overlap with a portion of the macrolide binding site and cluster at the entrance to the peptide exit tunnel. The data correlate with the recently reported chloramphenicol binding site...... on an archaeal ribosome and suggest that a similar binding site is present on the E.coli ribosome....

  16. Production of RNA-protein cross links in γ irradiated E. Coli ribosomes

    International Nuclear Information System (INIS)

    Ekert, Bernard; Giocanti, Nicole


    γ irradiation in de-aerated conditions of E. coli MRE 600 ribosomes, labelled with 14 C uracil, leads to a decrease of extractibility of 14 C RNA by lithium chloride 4 M-urea 8 M. On the other hand, the radioactivity of the protein fraction increases with irradiation. These results strongly suggest that RNA-protein cross links are formed in irradiated ribosomes [fr

  17. Evidence for alteration of the membrane-bound ribosomes in Micrococcus luteus cells exposed to lead

    Energy Technology Data Exchange (ETDEWEB)

    Barrow, W; Himmel, M; Squire, P G; Tornabene, T G


    Micrococcus luteus cells exposed to Pb(NO/sub 3/)/sub 2/ contained cytosol ribosomal particles and disaggregated membranal ribosomal particles as determined by ultracentrifugation and spectral studies. Approximately 60% of the membrane ribosome fraction from lead exposed cells had a sedimentation value of 8.4S. Cytosol ribosome from lead exposed cells as well as membranal and cytosol ribosomes from control cells were comparable by their contents of predominantly the 70S type with the 50S and 100S present in relatively small amounts. The lead content of the 8.4S components was more than 200 times higher than the components with higher sedimentation coefficients from lead exposed cells and approximately 650 times more than that of control cell ribosomes. The cells exposed to lead, however, showed no adverse effects from the lead in respect to their growth rates and cellular yields. These results indicate that lead is interacting only at specific sites of the membrane and is inducing events initiated only in strategic cellular regions. These data further substantiate that subtle changes do occur in lead exposed cells that show no obvious effects. It is assumed that these minor alterations are, in toto, biologically significant. 24 references, 2 figures, 1 table.

  18. The complete structure of the large subunit of the mammalian mitochondrial ribosome. (United States)

    Greber, Basil J; Boehringer, Daniel; Leibundgut, Marc; Bieri, Philipp; Leitner, Alexander; Schmitz, Nikolaus; Aebersold, Ruedi; Ban, Nenad


    Mitochondrial ribosomes (mitoribosomes) are extensively modified ribosomes of bacterial descent specialized for the synthesis and insertion of membrane proteins that are critical for energy conversion and ATP production inside mitochondria. Mammalian mitoribosomes, which comprise 39S and 28S subunits, have diverged markedly from the bacterial ribosomes from which they are derived, rendering them unique compared to bacterial, eukaryotic cytosolic and fungal mitochondrial ribosomes. We have previously determined at 4.9 Å resolution the architecture of the porcine (Sus scrofa) 39S subunit, which is highly homologous to the human mitoribosomal large subunit. Here we present the complete atomic structure of the porcine 39S large mitoribosomal subunit determined in the context of a stalled translating mitoribosome at 3.4 Å resolution by cryo-electron microscopy and chemical crosslinking/mass spectrometry. The structure reveals the locations and the detailed folds of 50 mitoribosomal proteins, shows the highly conserved mitoribosomal peptidyl transferase active site in complex with its substrate transfer RNAs, and defines the path of the nascent chain in mammalian mitoribosomes along their idiosyncratic exit tunnel. Furthermore, we present evidence that a mitochondrial tRNA has become an integral component of the central protuberance of the 39S subunit where it architecturally substitutes for the absence of the 5S ribosomal RNA, a ubiquitous component of all cytoplasmic ribosomes.

  19. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress. (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J


    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Could a Proto-Ribosome Emerge Spontaneously in the Prebiotic World?

    Directory of Open Access Journals (Sweden)

    Ilana C. Agmon


    Full Text Available An indispensable prerequisite for establishing a scenario of life emerging by natural processes is the requirement that the first simple proto-molecules could have had a realistic probability of self-assembly from random molecular polymers in the prebiotic world. The vestige of the proto-ribosome, which is believed to be still embedded in the contemporary ribosome, is used to assess the feasibility of such spontaneous emergence. Three concentric structural elements of different magnitudes, having a dimeric nature derived from the symmetrical region of the ribosomal large subunit, were suggested to constitute the vestige of the proto-ribosome. It is assumed to have materialized spontaneously in the prebiotic world, catalyzing non-coded peptide bond formation and simple elongation. Probabilistic and energetic considerations are applied in order to evaluate the suitability of the three contenders for being the initial proto-ribosome. The analysis points to the simplest proto-ribosome, comprised of a dimer of tRNA-like molecules presently embedded in the core of the symmetrical region, as the only one having a realistic statistical likelihood of spontaneous emergence from random RNA chains. Hence it offers a feasible starting point for a continuous evolutionary path from the prebiotic matter, through natural processes, into the intricate modern translation system.

  1. Trans-kingdom mimicry underlies ribosome customization by a poxvirus kinase. (United States)

    Jha, Sujata; Rollins, Madeline G; Fuchs, Gabriele; Procter, Dean J; Hall, Elizabeth A; Cozzolino, Kira; Sarnow, Peter; Savas, Jeffrey N; Walsh, Derek


    Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we report that a poxvirus kinase phosphorylates serine/threonine residues in the human small ribosomal subunit protein, receptor for activated C kinase (RACK1), that are not phosphorylated in uninfected cells or cells infected by other viruses. These modified residues cluster in an extended loop in RACK1, phosphorylation of which selects for translation of viral or reporter mRNAs with 5' untranslated regions that contain adenosine repeats, so-called polyA-leaders. Structural and phylogenetic analyses revealed that although RACK1 is highly conserved, this loop is variable and contains negatively charged amino acids in plants, in which these leaders act as translational enhancers. Phosphomimetics and inter-species chimaeras have shown that negative charge in the RACK1 loop dictates ribosome selectivity towards viral RNAs. By converting human RACK1 to a charged, plant-like state, poxviruses remodel host ribosomes so that adenosine repeats erroneously generated by slippage of the viral RNA polymerase confer a translational advantage. Our findings provide insight into ribosome customization through trans-kingdom mimicry and the mechanics of species-specific leader activity that underlie poxvirus polyA-leaders.

  2. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome. (United States)

    Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel


    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.

  3. Diverse Regulators of Human Ribosome Biogenesis Discovered by Changes in Nucleolar Number

    Directory of Open Access Journals (Sweden)

    Katherine I. Farley-Barnes


    Full Text Available Ribosome biogenesis is a highly regulated, essential cellular process. Although studies in yeast have established some of the biological principles of ribosome biogenesis, many of the intricacies of its regulation in higher eukaryotes remain unknown. To understand how ribosome biogenesis is globally integrated in human cells, we conducted a genome-wide siRNA screen for regulators of nucleolar number. We found 139 proteins whose depletion changed the number of nucleoli per nucleus from 2–3 to only 1 in human MCF10A cells. Follow-up analyses on 20 hits found many (90% to be essential for the nucleolar functions of rDNA transcription (7, pre-ribosomal RNA (pre-rRNA processing (16, and/or global protein synthesis (14. This genome-wide analysis exploits the relationship between nucleolar number and function to discover diverse cellular pathways that regulate the making of ribosomes and paves the way for further exploration of the links between ribosome biogenesis and human disease.

  4. Miscoding-induced stalling of substrate translocation on the bacterial ribosome. (United States)

    Alejo, Jose L; Blanchard, Scott C


    Directional transit of the ribosome along the messenger RNA (mRNA) template is a key determinant of the rate and processivity of protein synthesis. Imaging of the multistep translocation mechanism using single-molecule FRET has led to the hypothesis that substrate movements relative to the ribosome resolve through relatively long-lived late intermediates wherein peptidyl-tRNA enters the P site of the small ribosomal subunit via reversible, swivel-like motions of the small subunit head domain within the elongation factor G (GDP)-bound ribosome complex. Consistent with translocation being rate-limited by recognition and productive engagement of peptidyl-tRNA within the P site, we now show that base-pairing mismatches between the peptidyl-tRNA anticodon and the mRNA codon dramatically delay this rate-limiting, intramolecular process. This unexpected relationship between aminoacyl-tRNA decoding and translocation suggests that miscoding antibiotics may impact protein synthesis by impairing the recognition of peptidyl-tRNA in the small subunit P site during EF-G-catalyzed translocation. Strikingly, we show that elongation factor P (EF-P), traditionally known to alleviate ribosome stalling at polyproline motifs, can efficiently rescue translocation defects arising from miscoding. These findings help reveal the nature and origin of the rate-limiting steps in substrate translocation on the bacterial ribosome and indicate that EF-P can aid in resuming translation elongation stalled by miscoding errors.

  5. Organization of proteins in mammalian mitochondrial ribosomes: accessibility to lactoperoxidase-catalyzed radioiodination

    International Nuclear Information System (INIS)

    Denslow, N.D.; O'Brien, T.W.


    To assess the relative exposure of individual ribosomal proteins (r-proteins) in the large and small subunits of the bovine mitochondrial ribosome, double label iodination technique was used. Regions of r-proteins exposed in purified ribosomal subunits were labeled with 131 I using the lactoperoxidase-catalyzed iodination system, and additional reactive groups available upon denaturing the r-proteins in urea were labeled with 125 I using the chloramine-T mediated reaction. The ratio of 131 I to 125 I incorporated into individual proteins under these conditions is representative of the degree of exposure for each of the proteins in the subunits. In this manner, the r-proteins have been grouped into 3 classes depending on their degree of exposure: high exposure, intermediate exposure, and essentially buried. While both subunits have a few proteins in the highly exposed group, and a large number of proteins in the intermediate exposure group, only the large ribosomal subunit has an appreciable number of proteins which appear essentially buried. The more buried proteins may serve mainly structural roles, perhaps acting as assembly proteins, since many from this group bind to ribosomal RNA. The more superficially disposed proteins may comprise binding sites for macromolecules that interact with ribosomes during protein synthesis, as well as stabilizing the association of the large and small subribosomal particles

  6. Ribosomal and hematopoietic defects in induced pluripotent stem cells derived from Diamond Blackfan anemia patients. (United States)

    Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J


    Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.

  7. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence (United States)

    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros


    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differences in the function and structure of isolated ribosomes which were assembled in the presence of linezolid. The catalytic activity of peptidyltransferase was found to be significantly higher in the ribosomes derived from the linezolid-dependent strain. Interestingly, the same ribosomes exhibited an abnormal ribosomal subunit dissociation profile on a sucrose gradient in the absence of linezolid, but the profile was restored after treatment of the ribosomes with an excess of the antibiotic. Our study suggests that linezolid most likely modified the ribosomal assembly procedure, leading to a new functional ribosomal population active only in the presence of linezolid. Therefore, the higher growth rate of the partially linezolid-dependent strains could be attributed to the functional and structural adaptations of ribosomes to linezolid. PMID:24890589

  8. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease. (United States)

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J


    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).

  9. Dual binding mode of the nascent polypeptide-associated complex reveals a novel universal adapter site on the ribosome. (United States)

    Pech, Markus; Spreter, Thomas; Beckmann, Roland; Beatrix, Birgitta


    Nascent polypeptide-associated complex (NAC) was identified in eukaryotes as the first cytosolic factor that contacts the nascent polypeptide chain emerging from the ribosome. NAC is present as a homodimer in archaea and as a highly conserved heterodimer in eukaryotes. Mutations in NAC cause severe embryonically lethal phenotypes in mice, Drosophila melanogaster, and Caenorhabditis elegans. In the yeast Saccharomyces cerevisiae NAC is quantitatively associated with ribosomes. Here we show that NAC contacts several ribosomal proteins. The N terminus of betaNAC, however, specifically contacts near the tunnel exit ribosomal protein Rpl31, which is unique to eukaryotes and archaea. Moreover, the first 23 amino acids of betaNAC are sufficient to direct an otherwise non-associated protein to the ribosome. In contrast, alphaNAC (Egd2p) contacts Rpl17, the direct neighbor of Rpl31 at the ribosomal tunnel exit site. Rpl31 was also recently identified as a contact site for the SRP receptor and the ribosome-associated complex. Furthermore, in Escherichia coli peptide deformylase (PDF) interacts with the corresponding surface area on the eubacterial ribosome. In addition to the previously identified universal adapter site represented by Rpl25/Rpl35, we therefore refer to Rpl31/Rpl17 as a novel universal docking site for ribosome-associated factors on the eukaryotic ribosome.

  10. Inhibition of Early Stages of HIV-1 Assembly by INI1/hSNF5 Transdominant Negative Mutant S6 (United States)

    Cano, Jennifer; Kalpana, Ganjam V.


    INI1/hSNF5 is an HIV-1 integrase (IN) binding protein specifically incorporated into virions. A truncated mutant of INI1 (S6, amino acids 183 to 294) harboring the minimal IN binding Rpt1 domain potently inhibits HIV-1 particle production in a transdominant manner. The inhibition requires interaction of S6 with IN within Gag-Pol. While INI1 is a nuclear protein and harbors a masked nuclear export signal (NES), the transdominant negative mutant S6 is cytoplasmic, due to the unmasking of NES. Here, we examined the effects of subcellular localization of S6 on HIV-1 inhibition and further investigated the stages of assembly that are affected. We found that targeting a nuclear localization signal-containing S6 variant [NLS-S6(Rpt1)] to the nucleoplasm (but not to the nucleolus) resulted in complete reversal of inhibition of particle production. Electron microscopy indicated that although no electron-dense particles at any stage of assembly were seen in cells expressing S6, virions were produced in cells expressing the rescue mutant NLS-S6(Rpt1) to wild-type levels. Immunofluorescence analysis revealed that p24 exhibited a diffuse pattern of localization within the cytoplasm in cells expressing S6 in contrast to accumulation along the membrane in controls. Pulse-chase analysis indicated that in S6-expressing cells, although Gag(Pr55gag) protein translation was unaffected, processing and release of p24 were defective. Together, these results indicate that expression of S6 in the cytoplasm interferes with trafficking of Gag-Pol/Gag to the membrane and causes a defective processing leading to inhibition of assembly at an early stage prior to particle formation and budding. PMID:21159874

  11. C-IOP/NiO/Ni7S6 composite with the inverse opal lattice as an electrode for supercapacitors (United States)

    Sukhinina, Nadezhda S.; Masalov, Vladimir M.; Zhokhov, Andrey A.; Zverkova, Irina I.; Emelchenko, Gennadi A.


    In this work, we demonstrate the results of studies on the synthesis, the structure and properties of carbon inverted opal (C-IOP) nanostructures, the surface of which is modified by oxide and sulfide of nickel. It is shown that the modification of the matrix C-IOP by nickel compounds led to a decreasing the specific surface area more than three times and was 250 m2/g. The specific capacitance of the capacitor with the C-IOP/NiO/Ni7S6 composite as electrode has increased more than 4 times, from 130 F/g to 600 F/g, as compared with the sample C-IOP without the modification by nickel compounds. The significant contribution of the faradaic reactions in specific capacitance of the capacitor electrodes of the composites is marked.

  12. Insulin and TOR signal in parallel through FOXO and S6K to promote epithelial wound healing (United States)

    Kakanj, Parisa; Moussian, Bernard; Grönke, Sebastian; Bustos, Victor; Eming, Sabine A.; Partridge, Linda; Leptin, Maria


    The TOR and Insulin/IGF signalling (IIS) network controls growth, metabolism and ageing. Although reducing TOR or insulin signalling can be beneficial for ageing, it can be detrimental for wound healing, but the reasons for this difference are unknown. Here we show that IIS is activated in the cells surrounding an epidermal wound in Drosophila melanogaster larvae, resulting in PI3K activation and redistribution of the transcription factor FOXO. Insulin and TOR signalling are independently necessary for normal wound healing, with FOXO and S6K as their respective effectors. IIS is specifically required in cells surrounding the wound, and the effect is independent of glycogen metabolism. Insulin signalling is needed for the efficient assembly of an actomyosin cable around the wound, and constitutively active myosin II regulatory light chain suppresses the effects of reduced IIS. These findings may have implications for the role of insulin signalling and FOXO activation in diabetic wound healing. PMID:27713427

  13. Differential extracellular signal-regulated kinases 1 and 2 activation by the angiotensin type 1 receptor supports distinct phenotypes of cardiac myocytes

    DEFF Research Database (Denmark)

    Aplin, Mark; Christensen, Gitte Lund; Schneider, Mikael


    that phosphorylates p90 Ribosomal S6 Kinase, a ubiquitous and versatile mediator of ERK1/2 signal transduction. Moreover, the beta-arrestin2-dependent ERK1/2 signal supports intact proliferation of cardiac myocytes. In contrast to G(q)-activated ERK1/2, and in keeping with its failure to translocate to the nucleus...

  14. Ribosomal proteins L11 and L10.(L12)4 and the antibiotic thiostrepton interact with overlapping regions of the 23 S rRNA backbone in the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Rosendahl, G; Douthwaite, S


    RNA, and to investigate how this interaction is influenced by other ribosomal components. Complexes were characterized in both naked 23 S rRNA and ribosomes from an E. coli L11-minus strain, before and after reconstitution with L11. The protein protects 17 riboses between positions 1058 and 1085 in the naked 23 S r......The Escherichia coli ribosomal protein (r-protein) L11 and its binding site on 23 S ribosomal RNA (rRNA) are associated with ribosomal hydrolysis of guanosine 5'-triphosphate (GTP). We have used hydroxyl radical footprinting to map the contacts between L11 and the backbone riboses in 23 S r......)4 and other proteins within the ribosome. The antibiotics thiostrepton and micrococcin inhibit the catalytic functions of this region by slotting in between the accessible loops and interacting with nucleotides there....

  15. TOR and S6K1 promote translation reinitiation of uORF-containing mRNAs via phosphorylation of eIF3h. (United States)

    Schepetilnikov, Mikhail; Dimitrova, Maria; Mancera-Martínez, Eder; Geldreich, Angèle; Keller, Mario; Ryabova, Lyubov A


    Mammalian target-of-rapamycin (mTOR) triggers S6 kinase (S6K) activation to phosphorylate targets linked to translation in response to energy, nutrients, and hormones. Pathways of TOR activation in plants remain unknown. Here, we uncover the role of the phytohormone auxin in TOR signalling activation and reinitiation after upstream open reading frame (uORF) translation, which in plants is dependent on translation initiation factor eIF3h. We show that auxin triggers TOR activation followed by S6K1 phosphorylation at T449 and efficient loading of uORF-mRNAs onto polysomes in a manner sensitive to the TOR inhibitor Torin-1. Torin-1 mediates recruitment of inactive S6K1 to polysomes, while auxin triggers S6K1 dissociation and recruitment of activated TOR instead. A putative target of TOR/S6K1-eIF3h-is phosphorylated and detected in polysomes in response to auxin. In TOR-deficient plants, polysomes were prebound by inactive S6K1, and loading of uORF-mRNAs and eIF3h was impaired. Transient expression of eIF3h-S178D in plant protoplasts specifically upregulates uORF-mRNA translation. We propose that TOR functions in polysomes to maintain the active S6K1 (and thus eIF3h) phosphorylation status that is critical for translation reinitiation.

  16. Absence of the kinase S6k1 mimics the effect of chronic endurance exercise on glucose tolerance and muscle oxidative stress

    Directory of Open Access Journals (Sweden)

    C. Binsch


    Conclusions: In high-fat fed mice, loss of S6K1 mimics endurance exercise training by reducing mitochondrial ROS production and upregulating oxidative utilization of ketone bodies. Pharmacological targeting of S6K1 may improve the outcome of exercise-based interventions in obesity and diabetes.

  17. Novel mRNA-specific effects of ribosome drop-off on translation rate and polysome profile.

    Directory of Open Access Journals (Sweden)

    Pierre Bonnin


    Full Text Available The well established phenomenon of ribosome drop-off plays crucial roles in translational accuracy and nutrient starvation responses during protein translation. When cells are under stress conditions, such as amino acid starvation or aminoacyl-tRNA depletion due to a high level of recombinant protein expression, ribosome drop-off can substantially affect the efficiency of protein expression. Here we introduce a mathematical model that describes the effects of ribosome drop-off on the ribosome density along the mRNA and on the concomitant protein synthesis rate. Our results show that ribosome premature termination may lead to non-intuitive ribosome density profiles, such as a ribosome density which increases from the 5' to the 3' end. Importantly, the model predicts that the effects of ribosome drop-off on the translation rate are mRNA-specific, and we quantify their resilience to drop-off, showing that the mRNAs which present ribosome queues are much less affected by ribosome drop-off than those which do not. Moreover, among those mRNAs that do not present ribosome queues, resilience to drop-off correlates positively with the elongation rate, so that sequences using fast codons are expected to be less affected by ribosome drop-off. This result is consistent with a genome-wide analysis of S. cerevisiae, which reveals that under favourable growth conditions mRNAs coding for proteins involved in the translation machinery, known to be highly codon biased and using preferentially fast codons, are highly resilient to ribosome drop-off. Moreover, in physiological conditions, the translation rate of mRNAs coding for regulatory, stress-related proteins, is less resilient to ribosome drop-off. This model therefore allows analysis of variations in the translational efficiency of individual mRNAs by accounting for the full range of known ribosome behaviours, as well as explaining mRNA-specific variations in ribosome density emerging from ribosome profiling

  18. Ribosomal binding region for the antibiotic tiamulin: stoichiometry, subunit location, and affinity for various analogs. (United States)

    Högenauer, G; Ruf, C


    Equilibrium dialysis experiments with a highly purified preparation of labeled tiamulin, a semisynthetic derivative of the antibiotic pleuromutilin, and Escherichia coli ribosomes allowed the determination of two binding sites for the drug. The binding reaction showed a cooperative effect. Of the two subunits, the 50S particle was able to bind the antibiotic in a 1:1 stoichiometry. Hence, the 50S subunit contributed predominantly to the binding energy which held the antibiotic to the ribosomes. The 30S subunit, showing no strong affinity for the drug, may be needed for the generation of the second binding site in the 70S particle. If depleted of ammonium ions, 70S ribosomes lost their binding capacity for the antibiotic. The attachment sites for tiamulin could be restored by heating the ribosomes to 40 degrees C in the presence of either ammonium ions or the antibiotic. Other pleuromutilin derivatives displaced labeled tiamulin from its ribosomal binding sites. By quantifying this competition, the relative affinity of various pleuromutilin derivatives for E. coli ribosomes was determined. The binding correlated with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations of these compounds against E. coli. When compared with the minimal inhibitory concentrations against E. coli. When compared with the minimal inhibitory concentrations against Staphylococcus aureus, the correlation was less strict, but the same trend prevailed. These results suggest that the antibacterial activities of various pleuromutilin derivatives on a given test organism are mainly determined by the strength of binding to the ribosomes within the bacterial cell. PMID:6751216

  19. The 70S ribosome modulates the ATPase activity of Escherichia coli YchF. (United States)

    Becker, Marion; Gzyl, Katherine E; Altamirano, Alvin M; Vuong, Anthony; Urban, Kirstin; Wieden, Hans-Joachim


    YchF is one of two universally conserved GTPases with unknown cellular function. As a first step toward elucidating YchF's cellular role, we performed a detailed biochemical characterization of the protein from Escherichia coli. Our data from fluorescence titrations not only confirmed the surprising finding that YchFE.coli binds adenine nucleotides more efficiently than guanine nucleotides, but also provides the first evidence suggesting that YchF assumes two distinct conformational states (ATP- and ADP-bound) consistent with the functional cycle of a typical GTPase. Based on an in vivo pull-down experiment using a His-tagged variant of YchF from E. coli (YchFE.coli), we were able to isolate a megadalton complex containing the 70S ribosome. Based on this finding, we report the successful reconstitution of a YchF•70S complex in vitro, revealing an affinity (KD) of the YchFE.coli•ADPNP complex for 70S ribosomes of 3 μM. The in vitro reconstitution data also suggests that the identity of the nucleotide-bound state of YchF (ADP or ATP) modulates its affinity for 70S ribosomes. A detailed Michaelis-Menten analysis of YchF's catalytic activity in the presence and the absence of the 70S ribosome and its subunits revealed for the first time that the 70S ribosome is able to stimulate YchF's ATPase activity (~10-fold), confirming the ribosome as part of the functional cycle of YchF. Our findings taken together with previously reported data for the human homolog of YchF (hOLA1) indicate a high level of evolutionary conservation in the enzymatic properties of YchF and suggest that the ribosome is the main functional partner of YchF not only in bacteria.

  20. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction (United States)

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.


    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  1. Synthesis and methylation of ribosomal RNA in HeLa cells infected with the herpes virus pseudorabies virus

    International Nuclear Information System (INIS)

    Furlong, J.C.; Kyriakidis, S.; Stevely, W.S.


    The effects of infection with the herpes virus pseudorabies virus on the metabolism of HeLa cell ribosomal RNA were examined. There is a decline both in the synthesis of nucleolar 45S ribosomal precursor RNA and in its processing to mature cytoplasmic RNA. The methylated oligonucleotides in the ribosomal RNA species were studied. The methylation of cytoplasmic ribosomal RNA was essentially unchanged. However there was some undermethylation of the nucleolar precursor. If undermethylated RNA does not mature then this may partly explain the reduced processing in the infected cells. (Author)

  2. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar


    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  3. Structural insights into methyltransferase KsgA function in 30S ribosomal subunit biogenesis. (United States)

    Boehringer, Daniel; O'Farrell, Heather C; Rife, Jason P; Ban, Nenad


    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3'-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation.

  4. Structural Insights into Methyltransferase KsgA Function in 30S Ribosomal Subunit Biogenesis* (United States)

    Boehringer, Daniel; O'Farrell, Heather C.; Rife, Jason P.; Ban, Nenad


    The assembly of the ribosomal subunits is facilitated by ribosome biogenesis factors. The universally conserved methyltransferase KsgA modifies two adjacent adenosine residues in the 3′-terminal helix 45 of the 16 S ribosomal RNA (rRNA). KsgA recognizes its substrate adenosine residues only in the context of a near mature 30S subunit and is required for the efficient processing of the rRNA termini during ribosome biogenesis. Here, we present the cryo-EM structure of KsgA bound to a nonmethylated 30S ribosomal subunit. The structure reveals that KsgA binds to the 30S platform with the catalytic N-terminal domain interacting with substrate adenosine residues in helix 45 and the C-terminal domain making extensive contacts to helix 27 and helix 24. KsgA excludes the penultimate rRNA helix 44 from adopting its position in the mature 30S subunit, blocking the formation of the decoding site and subunit joining. We suggest that the activation of methyltransferase activity and subsequent dissociation of KsgA control conformational changes in helix 44 required for final rRNA processing and translation initiation. PMID:22308031

  5. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation. (United States)

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad


    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Fluctuations in protein synthesis from a single RNA template: stochastic kinetics of ribosomes. (United States)

    Garai, Ashok; Chowdhury, Debashish; Ramakrishnan, T V


    Proteins are polymerized by cyclic machines called ribosomes, which use their messenger RNA (mRNA) track also as the corresponding template, and the process is called translation. We explore, in depth and detail, the stochastic nature of the translation. We compute various distributions associated with the translation process; one of them--namely, the dwell time distribution--has been measured in recent single-ribosome experiments. The form of the distribution, which fits best with our simulation data, is consistent with that extracted from the experimental data. For our computations, we use a model that captures both the mechanochemistry of each individual ribosome and their steric interactions. We also demonstrate the effects of the sequence inhomogeneities of real genes on the fluctuations and noise in translation. Finally, inspired by recent advances in the experimental techniques of manipulating single ribosomes, we make theoretical predictions on the force-velocity relation for individual ribosomes. In principle, all our predictions can be tested by carrying out in vitro experiments.

  7. Diamond Blackfan Anemia at the Crossroad between Ribosome Biogenesis and Heme Metabolism

    Directory of Open Access Journals (Sweden)

    Deborah Chiabrando


    Full Text Available Diamond-Blackfan anemia (DBA is a rare, pure red-cell aplasia that presents during infancy. Approximately 40% of cases are associated with other congenital defects, particularly malformations of the upper limb or craniofacial region. Mutations in the gene coding for the ribosomal protein RPS19 have been identified in 25% of patients with DBA, with resulting impairment of 18S rRNA processing and 40S ribosomal subunit formation. Moreover, mutations in other ribosomal protein coding genes account for about 25% of other DBA cases. Recently, the analysis of mice from which the gene coding for the heme exporter Feline Leukemia Virus subgroup C Receptor (FLVCR1 is deleted suggested that this gene may be involved in the pathogenesis of DBA. FLVCR1-null mice show a phenotype resembling that of DBA patients, including erythroid failure and malformations. Interestingly, some DBA patients have disease linkage to chromosome 1q31, where FLVCR1 is mapped. Moreover, it has been reported that cells from DBA patients express alternatively spliced isoforms of FLVCR1 which encode non-functional proteins. Herein, we review the known roles of RPS19 and FLVCR1 in ribosome function and heme metabolism respectively, and discuss how the deficiency of a ribosomal protein or of a heme exporter may result in the same phenotype.

  8. The Circadian Clock Modulates Global Daily Cycles of mRNA Ribosome Loading[OPEN (United States)

    Missra, Anamika; Ernest, Ben; Jia, Qidong; Ke, Kenneth


    Circadian control of gene expression is well characterized at the transcriptional level, but little is known about diel or circadian control of translation. Genome-wide translation state profiling of mRNAs in Arabidopsis thaliana seedlings grown in long day was performed to estimate ribosome loading per mRNA. The experiments revealed extensive translational regulation of key biological processes. Notably, translation of mRNAs for ribosomal proteins and mitochondrial respiration peaked at night. Central clock mRNAs are among those subject to fluctuations in ribosome loading. There was no consistent phase relationship between peak translation states and peak transcript levels. The overlay of distinct transcriptional and translational cycles can be expected to alter the waveform of the protein synthesis rate. Plants that constitutively overexpress the clock gene CCA1 showed phase shifts in peak translation, with a 6-h delay from midnight to dawn or from noon to evening being particularly common. Moreover, cycles of ribosome loading that were detected under continuous light in the wild type collapsed in the CCA1 overexpressor. Finally, at the transcript level, the CCA1-ox strain adopted a global pattern of transcript abundance that was broadly correlated with the light-dark environment. Altogether, these data demonstrate that gene-specific diel cycles of ribosome loading are controlled in part by the circadian clock. PMID:26392078

  9. Structural and functional organization of ribosomal genes within the mammalian cell nucleolus. (United States)

    Derenzini, Massimo; Pasquinelli, Gianandrea; O'Donohue, Marie-Françoise; Ploton, Dominique; Thiry, Marc


    Data on the in situ structural-functional organization of ribosomal genes in the mammalian cell nucleolus are reviewed here. Major findings on chromatin structure in situ come from investigations carried out using the Feulgen-like osmium ammine reaction as a highly specific electron-opaque DNA tracer. Intranucleolar chromatin shows three different levels of organization: compact clumps, fibers ranging from 11 to 30 nm, and loose agglomerates of extended DNA filaments. Both clumps and fibers of chromatin exhibit a nucleosomal organization that is lacking in the loose agglomerates of extended DNA filaments. In fact, these filaments constantly show a thickness of 2-3 nm, the same as a DNA double-helix molecule. The loose agglomerates of DNA filaments are located in the fibrillar centers, the interphase counterpart of metaphase NORs, therefore being constituted by ribosomal DNA. The extended, non-nucleosomal configuration of this rDNA has been shown to be independent of transcriptional activity and characterizes ribosome genes that are either transcribed or transcriptionally silent. Data reviewed are consistent with a model of control for ribosome gene activity that is not mediated by changes in chromatin structure. The presence of rDNA in mammalian cells always structurally ready for transcription might facilitate a more rapid adjustment of the ribosome production in response to the metabolic needs of the cell.

  10. The nuclear import of ribosomal proteins is regulated by mTOR (United States)

    Kazyken, Dubek; Kaz, Yelimbek; Kiyan, Vladimir; Zhylkibayev, Assylbek A.; Chen, Chien-Hung; Agarwal, Nitin K.; Sarbassov, Dos D.


    Mechanistic target of rapamycin (mTOR) is a central component of the essential signaling pathway that regulates cell growth and proliferation by controlling anabolic processes in cells. mTOR exists in two distinct mTOR complexes known as mTORC1 and mTORC2 that reside mostly in cytoplasm. In our study, the biochemical characterization of mTOR led to discovery of its novel localization on nuclear envelope where it associates with a critical regulator of nuclear import Ran Binding Protein 2 (RanBP2). We show that association of mTOR with RanBP2 is dependent on the mTOR kinase activity that regulates the nuclear import of ribosomal proteins. The mTOR kinase inhibitors within thirty minutes caused a substantial decrease of ribosomal proteins in the nuclear but not cytoplasmic fraction. Detection of a nuclear accumulation of the GFP-tagged ribosomal protein rpL7a also indicated its dependence on the mTOR kinase activity. The nuclear abundance of ribosomal proteins was not affected by inhibition of mTOR Complex 1 (mTORC1) by rapamycin or deficiency of mTORC2, suggesting a distinctive role of the nuclear envelope mTOR complex in the nuclear import. Thus, we identified that mTOR in association with RanBP2 mediates the active nuclear import of ribosomal proteins. PMID:25294810

  11. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance (United States)

    Gregory, Steven T.


    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  12. A Novel Effect of CO2 Laser Induced Piezoelectricity in Ag2Ga2SiS6 Chalcogenide Crystals

    Directory of Open Access Journals (Sweden)

    Oleg V. Parasyuk


    Full Text Available We have discovered a substantial enhancement of the piezoelectric coefficients (from 10 to 78 pm/V in the chalcogenide Ag2Ga2SiS6 single crystals. The piezoelectric studies were done under the influence of a CO2 laser (wavelength 10.6 μm, time duration 200 ns, lasers with power densities varying up to 700 MW/cm2. Contrary to the earlier studies where the photoinduced piezoelectricity was done under the influence of the near IR lasers, the effect is higher by at least one order, which is a consequence of the phonon anharmonic contributions and photopolarizations. Such a discovery allows one to build infrared piezotronic devices, which may be used for the production of the IR laser tunable optoelectronic triggers and memories. This is additionally confirmed by the fact that analogous photoillumination by the near IR laser (Nd:YAG (1064 nm and Er:glass laser (1540 nm gives the obtained values of the effective piezoelectricity at of least one order less. The effect is completely reversible with a relaxation time up to several milliseconds. In order to clarify the role of free carriers, additional studies of photoelectrical spectra were done.

  13. Quantitation of intracellular metabolites of [35S]-6-mercaptopurine in L5178Y cells grown in time-course incubates. (United States)

    Breter, H J; Zahn, R K


    6-Mercaptopurine (6MP) metabolism was quantitatively determined in L5178Y murine lymphoma. Cells grown in time-course incubates with [35S]-6MP were extracted with cold perchloric acid, and the buffered extracts were subjected to high-performance liquid cation-exchange chromatography prior to and after hydrolysis with alkaline phosphatase. Free sulfate, 6-thiouric acid, 6-thioxanthosine, 6-thioguanosine, 6-thioinosine, free 6MP, and 6-methylthioinosine were separated from each other; identified in the radiochromatograms by elution volume, UV spectroscopic data, and enzymatic peak-shifting analyses with purine nucleoside phosphorylase; and quantitatively determined by means of 35S radioactivity. Gross intracellular 35S concentrations remained constant at 5 x 10(-5) M after 1 hr of incubation. 6MP metabolism in L5178Y cells was distinguished into an early phase (to 1 hr of incubation) in which 6MP was predominantly catabolized to 6-thiouric acid and free sulfate, into an intermediate phase (to 8 hr) in which substantial amounts of free 6MP and of ribonucleotides of 6-thioxanthosine and 6-thioguanosine were present while the concentrations of nonnucleotide oxidation products sharply decreased, and into a late phase (to 24 hr) in which the ribonucleotides of 6MP, of 6-thioguanosine and, in particular, of 6-methylthioinosine were the most abundant metabolites.

  14. Primary structures of ribosomal proteins from the archaebacterium Halobacterium marismortui and the eubacterium Bacillus stearothermophilus. (United States)

    Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M


    Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.

  15. Structures of the E. coli translating ribosome with SRP and its receptor and with the translocon. (United States)

    Jomaa, Ahmad; Boehringer, Daniel; Leibundgut, Marc; Ban, Nenad


    Co-translational protein targeting to membranes is a universally conserved process. Central steps include cargo recognition by the signal recognition particle and handover to the Sec translocon. Here we present snapshots of key co-translational-targeting complexes solved by cryo-electron microscopy at near-atomic resolution, establishing the molecular contacts between the Escherichia coli translating ribosome, the signal recognition particle and the translocon. Our results reveal the conformational changes that regulate the latching of the signal sequence, the release of the heterodimeric domains of the signal recognition particle and its receptor, and the handover of the signal sequence to the translocon. We also observe that the signal recognition particle and the translocon insert-specific structural elements into the ribosomal tunnel to remodel it, possibly to sense nascent chains. Our work provides structural evidence for a conformational state of the signal recognition particle and its receptor primed for translocon binding to the ribosome-nascent chain complex.

  16. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation. (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J


    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  17. Binding site of ribosomal proteins on prokaryotic 5S ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Christensen, A; Garrett, R A


    The binding sites of ribosomal proteins L18 and L25 on 5S RNA from Escherichia coli were probed with ribonucleases A, T1, and T2 and a double helix specific cobra venom endonuclease. The results for the protein-RNA complexes, which were compared with those for the free RNA [Douthwaite, S...... stearothermophilus 5S RNA. Several protein-induced changes in the RNA structures were identified; some are possibly allosteric in nature. The two prokaryotic 5S RNAs were also incubated with total 50S subunit proteins from E. coli and B. stearothermophilus ribosomes. Homologous and heterologous reconstitution....... stearothermophilus 5S RNA, which may have been due to a third ribosomal protein L5....

  18. Defining the structural requirements for a helix in 23 S ribosomal RNA that confers erythromycin resistance

    DEFF Research Database (Denmark)

    Douthwaite, S; Powers, T; Lee, J Y


    The helix spanning nucleotides 1198 to 1247 (helix 1200-1250) in Escherichia coli 23 S ribosomal RNA (rRNA) is functionally important in protein synthesis, and deletions in this region confer erythromycin resistance. In order to define the structural requirements for resistance, we have dissected...... deletion mutants show a sensitive phenotype. Deletions that extend into the base-pairing between GCC1208 and GGU1240 result in non-functional 23 S RNAs, which consequently do not confer resistance. A number of phylogenetically conserved nucleotides have been shown to be non-essential for 23 S RNA function....... However, removal of either these or non-conserved nucleotides from helix 1200-1250 measurably reduces the efficiency of 23 S RNA in forming functional ribosomes. We have used chemical probing and a modified primer extension method to investigate erythromycin binding to wild-type and resistant ribosomes...

  19. Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli

    International Nuclear Information System (INIS)

    Gravel, M.; Melancon, P.; Barkier-Gingras, L.


    [ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance

  20. Site-specific fluorescent labeling of nascent proteins on the translating ribosome. (United States)

    Saraogi, Ishu; Zhang, Dawei; Chandrasekaran, Sandhya; Shan, Shu-ou


    As newly synthesized proteins emerge from the ribosome, they interact with a variety of cotranslational cellular machineries that facilitate their proper folding, maturation, and localization. These interactions are essential for proper function of the cell, and the ability to study these events is crucial to understanding cellular protein biogenesis. To this end, we have developed a highly efficient method to generate ribosome-nascent chain complexes (RNCs) site-specifically labeled with a fluorescent dye on the nascent polypeptide. The fluorescent RNC provides real-time, quantitative information on its cotranslational interaction with the signal recognition particle and will be a valuable tool in elucidating the role of the translating ribosome in numerous biochemical pathways.

  1. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome. (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi


    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  2. Free and membrane-bound ribosomes and polysomes in hippocampal neurons during a learning experiment. (United States)

    Wenzel, J; David, H; Pohle, W; Marx, I; Matthies, H


    The ribosomes of the CA1 and CA3 pyramidal cells of hipocampus were investigated by morphometric methods after the acquisition of a shock-motivated brightness discrimination in rats. A significant increase in the total number of ribosomes was observed in CA1 cells of trained animals and in CA3 cells of both active controls and trained rats. A significant increase in membrane-bound ribosomes was obtained in CA1 and CA3 cells after training only. The results confirm the suggestion of an increased protein synthesis in hippocampal neurons during and after the acquisition of a brightness discrimination, as we have concluded from out previous investigations on the incorporation of labeled amino acids under identical experimental conditions. The results lead to the assumption that the protein synthesis in some neuronal cells may probably differ not only quantitatively, but also qualitatively in trained and untrained animals.

  3. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    DEFF Research Database (Denmark)

    Long, Katherine S.; Vester, Birte


    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations...... to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation...... of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little...

  4. Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis. (United States)

    Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C


    The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation. (United States)

    Mallik, Saurav; Kundu, Sudip


    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  6. rRNA maturation in yeast cells depleted of large ribosomal subunit proteins.

    Directory of Open Access Journals (Sweden)

    Gisela Pöll

    Full Text Available The structural constituents of the large eukaryotic ribosomal subunit are 3 ribosomal RNAs, namely the 25S, 5.8S and 5S rRNA and about 46 ribosomal proteins (r-proteins. They assemble and mature in a highly dynamic process that involves more than 150 proteins and 70 small RNAs. Ribosome biogenesis starts in the nucleolus, continues in the nucleoplasm and is completed after nucleo-cytoplasmic translocation of the subunits in the cytoplasm. In this work we created 26 yeast strains, each of which conditionally expresses one of the large ribosomal subunit (LSU proteins. In vivo depletion of the analysed LSU r-proteins was lethal and led to destabilisation and degradation of the LSU and/or its precursors. Detailed steady state and metabolic pulse labelling analyses of rRNA precursors in these mutant strains showed that LSU r-proteins can be grouped according to their requirement for efficient progression of different steps of large ribosomal subunit maturation. Comparative analyses of the observed phenotypes and the nature of r-protein-rRNA interactions as predicted by current atomic LSU structure models led us to discuss working hypotheses on i how individual r-proteins control the productive processing of the major 5' end of 5.8S rRNA precursors by exonucleases Rat1p and Xrn1p, and ii the nature of structural characteristics of nascent LSUs that are required for cytoplasmic accumulation of nascent subunits but are nonessential for most of the nuclear LSU pre-rRNA processing events.

  7. a repository of small ORFs identified by ribosome profiling. (United States)

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben


    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce (, a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Simulating movement of tRNA through the ribosome during hybrid-state formation. (United States)

    Whitford, Paul C; Sanbonmatsu, Karissa Y


    Biomolecular simulations provide a means for exploring the relationship between flexibility, energetics, structure, and function. With the availability of atomic models from X-ray crystallography and cryoelectron microscopy (cryo-EM), and rapid increases in computing capacity, it is now possible to apply molecular dynamics (MD) simulations to large biomolecular machines, and systematically partition the factors that contribute to function. A large biomolecular complex for which atomic models are available is the ribosome. In the cell, the ribosome reads messenger RNA (mRNA) in order to synthesize proteins. During this essential process, the ribosome undergoes a wide range of conformational rearrangements. One of the most poorly understood transitions is translocation: the process by which transfer RNA (tRNA) molecules move between binding sites inside of the ribosome. The first step of translocation is the adoption of a "hybrid" configuration by the tRNAs, which is accompanied by large-scale rotations in the ribosomal subunits. To illuminate the relationship between these rearrangements, we apply MD simulations using a multi-basin structure-based (SMOG) model, together with targeted molecular dynamics protocols. From 120 simulated transitions, we demonstrate the viability of a particular route during P/E hybrid-state formation, where there is asynchronous movement along rotation and tRNA coordinates. These simulations not only suggest an ordering of events, but they highlight atomic interactions that may influence the kinetics of hybrid-state formation. From these simulations, we also identify steric features (H74 and surrounding residues) encountered during the hybrid transition, and observe that flexibility of the single-stranded 3'-CCA tail is essential for it to reach the endpoint. Together, these simulations provide a set of structural and energetic signatures that suggest strategies for modulating the physical-chemical properties of protein synthesis by the

  9. The ribosome structure controls and directs mRNA entry, translocation and exit dynamics

    International Nuclear Information System (INIS)

    Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej


    The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit

  10. Acrolein preferentially damages nucleolus eliciting ribosomal stress and apoptosis in human cancer cells. (United States)

    Wang, Hsiang-Tsui; Chen, Tzu-Ying; Weng, Ching-Wen; Yang, Chun-Hsiang; Tang, Moon-Shong


    Acrolein (Acr) is a potent cytotoxic and DNA damaging agent which is ubiquitous in the environment and abundant in tobacco smoke. Acr is also an active cytotoxic metabolite of the anti-cancer drugs cyclophosphamide and ifosfamide. The mechanisms via which Acr exerts its anti-cancer activity and cytotoxicity are not clear. In this study, we found that Acr induces cytotoxicity and cell death in human cancer cells with different activities of p53. Acr preferentially binds nucleolar ribosomal DNA (rDNA) to form Acr-deoxyguanosine adducts, and induces oxidative damage to both rDNA and ribosomal RNA (rRNA). Acr triggers ribosomal stress responses, inhibits rRNA synthesis, reduces RNA polymerase I binding to the promoter of rRNA gene, disrupts nucleolar integrity, and impairs ribosome biogenesis and polysome formation. Acr causes an increase in MDM2 levels and phosphorylation of MDM2 in A549 and HeLa cells which are p53 active and p53 inactive, respectively. It enhances the binding of ribosomal protein RPL11 to MDM2 and reduces the binding of p53 and E2F-1 to MDM2 resulting in stabilization/activation of p53 in A549 cells and degradation of E2F-1 in A549 and HeLa cells. We propose that Acr induces ribosomal stress which leads to activation of MDM2 and RPL11-MDM2 binding, consequently, activates p53 and enhances E2F-1 degradation, and that taken together these two processes induce apoptosis and cell death.

  11. Regulation of androgen receptor transactivity and mTOR-S6 kinase pathway by Rheb in prostate cancer cell proliferation. (United States)

    Kobayashi, Takashi; Shimizu, Yosuke; Terada, Naoki; Yamasaki, Toshinari; Nakamura, Eijiro; Toda, Yoshinobu; Nishiyama, Hiroyuki; Kamoto, Toshiyuki; Ogawa, Osamu; Inoue, Takahiro


    Ras homolog-enriched in brain (Rheb), a small GTP-binding protein, is associated with prostate carcinogenesis through activating mammalian target of rapamycin (mTOR) signaling pathway. This study aimed to elucidate whether Rheb promotes proliferation of prostate cancer cells and can act as a potent therapeutic target in prostate cancer. Prostate cancer cell lines and human prostatic tissues were examined for the expression of Rheb. The effects of forced expression or knockdown of Rheb on cell proliferation were also examined. Semi-quantitative and quantitative RT-PCR were performed to evaluate mRNA expression. Western blotting was used to examine protein expression. Cell count and WST-1 assay were used to measure cell proliferation. Fluorescence-activated cell sorting was used to assess the cell cycle. Rheb mRNA and protein expression was higher in more aggressive, androgen-independent prostate cancer cell lines PC3, DU145, and C4-2, compared with the less aggressive LNCaP. Rheb expression was higher in cancer tissues than in benign prostatic epithelia. Forced expression of Rheb in LNCaP cells accelerated proliferation without enhancing androgen receptor transactivity. Attenuation of Rheb expression or treatment with the mTOR inhibitor rapamycin decreased proliferation of PC3 and DU145 cells, with a decrease in the activated form of p70S6 kinase, one of the main targets of mTOR. Rheb potentiates proliferation of prostate cancer cells and inhibition of Rheb or mTOR can lead to suppressed proliferation of aggressive prostate cancer cell lines in vitro. Rheb and the mTOR pathway are therefore probable targets for suppressing prostate cancer.

  12. The ribosomal protein uL22 modulates the shape of the nascent protein exit tunnel

    DEFF Research Database (Denmark)

    Wekselman, I.; Zimmerman, E.; Davidovich, C.


    in the entrance of theribosomal exit tunnel and interferes with the progression of nas-cent chains. Commonly, resistance to erythromycin is acquiredby alterations of rRNA nucleotides that interact with the drug.Mutations in theb-hairpin of ribosomal protein uL22, which israther distal to the erythromycin binding...... to erythromycin binding pocket and increases its flexi-bility. Based on our results, we suggest a feasble mechanism thatexplains how nanscent proteins can be translated when ery-thromycin is bound to the ribosome. Furthermore, our findingssupport recent studies showing that the interactions betweenuL22...

  13. The Ribosomal Protein uL22 Modulates the Shape of the Protein Exit Tunnel

    DEFF Research Database (Denmark)

    Wekselman, Itai; Zimmerman, Ella; Davidovich, Chen


    Erythromycin is a clinically useful antibiotic that binds to an rRNA pocket in the ribosomal exit tunnel. Commonly, resistance to erythromycin is acquired by alterations of rRNA nucleotides that interact with the drug. Mutations in the β hairpin of ribosomal protein uL22, which is rather distal...... of the β hairpin of the mutated uL22 toward the interior of the exit tunnel, triggering a cascade of structural alterations of rRNA nucleotides that propagate to the erythromycin binding pocket. Our findings support recent studies showing that the interactions between uL22 and specific sequences within...

  14. Implementation of communication-mediating domains for non-ribosomal peptide production in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Siewers, Verena; San-Bento, Rita; Nielsen, Jens


    Saccharomyces cerevisiae has in several cases been proven to be a suitable host for the production of natural products and was recently exploited for the production of non-ribosomal peptides. Synthesis of non-ribosomal peptides (NRPs) is mediated by NRP synthetases (NRPSs), modular enzymes, which...... are often organized in enzyme complexes. In these complexes, partner NRPSs interact via communication-mediating domains (COM domains). In order to test whether functional interaction between separate NRPS modules is possible in yeast we constructed a yeast strain expressing two modules with compatible COM...

  15. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling. (United States)

    Irigoyen, Nerea; Firth, Andrew E; Jones, Joshua D; Chung, Betty Y-W; Siddell, Stuart G; Brierley, Ian


    Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV) and Middle East respiratory syndrome-related coronavirus (MERS-CoV), are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59), a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the ribosomal

  16. High-Resolution Analysis of Coronavirus Gene Expression by RNA Sequencing and Ribosome Profiling.

    Directory of Open Access Journals (Sweden)

    Nerea Irigoyen


    Full Text Available Members of the family Coronaviridae have the largest genomes of all RNA viruses, typically in the region of 30 kilobases. Several coronaviruses, such as Severe acute respiratory syndrome-related coronavirus (SARS-CoV and Middle East respiratory syndrome-related coronavirus (MERS-CoV, are of medical importance, with high mortality rates and, in the case of SARS-CoV, significant pandemic potential. Other coronaviruses, such as Porcine epidemic diarrhea virus and Avian coronavirus, are important livestock pathogens. Ribosome profiling is a technique which exploits the capacity of the translating ribosome to protect around 30 nucleotides of mRNA from ribonuclease digestion. Ribosome-protected mRNA fragments are purified, subjected to deep sequencing and mapped back to the transcriptome to give a global "snap-shot" of translation. Parallel RNA sequencing allows normalization by transcript abundance. Here we apply ribosome profiling to cells infected with Murine coronavirus, mouse hepatitis virus, strain A59 (MHV-A59, a model coronavirus in the same genus as SARS-CoV and MERS-CoV. The data obtained allowed us to study the kinetics of virus transcription and translation with exquisite precision. We studied the timecourse of positive and negative-sense genomic and subgenomic viral RNA production and the relative translation efficiencies of the different virus ORFs. Virus mRNAs were not found to be translated more efficiently than host mRNAs; rather, virus translation dominates host translation at later time points due to high levels of virus transcripts. Triplet phasing of the profiling data allowed precise determination of translated reading frames and revealed several translated short open reading frames upstream of, or embedded within, known virus protein-coding regions. Ribosome pause sites were identified in the virus replicase polyprotein pp1a ORF and investigated experimentally. Contrary to expectations, ribosomes were not found to pause at the

  17. Acidic ribosomal proteins and histone H3 from Leishmania present a high rate of divergence

    Directory of Open Access Journals (Sweden)

    Ysabel Montoya


    Full Text Available Another additional peculiarity in Leishmania will be discussed about of the amino acid divergence rate of three structural proteins: acidic ribosomal P1 and P2b proteins, and histone H3 by using multiple sequence alignment and dendrograms. These structural proteins present a high rate of divergence regarding to their homologous protein in Trypanosoma cruzi. At this regard, L. (V. peruviana P1 and T. cruzi P1 showed 57.4% of divergence rate. Likewise, L. (V. braziliensis histone H3 and acidic ribosomal P2 protein exhibited 31.8% and 41.7% respectively of rate of divergence in comparison with their homologous in T. cruzi.

  18. The NBS1-Treacle complex controls ribosomal RNA transcription in response to DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe H; Hari, Flurina; Clapperton, Julie A


    Chromosome breakage elicits transient silencing of ribosomal RNA synthesis, but the mechanisms involved remained elusive. Here we discover an in trans signalling mechanism that triggers pan-nuclear silencing of rRNA transcription in response to DNA damage. This is associated with transient...... recruitment of the Nijmegen breakage syndrome protein 1 (NBS1), a central regulator of DNA damage responses, into the nucleoli. We further identify TCOF1 (also known as Treacle), a nucleolar factor implicated in ribosome biogenesis and mutated in Treacher Collins syndrome, as an interaction partner of NBS1...

  19. 5S Ribosomal RNA Is an Essential Component of a Nascent Ribosomal Precursor Complex that Regulates the Hdm2-p53 Checkpoint

    Directory of Open Access Journals (Sweden)

    Giulio Donati


    Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.

  20. 5S ribosomal RNA is an essential component of a nascent ribosomal precursor complex that regulates the Hdm2-p53 checkpoint. (United States)

    Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George


    Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  1. A hepatic amino acid/mTOR/S6K-dependent signalling pathway modulates systemic lipid metabolism via neuronal signals. (United States)

    Uno, Kenji; Yamada, Tetsuya; Ishigaki, Yasushi; Imai, Junta; Hasegawa, Yutaka; Sawada, Shojiro; Kaneko, Keizo; Ono, Hiraku; Asano, Tomoichiro; Oka, Yoshitomo; Katagiri, Hideki


    Metabolism is coordinated among tissues and organs via neuronal signals. Levels of circulating amino acids (AAs), which are elevated in obesity, activate the intracellular target of rapamycin complex-1 (mTORC1)/S6kinase (S6K) pathway in the liver. Here we demonstrate that hepatic AA/mTORC1/S6K signalling modulates systemic lipid metabolism via a mechanism involving neuronal inter-tissue communication. Hepatic expression of an AA transporter, SNAT2, activates the mTORC1/S6K pathway, and markedly elevates serum triglycerides (TGs), while downregulating adipose lipoprotein lipase (LPL). Hepatic Rheb or active-S6K expression have similar metabolic effects, whereas hepatic expression of dominant-negative-S6K inhibits TG elevation in SNAT2 mice. Denervation, pharmacological deafferentation and β-blocker administration suppress obesity-related hypertriglyceridemia with adipose LPL upregulation, suggesting that signals are transduced between liver and adipose tissue via a neuronal pathway consisting of afferent vagal and efferent sympathetic nerves. Thus, the neuronal mechanism uncovered here serves to coordinate amino acid and lipid levels and contributes to the development of obesity-related hypertriglyceridemia.

  2. Immunohistochemical Analysis of the Activation Status of the Akt/mTOR/pS6 Signaling Pathway in Oral Lichen Planus

    Directory of Open Access Journals (Sweden)

    Georgios Prodromidis


    Full Text Available Introduction. Aberrations of the Akt/mTOR/pS6 pathway have been linked to various types of human cancer, including oral squamous cell carcinoma (OSCC. The purpose of this study was to evaluate the activation status of Akt, mTOR, and pS6 in oral lichen planus (OLP in comparison with oral premalignant and malignant lesions and normal oral mucosa (NM. Materials and Methods. Immunohistochemistry for p-Akt, p-mTOR, and phospho-pS6 was performed in 40 OLP, 20 oral leukoplakias (OL, 10 OSCC, and 10 control samples of NM. Results. Nuclear p-Akt expression was detected in the vast majority of cases in all categories, being significantly higher in OL. Cytoplasmic p-Akt and p-mTOR staining was present only in a minority of OLP cases, being significantly lower compared to OL and OSCC. Phospho-pS6 showed cytoplasmic positivity in most OLP cases, which however was significantly lower compared to OL and OSCC. Conclusions. Overall, cytoplasmic p-Akt, p-mTOR, and phospho-pS6 levels appear to be significantly lower in OLP compared to OL and OSCC. However, the expression of these molecules in a subset of OLP cases suggests that activation of Akt/mTOR/pS6 may occur in the context of OLP, possibly contributing to the premalignant potential of individual cases.

  3. Distinct roles for the IIId2 sub-domain in pestivirus and picornavirus internal ribosome entry sites

    DEFF Research Database (Denmark)

    Willcocks, Margaret M.; Zaini, Salmah; Chamond, Nathalie


    Viral internal ribosomes entry site (IRES) elements coordinate the recruitment of the host translation machinery to direct the initiation of viral protein synthesis. Within hepatitis C virus (HCV)-like IRES elements, the sub-domain IIId(1) is crucial for recruiting the 40S ribosomal subunit...

  4. The ribosome as a molecular machine: the mechanism of tRNA-mRNA movement in translocation. (United States)

    Rodnina, Marina V; Wintermeyer, Wolfgang


    Translocation of tRNA and mRNA through the ribosome is one of the most dynamic events during protein synthesis. In the cell, translocation is catalysed by EF-G (elongation factor G) and driven by GTP hydrolysis. Major unresolved questions are: how the movement is induced and what the moving parts of the ribosome are. Recent progress in time-resolved cryoelectron microscopy revealed trajectories of tRNA movement through the ribosome. Driven by thermal fluctuations, the ribosome spontaneously samples a large number of conformational states. The spontaneous movement of tRNAs through the ribosome is loosely coupled to the motions within the ribosome. EF-G stabilizes conformational states prone to translocation and promotes a conformational rearrangement of the ribosome (unlocking) that accelerates the rate-limiting step of translocation: the movement of the tRNA anticodons on the small ribosomal subunit. EF-G acts as a Brownian ratchet providing directional bias for movement at the cost of GTP hydrolysis.

  5. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni


    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the factor...

  6. Expression Profiling of Ribosome Biogenesis Factors Reveals Nucleolin as a Novel Potential Marker to Predict Outcome in AML Patients.

    Directory of Open Access Journals (Sweden)

    Virginie Marcel

    Full Text Available Acute myeloid leukemia (AML is a heterogeneous disease. Prognosis is mainly influenced by patient age at diagnosis and cytogenetic alterations, two of the main factors currently used in AML patient risk stratification. However, additional criteria are required to improve the current risk classification and better adapt patient care. In neoplastic cells, ribosome biogenesis is increased to sustain the high proliferation rate and ribosome composition is altered to modulate specific gene expression driving tumorigenesis. Here, we investigated the usage of ribosome biogenesis factors as clinical markers in adult patients with AML. We showed that nucleoli, the nucleus compartments where ribosome production takes place, are modified in AML by analyzing a panel of AML and healthy donor cells using immunofluorescence staining. Using four AML series, including the TCGA dataset, altogether representing a total of about 270 samples, we showed that not all factors involved in ribosome biogenesis have clinical values although ribosome biogenesis is increased in AML. Interestingly, we identified the regulator of ribosome production nucleolin (NCL as over-expressed in AML blasts. Moreover, we found in two series that high NCL mRNA expression level was associated with a poor overall survival, particular in elderly patients. Multivariate analyses taking into account age and cytogenetic risk indicated that NCL expression in blast cells is an independent marker of reduced survival. Our study identifies NCL as a potential novel prognostic factor in AML. Altogether, our results suggest that the ribosome biogenesis pathway may be of interest as clinical markers in AML.

  7. Affinity labelling of ribosomes from the livers of different vertebrates by 2-nitro-4-azidobenzoyl-Phe-tRNA

    International Nuclear Information System (INIS)

    Stahl, J.; Boehm, H.; Voderberg, M.


    Ribosomal protein L 10 from the livers of trout, hen, and rat was found to be the main target for 2-nitro-4-azidobenzoyl-Phe-tRNA in affinity labelling experiments. Therefore, despite somewhat different electrophoretic mobilities, this protein seems to be involved in the organization of the peptidyl transferase centre in ribosomes of various vertebrates. (author)

  8. The functional half-life of an mRNA depends on the ribosome spacing in an early coding region

    DEFF Research Database (Denmark)

    Pedersen, Margit; Nissen, Søren; Mitarai, Namiko


    Bacterial mRNAs are translated by closely spaced ribosomes and degraded from the 5'-end, with half-lives of around 2 min at 37 °C in most cases. Ribosome-free or "naked" mRNA is known to be readily degraded, but the initial event that inactivates the mRNA functionally has not been fully described...

  9. Characterization of the domains of E. coli initiation factor IF2 responsible for recognition of the ribosome

    DEFF Research Database (Denmark)

    Manuel Palacios Moreno, Juan; Andersen, Lars Dyrskjøt; Egebjerg Kristensen, Janni


    We have studied the interactions between the ribosome and the domains of Escherichia coli translation initiation factor 2, using an in vitro ribosomal binding assay with wild-type forms, N- and C-terminal truncated forms of IF2 as well as isolated structural domains. A deletion mutant of the fact...

  10. Evidence for rRNA 2'-O-methylation plasticity: Control of intrinsic translational capabilities of human ribosomes. (United States)

    Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques


    Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.

  11. Markerless Escherichia coli rrn Deletion Strains for Genetic Determination of Ribosomal Binding Sites

    DEFF Research Database (Denmark)

    Quan, Selwyn; Skovgaard, Ole; McLaughlin, Robert E


    Single-copy rrn strains facilitate genetic ribosomal studies in Escherichia coli. Consecutive markerless deletion of rrn operons resulted in slower growth upon inactivation of the fourth copy, which was reversed by supplying transfer RNA genes encoded in rrn operons in trans. Removal of the sixth...

  12. Transcription of ribosomal RNA genes is initiated in the third cell cycle of bovine embryos

    DEFF Research Database (Denmark)

    Jakobsen, Anne Sørig; Avery, Birthe; Dieleman, Steph J.


    Transcription from the embryos own ribosomal genes is initiated in most species at the same time as the maternal-embryonic transition. Recently data have indicated that a minor activation may take place during the third embryonic cell cycle in the bovine, one cell cycle before the major activation...

  13. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus. (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H


    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  14. Reaction of some macrolide antibiotics with the ribosome. Labeling of the binding site components

    International Nuclear Information System (INIS)

    Tejedor, F.; Ballesta, J.P.


    Radioactive carbomycin A, niddamycin, tylosin, and spiramycin, but not erythromycin, can be covalently bound to Escherichia coli ribosomes by incubation at 37 degrees C. The incorporation of radioactivity into the particles is inhibited by SH- and activated double bond containing compounds but not by amino groups, suggesting that the reactions may take place by addition to the double bond present in the reactive antibiotics. This thermic reaction must be different from the photoreaction described for some of these macrolides [Tejedor, F., and Ballesta, J. P. G. (1985) Biochemistry 24, 467-472] since tylosin, which is not photoincorporated, is thermically bound to ribosomes. Most of the radioactivity is incorporated into the ribosomal proteins. Two-dimensional gel electrophoresis of proteins labeled by carbomycin A, niddamycin, and tylosin indicates that about 40% of the radioactivity is bound to protein L27; the rest is distributed among several other proteins such as L8, L2, and S12, to differing extents depending on the drug used. These results indicate, in accordance with previous data, that protein L27 plays an important role in the macrolide binding site, confirming that these drugs bind near the peptidyl transferase center of the ribosome

  15. Genome-Scale Analysis of Translation Elongation with a Ribosome Flow Model (United States)

    Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan


    We describe the first large scale analysis of gene translation that is based on a model that takes into account the physical and dynamical nature of this process. The Ribosomal Flow Model (RFM) predicts fundamental features of the translation process, including translation rates, protein abundance levels, ribosomal densities and the relation between all these variables, better than alternative (‘non-physical’) approaches. In addition, we show that the RFM can be used for accurate inference of various other quantities including genes' initiation rates and translation costs. These quantities could not be inferred by previous predictors. We find that increasing the number of available ribosomes (or equivalently the initiation rate) increases the genomic translation rate and the mean ribosome density only up to a certain point, beyond which both saturate. Strikingly, assuming that the translation system is tuned to work at the pre-saturation point maximizes the predictive power of the model with respect to experimental data. This result suggests that in all organisms that were analyzed (from bacteria to Human), the global initiation rate is optimized to attain the pre-saturation point. The fact that similar results were not observed for heterologous genes indicates that this feature is under selection. Remarkably, the gap between the performance of the RFM and alternative predictors is strikingly large in the case of heterologous genes, testifying to the model's promising biotechnological value in predicting the abundance of heterologous proteins before expressing them in the desired host. PMID:21909250

  16. The Potential of Targeting Ribosome Biogenesis in High-Grade Serous Ovarian Cancer

    Directory of Open Access Journals (Sweden)

    Shunfei Yan


    Full Text Available Overall survival for patients with ovarian cancer (OC has shown little improvement for decades meaning new therapeutic options are critical. OC comprises multiple histological subtypes, of which the most common and aggressive subtype is high-grade serous ovarian cancer (HGSOC. HGSOC is characterized by genomic structural variations with relatively few recurrent somatic mutations or dominantly acting oncogenes that can be targeted for the development of novel therapies. However, deregulation of pathways controlling homologous recombination (HR and ribosome biogenesis has been observed in a high proportion of HGSOC, raising the possibility that targeting these basic cellular processes may provide improved patient outcomes. The poly (ADP-ribose polymerase (PARP inhibitor olaparib has been approved to treat women with defects in HR due to germline BRCA mutations. Recent evidence demonstrated the efficacy of targeting ribosome biogenesis with the specific inhibitor of ribosomal RNA synthesis, CX-5461 in v-myc avian myelocytomatosis viral oncogene homolog (MYC-driven haematological and prostate cancers. CX-5461 has now progressed to a phase I clinical trial in patients with haematological malignancies and phase I/II trial in breast cancer. Here we review the currently available targeted therapies for HGSOC and discuss the potential of targeting ribosome biogenesis as a novel therapeutic approach against HGSOC.

  17. Cross-site comparison of ribosomal depletion kits for Illumina RNAseq library construction. (United States)

    Herbert, Zachary T; Kershner, Jamie P; Butty, Vincent L; Thimmapuram, Jyothi; Choudhari, Sulbha; Alekseyev, Yuriy O; Fan, Jun; Podnar, Jessica W; Wilcox, Edward; Gipson, Jenny; Gillaspy, Allison; Jepsen, Kristen; BonDurant, Sandra Splinter; Morris, Krystalynne; Berkeley, Maura; LeClerc, Ashley; Simpson, Stephen D; Sommerville, Gary; Grimmett, Leslie; Adams, Marie; Levine, Stuart S


    Ribosomal RNA (rRNA) comprises at least 90% of total RNA extracted from mammalian tissue or cell line samples. Informative transcriptional profiling using massively parallel sequencing technologies requires either enrichment of mature poly-adenylated transcripts or targeted depletion of the rRNA fraction. The latter method is of particular interest because it is compatible with degraded samples such as those extracted from FFPE and also captures transcripts that are not poly-adenylated such as some non-coding RNAs. Here we provide a cross-site study that evaluates the performance of ribosomal RNA removal kits from Illumina, Takara/Clontech, Kapa Biosystems, Lexogen, New England Biolabs and Qiagen on intact and degraded RNA samples. We find that all of the kits are capable of performing significant ribosomal depletion, though there are differences in their ease of use. All kits were able to remove ribosomal RNA to below 20% with intact RNA and identify ~ 14,000 protein coding genes from the Universal Human Reference RNA sample at >1FPKM. Analysis of differentially detected genes between kits suggests that transcript length may be a key factor in library production efficiency. These results provide a roadmap for labs on the strengths of each of these methods and how best to utilize them.

  18. Sequence analysis and over-expression of ribosomal protein S28 ...

    African Journals Online (AJOL)

    RPS28 is a component of the 40S small ribosomal subunit encoded by RPS28 gene, which is specific to eukaryotes. The cDNA and the genomic sequence of RPS28 were cloned successfully from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively. Both sequences were analyzed preliminarily ...

  19. Computational discovery of specificity-conferring sites in non-ribosomal peptide synthetases

    DEFF Research Database (Denmark)

    Knudsen, Michael; Søndergaard, Dan Ariel; Tofting-Olesen, Claus


    Motivation: By using a class of large modular enzymes known as Non-Ribosomal Peptide Synthetases (NRPS), bacteria and fungi are capable of synthesizing a large variety of secondary metabolites, many of which are bioactive and have potential, pharmaceutical applications as e.g.~antibiotics. There ...

  20. Molecular mechanism and structure of Trigger Factor bound to the translating ribosome (United States)

    Merz, Frieder; Boehringer, Daniel; Schaffitzel, Christiane; Preissler, Steffen; Hoffmann, Anja; Maier, Timm; Rutkowska, Anna; Lozza, Jasmin; Ban, Nenad; Bukau, Bernd; Deuerling, Elke


    Ribosome-associated chaperone Trigger Factor (TF) initiates folding of newly synthesized proteins in bacteria. Here, we pinpoint by site-specific crosslinking the sequence of molecular interactions of Escherichia coli TF and nascent chains during translation. Furthermore, we provide the first full-length structure of TF associated with ribosome–nascent chain complexes by using cryo-electron microscopy. In its active state, TF arches over the ribosomal exit tunnel accepting nascent chains in a protective void. The growing nascent chain initially follows a predefined path through the entire interior of TF in an unfolded conformation, and even after folding into a domain it remains accommodated inside the protective cavity of ribosome-bound TF. The adaptability to accept nascent chains of different length and folding states may explain how TF is able to assist co-translational folding of all kinds of nascent polypeptides during ongoing synthesis. Moreover, we suggest a model of how TF's chaperoning function can be coordinated with the co-translational processing and membrane targeting of nascent polypeptides by other ribosome-associated factors. PMID:18497744

  1. The use of 125iodine-labeled RNA for detection of the RNA binding to ribosomes

    International Nuclear Information System (INIS)

    Mori, Tomohiko; Fukuda, Mitsuru


    The in vitro labeling of RNA with radioactive iodine is the efficient method to obtain the RNA with high specific activity. The present paper reports on the application of this technique to the production of iodine-labeled RNA for use in the experiment of binding RNA to ribosomes. Tobacco mosaic virus (TMV) RNA was used as natural mRNA, and E. coli S-30 preparation was used as a source of ribosomes. The TMV-RNA was prepared by bentonite-phenol extraction from TMV, and the method used for the iodation of RNA was based on the procedure described by Getz et al. The iodine-labeled RNA was incubated in a cell-free protein synthesizing system (S-30) prepared from E. coli K-12. After the incubation, the reaction mixture was layered onto sucrose gradient, centrifuged, and fractionated into 18 fractions. Optical density at 260 nm was measured, and radioactivity was counted, for each fraction. The binding of mRNA to ribosomes occurred even at 0 deg C, and the occurrence of the nonspecific binding was also shown. Consequently, the specific binding, i.e. the formation of the initiation complex being involved in amino acid incorporation, may be estimated by subtracting the radioactivity associated with monosomes in the presence of both rRNA and ATA from that in the presence of rRNA only. It was shown that the iodine-labeled RNA can be used for the studies of binding RNA to ribosomes. (Kako, I.)

  2. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

    Directory of Open Access Journals (Sweden)

    Lynch Michael


    Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  3. Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium. (United States)

    Catania, Francesco; Lynch, Michael


    In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

  4. Ribosome Profiling Reveals Pervasive Translation Outside of Annotated Protein-Coding Genes

    Directory of Open Access Journals (Sweden)

    Nicholas T. Ingolia


    Full Text Available Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5′ UTRs and long noncoding RNAs (lncRNAs. Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs. Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences.

  5. Exploring ribosome composition and newly synthesized proteins through proteomics and potential biomedical applications

    Czech Academy of Sciences Publication Activity Database

    Šťastná, Miroslava; Gottlieb, R. A.; Van Eyk, J.E.


    Roč. 14, č. 6 (2017), s. 529-543 ISSN 1478-9450 Institutional support: RVO:68081715 Keywords : mass spectrometry * amino-acid labeling * translation * ribosomes * AHA Subject RIV: CB - Analytical Chemistry, Separation OBOR OECD: Analytical chemistry Impact factor: 3.849, year: 2016

  6. Virtual Ribosome - a comprehensive DNA translation tool with support for integration of sequence feature annotation

    DEFF Research Database (Denmark)

    Wernersson, Rasmus


    of alternative start codons. ( ii) Integration of sequences feature annotation - in particular, native support for working with files containing intron/ exon structure annotation. The software is available for both download and online use at

  7. Selection of scFvs specific for the HepG2 cell line using ribosome ...

    Indian Academy of Sciences (India)


    the important advantage of requiring no prior knowledge of ... were amplified separately by RT-PCR, and an anti-HepG2 VH/k chain ribosome display library was constructed ..... Engert A, Hudson P R and Power B E 2007 Selection of human.

  8. In silico modelling and analysis of ribosome kinetics and aa-tRNA competition

    NARCIS (Netherlands)

    Bošnački, D.; Pronk, T.E.; de Vink, E.P.


    We present a formal analysis of ribosome kinetics using probabilistic model checking and the tool Prism. We compute different parameters of the model, like probabilities of translation errors and average insertion times per codon. The model predicts strong correlation to the quotient of the

  9. YbxF, a protein associated with exponential-phase ribosomes in Bacillus subtilis

    Czech Academy of Sciences Publication Activity Database

    Sojka, Luděk; Fučík, Vladimír; Krásný, Libor; Barvík, I.; Jonák, Jiří


    Roč. 189, č. 13 (2007), s. 4809-4814 ISSN 0021-9193 R&D Projects: GA AV ČR IAA5052206 Institutional research plan: CEZ:AV0Z50520514 Keywords : ybxF * ymxC * ribosomes * Bacillus subtilis * GFP * growth phase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.013, year: 2007

  10. Ribosomal PCR and DNA sequencing for detection and identification of bacteria

    DEFF Research Database (Denmark)

    Jensen, Kristine Helander; Dargis, Rimtas; Christensen, Jens Jørgen


    -haemolytic streptococci, especially within the mitis group. The data show that ribosomal PCR with subsequent DNA sequencing of the PCR product is a most valuable supplement to culture for identifying bacterial agents of both acute and prolonged infections. However, some bacteria, including non-haemolytic streptococci...

  11. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation

    NARCIS (Netherlands)

    Fernandez, James; Yaman, Ibrahim; Huang, Charles; Liu, Haiyan; Lopez, Alex B.; Komar, Anton A.; Caprara, Mark G.; Merrick, William C.; Snider, Martin D.; Kaufman, Randal J.; Lamers, Wouter H.; Hatzoglou, Maria


    It was previously shown that the mRNA for the cat-1 Arg/Lys transporter is translated from an internal ribosome entry site (IRES) that is regulated by cellular stress. Amino acid starvation stimulated cat-1 translation via a mechanism that requires translation of an ORF in the mRNA leader and

  12. Development of Soft Tissue Sarcomas in Ribosomal Proteins L5 and S24 Heterozygous Mice

    Czech Academy of Sciences Publication Activity Database

    Kazerounian, S.; Ciarlini, P.D.S.C.; Yuan, D.; Ghazvinian, R.; Alberich-Jorda, Meritxell; Joshi, M.; Zhang, H.; Beggs, A.H.; Gazda, H.T.


    Roč. 7, č. 1 (2016), s. 32-36 ISSN 1837-9664 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Ribosomal proteins RPL5 and RPS24 * Diamond-Blackfan anemia * Soft tissue sarcoma Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.916, year: 2016

  13. Ribosome-inhibiting proteins from in vitro cultures of Phytolacca dodecandra

    DEFF Research Database (Denmark)

    Thomsen, S.; Hansen, Harald S.; Nyman, U.


    Phytolacca dodecandra (L'Herit) grown in cell cultures was investigated for content of ribosome-inhibiting proteins, which was evaluated hy measuring inhibition of protein synthesis in a cell-free rat liver extract. Calli initiated from leaf, cotyledon, radicle, and hypocotyl and suspension cells...

  14. Specific structural probing of plasmid-coded ribosomal RNAs from Escherichia coli

    DEFF Research Database (Denmark)

    Aagaard, C; Rosendahl, G; Dam, M


    The preferred method for construction and in vivo expression of mutagenised Escherichia coli ribosomal RNAs (rRNAs) is via high copy number plasmids. Transcription of wild-type rRNA from the seven chromosomal rrn operons in strains harbouring plasmid-coded mutant rRNAs leads to a heterogeneous...

  15. A rotational diffusion coefficient of the 70s ribosome determined by depolarized laser light scattering

    NARCIS (Netherlands)

    Bruining, J.; Fijnaut, H.M.

    We have obtained a rotational diffusion coefficient of the 70S ribosome isolated from Escherichia-coli (MRE-600), from the depolarized light scattering spectrum measured by photon correlation spectroscopy. The intensity correlation function of depolarized scattered light contains contributions due

  16. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation (United States)

    Xie, Ping


    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  17. Inhibition of p70S6K2 down-regulates Hedgehog/GLI pathway in non-small cell lung cancer cell lines

    Directory of Open Access Journals (Sweden)

    Kotani Hidehito


    Full Text Available Abstract Background The Hedgehog (HH pathway promotes tumorigenesis in a diversity of cancers. Activation of the HH signaling pathway is caused by overexpression of HH ligands or mutations in the components of the HH/GLI1 cascade, which lead to increased transactivation of GLI transcription factors. Although negative kinase regulators that antagonize the activity of GLI transcription factors have been reported, including GSK3β, PKA and CK1s, little is known regarding positive kinase regulators that are suitable for use on cancer therapeutic targets. The present study attempted to identify kinases whose silencing inhibits HH/GLI signalling in non-small cell lung cancer (NSCLC. Results To find positive kinase regulators in the HH pathway, kinome-wide siRNA screening was performed in a NSCLC cell line, A549, harboring the GLI regulatory reporter gene. This showed that p70S6K2-silencing remarkably reduced GLI reporter gene activity. The decrease in the activity of the HH pathway caused by p70S6K2-inhibition was accompanied by significant reduction in cell viability. We next investigated the mechanism for p70S6K2-mediated inhibition of GLI1 transcription by hypothesizing that GSK3β, a negative regulator of the HH pathway, is activated upon p70S6K2-silencing. We found that phosphorylated-GSK3β (Ser9 was reduced by p70S6K2-silencing, causing a decreased level of GLI1 protein. Finally, to further confirm the involvement of p70S6K2 in GLI1 signaling, down-regulation in GLI-mediated transcription by PI3KCA-inhibition was confirmed, establishing the pivotal role of the PI3K/p70S6K2 pathway in GLI1 cascade regulation. Conclusion We report herein that inhibition of p70S6K2, known as a downstream effector of the PI3K pathway, remarkably decreases GLI-mediated transactivation in NSCLC by reducing phosphorylated-GSK3β followed by GLI1 degradation. These results infer that p70S6K2 is a potential therapeutic target for NSCLC with hyperactivated HH/GLI pathway.

  18. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen


    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  19. Bactobolin resistance is conferred by mutations in the L2 ribosomal protein. (United States)

    Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter


    Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins

  20. Remodeling of ribosomal genes in somatic cells by Xenopus egg extract

    Energy Technology Data Exchange (ETDEWEB)

    Ostrup, Olga, E-mail: [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway); Hyttel, Poul; Klaerke, Dan A. [Institute of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Frederiksberg C (Denmark); Collas, Philippe, E-mail: [Stem Cell Epigenetics Laboratory, Institute of Basic Medical Sciences, Faculty of Medicine, University of Oslo, Oslo (Norway); Norwegian Center for Stem Cell Research, Oslo (Norway)


    Highlights: {yields} Xenopus egg extract remodels nuclei and alter cell growth characteristics. {yields} Ribosomal genes are reprogrammed within 6 h after extract exposure. {yields} rDNA reprogramming involves promoter targeting of SNF2H remodeling complex. {yields} Xenopus egg extract does not initiate stress-related response in somatic cells. {yields} Aza-cytidine elicits a stress-induced response in reprogrammed cells. -- Abstract: Extracts from Xenopus eggs can reprogram gene expression in somatic nuclei, however little is known about the earliest processes associated with the switch in the transcriptional program. We show here that an early reprogramming event is the remodeling of ribosomal chromatin and gene expression. This occurs within hours of extract treatment and is distinct from a stress response. Egg extract elicits remodeling of the nuclear envelope, chromatin and nucleolus. Nucleolar remodeling involves a rapid and stable decrease in ribosomal gene transcription, and promoter targeting of the nucleolar remodeling complex component SNF2H without affecting occupancy of the transcription factor UBF and the stress silencers SUV39H1 and SIRT1. During this process, nucleolar localization of UBF and SIRT1 is not altered. On contrary, azacytidine pre-treatment has an adverse effect on rDNA remodeling induced by extract and elicits a stress-type nuclear response. Thus, an early event of Xenopus egg extract-mediated nuclear reprogramming is the remodeling of ribosomal genes involving nucleolar remodeling complex. Condition-specific and rapid silencing of ribosomal genes may serve as a sensitive marker for evaluation of various reprogramming methods.

  1. Absence of ribosomal DNA amplification in the meroistic (telotrophic) ovary of the large milkweed bug Oncopeltus fasciatus (Dallas) (Hemiptera: Lygaeidae) (United States)


    In the typical meroistic insect ovary, the oocyte nucleus synthesizes little if any RNA. Nurse cells or trophocytes actively synthesize ribosomes which are transported to and accumulated by the oocyte. In the telotrophic ovary a morphological separation exists, the nurse cells being localized at the apical end of each ovariole and communicating with the ooocytes via nutritive cords. In order to determine whether the genes coding for ribosomal RNA (rRNA) are amplified in the telotrophic ovary of the milkweed bug Oncopeltus fasciatus, the percentages of the genome coding for ribosomal RNA in somatic cells, spermatogenic cells, ovarian follicles, and nurse cells were compared. The oocytes and most of the nurse cells of O. fasciatus are uninucleolate. DNA hybridizing with ribosomal RNA is localized in a satellite DNA, the density of which is 1.712 g/cm(-3). The density of main-band DNA is 1.694 g/cm(-3). The ribosomal DNA satellite accounts for approximately 0.2% of the DNA in somatic and gametogenic tissues of both males and females. RNA-DNA hybridization analysis demonstrates that approximately 0.03% of the DNA in somatic tissues, testis, ovarian follicles, and isolated nurse cells hybridizes with ribosomal RNA. The fact that the percentage of DNA hybridizing with rRNA is the same in somatic and in male and female gametogenic tissues indicates that amplification of ribosomal DNA does not occur in nurse cells and that if it occurs in oocytes, it represents less than a 50- fold increase in ribosomal DNA. An increase in total genome DNA accounted by polyploidization appears to provide for increasing the amount of ribosomal DNA in the nurse cells. PMID:1158969

  2. Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system

    DEFF Research Database (Denmark)

    Tchórzewski, M; Boldyreff, B; Issinger, O


    The surface acidic ribosomal proteins (P-proteins), together with ribosomal core protein P0 form a multimeric lateral protuberance on the 60 S ribosomal subunit. This structure, also called stalk, is important for efficient translational activity of the ribosome. In order to shed more light...... forms the 60 S ribosomal stalk: P0-(P1/P2)(2). Additionally, mutual interactions among human and yeast P-proteins were analyzed. Heterodimer formation could be observed between human P2 and yeast P1 proteins....

  3. Toxicity of ricin A chain is reduced in mammalian cells by inhibiting its interaction with the ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Jetzt, Amanda E. [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Li, Xiao-Ping; Tumer, Nilgun E. [Department of Plant Biology and Pathology, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States); Cohick, Wendie S., E-mail: [Department of Animal Sciences, Rutgers, The State University of New Jersey, New Brunswick, NJ 08901-8520 (United States)


    Ricin is a potent ribotoxin that is considered a bioterror threat due to its ease of isolation and possibility of aerosolization. In yeast, mutation of arginine residues away from the active site results in a ricin toxin A chain (RTA) variant that is unable to bind the ribosome and exhibits reduced cytotoxicity. The goal of the present work was to determine if these residues contribute to ribosome binding and cytotoxicity of RTA in mammalian cells. The RTA mutant R193A/R235A did not interact with mammalian ribosomes, while a G212E variant with a point mutation near its active site bound ribosomes similarly to wild-type (WT) RTA. R193A/R235A retained full catalytic activity on naked RNA but had reduced activity on mammalian ribosomes. To determine the effect of this mutant in intact cells, pre R193A/R235A containing a signal sequence directing it to the endoplasmic reticulum and mature R193A/R235A that directly targeted cytosolic ribosomes were each expressed. Depurination and protein synthesis inhibition were reduced by both pre- and mature R193A/R235A relative to WT. Protein synthesis inhibition was reduced to a greater extent by R193A/R235A than by G212E. Pre R193A/R235A caused a greater reduction in caspase activation and loss of mitochondrial membrane potential than G212E relative to WT RTA. These findings indicate that an RTA variant with reduced ribosome binding is less toxic than a variant with less catalytic activity but normal ribosome binding activity. The toxin-ribosome interaction represents a novel target for the development of therapeutics to prevent or treat ricin intoxication. - Highlights: • Arginines 193 and 235 of RTA are critical for binding to the mammalian ribosome. • R193A/R235A has full catalytic activity on RNA but not on mammalian ribosomes. • R193A/R235A is less toxic than a mutant that targets the active site. • The toxin-ribosome interaction is a therapeutic target for ricin intoxication.

  4. On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli. (United States)

    Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T


    The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its

  5. Results of the deepest all-sky survey for continuous gravitational waves on LIGO S6 data running on the Einstein@Home volunteer distributed computing project

    NARCIS (Netherlands)

    Abbott, B. P.; Abbott, R.; Abbott, T. D.; Abernathy, M. R.; Acemese, F.; Ackley, K.; Adams, C.; Phythian-Adams, A.T.; Addesso, P.; Adhikari, R. X.; Adya, V. B.; Affeldt, C.; Agathos, M.; Agatsuma, K.; Aggarwa, N.; Aguiar, O. D.; Aiello, L.; Ain, A.; Allen, B.; Allocca, A.; Altin, P. A.; Anderson, S. B.; Anderson, W. G.; Arai, K.; Araya, M. C.; Arceneaux, C. C.; Areeda, J. S.; Arnaud, N.; Arun, K. G.; Ascenzi, S.; Ashton, G.; Ast, M.; Aston, S. M.; Astone, P.; Aufmuth, P.; Aulbert, C.; Babak, S.; Bacon, P.; Bader, M. K. M.; Baker, P. T.; Baldaccini, F.; Ballardin, G.; Ballmer, S. W.; Barayoga, J. C.; Barclay, S. E.; Barish, B. C.; Arker, Bd.; Barone, F.; Barr, B.; Barsotti, L.; Barsuglia, M.; Barta, D.; Bartlett, J.; Bartos, I.; Bassiri, R.; Basti, A.; Batch, J. C.; Baune, C.; Bavigadda, V.; Bazzan, M.; Bejger, M.; Be, A. S.; Berger, B. K.; Bergmann, G.; Berry, C. P. L.; Bersanetti, D.; Bertolini, A.; Betzwieser, J.; Bhagwat, S.; Bhandare, R.; Bilenko, I. A.; Billingsley, G.; Birch, M.J.; Birney, R.; Biscans, S.; Bisht, A.; Bitoss, M.; Biwer, C.; Bizouard, M. A.; Blackburn, J. K.; Blair, C. D.; Blair, D. G.; Blair, R. M.; Bloemen, S.; Bock, O.; Boer, M.; Bogaert, J.G.; Bogan, C.; Bohe, A.; Bond, C.; Bondu, F.; Bonnand, R.; Boom, B. A.; Bork, R.; Boschi, V.; Bose, S.; Boutfanais, Y.; Bozzi, A.; Bradaschia, C.; Brady, P. R.; Braginsky, V. B.; Branchesi, M.; Brau, J. E.; Briant, T.; Brillet, A.; Brinkmann, M.; Brisson, V.; Brockill, P.; Broida, J. E.; Brooks, A. F.; Brown, A.D.; Brown, D.; Brown, N. M.; Brunett, S.; Buchanan, C. C.; Buikema, A.; Bulik, O.; Bulten, H. J.; Buonanno, A.; Buskulic, D.; Buy, C.; Byer, R. L.; Cabero, M.; Cadonati, L.; Cagnoli, C.; Cahillane, C.; Bustillo, J. Calderon; Callister, T. A.; Calloni, E.; Camp, J. B.; Cannon, K. C.; Cao, J.; Capano, C. D.; Capocasa, E.; Carbognani, F.; Caride, S.; Diaz, J. Casanueva; Casentini, C.; Caudill, S.; Cavaglia, M.; Cavalier, F.; Cavalieri, R.; Cella, G.; Cepeda, C. B.; Baiardi, L. Cerboni; Cerretani, G.; Cesarini, E.; Chamberlin, S. J.; Chan, M.; Chao, D. S.; Charlton, P.; Chassande-Mottin, E.; Cheeseboro, B. D.; Chen, H. Y.; Chen, Y; Cheng, C.; Chincarini, A.; Chiummo, A.; Cho, H. S.; Cho, M.; Chow, J. H.; Christensen, N.; Chu, Q.; Chua, S. S. Y.; Chung, S.; Ciani, G.; Clara, F.; Clark, J. A.; Cleva, F.; Coccia, E.; Cohadon, P. -F.; Colla, A.; Collette, C. G.; Cominsky, L.; Constancio, M., Jr.; Conte, A.; Conti, L.; Cook, D.; Corbitt, T. R.; Cornish, N.; Corsi, A.; Cortese, S.; Costa, C. A.; Coughlin, M. W.; Coughlin, S. B.; Coulon, J. -P.; Countryman, S. T.; Couvares, P.; Cowan, E. E.; Coward, D. M.; Cowart, M. J.; Coyne, D. C.; Coyne, R.; Craig, K.; Creighton, J. D. E.; Creighton, T. D.; Cripe, J.; Crowder, S. G.; Cumming, A.; Cunningham, Laura; Cuoco, E.; Dal Canton, T.; Danilishin, S. L.; D'Antonio, S.; Danzmann, K.; Darman, N. S.; Dasgupta, A.; Costa, C. F. Da Silva; Dattilo, V.; Dave, I.; Davier, M.; Davies, G. S.; Daw, E. J.; Day, R.; De, S.; DeBra, D.; Debreczeni, G.; Degallaix, J.; De laurentis, M.; Deleglise, S.; Del Pozzo, W.; Denker, T.; Dent, T.; Dergachev, V.A.; De Rosa, R.; DeRosa, R. T.; DeSalvo, R.; Devine, R. C.; Dhurandhar, S.; Diaz, M. C.; Di Fiore, L.; Giovanni, M. Di; Di Girolamo, T.; Di Lieto, A.; Di Pace, S.; Di Palma, I.; Di Virgilio, A.; Dolique, V.; Donovan, F.; Dooley, K. L.; Doravari, S.; Douglas, R.; Downes, T. P.; Drago, M.; Dreyer, R. W. P.; Driggers, J. C.; Ducrot, M.; Dwyer, S. E.; Edo, T. B.; Edwards, M. C.; Effler, A.; Egizenstein, H. -B.; Ehrens, P.; Eichholel, J.; Eikenberry, S. S.; Engels, W.; Essick, R. C.; Etzel, T.; Evans, M.; Evans, T. M.; Everett, R.; Factourovich, M.; Fafone, O.; Fair, H.; Fairhurst, S.; Fan, X.; Fang, Q.; Farinon, S.; Farr, B.; Far, W. M.; Favata, M.; Fays, M.; Fehrmann, H.; Fejer, M. M.; Fenyvesi, E.; Ferrante, I.; Ferreira, E. C.; Ferrini, F.; Fidecaro, F.; Fiori, I.; Fiorucci, D.; Fisher, R. P.; Flaminio, R.; Fletcher, M.M.; Fournier, J. -D.; Frasca, J. -D; Frasconi, F.; Frei, Z.; Freise, A.; Frey, R.; Frey, V.; Fritsche, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Gabbard, H. A. G.; Gair, J. R.; Gammaitoni, L.; Gaonkar, S. G.; Garuti, F.; Gaur, G.; Gehrels, N.; Gemme, G.; Geng, P.; Genin, E.; Gennai, A.; George, J.; Gergely, L.; Germain, V.; Ghosh, Abhirup; Ghosh, Archisman; Ghosh, S.; Giaime, J. A.; Giardina, K. D.; Giazotto, A.; Gi, K.; Glaetke, A.; Goetz, E.; Goetz, R.; Gondan, L.; Gonzalez, Idelmis G.; Castro, J. M. Gonzalez; Gopakumar, A.; Gordon, N. A.; Gorodetsky, M. L.; Gossan, S. E.; Lee-Gosselin, M.; Gouaty, R.; Grado, A.; Graef, C.; Graff, P. B.; Granata, M.; Granta, A.; Gras, S.; Cray, C.; Greco, G.; Green, A. C.; Groot, P.; Grote, H.; Grunewald, S.; Guidi, G. M.; Guo, X.; Gupta, A.; Gupta, M. K.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hacker, J. J.; Hall, B. R.; Hall, E. D.; Hammond, G.; Haney, M.; Hanke, M. M.; Hanks, J.; Hanna, C.; Hanson, J.; Hardwick, T.; Harms, J.; Harry, G. M.; Harry, I. W.; Hart, M. J.; Hartman, M. T.; Haster, C. -J.; Haughian, K.; Heidmann, A.; Heintze, M. C.; Heitmann, H.; Hello, P.; Hemming, G.; Hendry, M.; Heng, S.; Hennig, J.; Henry, J.A.; Heptonsta, A. W.; Heurs, M.; Hild, S.; Hoak, D.; Hofman, D.; Holt, K.; Holz, D. E.; Hopkins, P.; Hough, J.; Houston, E. A.; Howel, E. J.; Hu, Y. M.; Huang, O.; Huerta, E. A.; Huet, D.; Hughey, B.; Husa, S.; Huttner, S. H.; Huynh-Dinh, T.; Indik, N.; Ingram, D. R.; Inta, R.; Isa, H. N.; Isac, J. -M.; Isi, M.; Isogai, T.; Lyer, B. R.; Fzumi, K.; Jaccimin, T.; Jang, D.H.; Jani, K.; Jaranowski, P.; Jawahar, S.; Jian, L.; Jimenez-Forteza, F.; Johnson, W.; Jones, I.D.; Jones, R.; Jones, R.; Jonker, R. J. G.; Ju, L.; Wads, k; Kalaghatgi, C. V.; Kalogera, V.; Kandhasamy, S.; Kang, G.; Kanner, J. B.; Kapadia, S. J.; Karki, S.; Karvinen, K. S.; Kasprzack, M.; Katsavounidis, E.; Katzman, W.; Kaufer, S.; Kaur, T.; Kawabe, K.; Kefelian, F.; Keh, M. S.; Keite, D.; Kelley, D. B.; Kells, W.; Kennedy, R.E.; Key, J. S.; Khalili, F. Y.; Khan, I.; Khan, S.; Khan, Z.; Khazanov, E. A.; Kijbunchoo, N.; Kim, Chi-Woong; Kim, Chunglee; Kim, J.; Kim, K.; Kim, Namjun; Kim, W.; Kimbre, S. J.; King, E. J.; King, P. J.; Kisse, J. S.; Klein, B.; Kleybolte, L.; Klimenko, S.; Koehlenbeck, S. M.; Koley, S.; Kondrashov, V.; Kontos, A.; Korobko, M.; Korth, W. Z.; Kowalska, I.; Kozak, D. B.; Kringe, V.; Krishnan, B.; Krolak, A.; Krueger, C.; Kuehn, G.; Kumar, P.; Kumar, R.; Kuo, L.; Kutynia, A.; Lackey, B. D.; Landry, M.; Lange, J.; Lantz, B.; Lasky, P. D.; Laxen, M.; Lazzaro, C.; Leaci, P.; Leavey, S.; Lebigot, E. O.; Lee, C. H.; Lee, K.H.; Lee, M.H.; Lee, K.; Lenon, A.; Leonardi, M.; Leong, J. R.; Leroy, N.; Letendre, N.; Levin, Y.; Lewis, J. B.; Li, T. G. F.; Libson, A.; Littenberg, T. B.; Lockerbie, N. A.; Lombardi, A. L.; London, L. T.; Lord, J. E.; Lorenzini, M.; Loriette, V.; Lormand, M.; Losurdo, G.; Lough, J. D.; Liick, H.; Lundgren, A. P.; Lynch, R.; Ivia, Y.; Machenschalk, B.; Maclnnis, M.; Macleod, D. M.; Magafia-Sandoval, F.; Zertuche, L. Magafia; Magee, R. M.; Majorana, E.; Maksimovic, I.; Malvezzi, V.; Man, N.; Mandic, V.; Mangano, V.; Manse, G. L.; Manske, M.; Mantovani, M.; Marchesoni, F.; Marion, F.; Marka, S.; Marka, Z.; Markosyan, A. S.; Maros, E.; Martelli, F.; Martellini, L.; Martin, I. W.; Martynov, D. V.; Marx, J. N.; Mason, K.; Masserot, A.; Massinger, T. J.; Masso-Reid, M.; Mastrogiovanni, S.; Matiehard, F.; Matone, L.; Mavalvala, N.; Mazumder, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McGuire, S. C.; McIntyre, G.; McIver, J.; McManus, D. J.; McRae, T.; McWilliams, S. T.; Meacher, D.; Meadors, G. D.; Meidam, J.; Melatos, A.; Mende, G.; Mercer, R. A.; Merilh, E. L.; Merzougui, M.; Meshkov, S.; Messenger, C.; Messick, C.; Metzdorff, R.; Meyers, P. M.; Mezzani, F.; Miao, H.; Miche, C.; Middleton, H.; Mikhailov, E. E.; Milano, L.; Miller, A. L.; Miller, A.; Miller, B. B.; Miller, J.; Millhouse, M.; Minenkov, Y.; Ming, J.; Mirshekari, S.; Mishra, C.; Mitra, S.; Mitrofanov, V. P.; Mitselmakher, G.; Mittleman, R.; Moggi, A.; Mohan, M.; Mohapatra, S. R. P.; Montani, M.; Moore, B.C.; Moore, C. J.; Moraru, D.; Moreno, G.; Morriss, S. R.; Mossavi, K.; Mours, B.; Mow-Lowry, C. M.; Mueller, G.; Muir, A. W.; Mukherjee, Arunava; Mukherjee, S.D.; Mukherjee, S.; Mukund, N.; Mullavey, A.; Munch, J.; Murphy, D. J.; Murray, P.G.; Mytidis, A.; Nardecehia, I.; Naticchioni, L.; Nayak, R. K.; Nedkova, K.; Nelemans, G.; Nelson, T. J. N.; Gutierrez-Neri, M.; Neunzert, A.; Newton, G.; Nguyen, T. T.; Nielsen, A. B.; Nissanke, S.; Nitz, A.; Nocera, F.; Nolting, D.; Normandin, M. E. N.; Nuttall, L. K.; Oberling, J.; Ochsner, E.; O'Dell, J.; Oelker, E.; Ogin, G. H.; Oh, J. J.; Hang, S.; Ohme, F.; Oliver, M.; Oppermann, P.; Ram, Richard J.; O'Reilly, B.; O'Shaughnessy, R.; Ottaway, D. J.; Overmier, H.; Owen, B. J.; Pai, A.; Pai, S. A.; Palamos, J. R.; Palashov, O.; Palomba, C.; Pal-Singh, A.; Pan, H.; Pankow, C.; Pannarale, F.; Pant, B. C.; Paoletti, F.; Paoli, A.; Papa, M. A.; Paris, H. R.; Parker, W.S; Pascucci, D.; Pasqualetti, A.; Passaquieti, R.; Passuello, D.; Patricelli, B.; Patrick, Z.; Pearlstone, B. L.; Pedraza, M.; Pedurand, R.; Pekowsky, L.; Pele, A.; Penn, S.; Perreca, A.; Perri, L. M.; Phelps, M.; Piccinni, . J.; Pichot, M.; Piergiovanni, F.; Pierro, V.; Pillant, G.; Pinard, L.; Pinto, I. M.; Pitkin, M.; Poe, M.; Poggiani, R.; Popolizio, P.; Post, A.; Powel, J.; Prasad, J.; Predoi, V.; Prestegard, T.; Price, L. R.; Prijatelj, M.; Principe, M.; Privitera, S.; Prix, R.; Prodi, G. A.; Prokhorov, L. G.; Puncken, .; Punturo, M.; Purrer, PuppoM.; Qi, H.; Qin, J.; Qiu, S.; Quetschke, V.; Quintero, E. A.; Quitzow-James, R.; Raab, F. J.; Rabeling, D. S.; Radkins, H.; Raffai, P.; Raja, S.; Rajan, C.; Rakhmanov, M.; Rapagnani, P.; Raymond, V.; Razzano, M.; Re, V.; Read, J.; Reed, C. M.; Regimbau, T.; Rei, L.; Reid, S.; Reitze, D. H.; Rew, H.; Reyes, S. D.; Ricci, F.; Riles, K.; Rizzo, M.; Robertson, N. A.; Robie, R.; Robinet, F.; Rocchi, A.; Rolland, L.; Rollins, J. G.; Roma, V. J.; Romano, R.; Romanov, G.; Romie, J. H.; Rowan, RosiliskaS.; Ruggi, RiidigerP.; Ryan, K.; Sachdev, Perminder S; Sadecki, T.; Sadeghian, L.; Sakellariadou, M.; Salconi, L.; Saleem, M.; Salemi, F.; Samajdar, A.; Sammut, L.; Sanchez, E. J.; Sandberg, V.; Sandeen, B.; Sanders, J. R.; Sassolas, B.; Saulson, P. R.; Sauter, E. S.; Savage, R. L.; Sawadsky, A.; Schale, P.; Schilling, R.; Schmidt, J; Schmidt, P.; Schnabe, R.; Schofield, R. M. S.; Schonbeck, A.; Schreiber, K.E.C.; Schuette, D.; Schutz, B. F.; Scott, J.; Scott, S. M.; Sellers, D.; Sengupta, A. S.; Sentenac, D.; Sequino, V.; Sergeev, A.; Setyawati, Y.; Shaddock, D. A.; Shaffer, T. J.; Shahriar, M. S.; Shaltev, M.; Shapiro, B.; Shawhan, P.; Sheperd, A.; Shoemaker, D. H.; Shoemaker, D. M.; Sielleez, K.; Siemens, X.; Sieniawska, M.; Sigg, D.; Silva, António Dias da; Singer, A.; Singer, L. P.; Singh, A.; Singh, R.; Singhal, A.; Sintes, A. M.; Slagmolen, B. J. J.; Smith, R. J. E.; Smith, N.D.; Smith, R. J. E.; Son, E. J.; Sorazus, B.; Sorrentino, F.; Souradeep, T.; Srivastava, A. K.; Staley, A.; Steinke, M.; Steinlechner, J.; Steinlechner, S.; Steinmeyer, D.; Stephens, B. C.; Stone, R.; Strain, K. A.; Straniero, N.; Stratta, G.; Strauss, N. A.; Strigin, S. E.; Sturani, R.; Stuver, A. L.; Summerscales, T. Z.; Sunil, Suns; Sutton, P. J.; Swinkels, B. L.; Szczepariczyk, M. J.; Tacca, M.; Talukder, D.; Tanner, D. B.; Tapai, M.; Tarabrin, S. P.; Taracchini, A.; Taylor, W.R.; Theeg, T.; Thirugnanasambandam, M. P.; Thomas, E. G.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Tiwari, S.; Tiwari, V.; Tokmakov, K. V.; Toland, K.; Tomlinson, C.; Tonelli, M.; Tomasi, Z.; Torres, C. V.; Tome, C.; Tot, D.; Travasso, F.; Traylor, G.; Trifire, D.; Tringali, M. C.; Trozz, L.; Tse, M.; Turconi, M.; Tuyenbayev, D.; Ugolini, D.; Unnikrishnan, C. S.; Urban, A. L.; Usman, S. A.; Vahlbruch, H.; Valente, G.; Valdes, G.; van Bake, N.; Van Beuzekom, Martin; Van den Brand, J. F. J.; Van Den Broeck, C.F.F.; Vander-Hyde, D. C.; van der Schaaf, L.; Van Heilningen, J. V.; Van Vegge, A. A.; Vardaro, M.; Vass, S.; Vaslith, M.; Vaulin, R.; Vecchio, A.; Vedovato, G.; Veitch, J.; Veitch, P.J.; Venkateswara, K.; Verkindt, D.; Vetrano, F.; Vicere, A.; Vinciguerra, S.; Vine, D. J.; Vinet, J. -Y.; Vitale, S.; Vo, T.; Vocca, H.; Vorvick, C.; Voss, D. V.; Vousden, W. D.; Vyatchanin, S. P.; Wade, A. R.; Wade, L. E.; Wade, MT; Walker, M.; Wallace, L.; Walsh, S.; Vvang, G.; Wang, O.; Wang, X.; Wiang, Y.; Ward, R. L.; Wiarner, J.; Was, M.; Weaver, B.; Wei, L. -W.; Weinert, M.; Weinstein, A. J.; Weiss, R.; Wen, L.; Weliels, P.; Westphal, T.; Wette, K.; Whelan, J. T.; Whiting, B. F.; Williams, D.R.; Williamson, A. R.; Willis, J. L.; WilIke, B.; Wimmer, M. H.; Whinkler, W.; Wipf, C. C.; De Witte, H.; Woan, G.; Woehler, J.; Worden, J.; Wright, J.L.; Wu, D. S.; Wu, G.; Yablon, J.; Yam, W.; Yamamoto, H.; Yancey, C. C.; Yu, H.; Yvert, M.; Zadrozny, A.; Zangrando, L.; Zanolin, M.; Zendri, J. P.; Zevin, M.; Zhang, L.; Zhang, M.; Zhang, Y.; Zhao, C.; Zhou, M.; Zhou, Z.; Zhu, S.J.; Zhu, X.; Zucker, M. E.; Zuraw, S. E.; Zweizig, J.


    We report results of a deep all-sky search for periodic gravitational waves from isolated neutron stars in data from the S6 LIGO science run. The search was possible thanks to the computing power provided by the volunteers of the Einstein@Home distributed computing project. We find no significant

  6. Synthesis, structural, electronic and linear electro-optical features of new quaternary Ag2Ga2SiS6 compound (United States)

    Piasecki, M.; Myronchuk, G. L.; Parasyuk, O. V.; Khyzhun, O. Y.; Fedorchuk, A. O.; Pavlyuk, V. V.; Kozer, V. R.; Sachanyuk, V. P.; El-Naggar, A. M.; Albassam, A. A.; Jedryka, J.; Kityk, I. V.


    For the first time phase equilibria and phase diagram of the AgGaS2-SiS2 system were successfully explored by differential thermal and X-ray phase analysis methods. Crystal structure of low-temperature (LT) modification of Ag2Ga2SiS6 (LT- Ag2Ga2SiS6) was studied by X-ray powder method and it belongs to tetragonal space group I-42d, with unit cell parameters a=5.7164(4) Å, c=9.8023(7) Å, V=320.32(7) Å3. Additional details regarding the crystal structure exploration are available at the web page Fachinformationszentrum Karlsruhe. X-ray photoelectron core-level and valence-band spectra were measured for pristine LT- Ag2Ga2SiS6 crystal surface. In addition, the X-ray photoelectron valence-band spectrum of LT-Ag2Ga2SiS6 was matched on a common energy scale with the X-ray emission S Kβ1,3 and Ga Kβ2 bands, which give information on the energy distribution of the S 3p and Ga 4p states, respectively. The presented X-ray spectroscopy results indicate that the valence S p and Ga p atomic states contribute mainly to the upper and central parts of the valence band of LT-Ag2Ga2SiS6, respectively, with a less significant contribution also to other valence-band regions. Band gap energy was estimated by measuring the quantum energy in the spectral range of the fundamental absorption. We have found that energy gap Eg is equal to 2.35 eV at 300 K. LT-Ag2Ga2SiS6 is a photosensitive material and reveals two spectral maxima on the curve of spectral photoconductivity spectra at λmax1 =590 nm and λmax2 =860 nm. Additionally, linear electro-optical effect of LT-Ag2Ga2SiS6 for the wavelengths of a cw He-Ne laser at 1150 nm was explored.

  7. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    International Nuclear Information System (INIS)

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan


    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20 NLS mutant gene and examined polysome profile of cells that had been transfected with the S20 NLS gene. As a result, we observed the formation of recombinant 40S carried S20 NLS but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20 NLS in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20 NLS in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20 NLS is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20 NLS . • Cytoplasm-retained S20 NLS is crucial for creating a functional small subunit

  8. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    Energy Technology Data Exchange (ETDEWEB)

    Tai, Lin-Ru [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Chou, Chang-Wei [Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China); Wu, Jing-Ying; Kirby, Ralph [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Lin, Alan, E-mail: [Institute of Genome Sciences, School of Life Sciences, National Yang-Ming University, Taipei, Taiwan, ROC (China); Department of Dentistry, School of Dentistry, National Yang-Ming University, Taipei, Taiwan, ROC (China)


    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  9. Influence of supplementation with branched-chain amino acids in combination with resistance exercise on p70S6 kinase phosphorylation in resting and exercising human skeletal muscle. (United States)

    Apró, W; Blomstrand, E


    Skeletal muscle growth is thought to be regulated by the mammalian target of rapamycin (mTOR) pathway, which can be activated by resistance exercise and branched-chain amino acids (BCAA). The major aim of the present study was to distinguish between the influence of resistance exercise and BCAA on key enzymes considered to be involved in the regulation of protein synthesis, including p70(S6) kinase (p70(S6k)). Nine healthy subjects (four men and five women) performed unilateral resistance exercise on two occasions separated by 1 month. Subjects were randomly supplied either a mixture of BCAA or flavoured water. Muscle biopsies were taken from both resting and exercising muscle before, after and 1 h after exercise. Phosphorylation of Akt was unaltered by either resistance exercise and/or BCAA supplementation whereas mTOR phosphorylation was enhanced (Pexercising and resting muscle following exercise in the absence (70-90%) and presence of BCAA supplementation (80-130%). Phosphorylation of p70(S6k) was unaffected by resistance exercise alone; however, BCAA intake increased (Pexercise. In resting muscle, a 5- and 16-fold increase in p70(S6k) was observed immediately after and 1 h after exercise, respectively, as compared to 11- and 30-fold increases in the exercising muscle. Phosphorylation of eukaryotic elongation factor 2 was attenuated 1 h after exercise (Pexercising muscle (30-50%) under both conditions. The present findings indicate that resistance exercise and BCAA exert both separate and combined effects on the p70(S6k) phosphorylation in an Akt-independent manner. © 2010 The Authors. Journal compilation © 2010 Scandinavian Physiological Society.

  10. Inhibition of p70S6K1 Activation by Pdcd4 Overcomes the Resistance to an IGF-1R/IR Inhibitor in Colon Carcinoma Cells. (United States)

    Zhang, Yan; Wang, Qing; Chen, Li; Yang, Hsin-Sheng


    Agents targeting insulin-like growth factor 1 receptor (IGF-1R) are being actively examined in clinical trials. Although there has been some initial success of single-agent targeting IGF-1R, attempts in later studies failed because of resistance. This study aimed to understand the effects of programmed cell death 4 (Pdcd4) on the chemosensitivity of the IGF-1R inhibitor OSI-906 in colorectal cancer cells and the mechanism underlying this impact. Using OSI-906-resistant and -sensitive colorectal cancer cells, we found that the Pdcd4 level directly correlates with cell chemosensitivity to OSI-906. In addition, tumors derived from Pdcd4 knockdown cells resist the growth inhibitory effect of OSI-906 in a colorectal cancer xenograft mouse model. Moreover, Pdcd4 enhances the antiproliferative effect of OSI-906 in resistant cells through suppression of p70S6K1 activation. Knockdown of p70S6K1, but not p70S6K2, significantly increases the chemosensitivity of OSI-906 in cultured colorectal cancer cells. Furthermore, the combination of OSI-906 and PF-4708671, a p70S6K1 inhibitor, efficiently suppresses the growth of OSI-906-resistant colon tumor cells in vitro and in vivo. Taken together, activation of p70S6K1 that is inhibited by Pdcd4 is essential for resistance to the IGF-1R inhibitor in colon tumor cells, and the combinational treatment of OSI-906 and PF-4708671 results in enhanced antiproliferation effects in colorectal cancer cells in vitro and in vivo, providing a novel venue to overcome the resistance to the IGF-1R inhibitor in treating colorectal cancer. ©2015 American Association for Cancer Research.

  11. Protective Effects of Sonic Hedgehog Against Ischemia/Reperfusion Injury in Mouse Skeletal Muscle via AKT/mTOR/p70S6K Signaling

    Directory of Open Access Journals (Sweden)

    Qiu Zeng


    Full Text Available Background/Aims: Skeletal muscle ischemia/reperfusion (I/R injury is a common and severe disease. Sonic hedgehog (Shh plays a critical role in post-natal skeletal muscle regeneration. In the present study, the role of Shh in skeletal muscle I/R injury and the mechanisms involved were investigated. Methods: The expression of Shh, AKT/mTOR/p70S6K and apoptosis pathway components were evaluated following tourniquet-induced skeletal muscle I/R injury. Then, mice were subjected to systemic administration of cyclopamine or one-shot treatment of a plasmid encoding the human Shh gene (phShh to examine the effects of Shh on I/R injury. Moreover, mice were subjected to systemic administration of NVP-BEZ235 to investigate the role of the AKT/mTOR/p70S6K pathway in Shh-triggered skeletal muscle protection. Results: We found that the levels of Shh, AKT/mTOR/p70S6K pathway components and Cleaved Caspase 3 and the Bax/Bcl2 ratio initially increased and then decreased at different time points post-I/R injury. Moreover, Shh protected skeletal muscle against I/R injury by alleviating muscle destruction, reducing interstitial fibrosis and inhibiting apoptosis, and these protective effects were abrogated when the AKT/mTOR/p70S6K pathway was inhibited. Conclusion: Collectively, these data suggest that Shh signaling exerts a protective role through the AKT/mTOR/p70S6K signaling pathway during skeletal muscle I/R injury. Thus, Shh signaling may be a therapeutic target for protecting skeletal muscle from I/R injury.

  12. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs. (United States)

    Campbell, A J; Gasser, R B; Chilton, N B


    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  13. Pioglitazone enhances mitochondrial biogenesis and ribosomal protein biosynthesis in skeletal muscle in polycystic ovary syndrome

    DEFF Research Database (Denmark)

    Skov, Vibe; Glintborg, Dorte; Knudsen, Steen


    indicate that pioglitazone therapy restores insulin sensitivity, in part, by a coordinated upregulation of genes involved in mitochondrial OXPHOS and ribosomal protein biosynthesis in muscle in PCOS. These transcriptional effects of pioglitazone may contribute to prevent the onset of type 2 diabetes...... by changes in the transcriptional profile of muscle favoring insulin sensitivity. Using Affymetrix microarrays, we examined the effect of pioglitazone (30 mg/day for 16 weeks) on gene expression in skeletal muscle of 10 obese women with PCOS metabolically characterized by a euglycemic-hyperinsulinemic clamp...... Annotator and Pathway Profiler (GenMAPP 2.1) and Gene Set Enrichment Analysis (GSEA 2.0.1) revealed a significant upregulation of genes representing mitochondrial oxidative phosphorylation (OXPHOS), ribosomal proteins, mRNA processing reactome, translation factors, and proteasome degradation in PCOS after...

  14. Detection of carriers and genetic counseling in duchenne muscular dystrophy by ribosomal protein synthesis. (United States)

    Ionasescu, V; Zellweger, H; Burmeister, L


    The in vitro protein synthesis by polyribosomes extracted from biopsied muscle (vastus lateralis) was studied in 47 known carriers, 87 possible carriers and in 60 normal females. A significant increase in specific activity of monomeric ribosomes, total polyribosomes and collagen synthesis was found in 46 (97.8 per cent) known carriers and 47 (54 per cent) possible carriers of Duchenne muscular dytrophy. The latter showed an increase in ribosomal protein synthesis in 10 (52.6 per cent) of 19 mothers of isolated cases, 31 (53.3 per cent) of 58 sisters, and 6 (60 per cent) of other female relatives. Serum creatine phosphokinase was increased in 30 (63.8 per cent) of 47 known carriers.


    Directory of Open Access Journals (Sweden)

    Tobias von der Haar


    Full Text Available Translation or protein synthesis consists of a complex system of chemical reactions, which ultimately result in decoding of the mRNA and the production of a protein. The complexity of this reaction system makes it difficult to quantitatively connect its input parameters (such as translation factor or ribosome concentrations, codon composition of the mRNA, or energy availability to output parameters (such as protein synthesis rates or ribosome densities on mRNAs. Mathematical and computational models of translation have now been used for nearly five decades to investigate translation, and to shed light on the relationship between the different reactions in the system. This review gives an overview over the principal approaches used in the modelling efforts, and summarises some of the major findings that were made.

  16. The 2009 Nobel Prize in Chemistry: Thomas A. Steitz and the structure of the ribosome. (United States)

    Zhao, Peter


    Over the past 200 years, there have been countless groundbreaking discoveries in biology and medicine at Yale University. However, one particularly noteworthy discovery with profoundly important and broad consequences happened here in just the past two decades. In 2009, Thomas Steitz, the Sterling Professor of Molecular Biophysics & Biochemistry, was awarded the Nobel Prize in Chemistry for "studies of the structure and function of the ribosome," along with Venkatraman Ramakrishnan of the MRC Laboratory of Molecular Biology and Ada E. Yonath of the Weizmann Institute of Science. This article covers the historical context of Steitz's important discovery, the techniques his laboratory used to study the ribosome, and the impact that this research has had, and will have, on the future of biological and medical research.

  17. Structure of a prehandover mammalian ribosomal SRP·SRP receptor targeting complex. (United States)

    Kobayashi, Kan; Jomaa, Ahmad; Lee, Jae Ho; Chandrasekar, Sowmya; Boehringer, Daniel; Shan, Shu-Ou; Ban, Nenad


    Signal recognition particle (SRP) targets proteins to the endoplasmic reticulum (ER). SRP recognizes the ribosome synthesizing a signal sequence and delivers it to the SRP receptor (SR) on the ER membrane followed by the transfer of the signal sequence to the translocon. Here, we present the cryo-electron microscopy structure of the mammalian translating ribosome in complex with SRP and SR in a conformation preceding signal sequence handover. The structure visualizes all eukaryotic-specific SRP and SR proteins and reveals their roles in stabilizing this conformation by forming a large protein assembly at the distal site of SRP RNA. We provide biochemical evidence that the guanosine triphosphate hydrolysis of SRP·SR is delayed at this stage, possibly to provide a time window for signal sequence handover to the translocon. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  18. Mitochondrial genome evolution in Alismatales: Size reduction and extensive loss of ribosomal protein genes

    DEFF Research Database (Denmark)

    Petersen, Gitte; Cuenca, Argelia; Zervas, Athanasios


    The order Alismatales is a hotspot for evolution of plant mitochondrial genomes characterized by remarkable differences in genome size, substitution rates, RNA editing, retrotranscription, gene loss and intron loss. Here we have sequenced the complete mitogenomes of Zostera marina and Stratiotes...... aloides, which together with previously sequenced mitogenomes from Butomus and Spirodela, provide new evolutionary evidence of genome size reduction, gene loss and transfer to the nucleus. The Zostera mitogenome includes a large portion of DNA transferred from the plastome, yet it is the smallest known...... mitogenome from a non-parasitic plant. Using a broad sample of the Alismatales, the evolutionary history of ribosomal protein gene loss is analyzed. In Zostera almost all ribosomal protein genes are lost from the mitogenome, but only some can be found in the nucleus....

  19. Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

    Directory of Open Access Journals (Sweden)

    Kai-Chun Chang


    Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

  20. Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies

    Directory of Open Access Journals (Sweden)

    Kirsten Kehrein


    Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.

  1. Simultaneous Binding of Multiple EF-Tu Copies to Translating Ribosomes in Live Escherichia coli. (United States)

    Mustafi, Mainak; Weisshaar, James C


    In bacteria, elongation factor Tu is a translational cofactor that forms ternary complexes with aminoacyl-tRNA (aa-tRNA) and GTP. Binding of a ternary complex to one of four flexible L7/L12 units on the ribosome tethers a charged tRNA in close proximity to the ribosomal A site. Two sequential tests for a match between the aa-tRNA anticodon and the current mRNA codon then follow. Because one elongation cycle can occur in as little as 50 ms and the vast majority of aa-tRNA copies are not cognate with the current mRNA codon, this testing must occur rapidly. We present a single-molecule localization and tracking study of fluorescently labeled EF-Tu in live Escherichia coli Imaging at 2 ms/frame distinguishes 60% slowly diffusing EF-Tu copies (assigned as transiently bound to translating ribosome) from 40% rapidly diffusing copies (assigned as a mixture of free ternary complexes and free EF-Tu). Combining these percentages with copy number estimates, we infer that the four L7/L12 sites are essentially saturated with ternary complexes in vivo. The results corroborate an earlier inference that all four sites can simultaneously tether ternary complexes near the A site, creating a high local concentration that may greatly enhance the rate of testing of aa-tRNAs. Our data and a combinatorial argument both suggest that the initial recognition test for a codon-anticodon match occurs in less than 1 to 2 ms per aa-tRNA copy. The results refute a recent study (A. Plochowietz, I. Farrell, Z. Smilansky, B. S. Cooperman, and A. N. Kapanidis, Nucleic Acids Res 45:926-937, 2016, of tRNA diffusion in E. coli that inferred that aa-tRNAs arrive at the ribosomal A site as bare monomers, not as ternary complexes. IMPORTANCE Ribosomes catalyze translation of the mRNA codon sequence into the corresponding sequence of amino acids within the nascent polypeptide chain. Polypeptide elongation can be as fast as 50 ms per added amino acid. Each amino acid

  2. De novo design and engineering of non-ribosomal peptide synthetases (United States)

    Bozhüyük, Kenan A. J.; Fleischhacker, Florian; Linck, Annabell; Wesche, Frank; Tietze, Andreas; Niesert, Claus-Peter; Bode, Helge B.


    Peptides derived from non-ribosomal peptide synthetases (NRPSs) represent an important class of pharmaceutically relevant drugs. Methods to generate novel non-ribosomal peptides or to modify peptide natural products in an easy and predictable way are therefore of great interest. However, although the overall modular structure of NRPSs suggests the possibility of adjusting domain specificity and selectivity, only a few examples have been reported and these usually show a severe drop in production titre. Here we report a new strategy for the modification of NRPSs that uses defined exchange units (XUs) and not modules as functional units. XUs are fused at specific positions that connect the condensation and adenylation domains and respect the original specificity of the downstream module to enable the production of the desired peptides. We also present the use of internal condensation domains as an alternative to other peptide-chain-releasing domains for the production of cyclic peptides.


    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva


    Full Text Available Acute respiratory infections (ARI are widespread in children regardless of age and region of living; they are characterized with big amount of infectious agents and absence of a trend to morbidity decrease. Drugs for nonspecific prophylaxis (immunostimulators and immunomodulatory agents are frequently used for prevention of ARI. There are plenty of immunomodulating agents; the wellstudied medication with systemic action with good efficacy and safety in pediatric practice is ribosomal-proteoglycan complex. The article presents the description of clinical experience of treatment with this complex in pediatric practice.Key words: children, acute respiratory infections, prophylaxis, treatment, ribosomal complex.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:127-130


    Directory of Open Access Journals (Sweden)

    A.A. Alekseeva


    Full Text Available The leading pathology in children is acute respiratory infections (ARI according to the expert data of WHO. The incidence of prolonged and recurrent types of ARI increases during recent years. Patients with these diseases subsequently form the group of children with compromised immunity. Immunogens and immunomodulators are the drugs of nonspecific prophylaxis which are used for the prevention of ARI. The group of bacterial immunomodulators is big but most well-studied systemic drug from this group is Ribomunyl. Ribosomal complex is effective and safe in pediatric practice. The article presents the clinical case of treatment with ribosomal complex in immunocompronised child with allergic pathology.Key words: children with compromised immunity, allergy, acute respiratory infections, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2011; 10 (2: 211–215

  5. Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development

    International Nuclear Information System (INIS)

    Dessen, E.M.B.; Perondini, A.L.P.


    Ribosomal RNA in the salivary gland of Sciara ocellaris during larval development. The molecular weights of the precursor and of the 28S and 18S mature fractions of the ribosomal RNA estimated by poliacrilamid gel electrophoresis are 2.6 X 10 6 D, 1.4 X 10 6 D and 0.68 X 10 6 D, respectively. The in vivo processing of pre-rRNA is very fast since radioactivity could be detected in the mature fractions fifteen minutes after incorporation. The processing rate of salivary pre-rRNA increases after the stage of metamorphosis induction. The in vitro processing of the pre-rRNA is less rapid when compared to that in vivo, and no differences were found in RNAs [pt

  6. D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp. (United States)

    Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K


    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

  7. Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli (United States)

    Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.


    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.

  8. Altered Machinery of Protein Synthesis in Alzheimer's: From the Nucleolus to the Ribosome. (United States)

    Hernández-Ortega, Karina; Garcia-Esparcia, Paula; Gil, Laura; Lucas, José J; Ferrer, Isidre


    Ribosomes and protein synthesis have been reported to be altered in the cerebral cortex at advanced stages of Alzheimer's disease (AD). Modifications in the hippocampus with disease progression have not been assessed. Sixty-seven cases including middle-aged (MA) and AD stages I-VI were analyzed. Nucleolar chaperones nucleolin, nucleophosmin and nucleoplasmin 3, and upstream binding transcription factor RNA polymerase I gene (UBTF) mRNAs are abnormally regulated and their protein levels reduced in AD. Histone modifications dimethylated histone H3K9 (H3K9me2) and acetylated histone H3K12 (H3K12ac) are decreased in CA1. Nuclear tau declines in CA1 and dentate gyrus (DG), and practically disappears in neurons with neurofibrillary tangles. Subunit 28 ribosomal RNA (28S rRNA) expression is altered in CA1 and DG in AD. Several genes encoding ribosomal proteins are abnormally regulated and protein levels of translation initiation factors eIF2α, eIF3η and eIF5, and elongation factor eEF2, are altered in the CA1 region in AD. These findings show alterations in the protein synthesis machinery in AD involving the nucleolus, nucleus and ribosomes in the hippocampus in AD some of them starting at first stages (I-II) preceding neuron loss. These changes may lie behind reduced numbers of dendritic branches and reduced synapses of CA1 and DG neurons which cause hippocampal atrophy. © 2015 International Society of Neuropathology.

  9. Crystal Structure of the Oxazolidinone Antibiotic Linezolid Bound to the 50S Ribosomal Subunit

    Energy Technology Data Exchange (ETDEWEB)

    Ippolito,J.; Kanyo, Z.; Wang, D.; Franceschi, F.; Moore, P.; Steitz, T.; Duffy, E.


    The oxazolidinone antibacterials target the 50S subunit of prokaryotic ribosomes. To gain insight into their mechanism of action, the crystal structure of the canonical oxazolidinone, linezolid, has been determined bound to the Haloarcula marismortui 50S subunit. Linezolid binds the 50S A-site, near the catalytic center, which suggests that inhibition involves competition with incoming A-site substrates. These results provide a structural basis for the discovery of improved oxazolidinones active against emerging drug-resistant clinical strains.

  10. Subcellular localization of Bombyx mori ribosomal protein S3a and ...

    African Journals Online (AJOL)



    Apr 5, 2010 ... In the present study, using a BV/PH-Bms3a-EGFP, we found that Bombyx mori ribosomal protein S3a. (BmS3a) with EGFP fused to its C-terminal, was predominantly localized in the cytoplasm of B. mori cells. Subsequently, to investigate the effect of BmS3a over-expression on BmNPV infection both at the.

  11. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang


    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  12. Neutron scattering and the 30 S ribosomal subunit of E. coli

    International Nuclear Information System (INIS)

    Moore, P.B.; Engelman, D.M.; Langer, J.A.; Ramakrishnan, V.R.; Schindler, D.G.; Schoenborn, B.P.; Sillers, I.Y.; Yabuki, S.


    This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today. 30 references, 5 figures

  13. Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy? (United States)

    Johnson, Arlen W; Ellis, Steve R


    Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917-929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.

  14. Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy?


    Johnson, Arlen W.; Ellis, Steve R.


    Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917–929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.

  15. The primary structures of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui. (United States)

    Hatakeyama, T; Hatakeyama, T; Kimura, M


    The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.

  16. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18 (United States)

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan


    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364

  17. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif. (United States)

    Chan, Y L; Paz, V; Olvera, J; Wool, I G


    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  18. A combined quantitative mass spectrometry and electron microscopy analysis of ribosomal 30S subunit assembly in E. coli. (United States)

    Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R


    Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3' domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3'-domain is unanchored and the 5'-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells.

  19. Translational regulation of ribosomal protein S15 drives characteristic patterns of protein-mRNA epistasis. (United States)

    Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip


    Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.

  20. Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel

    Energy Technology Data Exchange (ETDEWEB)

    Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry; Khabibullina, Nelli F.; Yakimov, Alexander; Shabalin, Konstantin; Utkina, Irina; Travin, Dmitry Y.; Komarova, Ekaterina S.; Serebryakova, Marina; Artamonova, Tatyana; Khodorkovskii, Mikhail; Konevega, Andrey L.; Sergiev, Petr V.; Severinov, Konstantin; Polikanov, Yury S.


    Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering with translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.

  1. The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein. (United States)

    Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P


    The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.

  2. Post-translational modification of ribosomally synthesized peptides by a radical SAM epimerase in Bacillus subtilis (United States)

    Benjdia, Alhosna; Guillot, Alain; Ruffié, Pauline; Leprince, Jérôme; Berteau, Olivier


    Ribosomally synthesized peptides are built out of L-amino acids, whereas D-amino acids are generally the hallmark of non-ribosomal synthetic processes. Here we show that the model bacterium Bacillus subtilis is able to produce a novel type of ribosomally synthesized and post-translationally modified peptide that contains D-amino acids, and which we propose to call epipeptides. We demonstrate that a two [4Fe-4S]-cluster radical S-adenosyl-L-methionine (SAM) enzyme converts L-amino acids into their D-counterparts by catalysing Cα-hydrogen-atom abstraction and using a critical cysteine residue as the hydrogen-atom donor. Unexpectedly, these D-amino acid residues proved to be essential for the activity of a peptide that induces the expression of LiaRS, a major component of the bacterial cell envelope stress-response system. Present in B. subtilis and in several members of the human microbiome, these epipeptides and radical SAM epimerases broaden the landscape of peptidyl structures accessible to living organisms.

  3. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome (United States)

    Long, Katherine S.


    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  4. Resistance to the peptidyl transferase inhibitor tiamulin caused by mutation of ribosomal protein l3. (United States)

    Bøsling, Jacob; Poulsen, Susan M; Vester, Birte; Long, Katherine S


    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ribosomal protein L3, resulting in an Asn149Asp alteration. Complementation experiments and sequencing of transductants demonstrate that the mutation is responsible for the resistance phenotype. Chemical footprinting experiments show a reduced binding of tiamulin to mutant ribosomes. It is inferred that the L3 mutation, which points into the peptidyl transferase cleft, causes tiamulin resistance by alteration of the drug-binding site. This is the first report of a mechanism of resistance to tiamulin unveiled in molecular detail.

  5. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning. (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P


    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Ribosome-induced changes in elongation factor Tu conformation control GTP hydrolysis

    DEFF Research Database (Denmark)

    Villa, Elizabeth; Sengupta, Jayati; Trabuco, Leonard G.


    In translation, elongation factor Tu (EF-Tu) molecules deliver aminoacyl-tRNAs to the mRNA-programmed ribosome. The GTPase activity of EF-Tu is triggered by ribosome-induced conformational changes of the factor that play a pivotal role in the selection of the cognate aminoacyl-tRNAs. We present a 6.......7-A cryo-electron microscopy map of the aminoacyl-tRNA x EF-Tu x GDP x kirromycin-bound Escherichia coli ribosome, together with an atomic model of the complex obtained through molecular dynamics flexible fitting. The model reveals the conformational changes in the conserved GTPase switch regions...... of EF-Tu that trigger hydrolysis of GTP, along with key interactions, including those between the sarcin-ricin loop and the P loop of EF-Tu, and between the effector loop of EF-Tu and a conserved region of the 16S rRNA. Our data suggest that GTP hydrolysis on EF-Tu is controlled through a hydrophobic...

  7. Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use. (United States)

    Atkins, John F; Loughran, Gary; Bhatt, Pramod R; Firth, Andrew E; Baranov, Pavel V


    Genetic decoding is not 'frozen' as was earlier thought, but dynamic. One facet of this is frameshifting that often results in synthesis of a C-terminal region encoded by a new frame. Ribosomal frameshifting is utilized for the synthesis of additional products, for regulatory purposes and for translational 'correction' of problem or 'savior' indels. Utilization for synthesis of additional products occurs prominently in the decoding of mobile chromosomal element and viral genomes. One class of regulatory frameshifting of stable chromosomal genes governs cellular polyamine levels from yeasts to humans. In many cases of productively utilized frameshifting, the proportion of ribosomes that frameshift at a shift-prone site is enhanced by specific nascent peptide or mRNA context features. Such mRNA signals, which can be 5' or 3' of the shift site or both, can act by pairing with ribosomal RNA or as stem loops or pseudoknots even with one component being 4 kb 3' from the shift site. Transcriptional realignment at slippage-prone sequences also generates productively utilized products encoded trans-frame with respect to the genomic sequence. This too can be enhanced by nucleic acid structure. Together with dynamic codon redefinition, frameshifting is one of the forms of recoding that enriches gene expression. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong


    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  9. Salmonella Enterica Serovar Typhimurium BipA Exhibits Two Distinct Ribosome Binding Modes

    Energy Technology Data Exchange (ETDEWEB)

    deLivron, M.; Robinson, V


    BipA is a highly conserved prokaryotic GTPase that functions to influence numerous cellular processes in bacteria. In Escherichia coli and Salmonella enterica serovar Typhimurium, BipA has been implicated in controlling bacterial motility, modulating attachment and effacement processes, and upregulating the expression of virulence genes and is also responsible for avoidance of host defense mechanisms. In addition, BipA is thought to be involved in bacterial stress responses, such as those associated with virulence, temperature, and symbiosis. Thus, BipA is necessary for securing bacterial survival and successful invasion of the host. Steady-state kinetic analysis and pelleting assays were used to assess the GTPase and ribosome-binding properties of S. enterica BipA. Under normal bacterial growth, BipA associates with the ribosome in the GTP-bound state. However, using sucrose density gradients, we demonstrate that the association of BipA and the ribosome is altered under stress conditions in bacteria similar to those experienced during virulence. The data show that this differential binding is brought about by the presence of ppGpp, an alarmone that signals the onset of stress-related events in bacteria.

  10. Predicting the dynamics of bacterial growth inhibition by ribosome-targeting antibiotics (United States)

    Greulich, Philip; Doležal, Jakub; Scott, Matthew; Evans, Martin R.; Allen, Rosalind J.


    Understanding how antibiotics inhibit bacteria can help to reduce antibiotic use and hence avoid antimicrobial resistance—yet few theoretical models exist for bacterial growth inhibition by a clinically relevant antibiotic treatment regimen. In particular, in the clinic, antibiotic treatment is time-dependent. Here, we use a theoretical model, previously applied to steady-state bacterial growth, to predict the dynamical response of a bacterial cell to a time-dependent dose of ribosome-targeting antibiotic. Our results depend strongly on whether the antibiotic shows reversible transport and/or low-affinity ribosome binding (‘low-affinity antibiotic’) or, in contrast, irreversible transport and/or high affinity ribosome binding (‘high-affinity antibiotic’). For low-affinity antibiotics, our model predicts that growth inhibition depends on the duration of the antibiotic pulse, and can show a transient period of very fast growth following removal of the antibiotic. For high-affinity antibiotics, growth inhibition depends on peak dosage rather than dose duration, and the model predicts a pronounced post-antibiotic effect, due to hysteresis, in which growth can be suppressed for long times after the antibiotic dose has ended. These predictions are experimentally testable and may be of clinical significance.

  11. Emergence of robust growth laws from optimal regulation of ribosome synthesis. (United States)

    Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence


    Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

  12. Linezolid-Dependent Function and Structure Adaptation of Ribosomes in a Staphylococcus epidermidis Strain Exhibiting Linezolid Dependence


    Kokkori, Sofia; Apostolidi, Maria; Tsakris, Athanassios; Pournaras, Spyros; Stathopoulos, Constantinos; Dinos, George


    Linezolid-dependent growth was recently reported in Staphylococcus epidermidis clinical strains carrying mutations associated with linezolid resistance. To investigate this unexpected behavior at the molecular level, we isolated active ribosomes from one of the linezolid-dependent strains and we compared them with ribosomes isolated from a wild-type strain. Both strains were grown in the absence and presence of linezolid. Detailed biochemical and structural analyses revealed essential differe...

  13. The pre-existing population of 5S rRNA effects p53 stabilization during ribosome biogenesis inhibition. (United States)

    Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo


    Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.

  14. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation (United States)


    unlimited. Improved Ribosome-Footprint and mRNA Measurements Provide Insights into Dynamics and Regulation of Yeast Translation The views, opinions and...into Dynamics and Regulation of Yeast Translation Report Title Ribosome-footprint profiling provides genome-wide snapshots of translation, but...tend to slow translation. With the improved mRNA measurements, the variation attributable to translational control in exponentially growing yeast was

  15. Alterations at the peptidyl transferase centre of the ribosome induced by the synergistic action of the streptogramins dalfopristin and quinupristin

    Directory of Open Access Journals (Sweden)

    Fucini Paola


    Full Text Available Abstract Background The bacterial ribosome is a primary target of several classes of antibiotics. Investigation of the structure of the ribosomal subunits in complex with different antibiotics can reveal the mode of inhibition of ribosomal protein synthesis. Analysis of the interactions between antibiotics and the ribosome permits investigation of the specific effect of modifications leading to antimicrobial resistances. Streptogramins are unique among the ribosome-targeting antibiotics because they consist of two components, streptogramins A and B, which act synergistically. Each compound alone exhibits a weak bacteriostatic activity, whereas the combination can act bactericidal. The streptogramins A display a prolonged activity that even persists after removal of the drug. However, the mode of activity of the streptogramins has not yet been fully elucidated, despite a plethora of biochemical and structural data. Results The investigation of the crystal structure of the 50S ribosomal subunit from Deinococcus radiodurans in complex with the clinically relevant streptogramins quinupristin and dalfopristin reveals their unique inhibitory mechanism. Quinupristin, a streptogramin B compound, binds in the ribosomal exit tunnel in a similar manner and position as the macrolides, suggesting a similar inhibitory mechanism, namely blockage of the ribosomal tunnel. Dalfopristin, the corresponding streptogramin A compound, binds close to quinupristin directly within the peptidyl transferase centre affecting both A- and P-site occupation by tRNA molecules. Conclusions The crystal structure indicates that the synergistic effect derives from direct interaction between both compounds and shared contacts with a single nucleotide, A2062. Upon binding of the streptogramins, the peptidyl transferase centre undergoes a significant conformational transition, which leads to a stable, non-productive orientation of the universally conserved U2585. Mutations of this r

  16. Formation of covalent linkages between nuclear and protein constituents of ribosomes of E. coli MRE 600 irradiated by gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    Ekert, B; Giocanti, N [Institut du Radium, 91 - Orsay (France)


    Gamma irradiation of E.coli MRE 600 ribosomes in aqueous suspensions led to covalent linkages between the RNA and some ribosomal proteins. The presence of oxygen during the irradiation strongly inhibited this phenomenon. It appears clearly that only a few proteins were able to participate in these cross-linking reactions, which occurred simultaneously in the two sub-units. The radiochemical yield was determined at several concentrations and was relatively low.

  17. Suboptimal T-cell receptor signaling compromises protein translation, ribosome biogenesis, and proliferation of mouse CD8 T cells. (United States)

    Tan, Thomas C J; Knight, John; Sbarrato, Thomas; Dudek, Kate; Willis, Anne E; Zamoyska, Rose


    Global transcriptomic and proteomic analyses of T cells have been rich sources of unbiased data for understanding T-cell activation. Lack of full concordance of these datasets has illustrated that important facets of T-cell activation are controlled at the level of translation. We undertook translatome analysis of CD8 T-cell activation, combining polysome profiling and microarray analysis. We revealed that altering T-cell receptor stimulation influenced recruitment of mRNAs to heavy polysomes and translation of subsets of genes. A major pathway that was compromised, when TCR signaling was suboptimal, was linked to ribosome biogenesis, a rate-limiting factor in both cell growth and proliferation. Defective TCR signaling affected transcription and processing of ribosomal RNA precursors, as well as the translation of specific ribosomal proteins and translation factors. Mechanistically, IL-2 production was compromised in weakly stimulated T cells, affecting the abundance of Myc protein, a known regulator of ribosome biogenesis. Consequently, weakly activated T cells showed impaired production of ribosomes and a failure to maintain proliferative capacity after stimulation. We demonstrate that primary T cells respond to various environmental cues by regulating ribosome biogenesis and mRNA translation at multiple levels to sustain proliferation and differentiation.

  18. The amino terminal end determines the stability and assembling capacity of eukaryotic ribosomal stalk proteins P1 and P2. (United States)

    Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G


    The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.

  19. Cryo-EM structures of the 80S ribosomes from human parasites Trichomonas vaginalis and Toxoplasma gondii

    Institute of Scientific and Technical Information of China (English)

    Zhifei Li; Qiang Guo; Lvqin Zheng; Yongsheng Ji; Yi-Ting Xie; De-Hua Lai; Zhao-Rong Lun; Xun Suo; Ning Gao


    As an indispensable molecular machine universal in all living organisms,the ribosome has been selected by evolution to be the natural target of many antibiotics and small-molecule inhibitors.High-resolution structures of pathogen ribosomes are crucial for understanding the general and unique aspects of translation control in disease-causing microbes.With cryo-electron microscopy technique,we have determined structures of the cytosolic ribosomes from two human parasites,Trichomonas vaginalis and Toxoplasma gondii,at resolution of 3.2-3.4,(A).Although the ribosomal proteins from both pathogens are typical members of eukaryotic families,with a co-evolution pattern between certain species-specific insertions/extensions and neighboring ribosomal RNA (rRNA) expansion segments,the sizes of their rRNAs are sharply different.Very interestingly,rRNAs of T.vaginalis are in size comparable to prokaryotic counterparts,with nearly all the eukaryote-specific rRNA expansion segments missing.These structures facilitate the dissection of evolution path for ribosomal proteins and RNAs,and may aid in design of novel translation inhibitors.

  20. The ribosome biogenesis factor Nol11 is required for optimal rDNA transcription and craniofacial development in Xenopus.

    Directory of Open Access Journals (Sweden)

    John N Griffin


    Full Text Available The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival.

  1. Dwell-Time Distribution, Long Pausing and Arrest of Single-Ribosome Translation through the mRNA Duplex. (United States)

    Xie, Ping


    Proteins in the cell are synthesized by a ribosome translating the genetic information encoded on the single-stranded messenger RNA (mRNA). It has been shown that the ribosome can also translate through the duplex region of the mRNA by unwinding the duplex. Here, based on our proposed model of the ribosome translation through the mRNA duplex we study theoretically the distribution of dwell times of the ribosome translation through the mRNA duplex under the effect of a pulling force externally applied to the ends of the mRNA to unzip the duplex. We provide quantitative explanations of the available single molecule experimental data on the distribution of dwell times with both short and long durations, on rescuing of the long paused ribosomes by raising the pulling force to unzip the duplex, on translational arrests induced by the mRNA duplex and Shine-Dalgarno(SD)-like sequence in the mRNA. The functional consequences of the pauses or arrests caused by the mRNA duplex and the SD sequence are discussed and compared with those obtained from other types of pausing, such as those induced by "hungry" codons or interactions of specific sequences in the nascent chain with the ribosomal exit tunnel.

  2. Rapamycin inhibits mTOR/p70S6K activation in CA3 region of the hippocampus of the rat and impairs long term memory. (United States)

    Lana, D; Di Russo, J; Mello, T; Wenk, G L; Giovannini, M G


    The present study was aimed at establishing whether the mTOR pathway and its downstream effector p70S6K in CA3 pyramidal neurons are under the modulation of the cholinergic input to trigger the formation of long term memories, similar to what we demonstrated in CA1 hippocampus. We performed in vivo behavioral experiments using the step down inhibitory avoidance test in adult Wistar rats to evaluate memory formation under different conditions. We examined the effects of rapamycin, an inhibitor of mTORC1 formation, scopolamine, a muscarinic receptor antagonist or mecamylamine, a nicotinic receptor antagonist, on short and long term memory formation and on the functionality of the mTOR pathway. Acquisition was conducted 30min after i.c.v. injection of rapamycin. Recall testing was performed 1h, 4h or 24h after acquisition. We found that (1) mTOR and p70S6K activation in CA3 pyramidal neurons were involved in long term memory formation; (2) rapamycin significantly inhibited mTOR and of p70S6K activation at 4h, and long term memory impairment 24h after acquisition; (3) scopolamine impaired short but not long term memory, with an early increase of mTOR/p70S6K activation at 1h followed by stabilization at longer times; (4) mecamylamine and scopolamine co-administration impaired short term memory at 1h and 4h and reduced the scopolamine-induced increase of mTOR/p70S6K activation at 1h and 4h; (5) mecamylamine and scopolamine treatment did not impair long term memory formation; (6) unexpectedly, rapamycin increased mTORC2 activation in microglial cells. Our results demonstrate that in CA3 pyramidal neurons the mTOR/p70S6K pathway is under the modulation of the cholinergic system and is involved in long-term memory encoding, and are consistent with the hypothesis that the CA3 region of the hippocampus is involved in memory mechanisms based on rapid, one-trial object-place learning and recall. Furthermore, our results are in accordance with previous reports that selective

  3. Roles of Transcriptional and Translational Control Mechanisms in Regulation of Ribosomal Protein Synthesis in Escherichia coli. (United States)

    Burgos, Hector L; O'Connor, Kevin; Sanchez-Vazquez, Patricia; Gourse, Richard L


    Bacterial ribosome biogenesis is tightly regulated to match nutritional conditions and to prevent formation of defective ribosomal particles. In Escherichia coli , most ribosomal protein (r-protein) synthesis is coordinated with rRNA synthesis by a translational feedback mechanism: when r-proteins exceed rRNAs, specific r-proteins bind to their own mRNAs and inhibit expression of the operon. It was recently discovered that the second messenger nucleotide guanosine tetra and pentaphosphate (ppGpp), which directly regulates rRNA promoters, is also capable of regulating many r-protein promoters. To examine the relative contributions of the translational and transcriptional control mechanisms to the regulation of r-protein synthesis, we devised a reporter system that enabled us to genetically separate the cis -acting sequences responsible for the two mechanisms and to quantify their relative contributions to regulation under the same conditions. We show that the synthesis of r-proteins from the S20 and S10 operons is regulated by ppGpp following shifts in nutritional conditions, but most of the effect of ppGpp required the 5' region of the r-protein mRNA containing the target site for translational feedback regulation and not the promoter. These results suggest that most regulation of the S20 and S10 operons by ppGpp following nutritional shifts is indirect and occurs in response to changes in rRNA synthesis. In contrast, we found that the promoters for the S20 operon were regulated during outgrowth, likely in response to increasing nucleoside triphosphate (NTP) levels. Thus, r-protein synthesis is dynamic, with different mechanisms acting at different times. IMPORTANCE Bacterial cells have evolved complex and seemingly redundant strategies to regulate many high-energy-consuming processes. In E. coli , synthesis of ribosomal components is tightly regulated with respect to nutritional conditions by mechanisms that act at both the transcription and translation steps. In

  4. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription

    International Nuclear Information System (INIS)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia


    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. - Highlights: • RINT-1 is a novel MSP58-interacting protein. • RINT-1 is a nucleolar protein that suppresses ribosomal RNA gene transcription. • RINT-1 and MSP58 cooperate to suppress ribosomal RNA gene transcription. • RINT-1, MSP58, and UBF form a complex on the rDNA promoter.

  5. Anisotropic thermal properties and ferroelectric phase transitions in layered CuInP2S6 and CuInP2Se6 crystals (United States)

    Liubachko, V.; Shvalya, V.; Oleaga, A.; Salazar, A.; Kohutych, A.; Pogodin, A.; Vysochanskii, Yu. M.


    Thermal diffusivity and thermal conductivity have been studied for the layered crystals CuInP2S6, CuInP2Se6 from 30 K to 350 K, showing a relevant thermal anisotropy. Heat is much more efficiently transferred within the layers than perpendicular to them. The ferrielectric transition in CuInP2S6 is proven to be clearly first order while the ferroelectric one in CuInP2Se6 has a weak first order character. The behavior of the thermal conductivity as a function of temperature in the ferroelectric phases shows that heat conduction is phonon driven. Disorder in the paraelectric phases due to hopping motions of Cu ions significantly reduces the thermal conductivity to extremely low values.

  6. Lean and Obese Zucker Rat Extensor Digitorum Longus Muscle high-frequency electrical stimulation (HFES Data: Regulation of p70S6kinase Associated Proteins

    Directory of Open Access Journals (Sweden)

    Kevin M. Rice


    Full Text Available Anaerobic exercise has been advocated as a prescribed treatment for the management of diabetes: however, alterations in exercise-induced signaling remain largely unexplored in the diabetic muscle. Here, we compare the basal and the in situ contraction-induced phosphorylation of the AKT, GSK3beta, mTor, p70s6K, Pten, and Shp2 in the lean and obese (fa/fa Zucker rat Extensor Digitorum Longus (EDL muscle following a single bout of contractile stimuli. This article represents data associated with prior publications from our lab (Katta et al., 2009a, 2009b; Tullgren et al., 1991 [1–3] and concurrent Data in Brief articles (Ginjupalli et al., 2017a, 2017b; Rice et al., 2017a, 2017b [4–7]. Keywords: Diabetes, Skeletal muscle, High-frequency electrical stimulation (HFES, Zucker rat, Extensor Digitorum Longus, p70s6k

  7. Experimental infection of chickens and turkeys with Mycoplasma gallisepticum reference strain S6 and North Carolina field isolate RAPD type B. (United States)

    Sanei, B; Barnes, H J; Vaillancourt, J P; Leyc, D H


    During an epidemic of mycoplasmosis in chicken and turkey flocks in North Carolina between 1999 and 2001, isolates of Mycoplasma gallisepticum (MG) from affected flocks were characterized by random amplification of polymorphic DNA (RAPD), and eight distinct RAPD types were identified. MG RAPD type B accounted for more than 90% of the isolates and was associated with moderate-to-severe clinical signs and mortality. The virulence of MG RAPD type B for chickens and turkeys was compared with sham-inoculated negative controls and MG S6 (a virulent strain)-inoculated positive controls. Clinical signs occurred in chickens and turkeys inoculated with either MG RAPD type B or MG S6. However, they were not as frequent or severe as those seen in naturally affected flocks, and there was no mortality in the experimental groups. Based on gross and microscopic findings, MG RAPD type B was equal to or more virulent than MG S6. All MG-inoculated birds were culture and PCR positive at 7 and 14 days postinoculation (PI). Among serological tests, the serum plate agglutination test was positive for the majority of chickens and turkeys (58%-100%) infected with either strain of MG at both 7 and 14 days PI. The hemagglutination inhibition test was negative for all birds at 7 days PI and positive for a few chickens (8%-17%) and several turkey sera (40%-60%) at 14 days PI. Only a single serum was positive by enzyme-linked immunosorbent assay (an MG S6-infected turkey) at 14 days PI.

  8. S6K1 in the central nervous system regulates energy expenditure via MC4R/CRH pathways in response to deprivation of an essential amino acid. (United States)

    Xia, Tingting; Cheng, Ying; Zhang, Qian; Xiao, Fei; Liu, Bin; Chen, Shanghai; Guo, Feifan


    It is well established that the central nervous system (CNS), especially the hypothalamus, plays an important role in regulating energy homeostasis and lipid metabolism. We have previously shown that hypothalamic corticotropin-releasing hormone (CRH) is critical for stimulating fat loss in response to dietary leucine deprivation. The molecular mechanisms underlying the CNS regulation of leucine deprivation-stimulated fat loss are, however, still largely unknown. Here, we used intracerebroventricular injection of adenoviral vectors to identify a novel role for hypothalamic p70 S6 kinase 1 (S6K1), a major downstream effector of the kinase mammalian target of rapamycin, in leucine deprivation stimulation of energy expenditure. Furthermore, we show that the effect of hypothalamic S6K1 is mediated by modulation of Crh expression in a melanocortin-4 receptor-dependent manner. Taken together, our studies provide a new perspective for understanding the regulation of energy expenditure by the CNS and the importance of cross-talk between nutritional control and regulation of endocrine signals.

  9. Assembly of the 30S subunit from Escherichia coli ribosomes occurs via two assembly domains which are initiated by S4 and S7

    International Nuclear Information System (INIS)

    Nowotny, V.; Nierhaus, K.H.


    A protein which initiates assembly of ribosomes is defined as a protein which binds to the respective rRNA without cooperativity (i.e., without the help of other proteins) during the onset of assembly and is essential for the formation of active ribosomal subunits. The number of proteins binding without cooperativity was determined by monitoring the reconstitution output of active particles at various inputs of 16S rRNA, in the present of constant amounts of 30S-derived proteins (TP30): This showed that only two of the proteins of the 30S subunit are assembly-initiator proteins. These two proteins are still present on a LiCl core particle comprising 16S rRNA and 12 proteins (including minor proteins). The 12 proteins were isolated, and a series of reconstitution experiments at various levels of rRNA excess demonstrated that S4 and S7 are the initiator proteins. Pulse-chase experiments performed during the early assembly with 14 C- and 3 H-labeled TP30 and the determination of the 14 C/ 3 H ratio of the individual proteins within the assembled particles revealed a bilobal structure of the 30S assembly: A group of six proteins headed by S4 (namely, S4, S20, S16, S15, S6, and S18) resisted the chasing most efficiently (S4 assembly domain). None of the proteins depending on S7 during assembly were found in this group but rather in a second group with intermediate chasing stability [S7 assembly domain; consisting of S7, S9, (S8), S19, and S3]. A number of proteins could be fully chased during the early assembly and therefore represent late assembly proteins (S10, S5, S13, S2, S21, S1). These findings fit well with the 30S assembly map. These data, together with the assembly map, imply that S8 and S5 play an important role in the interconnection of the two assembly domains

  10. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene]. (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong


    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  11. Table_S6.xls

    Indian Academy of Sciences (India)


    369, 6, 406, -0.01, 0.0057, 0.0108. 370, 7, 334, -0.048, 0.0081, 0.0264. 371. 372, 48, 1vzwA, 1, 224, 0.005, 0.005, 0. 373, 2, 224, 0.005, 0.005, 0. 374, 3, 224, 0.005, 0.005, 0. 375, 4, 222, 0.004, 0.0053, 0.0061. 376, 5, 221, -0.001, 0.0043, 0.0079. 377, 6, 213, 0.01, 0.0049, 0.0153. 378. 379, 49, 1xagA, 1, 353, 0.001, 0.0008 ...

  12. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast.

    Directory of Open Access Journals (Sweden)

    Joseph C Sanchez


    Full Text Available A form of dwarfism known as Meier-Gorlin syndrome (MGS is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5. These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45. The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C. We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  13. Defective replication initiation results in locus specific chromosome breakage and a ribosomal RNA deficiency in yeast. (United States)

    Sanchez, Joseph C; Kwan, Elizabeth X; Pohl, Thomas J; Amemiya, Haley M; Raghuraman, M K; Brewer, Bonita J


    A form of dwarfism known as Meier-Gorlin syndrome (MGS) is caused by recessive mutations in one of six different genes (ORC1, ORC4, ORC6, CDC6, CDT1, and MCM5). These genes encode components of the pre-replication complex, which assembles at origins of replication prior to S phase. Also, variants in two additional replication initiation genes have joined the list of causative mutations for MGS (Geminin and CDC45). The identity of the causative MGS genetic variants strongly suggests that some aspect of replication is amiss in MGS patients; however, little evidence has been obtained regarding what aspect of chromosome replication is faulty. Since the site of one of the missense mutations in the human ORC4 alleles is conserved between humans and yeast, we sought to determine in what way this single amino acid change affects the process of chromosome replication, by introducing the comparable mutation into yeast (orc4Y232C). We find that yeast cells with the orc4Y232C allele have a prolonged S-phase, due to compromised replication initiation at the ribosomal DNA (rDNA) locus located on chromosome XII. The inability to initiate replication at the rDNA locus results in chromosome breakage and a severely reduced rDNA copy number in the survivors, presumably helping to ensure complete replication of chromosome XII. Although reducing rDNA copy number may help ensure complete chromosome replication, orc4Y232C cells struggle to meet the high demand for ribosomal RNA synthesis. This finding provides additional evidence linking two essential cellular pathways-DNA replication and ribosome biogenesis.

  14. Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes

    Directory of Open Access Journals (Sweden)

    Milbury Coren A


    Full Text Available Abstract Background Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. Results In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Conclusions Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

  15. RINT-1 interacts with MSP58 within nucleoli and plays a role in ribosomal gene transcription. (United States)

    Yang, Chuan-Pin; Kuo, Yu-Liang; Lee, Yi-Chao; Lee, Kuen-Haur; Chiang, Chi-Wu; Wang, Ju-Ming; Hsu, Che-Chia; Chang, Wen-Chang; Lin, Ding-Yen


    The nucleolus is the cellular site of ribosomal (r)DNA transcription and ribosome biogenesis. The 58-kDa microspherule protein (MSP58) is a nucleolar protein involved in rDNA transcription and cell proliferation. However, regulation of MSP58-mediated rDNA transcription remains unknown. Using a yeast two-hybrid system with MSP58 as bait, we isolated complementary (c)DNA encoding Rad50-interacting protein 1 (RINT-1), as a MSP58-binding protein. RINT-1 was implicated in the cell cycle checkpoint, membrane trafficking, Golgi apparatus and centrosome dynamic integrity, and telomere length control. Both in vitro and in vivo interaction assays showed that MSP58 directly interacts with RINT-1. Interestingly, microscopic studies revealed the co-localization of MSP58, RINT-1, and the upstream binding factor (UBF), a rRNA transcription factor, in the nucleolus. We showed that ectopic expression of MSP58 or RINT-1 resulted in decreased rRNA expression and rDNA promoter activity, whereas knockdown of MSP58 or RINT-1 by siRNA exerted the opposite effect. Coexpression of MSP58 and RINT-1 robustly decreased rRNA synthesis compared to overexpression of either protein alone, whereas depletion of RINT-1 from MSP58-transfected cells enhanced rRNA synthesis. We also found that MSP58, RINT-1, and the UBF were associated with the rDNA promoter using a chromatin immunoprecipitation assay. Because aberrant ribosome biogenesis contributes to neoplastic transformation, our results revealed a novel protein complex involved in the regulation of rRNA gene expression, suggesting a role for MSP58 and RINT-1 in cancer development. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Plastid-Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae. (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A; Jansen, Robert K


    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid-nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Plastid–Nuclear Interaction and Accelerated Coevolution in Plastid Ribosomal Genes in Geraniaceae (United States)

    Weng, Mao-Lun; Ruhlman, Tracey A.; Jansen, Robert K.


    Plastids and mitochondria have many protein complexes that include subunits encoded by organelle and nuclear genomes. In animal cells, compensatory evolution between mitochondrial and nuclear-encoded subunits was identified and the high mitochondrial mutation rates were hypothesized to drive compensatory evolution in nuclear genomes. In plant cells, compensatory evolution between plastid and nucleus has rarely been investigated in a phylogenetic framework. To investigate plastid–nuclear coevolution, we focused on plastid ribosomal protein genes that are encoded by plastid and nuclear genomes from 27 Geraniales species. Substitution rates were compared for five sets of genes representing plastid- and nuclear-encoded ribosomal subunit proteins targeted to the cytosol or the plastid as well as nonribosomal protein controls. We found that nonsynonymous substitution rates (dN) and the ratios of nonsynonymous to synonymous substitution rates (ω) were accelerated in both plastid- (CpRP) and nuclear-encoded subunits (NuCpRP) of the plastid ribosome relative to control sequences. Our analyses revealed strong signals of cytonuclear coevolution between plastid- and nuclear-encoded subunits, in which nonsynonymous substitutions in CpRP and NuCpRP tend to occur along the same branches in the Geraniaceae phylogeny. This coevolution pattern cannot be explained by physical interaction between amino acid residues. The forces driving accelerated coevolution varied with cellular compartment of the sequence. Increased ω in CpRP was mainly due to intensified positive selection whereas increased ω in NuCpRP was caused by relaxed purifying selection. In addition, the many indels identified in plastid rRNA genes in Geraniaceae may have contributed to changes in plastid subunits. PMID:27190001

  18. Ribosomal Stalk Protein Silencing Partially Corrects the ΔF508-CFTR Functional Expression Defect.

    Directory of Open Access Journals (Sweden)

    Guido Veit


    Full Text Available The most common cystic fibrosis (CF causing mutation, deletion of phenylalanine 508 (ΔF508 or Phe508del, results in functional expression defect of the CF transmembrane conductance regulator (CFTR at the apical plasma membrane (PM of secretory epithelia, which is attributed to the degradation of the misfolded channel at the endoplasmic reticulum (ER. Deletion of phenylalanine 670 (ΔF670 in the yeast oligomycin resistance 1 gene (YOR1, an ABC transporter of Saccharomyces cerevisiae phenocopies the ΔF508-CFTR folding and trafficking defects. Genome-wide phenotypic (phenomic analysis of the Yor1-ΔF670 biogenesis identified several modifier genes of mRNA processing and translation, which conferred oligomycin resistance to yeast. Silencing of orthologues of these candidate genes enhanced the ΔF508-CFTR functional expression at the apical PM in human CF bronchial epithelia. Although knockdown of RPL12, a component of the ribosomal stalk, attenuated the translational elongation rate, it increased the folding efficiency as well as the conformational stability of the ΔF508-CFTR, manifesting in 3-fold augmented PM density and function of the mutant. Combination of RPL12 knockdown with the corrector drug, VX-809 (lumacaftor restored the mutant function to ~50% of the wild-type channel in primary CFTRΔF508/ΔF508 human bronchial epithelia. These results and the observation that silencing of other ribosomal stalk proteins partially rescue the loss-of-function phenotype of ΔF508-CFTR suggest that the ribosomal stalk modulates the folding efficiency of the mutant and is a potential therapeutic target for correction of the ΔF508-CFTR folding defect.

  19. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Nichols, C. E. [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom); Johnson, C.; Lamb, H. K. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Lockyer, M. [Arrow Therapeutics Ltd, Britannia House, Trinity Street, Borough, London SE1 1DA (United Kingdom); Charles, I. G. [The Wolfson Institute for Biomedical Research, The Cruciform Building, University College London, Gower Street, London WC1E 6BT (United Kingdom); Hawkins, A. R. [Institute of Cell and Molecular Biosciences, Catherine Cookson Building, Medical School, Framlington Place, Newcastle University, Newcastle-upon-Tyne NE2 4HH (United Kingdom); Stammers, D. K., E-mail: [Division of Structural Biology, The Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)


    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs.

  20. An approach to analyse the specific impact of rapamycin on mRNA-ribosome association

    Directory of Open Access Journals (Sweden)

    Jaquier-Gubler Pascale


    Full Text Available Abstract Background Recent work, using both cell culture model systems and tumour derived cell lines, suggests that the differential recruitment into polysomes of mRNA populations may be sufficient to initiate and maintain tumour formation. Consequently, a major effort is underway to use high density microarray profiles to establish molecular fingerprints for cells exposed to defined drug regimes. The aim of these pharmacogenomic approaches is to provide new information on how drugs can impact on the translational read-out within a defined cellular background. Methods We describe an approach that permits the analysis of de-novo mRNA-ribosome association in-vivo during short drug exposures. It combines hypertonic shock, polysome fractionation and high-throughput analysis to provide a molecular phenotype of translationally responsive transcripts. Compared to previous translational profiling studies, the procedure offers increased specificity due to the elimination of the drugs secondary effects (e.g. on the transcriptional read-out. For this pilot "proof-of-principle" assay we selected the drug rapamycin because of its extensively studied impact on translation initiation. Results High throughput analysis on both the light and heavy polysomal fractions has identified mRNAs whose re-recruitment onto free ribosomes responded to short exposure to the drug rapamycin. The results of the microarray have been confirmed using real-time RT-PCR. The selective down-regulation of TOP transcripts is also consistent with previous translational profiling studies using this drug. Conclusion The technical advance outlined in this manuscript offers the possibility of new insights into mRNA features that impact on translation initiation and provides a molecular fingerprint for transcript-ribosome association in any cell type and in the presence of a range of drugs of interest. Such molecular phenotypes defined pre-clinically may ultimately impact on the evaluation of

  1. Structure of the ribosomal interacting GTPase YjeQ from the enterobacterial species Salmonella typhimurium

    International Nuclear Information System (INIS)

    Nichols, C. E.; Johnson, C.; Lamb, H. K.; Lockyer, M.; Charles, I. G.; Hawkins, A. R.; Stammers, D. K.


    The X-ray crystal structure of the GTPase YjeQ from S. typhimurium is presented and compared with those of orthologues from T. maritima and B. subtilis. The YjeQ class of P-loop GTPases assist in ribosome biogenesis and also bind to the 30S subunit of mature ribosomes. YjeQ ribosomal binding is GTP-dependent and thought to specifically direct protein synthesis, although the nature of the upstream signal causing this event in vivo is as yet unknown. The attenuating effect of YjeQ mutants on bacterial growth in Escherichia coli makes it a potential target for novel antimicrobial agents. In order to further explore the structure and function of YjeQ, the isolation, crystallization and structure determination of YjeQ from the enterobacterial species Salmonella typhimurium (StYjeQ) is reported. Whilst the overall StYjeQ fold is similar to those of the previously reported Thematoga maritima and Bacillus subtilis orthologues, particularly the GTPase domain, there are larger differences in the three OB folds. Although the zinc-finger secondary structure is conserved, significant sequence differences alter the nature of the external surface in each case and may reflect varying signalling pathways. Therefore, it may be easier to develop YjeQ-specific inhibitors that target the N- and C-terminal regions, disrupting the metabolic connectivity rather than the GTPase activity. The availability of coordinates for StYjeQ will provide a significantly improved basis for threading Gram-negative orthologue sequences and in silico compound-screening studies, with the potential for the development of species-selective drugs

  2. Ribosomal RNA gene sequences confirm that protistan endoparasite of larval cod Gadus morhua is Ichthyodinium sp

    DEFF Research Database (Denmark)

    Skovgaard, Alf; Meyer, Stefan; Overton, Julia Lynne


    An enigmatic protistan endoparasite found in eggs and larvae of cod Gadus morhua and turbot Psetta maxima was isolated from Baltic cod larvae, and DNA was extracted for sequencing of the parasite's small Subunit ribosomal RNA (SSU rRNA) gene. The endoparasite has previously been suggested...... to be related to Ichthyodinium chabelardi, a dinoflagellate-like protist that parasitizes yolk sacs of embryos and larvae of a variety of fish species. Comparison of a 1535 bp long fragment of the SSU rRNA gene of the cod endoparasite showed absolute identify with I. chabelardi, demonstrating that the 2...

  3. Evolutionary Conservation of the Ribosomal Biogenesis Factor Rbm19/Mrd1: Implications for Function


    Kallberg, Yvonne; Segerstolpe, Åsa; Lackmann, Fredrik; Persson, Bengt; Wieslander, Lars


    Ribosome biogenesis in eukaryotes requires coordinated folding and assembly of a pre-rRNA into sequential pre-rRNA-protein complexes in which chemical modifications and RNA cleavages occur. These processes require many small nucleolar RNAs (snoRNAs) and proteins. Rbm19/Mrd1 is one such protein that is built from multiple RNA-binding domains (RBDs). We find that Rbm19/Mrd1 with five RBDs is present in all branches of the eukaryotic phylogenetic tree, except in animals and Choanoflagellates, th...

  4. Secondary structure of prokaryotic 5S ribosomal ribonucleic acids: a study with ribonucleases

    DEFF Research Database (Denmark)

    Douthwaite, S; Garrett, R A


    The structures of 5S ribosomal RNAs from Escherichia coli and Bacillus stearothermophilus were examined by using ribonucleases A, T1, and T2 and a double helix specific cobra venom ribonuclease. By using both 5' and 3'-32P-end labeling methods and selecting for digested but intact 5S RNA molecules...... evidence for three of the helical regions of the Fox and Woese model of 5S RNA [Fox, G. E., & Woese, C. (1975) Nature (London) 256, 505] and support other important structural features which include a nucleotide looped out from a helical region which has been proposed as a recognition site for protein L18....

  5. Resistance to the Peptidyl Transferase Inhibitor Tiamulin Caused by Mutation of Ribosomal Protein L3


    Bøsling, Jacob; Poulsen, Susan M.; Vester, Birte; Long, Katherine S.


    The antibiotic tiamulin targets the 50S subunit of the bacterial ribosome and interacts at the peptidyl transferase center. Tiamulin-resistant Escherichia coli mutants were isolated in order to elucidate mechanisms of resistance to the drug. No mutations in the rRNA were selected as resistance determinants using a strain expressing only a plasmid-encoded rRNA operon. Selection in a strain with all seven chromosomal rRNA operons yielded a mutant with an A445G mutation in the gene coding for ri...

  6. Ribosome formation from subunits studied by stopped-flow and Rayleigh light scattering

    Directory of Open Access Journals (Sweden)

    Antoun Ayman


    Full Text Available Light scattering and standard stopped-flow techniques were used to monitor rapid association of ribosomal subunits during initiation of eubacterial protein synthesis. The effects of the initiation factors IF1, IF2, IF3 and buffer conditions on subunit association were studied along with the role of GTP in this process. The part of light scattering theory that is essential for kinetic measurements is high-lighted in the main text and a more general treatment of Rayleigh scattering from macromolecules is given in an appendix.

  7. A poly (U) polymerase in ribosome preparations from Ehrlich ascites tumor cells

    International Nuclear Information System (INIS)

    Guimaraes, R.C.; Bloch, D.P.


    A ribosome-bound poly (U) polymerase from Ehrlich ascites tumor cells is partially characterized. It adds UMPs to RNAs terminating in U-(3')-OH. The UMP-rich segments added reach average sizes of up to 18 nucleotides. CTP is strongly inhibitory to the enzyme. The main endogenous primers are low molecular weight RNAs which are found, after the addition of UMPs, mostly in the 6-8 S range. Some evidence suggests that a 5 S rRNA or polysome-associated 7 S RNA could be the main endogenous primers. (Author) [pt

  8. Phosphorylation of ribosomal proteins influences subunit association and translation of poly (U) in Streptomyces coelicolor

    Czech Academy of Sciences Publication Activity Database

    Mikulík, Karel; Bobek, Jan; Ziková, Alice; Smětáková, Magdalena; Bezoušková, Silvia


    Roč. 7, č. 3 (2011), s. 817-823 ISSN 1742-206X R&D Projects: GA ČR GAP302/10/0468; GA ČR GA303/09/0475; GA ČR GA310/07/1009; GA AV ČR(CZ) IAA500110805 Institutional research plan: CEZ:AV0Z50200510 Keywords : ESCHERICHIA-COLI RIBOSOME * ELONGATION-FACTOR-G * MESSENGER-RNA Subject RIV: EE - Microbiology, Virology Impact factor: 3.534, year: 2011

  9. The antibiotic thiostrepton inhibits a functional transition within protein L11 at the ribosomal GTPase centre

    DEFF Research Database (Denmark)

    Porse, B T; Leviev, I; Mankin, A S


    A newly identified class of highly thiostrepton-resistant mutants of the archaeon Halobacterium halobium carry a missense mutation at codon 18 within the gene encoding ribosomal protein L11. In the mutant proteins, a proline, conserved in archaea and bacteria, is converted to either serine...... technique, demonstrated that a general tightening of the C-terminal domain occurred on rRNA binding, while thiostrepton produced a footprint centred on tyrosine 62 at the junction of the N and C-terminal domains of protein L11 complexed to rRNA. The intensity of this protein footprint was strongly reduced...

  10. Discrepancy between low levels of mTOR activity and high levels of p-S6 in primary central nervous system lymphoma may be explained by PAS domain-containing serine/threonine-protein kinase-mediated phosphorylation

    DEFF Research Database (Denmark)

    Marosvari, Dora; Nagy, Noemi; Kriston, Csilla


    The primary aim of this study was to determine mTOR-pathway activity in primary central nervous system lymphoma (PCNSL), which could be a potential target for therapy. After demonstrating that p-S6 positivity largely exceeded mTOR activity, we aimed to identify other pathways that may lead to S6...... phosphorylation. We measured mTOR activity with immunohistochemistry for p-mTOR and its downstream effectors p(T389)-p70S6K1, p-S6, and p-4EBP1 in 31 cases of PCNSL and 51 cases of systemic diffuse large B-cell lymphoma (DLBCL) and evaluated alternative S6 phosphorylation pathways with p-RSK, p(T229)-p70S6K1...... responsible for S6 phosphorylation, PASK proved to be positive in all cases of PCNSL and DLBCL. Inhibition of PASK resulted in reduced expression of p-S6 in BHD1-cells. This is the first study demonstrating an mTOR independent p-S6 activity in PCNSL and that PASK may contribute to the phosphorylation of S6...

  11. Complete amino acid sequences of the ribosomal proteins L25, L29 and L31 from the archaebacterium Halobacterium marismortui. (United States)

    Hatakeyama, T; Kimura, M


    Ribosomal proteins were extracted from 50S ribosomal subunits of the archaebacterium Halobacterium marismortui by decreasing the concentration of Mg2+ and K+, and the proteins were separated and purified by ion-exchange column chromatography on DEAE-cellulose. Ten proteins were purified to homogeneity and three of these proteins were subjected to sequence analysis. The complete amino acid sequences of the ribosomal proteins L25, L29 and L31 were established by analyses of the peptides obtained by enzymatic digestion with trypsin, Staphylococcus aureus protease, chymotrypsin and lysylendopeptidase. Proteins L25, L29 and L31 consist of 84, 115 and 95 amino acid residues with the molecular masses of 9472 Da, 12293 Da and 10418 Da respectively. A comparison of their sequences with those of other large-ribosomal-subunit proteins from other organisms revealed that protein L25 from H. marismortui is homologous to protein L23 from Escherichia coli (34.6%), Bacillus stearothermophilus (41.8%), and tobacco chloroplasts (16.3%) as well as to protein L25 from yeast (38.0%). Proteins L29 and L31 do not appear to be homologous to any other ribosomal proteins whose structures are so far known.

  12. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model. (United States)

    Spirin, Alexander S


    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  13. Myb-binding protein 1a (Mybbp1a) regulates levels and processing of pre-ribosomal RNA. (United States)

    Hochstatter, Julia; Hölzel, Michael; Rohrmoser, Michaela; Schermelleh, Lothar; Leonhardt, Heinrich; Keough, Rebecca; Gonda, Thomas J; Imhof, Axel; Eick, Dirk; Längst, Gernot; Németh, Attila


    Ribosomal RNA gene transcription, co-transcriptional processing, and ribosome biogenesis are highly coordinated processes that are tightly regulated during cell growth. In this study we discovered that Mybbp1a is associated with both the RNA polymerase I complex and the ribosome biogenesis machinery. Using a reporter assay that uncouples transcription and RNA processing, we show that Mybbp1a represses rRNA gene transcription. In addition, overexpression of the protein reduces RNA polymerase I loading on endogenous rRNA genes as revealed by chromatin immunoprecipitation experiments. Accordingly, depletion of Mybbp1a results in an accumulation of the rRNA precursor in vivo but surprisingly also causes growth arrest of the cells. This effect can be explained by the observation that the modulation of Mybbp1a protein levels results in defects in pre-rRNA processing within the cell. Therefore, the protein may play a dual role in the rRNA metabolism, potentially linking and coordinating ribosomal DNA transcription and pre-rRNA processing to allow for the efficient synthesis of ribosomes.

  14. Identification and role of functionally important motifs in the 970 loop of Escherichia coli 16S ribosomal RNA. (United States)

    Saraiya, Ashesh A; Lamichhane, Tek N; Chow, Christine S; SantaLucia, John; Cunningham, Philip R


    The 970 loop (helix 31) of Escherichia coli 16S ribosomal RNA contains two modified nucleotides, m(2)G966 and m(5)C967. Positions A964, A969, and C970 are conserved among the Bacteria, Archaea, and Eukarya. The nucleotides present at positions 965, 966, 967, 968, and 971, however, are only conserved and unique within each domain. All organisms contain a modified nucleoside at position 966, but the type of the modification is domain specific. Biochemical and structure studies have placed this loop near the P site and have shown it to be involved in the decoding process and in binding the antibiotic tetracycline. To identify the functional components of this ribosomal RNA hairpin, the eight nucleotides of the 970 loop of helix 31 were subjected to saturation mutagenesis and 107 unique functional mutants were isolated and analyzed. Nonrandom nucleotide distributions were observed at each mutated position among the functional isolates. Nucleotide identity at positions 966 and 969 significantly affects ribosome function. Ribosomes with single mutations of m(2)G966 or m(5)C967 produce more protein in vivo than do wild-type ribosomes. Overexpression of initiation factor 3 specifically restored wild-type levels of protein synthesis to the 966 and 967 mutants, suggesting that modification of these residues is important for initiation factor 3 binding and for the proper initiation of protein synthesis.

  15. The SmpB C-terminal tail helps tmRNA to recognize and enter stalled ribosomes

    Directory of Open Access Journals (Sweden)

    Mickey R. Miller


    Full Text Available In bacteria, transfer-messenger RNA (tmRNA and SmpB comprise the most common and effective system for rescuing stalled ribosomes. Ribosomes stall on mRNA transcripts lacking stop codons and are rescued as the defective mRNA is swapped for the tmRNA template in a process known as trans-translation. The tmRNA–SmpB complex is recruited to the ribosome independent of a codon–anticodon interaction. Given that the ribosome uses robust discriminatory mechanisms to select against non-cognate tRNAs during canonical decoding, it has been hard to explain how this can happen. Recent structural and biochemical studies show that SmpB licenses tmRNA entry through its interactions with the decoding center and mRNA channel. In particular, the C-terminal tail of SmpB promotes both EFTu activation and accommodation of tmRNA, the former through interactions with 16S rRNA nucleotide G530 and the latter through interactions with the mRNA channel downstream of the A site. Here we present a detailed model of the earliest steps in trans-translation, and in light of these mechanistic considerations, revisit the question of how tmRNA preferentially reacts with stalled, non-translating ribosomes.

  16. Staphylococcus aureus and Escherichia coli have disparate dependences on KsgA for growth and ribosome biogenesis

    Directory of Open Access Journals (Sweden)

    O’Farrell Heather C


    Full Text Available Abstract Background The KsgA methyltransferase has been conserved throughout evolution, methylating two adenosines in the small subunit rRNA in all three domains of life as well as in eukaryotic organelles that contain ribosomes. Understanding of KsgA’s important role in ribosome biogenesis has been recently expanded in Escherichia coli; these studies help explain why KsgA is so highly conserved and also suggest KsgA’s potential as an antimicrobial drug target. Results We have analyzed KsgA’s contribution to ribosome biogenesis and cell growth in Staphylococcus aureus. We found that deletion of ksgA in S. aureus led to a cold-sensitive growth phenotype, although KsgA was not as critical for ribosome biogenesis as it was shown to be in E. coli. Additionally, the ksgA knockout strain showed an increased sensitivity to aminoglycoside antibiotics. Overexpression of a catalytically inactive KsgA mutant was deleterious in the knockout strain but not the wild-type strain; this negative phenotype disappeared at low temperature. Conclusions This work extends the study of KsgA, allowing comparison of this aspect of ribosome biogenesis between a Gram-negative and a Gram-positive organism. Our results in S. aureus are in contrast to results previously described in E. coli, where the catalytically inactive protein showed a negative phenotype in the presence or absence of endogenous KsgA.

  17. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. (United States)

    Crossland, Hannah; Timmons, James A; Atherton, Philip J


    Increased ribosomal DNA transcription has been proposed to limit muscle protein synthesis, making ribosome biogenesis central to skeletal muscle hypertrophy. We examined the relationship between ribosomal RNA (rRNA) production and IGF-1-mediated myotube hypertrophy in vitro Primary skeletal myotubes were treated with IGF-1 (50 ng/ml) with or without 0.5 µM CX-5461 (CX), an inhibitor of RNA polymerase I. Myotube diameter, total protein, and RNA and DNA levels were measured along with markers of RNA polymerase I regulatory factors and regulators of protein synthesis. CX treatment reduced 45S pre-rRNA expression (-64 ± 5% vs. IGF-1; P IGF-1; P IGF-1-treated myotubes. IGF-1-mediated increases in myotube diameter (1.27 ± 0.09-fold, P IGF-1 treatment did not prevent early increases in AKT (+203 ± 39% vs. CX; P IGF-1, myotube diameter and protein accretion were sustained. Thus, while ribosome biogenesis represents a potential site for the regulation of skeletal muscle protein synthesis and muscle mass, it does not appear to be a prerequisite for IGF-1-induced myotube hypertrophy in vitro. -Crossland, H., Timmons, J. A., Atherton, P. J. A dynamic ribosomal biogenesis response is not required for IGF-1-mediated hypertrophy of human primary myotubes. © The Author(s).


    Directory of Open Access Journals (Sweden)

    Eisuke Ochi


    Full Text Available The purpose of this study was to examine whether insulin-like growth factor (IGF-1 and Akt/mTOR/p70S6K pathway activity is altered by chronic eccentric exercise in rat medial gastrocnemius muscle. Male Wistar rats (n = 24 were randomly assigned to 1 of the 2 groups: eccentric exercise (ECC group or sham-operated control (CON group. Rats in the ECC group were trained every second day for 10 days (5 sessions in total or 20 days (10 sessions in total. After either 5 or 10 exercise sessions, muscle specimens were dissected and weighed. The mRNA expression of IGF-1 and its variant, mechano growth factor (MGF, was evaluated using real time reverse transcriptase-polymerase chain reaction (RT-PCR. Tissue concentrations of Akt (P, mTOR (P, and p70S6K (P were measured by using western blot analysis. The medial gastrocnemius muscle mass of the ECC group did not show any significant difference after 5 exercise sessions, whereas the muscle mass increased significantly after 10 exercise sessions with a concomitant increase in the cross-sectional area of muscle fibers (p < 0.05. The expression of IGF-1 mRNA and the tissue concentrations of Akt (P and p70S6K (P after 10 exercise sessions was significantly higher than those of the age-matched controls and the rats that received 5 exercise sessions. The expression of MGF mRNA in both ECC5S and ECC10S were significantly higher than that in each period-matched control (p < 0.01. The tissue concentration of mTOR (P after 10 sessions showed a significant increase when compared with period-matched controls (p < 0.01. These results suggest that activation of the IGF-1/Akt/mTOR/p70S6K signaling pathway becomes dominant in the later phase of chronic exercise, when significant muscular hypertrophy is observed

  19. Temperature and orientation dependence of the short-term strength characteristics, Young's modulus, and linear expansion coefficient of ZhS6F alloy single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Svetlov, I L; Sukhanov, N N; Krivko, A I; Roshchina, I N; Khatsinskaia, I M


    Experimental data are presented on the temperature dependence of the short- term strength characteristics, Young's modulus, and linear expansion coefficients of single crystals of a nickel alloy, ZhS6F, with crystallographic orientations along the 001, 111, 011, and 112 lines. It is found that the mechanical properties and Young's modulus of the alloy crystals exibit anisotropy in the temperature range 20-900 C. The linear thermal expansion coefficient is isotropic up to 900 C and equal to that of the equiaxed alloy. 10 references.

  20. Linezolid-induced lactic acidosis: the thin line between bacterial and mitochondrial ribosomes. (United States)

    Santini, Alessandro; Ronchi, Dario; Garbellini, Manuela; Piga, Daniela; Protti, Alessandro


    Linezolid inhibits bacterial growth by targeting bacterial ribosomes and by interfering with bacterial protein synthesis. Lactic acidosis is a rare, but potentially lethal, side effect of linezolid. Areas covered: The pathogenesis of linezolid-induced lactic acidosis is reviewed with special emphasis on aspects relevant to the recognition, prevention and treatment of the syndrome. Expert opinion: Linezolid-induced lactic acidosis reflects the untoward interaction between the drug and mitochondrial ribosomes. The inhibition of mitochondrial protein synthesis diminishes the respiratory chain enzyme content and thus limits aerobic energy production. As a result, anaerobic glycolysis and lactate generation accelerate independently from tissue hypoxia. In the absence of any confirmatory test, linezolid-induced lactic acidosis should be suspected only after exclusion of other, more common, causes of lactic acidosis such as hypoxemia, anemia or low cardiac output. Normal-to-high whole-body oxygen delivery, high venous oxygen saturation and lack of response to interventions that effectively increase tissue oxygen provision all suggest a primary defect in oxygen use at the mitochondrial level. During prolonged therapy with linezolid, blood drug and lactate levels should be regularly monitored. The current standard-of-care treatment of linezolid-induced lactic acidosis consists of drug withdrawal to reverse mitochondrial intoxication and intercurrent life support.