WorldWideScience

Sample records for p53-specific t-cell responses

  1. Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients

    DEFF Research Database (Denmark)

    Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune

    2011-01-01

    patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...

  2. p53 specific (auto)immunity in mice

    NARCIS (Netherlands)

    Lauwen, Marjolein Monique

    2008-01-01

    Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

  3. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    Science.gov (United States)

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  4. Stress-specific response of the p53-Mdm2 feedback loop

    Directory of Open Access Journals (Sweden)

    Jensen Mogens H

    2010-07-01

    Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.

  5. Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.

    Science.gov (United States)

    O'Neill, F J; Hu, Y; Chen, T; Carney, H

    1997-02-27

    In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.

  6. Ubiquitin-specific protease 2 decreases p53-dependent apoptosis in cutaneous T-cell lymphoma

    DEFF Research Database (Denmark)

    Wei, Tianling; Biskup, Edyta; Gjerdrum, Lise Mette Rahbek

    2016-01-01

    expression is 50% lower in CTCL cell lines (MyLa2000, SeAx and Hut-78) than in normal T-cells. USP2 is expressed in neoplastic cells in early, plaque-stage mycosis fungoides (MF) and is downregulated in advanced tumor stages. Upon treatment with psoralen with UVA (PUVA) or a p53 activator, nutlin3a, USP2...

  7. Characterization of highly frequent epitope-specific CD45RA+/CCR7+/- T lymphocyte responses against p53-binding domains of the human polyomavirus BK large tumor antigen in HLA-A*0201+ BKV-seropositive donors

    Directory of Open Access Journals (Sweden)

    Zajac Paul

    2006-11-01

    Full Text Available Abstract Human polyomavirus BK (BKV has been implicated in oncogenic transformation. Its ability to replicate is determined by the binding of its large tumor antigen (LTag to products of tumor-suppressor genes regulating cell cycle, as specifically p53. We investigated CD8+ T immune responses to BKV LTag portions involved in p53 binding in HLA-A*0201+ BKV LTag experienced individuals. Peptides selected from either p53-binding region (LTag351–450 and LTag533–626 by current algorithms and capacity to bind HLA-A*0201 molecule were used to stimulate CD8+ T responses, as assessed by IFN-γ gene expression ex vivo and detected by cytotoxicity assays following in vitro culture. We observed epitope-specific immune responses in all HLA-A*0201+ BKV LTag experienced individuals tested. At least one epitope, LTag579–587; LLLIWFRPV, was naturally processed in non professional antigen presenting cells and induced cytotoxic responses with CTL precursor frequencies in the order of 1/20'000. Antigen specific CD8+ T cells were only detectable in the CD45RA+ subset, in both CCR7+ and CCR7- subpopulations. These data indicate that widespread cellular immune responses against epitopes within BKV LTag-p53 binding regions exist and question their roles in immunosurveillance against tumors possibly associated with BKV infection.

  8. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.

    1985-01-01

    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  9. Cytotoxic T-lymphocyte clones, established by stimulation with the HLA-A2 binding p5365-73 wild type peptide loaded on dendritic cells In vitro, specifically recognize and lyse HLA-A2 tumour cells overexpressing the p53 protein

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Petersen, T R; Kirkin, A F

    2000-01-01

    of recognizing p53 derived wild type (self) peptides. Furthermore, the capacity of R9V specific T cell clones to exert HLA restricted cytotoxicity, argues that the R9V peptide is naturally presented on certain cancer cells. This supports the view that p53 derived wild type peptides might serve as candidate......Mutations in the tumour suppressor gene p53 are among the most frequent genetic alterations in human malignancies, often associated with an accumulation of the p53 protein in the cytoplasm. We have generated a number of cytotoxic T lymphocyte (CTL) clones that specifically recognize the HLA-A*0201...

  10. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    Science.gov (United States)

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  11. Specific TP53 Mutants Overrepresented in Ovarian Cancer Impact CNV, TP53 Activity, Responses to Nutlin-3a, and Cell Survival

    Directory of Open Access Journals (Sweden)

    Lisa K. Mullany

    2015-10-01

    Full Text Available Evolutionary Action analyses of The Cancer Gene Atlas data sets show that many specific p53 missense and gain-of-function mutations are selectively overrepresented and functional in high-grade serous ovarian cancer (HGSC. As homozygous alleles, p53 mutants are differentially associated with specific loss of heterozygosity (R273; chromosome 17; copy number variation (R175H; chromosome 9; and up-stream, cancer-related regulatory pathways. The expression of immune-related cytokines was selectively related to p53 status, showing for the first time that specific p53 mutants impact, and are related to, the immune subtype of ovarian cancer. Although the majority (31% of HGSCs exhibit loss of heterozygosity, a significant number (24% maintain a wild-type (WT allele and represent another HGSC subtype that is not well defined. Using human and mouse cell lines, we show that specific p53 mutants differentially alter endogenous WT p53 activity; target gene expression; and responses to nutlin-3a, a small molecular that activates WT p53 leading to apoptosis, providing “proof of principle” that ovarian cancer cells expressing WT and mutant alleles represent a distinct ovarian cancer subtype. We also show that siRNA knock down of endogenous p53 in cells expressing homozygous mutant alleles causes apoptosis, whereas cells expressing WT p53 (or are heterozygous for WT and mutant p53 alleles are highly resistant. Therefore, despite different gene regulatory pathways associated with specific p53 mutants, silencing mutant p53 might be a suitable, powerful, global strategy for blocking ovarian cancer growth in those tumors that rely on mutant p53 functions for survival. Knowing p53 mutational status in HGSC should permit new strategies tailored to control this disease.

  12. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  13. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  14. Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

    International Nuclear Information System (INIS)

    Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

    1996-01-01

    ataxia-telangiectasia (A-T) cells. In parallel with the 3-fold increase in levels of p53 seen following IR in FC and FS cells, oligonucleotide binding increased greater than 20-fold in FC cells, and showed only a 3-fold increase in FS cells. Oligonucleotide binding by p53 is currently being measured in A-T cells. Conclusions: The sequence-specific binding of p53 is enhanced in response to ionizing radiation damage, above and beyond changes in the level of p53 protein. The scid gene product (p350, catalytic sub-unit of the DNA-dependent protein kinase, DNA-PK) appears to regulate the post translational modification of p53, presumably by phosphorylation. Confirmation of differences in phosphorylation between normal cells and scid cells is awaited, as are attempts to map the site of post-translational modification resulting in enhanced sequence-specific DNA binding

  15. Cell-Cycle-Specific Function of p53 in Fanconi Anemia Hematopoietic Stem and Progenitor Cell Proliferation

    Directory of Open Access Journals (Sweden)

    Xiaoli Li

    2018-02-01

    Full Text Available Summary: Overactive p53 has been proposed as an important pathophysiological factor for bone marrow failure syndromes, including Fanconi anemia (FA. Here, we report a p53-dependent effect on hematopoietic stem and progenitor cell (HSPC proliferation in mice deficient for the FA gene Fanca. Deletion of p53 in Fanca−/− mice leads to replicative exhaustion of the hematopoietic stem cell (HSC in transplant recipients. Using Fanca−/− HSCs expressing the separation-of-function mutant p53515C transgene, which selectively impairs the p53 function in apoptosis but keeps its cell-cycle checkpoint activities intact, we show that the p53 cell-cycle function is specifically required for the regulation of Fanca−/− HSC proliferation. Our results demonstrate that p53 plays a compensatory role in preventing FA HSCs from replicative exhaustion and suggest a cautious approach to manipulating p53 signaling as a therapeutic utility in FA. : In this article, Pang and colleagues demonstrate a p53-dependent HSPC proliferation regulation in mice deficient for the Fanca gene in the Fanconi anemia (FA pathway. They show that the p53 cell-cycle function is specifically required for the regulation of FA HSC proliferation. These results suggest that overactive p53 may represent a compensatory checkpoint mechanism for FA HSC proliferation. Keywords: p53, bone marrow failure, Fanconi anemia, hematopoietic stem and progenitor cells, apoptosis, cell cycle, proliferation

  16. Ionizing radiation enhances immunogenicity of cells expressing a tumor-specific T-cell epitope

    International Nuclear Information System (INIS)

    Ciernik, Ilja F.; Romero, Pedro; Berzofsky, Jay A.; Carbone, David P.

    1999-01-01

    Background: p53 point mutations represent potential tumor-specific cytolytic T lymphocyte (CTL) epitopes. Whether ionizing radiation (IR) alters the immunological properties of cells expressing mutant p53 in respect of the CTL epitope generated by a defined point mutation has not been evaluated. Methods: Mutant p53-expressing syngeneic, nontumor forming BALB/c 3T3 fibroblasts, tumor forming ras-transfected BALB/c 3T3 sarcomas, and DBA/2-derived P815 mastocytoma cells, which differ at the level of minor histocompatibility antigens, were used as cellular vaccines. Cells were either injected with or without prior IR into naive BALB/c mice. Cellular cytotoxicity was assessed after secondary restimulation of effector spleen cells in vitro. Results: Injection of P815 mastocytoma cells expressing the mutant p53 induced mutation-specific CTL in BALB/c mice irrespective of prior irradiation. However, syngeneic fibroblasts or fibrosarcomas endogenously expressing mutant p53 were able to induce significant mutation-specific CTL only when irradiated prior to injection into BALB/c mice. IR of fibroblasts did not detectably alter the expression of cell surface molecules involved in immune response induction, nor did it alter the short-term in vitro viability of the fibroblasts. Interestingly, radioactively-labeled fibroblasts injected into mice after irradiation showed altered organ distribution, suggesting that the in vivo fate of these cells may play a crucial role in their immunogenicity. Conclusions: These findings indicate that IR can alter the immunogenicity of syngeneic normal as well as tumor forming fibroblasts in vivo, and support the view that ionizing radiation enhances immunogenicity of cellular tumor vaccines

  17. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    Science.gov (United States)

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  18. Characterisation of the p53-mediated cellular responses evoked in primary mouse cells following exposure to ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Gillian D McFeat

    Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.

  19. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2004-01-01

    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  20. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    Science.gov (United States)

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  1. p53 shapes genome-wide and cell type-specific changes in microRNA expression during the human DNA damage response.

    Science.gov (United States)

    Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R

    2014-01-01

    The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.

  2. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    Science.gov (United States)

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  3. Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation

    Science.gov (United States)

    Armitage, Mark

    Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

  4. Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Clarke Alan R

    2002-11-01

    Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.

  5. Specific immunotherapy modifies allergen-specific CD4+ T cell responses in an epitope-dependent manner

    Science.gov (United States)

    Wambre, Erik; DeLong, Jonathan H.; James, Eddie A.; Torres-Chinn, Nadia; Pfützner, Wolfgang; Möbs, Christian; Durham, Stephen R.; Till, Stephen J.; Robinson, David; Kwok, William W.

    2014-01-01

    Background Understanding the mechanisms by which the immune system induces and controls allergic inflammation at the T cell epitope level is critical for the design of new allergy vaccine strategies. Objective To characterize allergen-specific T cell responses linked with allergy or peripheral tolerance and to determine how CD4+ T cell responses to individual allergen-derived epitopes change over allergen-specific immunotherapy (ASIT). Methods Timothy grass pollen (TGP) allergy was used as a model for studying grass pollen allergies. The breadth, magnitude, epitope hierarchy and phenotype of the DR04:01-restricted TGP-specific T cell responses in ten grass pollen allergic, five non-atopic and six allergy vaccine-treated individuals was determined using an ex vivo pMHCII-tetramer approach. Results CD4+ T cells in allergic individuals are directed to a broad range of TGP epitopes characterized by defined immunodominance hierarchy patterns and with distinct functional profiles that depend on the epitope recognized. Epitopes that are restricted specifically to either TH2 or TH1/TR1 responses were identified. ASIT was associated with preferential deletion of allergen-specific TH2 cells and without significant change in frequency of TH1/TR1 cells. Conclusions Preferential allergen-specific TH2-cells deletion after repeated high doses antigen stimulation can be another independent mechanism to restore tolerance to allergen during immunotherapy. PMID:24373351

  6. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  7. RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Toshinori Ozaki

    2013-01-01

    Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.

  8. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  9. Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.

    1995-12-01

    One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.

  10. Effect of UV C irradiation on P53 in FADD+/+ and FADD-/- cells

    International Nuclear Information System (INIS)

    Matic, Igor; Radnic, Maja; Marijanovic, Inga; Furcic, Ivana; Nagy, Biserka

    2008-01-01

    The dominant paradigm of tumor biology is that evasion from apoptosis is one of the crucial features of malignant diseases and that the efficiency of cancer therapy depends on P53-dependent apoptosis. Because of the importance of apoptotic pathways in protecting cells against malignant transformation, disruption of apoptosis is extremely common in cancer cells, and is frequently due to mutations in the P53 tumor suppressor gene. Fas-associated death domain (FADD) is an adapter protein that is required for apoptosis induced by all known death receptors. FADD is implicated in death receptor-independent apoptotic response, such as DNA damage. We used embryonic fibroblasts derived from FADD knockout mice and their genetic counterparts. We predicted that UV exposure induces a loss of FADD function and leads to mutations in P53. Loss of FADD expression causes deregulation of apoptosis and expansion of mutated cells and initiation of cancer. We predicted that FADD dysfunction may be potentially advantageous for tumor growth and that FADD can act as a tumor suppressor. Cells were irradiated with UV C light (254 nm) using a germicidal lamp (Upland, CA). The culture media was drained before the irradiation and fresh media was added after. In the first experiment we irradiated cells with a dose of 25 J/m 2 and after 5 days we isolated genomic DNA but part of the cells were irradiated again with the same dose. After 5 days DNA were isolated so the cumulative irradiation dose was 50 J/m 2 . In the second experiment cells were irradiated ones with the dose of 40 J/m 2 and DNA was isolated after 18 days. Lethal dosage for each cell line is 50 J/m 2 . Genomic DNA was analyzed by allele-specific polymerase chain reaction (AS-PCR) for CC to TT mutation at codons 154-155 and 175-176 in exon 5 and for C to T mutations at codons 270 and 275 in exon 8 of the P53 gene. The mutant-specific forward primer was used for each mutation. The reverse primers for amplification of mutations were

  11. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

  12. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  13. Disrupted p53 Function as Predictor of Treatment Failure and Poor Prognosis in B- and T-Cell Non-Hodgkin’s Lymphoma

    DEFF Research Database (Denmark)

    Møller, Michael Boe; Gerdes, A M; Skjødt, K

    1999-01-01

    screening for p53 gene mutations as a prognostic marker in a population-based group of B- and T-cell non-Hodgkin's lymphomas (NHLs). On the basis of p53 gene mutation status and immunohistochemically detected p53 and p21Waf1 expression in 34 lymphomas, we established an immunophenotype (delta p53......) correlating with p53 gene mutation. The immunohistochemical analysis was extended to encompass 199 lymphomas from a population-based registry and was correlated with clinical parameters. Delta p53 showed 100% concordance with p53 gene mutation and was detected in 42 cases (21%). Multivariate analysis...... of advanced stage lymphomas showed that delta p53 was independently associated with treatment failure (relative risk, 3.8; P = 0.001). Delta p53 predicted poor survival when analyzing all patients (P = 0.0001), as well as B-cell (P = 0.04) and T-cell NHL (P = 0.000002). In multivariate analysis, delta p53...

  14. [Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

    Science.gov (United States)

    Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

    2017-01-01

    PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I

  15. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    Science.gov (United States)

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  16. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  17. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  18. Ovalbumin-coated pH-sensitive microneedle arrays effectively induce ovalbumin-specific antibody and T-cell responses in mice.

    Science.gov (United States)

    van der Maaden, Koen; Varypataki, Eleni Maria; Romeijn, Stefan; Ossendorp, Ferry; Jiskoot, Wim; Bouwstra, Joke

    2014-10-01

    The aim of this work was to study the applicability of antigen-coated pH-sensitive microneedle arrays for effective vaccination strategies. Therefore, a model antigen (ovalbumin) was coated onto pH-sensitive (pyridine-modified) microneedle arrays to test pH-triggered antigen release by applying the coated arrays onto ex vivo human skin, and by conducting a dermal immunization study in mice. The release of antigen into ex vivo human skin from the coated microneedles was determined by using radioactively labeled ovalbumin. To investigate the induction of antigen-specific IgG, and CD4(+) and CD8(+) T-cell responses, BALB/c mice were immunized with antigen-coated pH-sensitive microneedles by the 'coat and poke' approach. These responses were compared to responses induced by the 'poke and patch' approach, and subcutaneous and intradermal vaccination with classic hypodermic needles. The pH-sensitive microneedle arrays were efficiently coated with ovalbumin (95% coating efficiency) and upon application of six microneedle arrays 4.27 of 7 μg ovalbumin was delivered into the skin, showing a release efficiency of 70%. In contrast, the 'poke and patch' approach led to a delivery of only 6.91 of 100 μg ovalbumin (7% delivery efficiency). Immunization by means of ovalbumin-coated microneedles resulted in robust CD4(+) and CD8(+) T-cell responses comparable to those obtained after subcutaneous or intradermal immunization with conventional needles. Moreover, it effectively induced IgG responses; however, it required prime-boost immunizations before antibodies were produced. In conclusion, antigen delivery into ex vivo human skin by antigen-coated pH-sensitive microneedle arrays is more efficient than the 'poke-and-patch' approach and in vivo vaccination studies show the applicability of pH-sensitive microneedles for the induction of both T cell and B cell responses. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Alterations in regulatory T cells induced by specific oligosaccharides improve vaccine responsiveness in mice.

    Directory of Open Access Journals (Sweden)

    Marcel A Schijf

    Full Text Available Prophylactic vaccinations are generally performed to protect naïve individuals with or without suppressed immune responsiveness. In a mouse model for Influenza vaccinations the specific alterations of CD4(+CD25(+Foxp3(+ regulatory T-cells (Tregs in the immune modulation induced by orally supplied oligosaccharides containing scGOS/lcFOS/pAOS was assessed. This dietary intervention increased vaccine specific DTH responses. In addition, a significant increased percentage of T-bet(+ (Th1 activated CD69(+CD4(+ T cells (p<0.001 and reduced percentage of Gata-3(+ (Th2 activated CD69(+CD4(+T cells (p<0.001 was detected in the mesenteric lymph nodes (MLN of mice receiving scGOS/lcFOS/pAOS compared to control mice. Although no difference in the number or percentage of Tregs (CD4(+Foxp3(+ could be determined after scGOS/lcFOS/pAOS intervention, the percentage of CXCR3 (+ /T-bet(+ (Th1-Tregs was significantly reduced (p<0.05 in mice receiving scGOS/lcFOS/pAOS as compared to mice receiving placebo diets. Moreover, although no absolute difference in suppressive capacity could be detected, an alteration in cytokine profile suggests a regulatory T cell shift towards a reducing Th1 suppression profile, supporting an improved vaccination response.These data are indicative for improved vaccine responsiveness due to reduced Th1 suppressive capacity in the Treg population of mice fed the oligosaccharide specific diet, showing compartmentalization within the Treg population. The modulation of Tregs to control immune responses provides an additional arm of intervention using alternative strategies possibly leading to the development of improved vaccines.

  20. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  1. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    Science.gov (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  2. Contribution of herpesvirus specific CD8 T cells to anti-viral T cell response in humans.

    Directory of Open Access Journals (Sweden)

    Elena Sandalova

    Full Text Available Herpesviruses infect most humans. Their infections can be associated with pathological conditions and significant changes in T cell repertoire but evidences of symbiotic effects of herpesvirus latency have never been demonstrated. We tested the hypothesis that HCMV and EBV-specific CD8 T cells contribute to the heterologous anti-viral immune response. Volume of activated/proliferating virus-specific and total CD8 T cells was evaluated in 50 patients with acute viral infections: 20 with HBV, 12 with Dengue, 12 with Influenza, 3 with Adenovirus infection and 3 with fevers of unknown etiology. Virus-specific (EBV, HCMV, Influenza pentamer+ and total CD8 T cells were analyzed for activation (CD38/HLA-DR, proliferation (Ki-67/Bcl-2(low and cytokine production. We observed that all acute viral infections trigger an expansion of activated/proliferating CD8 T cells, which differs in size depending on the infection but is invariably inflated by CD8 T cells specific for persistent herpesviruses (HCMV/EBV. CD8 T cells specific for other non-related non persistent viral infection (i.e. Influenza were not activated. IL-15, which is produced during acute viral infections, is the likely contributing mechanism driving the selective activation of herpesvirus specific CD8 T cells. In addition we were able to show that herpesvirus specific CD8 T cells displayed an increased ability to produce the anti-viral cytokine interferon-gamma during the acute phase of heterologous viral infection. Taken together, these data demonstrated that activated herpesvirus specific CD8 T cells inflate the activated/proliferating CD8 T cells population present during acute viral infections in human and can contribute to the heterologous anti-viral T cell response.

  3. Cytomegalovirus-specific T-cell responses and viral replication in kidney transplant recipients

    Directory of Open Access Journals (Sweden)

    Sester Urban

    2008-06-01

    Full Text Available Abstract Background Cytomegalovirus (CMV seronegative recipients (R- of kidney transplants (KT from seropositive donors (D+ are at higher risk for CMV replication and ganciclovir(GCV-resistance than CMV R(+. We hypothesized that low CMV-specific T-cell responses are associated with increased risk of CMV replication in R(+-patients with D(+ or D(- donors. Methods We prospectively evaluated 73 consecutive KT-patients [48 R(+, 25 D(+R(-] undergoing routine testing for CMV replication as part of a preemptive strategy. We compared CMV-specific interferon-γ (IFN-γ responses of CD4+CD3+ lymphocytes in peripheral blood mononuclear cells (PBMC using three different antigen preparation (CMV-lysate, pp72- and pp65-overlapping peptide pools using intracellular cytokine staining and flow cytometry. Results Median CD4+ and CD8+T-cell responses to CMV-lysate, pp72- and pp65-overlapping peptide pools were lower in D(+R(- than in R(+patients or in non-immunosuppressed donors. Comparing subpopulations we found that CMV-lysate favored CD4+- over CD8+-responses, whereas the reverse was observed for pp72, while pp65-CD4+- and -CD8+-responses were similar. Concurrent CMV replication in R(+-patients was associated with significantly lower T-cell responses (pp65 median CD4+ 0.00% vs. 0.03%, p = 0.001; CD8+ 0.01% vs. 0.03%; p = 0.033. Receiver operated curve analysis associated CMV-pp65 CD4+ responses of > 0.03% in R(+-patients with absence of concurrent (p = 0.003 and future CMV replication in the following 8 weeks (p = 0.036. GCV-resistant CMV replication occurred in 3 R(+-patients (6.3% with pp65- CD4+ frequencies Conclusion The data suggest that pp65-specific CD4+ T-cells might be useful to identify R(+-patients at increased risk of CMV replication. Provided further corroborating evidence, CMV-pp65 CD4+ responses above 0.03% in PBMCs of KT patients under stable immunosuppression are associated with lower risk of concurrent and future CMV replication during the

  4. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  5. The simultaneous ex vivo detection of low-frequency antigen-specific CD4+ and CD8+ T-cell responses using overlapping peptide pools.

    Science.gov (United States)

    Singh, Satwinder Kaur; Meyering, Maaike; Ramwadhdoebe, Tamara H; Stynenbosch, Linda F M; Redeker, Anke; Kuppen, Peter J K; Melief, Cornelis J M; Welters, Marij J P; van der Burg, Sjoerd H

    2012-11-01

    The ability to measure antigen-specific T cells at the single-cell level by intracellular cytokine staining (ICS) is a promising immunomonitoring tool and is extensively applied in the evaluation of immunotherapy of cancer. The protocols used to detect antigen-specific CD8+ T-cell responses generally work for the detection of antigen-specific T cells in samples that have undergone at least one round of in vitro pre-stimulation. Application of a common protocol but now using long peptides as antigens was not suitable to simultaneously detect antigen-specific CD8+ and CD4+ T cells directly ex vivo in cryopreserved samples. CD8 T-cell reactivity to monocytes pulsed with long peptides as antigens ranged between 5 and 25 % of that observed against monocytes pulsed with a direct HLA class I fitting minimal CTL peptide epitope. Therefore, we adapted our ICS protocol and show that the use of tenfold higher concentration of long peptides to load APC, the use of IFN-α and poly(I:C) to promote antigen processing and improve T-cell stimulation, does allow for the ex vivo detection of low-frequency antigen-specific CD8+ and CD4+ T cells in an HLA-independent setting. While most of the improvements were related to increasing the ability to measure CD8+ T-cell reactivity following stimulation with long peptides to at least 50 % of the response detected when using a minimal peptide epitope, the final analysis of blood samples from vaccinated patients successfully showed that the adapted ICS protocol also increases the ability to ex vivo detect low-frequency p53-specific CD4+ T-cell responses in cryopreserved PBMC samples.

  6. Antigen specific T-cell responses against tumor antigens are controlled by regulatory T cells in patients with prostate cancer.

    Science.gov (United States)

    Hadaschik, Boris; Su, Yun; Huter, Eva; Ge, Yingzi; Hohenfellner, Markus; Beckhove, Philipp

    2012-04-01

    Immunotherapy is a promising approach in an effort to control castration resistant prostate cancer. We characterized tumor antigen reactive T cells in patients with prostate cancer and analyzed the suppression of antitumor responses by regulatory T cells. Peripheral blood samples were collected from 57 patients with histologically confirmed prostate cancer, 8 patients with benign prostatic hyperplasia and 16 healthy donors. Peripheral blood mononuclear cells were isolated and antigen specific interferon-γ secretion of isolated T cells was analyzed by enzyme-linked immunospot assay. T cells were functionally characterized and T-cell responses before and after regulatory T-cell depletion were compared. As test tumor antigens, a panel of 11 long synthetic peptides derived from a total of 8 tumor antigens was used, including prostate specific antigen and prostatic acid phosphatase. In patients with prostate cancer we noted a 74.5% effector T-cell response rate compared with only 25% in patients with benign prostatic hyperplasia and 31% in healthy donors. In most patients 2 or 3 tumor antigens were recognized. Comparing various disease stages there was a clear increase in the immune response against prostate specific antigens from intermediate to high risk tumors and castration resistant disease. Regulatory T-cell depletion led to a significant boost in effector T-cell responses against prostate specific antigen and prostatic acid phosphatase. Tumor specific effector T cells were detected in most patients with prostate cancer, especially those with castration resistant prostate cancer. Since effector T-cell responses against prostate specific antigens strongly increased after regulatory T-cell depletion, our results indicate that immunotherapy efficacy could be enhanced by decreasing regulatory T cells. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  7. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    Science.gov (United States)

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  8. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    International Nuclear Information System (INIS)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna

    2015-01-01

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  9. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)

    2015-08-15

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  10. A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation

    Directory of Open Access Journals (Sweden)

    Kumar Sonia

    2011-02-01

    Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.

  11. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  12. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  13. Nongenotoxic p53 activation protects cells against S-phase-specific chemotherapy

    DEFF Research Database (Denmark)

    Kranz, Dominique; Dobbelstein, Matthias

    2006-01-01

    Mutations in the tumor suppressor gene TP53 represent the most frequent genetic difference between tumor cells and normal cells. Here, we have attempted to turn this difference into an advantage for normal cells during therapy. Using the Mdm2 antagonist nutlin-3, we first activated p53 in U2OS an...... a killer to a protector of cells, with the potential to reduce unwanted side effects of chemotherapy....

  14. Norovirus-specific memory T cell responses in adult human donors

    Directory of Open Access Journals (Sweden)

    Maria Malm

    2016-10-01

    Full Text Available Norovirus (NoV is a leading cause of acute gastroenteritis in people of all ages worldwide. NoV specific serum antibodies which block the binding of NoV virus-like particles (VLPs to the cell receptors have been thoroughly investigated. In contrast, only a few publications are available on the NoV capsid VP1 protein-specific T cell responses in humans naturally infected with the virus. Freshly isolated peripheral blood mononuclear cells of eight healthy adult human donors previously exposed to NoV were stimulated with purified VLPs derived from NoV GII.4-1999, GII.4-2012 (Sydney, and GI.3, and IFN-g production was measured by an ELISPOT assay. In addition, 76 overlapping synthetic peptides spanning the entire 539 amino acid sequence of GII.4 VP1 were pooled into two-dimensional matrices and used to identify putative T cell epitopes. Seven of the eight subjects produced IFN-g in response to the peptides and five subjects produced IFN-g in response to the VLPs of the same origin. In general, stronger T cell responses were induced with the peptides in each donor compared to the VLPs. A CD8+ T cell epitope in the shell domain of the VP1 (134SPSQVTMFPHIIVDVRQL151 was identified in two subjects, both having human leukocyte antigen (HLA-A*02:01 allele. To our knowledge, this is the first report using synthetic peptides to study NoV-specific T cell responses in human subjects and identify T cell epitopes.

  15. Accessing complexity: the dynamics of virus-specific T cell responses

    DEFF Research Database (Denmark)

    Doherty, P C; Christensen, Jan Pravsgaard

    2000-01-01

    -specific CD8(+ )T cells. Analysis to date with both naturally acquired and experimentally induced infections has established that the numbers of virus-specific CD8(+) T cells present during both the acute and memory phases of the host response are more than tenfold in excess of previously suspected values....... The levels are such that the virus-specific CD8(+) set is readily detected in the human peripheral blood lymphocyte compartment, particularly during persistent infections. Experimentally, it is now possible to measure the extent of cycling for tetramer (+)CD8(+) T cells during the acute and memory phases...... of the host response to viruses. Dissection of the phenotypic, functional, and molecular diversity of CD8(+) T cell populations has been greatly facilitated. It is hoped it will also soon be possible to analyze CD4(+) T cell populations in this way. Though these are early days and there is an enormous amount...

  16. Marked differences in human melanoma antigen-specific T cell responsiveness after vaccination using a functional microarray.

    Directory of Open Access Journals (Sweden)

    Daniel S Chen

    2005-10-01

    Full Text Available In contrast to many animal model studies, immunotherapeutic trials in humans suffering from cancer invariably result in a broad range of outcomes, from long-lasting remissions to no discernable effect.In order to study the T cell responses in patients undergoing a melanoma-associated peptide vaccine trial, we have developed a high-throughput method using arrays of peptide-major histocompatibility complexes (pMHC together with antibodies against secreted factors. T cells were specifically immobilized and activated by binding to particular pMHCs. The antibodies, spotted together with the pMHC, specifically capture cytokines secreted by the T cells. This technique allows rapid, simultaneous isolation and multiparametric functional characterization of antigen-specific T cells present in clinical samples. Analysis of CD8+ lymphocytes from ten melanoma patients after peptide vaccination revealed a diverse set of patient- and antigen-specific profiles of cytokine secretion, indicating surprising differences in their responsiveness. Four out of four patients who showed moderate or greater secretion of both interferon-gamma (IFNgamma and tumor necrosis factor-alpha (TNFalpha in response to a gp100 antigen remained free of melanoma recurrence, whereas only two of six patients who showed discordant secretion of IFNgamma and TNFalpha did so.Such multiparametric analysis of T cell antigen specificity and function provides a valuable tool with which to dissect the molecular underpinnings of immune responsiveness and how this information correlates with clinical outcome.

  17. Relationship between P53 and bystander effect induced by radiated hepatoma cells

    International Nuclear Information System (INIS)

    Zhao Meijia; Shen Bo; Yuan Dexiao; Cheng Honghong; Shao Chunlin

    2009-01-01

    The role of p53 in bystander responses on normal liver cells were investigated by co-culturing irradiated hepatoma cells with non-irradiated bystander Chang liver cells. It was found that radiosensitivity of the hepatoma cells was relative to p53. HepG2 cells with wtp53 had the highest radiosensitivity followed by PLC/PRF/5 cells with mtp53 and Hep3B cells with null-p53. The induction of bystander micronucleus(MN) was observed only in the Chang liver cells that had been co-cultured with HepG2 cells but not co-cultured with PLC/PRF/5 or Hep3B. Also, this bystander MN was relative to the irradiation dose and the cell co-culture rime. When the hepatoma cells were treated with pifithrin-α, a p53 inhibitor, their radiosensitivities were reduced, and the bystander effect was diminished. The results indicate that p53 could regulate not only the radiosensitivity but also the bystander response. (authors)

  18. Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

    Directory of Open Access Journals (Sweden)

    Monica M Horvath

    2007-07-01

    Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

  19. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  20. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  1. Characterization of the human T cell response to rye grass pollen allergens Lol p 1 and Lol p 5.

    Science.gov (United States)

    Burton, M D; Papalia, L; Eusebius, N P; O'Hehir, R E; Rolland, J M

    2002-12-01

    Knowledge of dominant T cell epitopes of major allergens recognized by allergic individuals is required to improve efficacy and safety of allergen immunotherapy. Rye grass pollen (RGP) is the most important source of seasonal aeroallergens in temperate climates and Lol p 1 and Lol p 5 are the two major IgE-reactive allergens. This study aimed to characterize the T cell response to these allergens using a large panel of RGP-sensitive individuals. Short-term RGP-specific T cell lines (TCL) were generated from 38 RGP-sensitive subjects and stimulated with Lol p 1 and/or Lol p 5 allergens and synthetic 20-mer peptides. Proliferative responses were determined by 3H-thymidine uptake and IL-5 and IFN-gamma in culture supernatants analysed by ELISA. Of 17 subjects tested for reactivity to both allergens 16 (94%) responded to Lol p 1 and/or Lol p 5, establishing these as major T cell-reactive allergens. Sites of T cell reactivity were spread throughout the allergen molecules but regions of high reactivity were found. For Lol p 1 these spanned residues 19-38, 109-128, 154-173, 190-209, and for Lol p 5 37-56, 100-119, 145-164, 154-173, 190-209, 217-236 and 226-245. IL-5 and IFN-gamma were produced by T cells cultured with proliferation-inducing peptides. T cell responses to RGP major allergens have been extensively characterized, providing fundamental information for developing T cell-targeted immunotherapy for RGP allergy.

  2. The absence of Ser389 phosphorylation in p53 affects the basal gene expression level of many p53-dependent genes and alters the biphasic response to UV exposure in mouse embryonic fibroblasts

    NARCIS (Netherlands)

    Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.

    2008-01-01

    Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the

  3. Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.

    Science.gov (United States)

    Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D

    2017-08-01

    Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.

  4. Therapeutic targeting of regulatory T cells enhances tumor-specific CD8+ T cell responses in Epstein–Barr virus associated nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Fogg, Mark; Murphy, John R.; Lorch, Jochen; Posner, Marshall; Wang, Fred

    2013-01-01

    Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, as well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. - Highlights: • Viral proteins are tumor antigens in Epstein–Barr virus associated Nasopharyngeal Carcinoma. • CD8+ T cell responses against EBV proteins EBNA-1 and LMP2 are suppressed in NPC patients. • T regulatory cells are responsible for suppressing EBV immunity in NPC patients. • Depletion of Tregs with Ontak can rescue EBV-specific CD8+ T cell responses in NPC patients. • This clinically approved drug may be effective for enhancing anti-tumor immunity in NPC patients

  5. Therapeutic targeting of regulatory T cells enhances tumor-specific CD8+ T cell responses in Epstein–Barr virus associated nasopharyngeal carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Fogg, Mark [Department of Medicine, Brigham and Women' s Hospital (United States); Murphy, John R. [Departments of Medicine and Microbiology, Boston University School of Medicine, Boston, MA 02118 (United States); Lorch, Jochen; Posner, Marshall [Department of Adult Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02115 (United States); Wang, Fred, E-mail: fwang@research.bwh.harvard.edu [Department of Medicine, Brigham and Women' s Hospital (United States); Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115 (United States)

    2013-07-05

    Epstein–Barr virus (EBV) is associated with multiple malignancies including nasopharyngeal carcinoma (NPC). In nasopharynx cancer, CD8+ T cells specific for EBV Nuclear Antigen-1 (EBNA-1) and Latent Membrane Protein 2 (LMP2) are important components of anti-tumor immunity since both are consistently expressed in NPC. We have previously shown that EBNA-1-specific CD8+ T cell responses were suppressed in NPC patients compared to healthy controls. We now find that CD8+ T cell responses specific for LMP2 are also abnormal in NPC patients, and both EBNA-1- and LMP2-specific responses are suppressed by regulatory T cells (Treg). EBNA-1 and LMP2-specific CD8+ T cell responses, as well as immune control of EBV-infected cells in vitro, could be restored by the depletion of Tregs and by use of a clinically approved drug targeting Tregs. Thus, in vivo modulation of Tregs may be an effective means of enhancing these anti-tumor immune responses in NPC patients. - Highlights: • Viral proteins are tumor antigens in Epstein–Barr virus associated Nasopharyngeal Carcinoma. • CD8+ T cell responses against EBV proteins EBNA-1 and LMP2 are suppressed in NPC patients. • T regulatory cells are responsible for suppressing EBV immunity in NPC patients. • Depletion of Tregs with Ontak can rescue EBV-specific CD8+ T cell responses in NPC patients. • This clinically approved drug may be effective for enhancing anti-tumor immunity in NPC patients.

  6. Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.

    Science.gov (United States)

    Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei

    2016-11-01

    Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.

  7. The combined status of ATM and p53 link tumor development with therapeutic response

    DEFF Research Database (Denmark)

    Jiang, Hai; Reinhardt, H Christian; Bartkova, Jirina

    2009-01-01

    commonly used by tumors to bypass early neoplastic checkpoints ultimately determine chemotherapeutic response and generate tumor-specific vulnerabilities that can be exploited with targeted therapies. Specifically, evaluation of the combined status of ATM and p53, two commonly mutated tumor suppressor...... genes, can help to predict the clinical response to genotoxic chemotherapies. We show that in p53-deficient settings, suppression of ATM dramatically sensitizes tumors to DNA-damaging chemotherapy, whereas, conversely, in the presence of functional p53, suppression of ATM or its downstream target Chk2...... actually protects tumors from being killed by genotoxic agents. Furthermore, ATM-deficient cancer cells display strong nononcogene addiction to DNA-PKcs for survival after DNA damage, such that suppression of DNA-PKcs in vivo resensitizes inherently chemoresistant ATM-deficient tumors to genotoxic...

  8. Semiallogenic fusions of MSI+ tumor cells and activated B cells induce MSI-specific T cell responses

    International Nuclear Information System (INIS)

    Garbe, Yvette; Klier, Ulrike; Linnebacher, Michael

    2011-01-01

    Various strategies have been developed to transfer tumor-specific antigens into antigen presenting cells in order to induce cytotoxic T cell responses against tumor cells. One approach uses cellular vaccines based on fusions of autologous antigen presenting cells and allogeneic tumor cells. The fusion cells combine antigenicity of the tumor cell with optimal immunostimulatory capacity of the antigen presenting cells. Microsatellite instability caused by mutational inactivation of DNA mismatch repair genes results in translational frameshifts when affecting coding regions. It has been shown by us and others that these mutant proteins lead to the presentation of immunogenic frameshift peptides that are - in principle - recognized by a multiplicity of effector T cells. We chose microsatellite instability-induced frameshift antigens as ideal to test for induction of tumor specific T cell responses by semiallogenic fusions of microsatellite instable carcinoma cells with CD40-activated B cells. Two fusion clones of HCT116 with activated B cells were selected for stimulation of T cells autologous to the B cell fusion partner. Outgrowing T cells were phenotyped and tested in functional assays. The fusion clones expressed frameshift antigens as well as high amounts of MHC and costimulatory molecules. Autologous T cells stimulated with these fusions were predominantly CD4 + , activated, and reacted specifically against the fusion clones and also against the tumor cell fusion partner. Interestingly, a response toward 6 frameshift-derived peptides (of 14 tested) could be observed. Cellular fusions of MSI + carcinoma cells and activated B cells combine the antigen-presenting capacity of the B cell with the antigenic repertoire of the carcinoma cell. They present frameshift-derived peptides and can induce specific and fully functional T cells recognizing not only fusion cells but also the carcinoma cells. These hybrid cells may have great potential for cellular immunotherapy and

  9. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  10. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  11. Antiviral T cell competence and restriction specificity of mixed allogeneic (P1 + P2----P1) irradiation chimeras

    International Nuclear Information System (INIS)

    Rueedi, E.S.; Sykes, M.; Ildstad, S.T.; Chester, C.H.; Althage, A.; Hengartner, H.; Sachs, D.H.; Zinkernagel, R.M.

    1989-01-01

    Mixed irradiation bone marrow chimeras were prepared by reconstituting lethally irradiated C57BL/10 (B10) or B10.D2 mice with T cell-depleted bone marrow cells of B10 plus B10.D2 origin. These chimeras were healthy and survived well under conventional housing conditions and after experimental laboratory infections. Of a total of 17 chimeras tested, 2 died spontaneously or from the injected virus. Twelve of fifteen chimeras mounted a measurable cytotoxic T cell response to virus. Despite approximately equal percentages of B10 and B10.D2 lymphocytes in chimeras, cytotoxic T cell responses to vaccinia virus and lymphocytic choriomeningitis virus were mediated variably by either syngeneic or allogeneic donor lymphocytes; thus the H-2 type of effector T cells frequently did not correspond to the 50:50 distribution of spleen or peripheral blood lymphocytes. Cytotoxic responses were restricted exclusively to recipient H-2 type. All mixed chimeras examined were able to mount a good IgG response to vesicular stomatitis virus. These results confirm previous data suggesting that such mixed chimeras are healthy and immunocompetent and demonstrate strict recipient-determined restriction specificity of effector T cells; they also suggest that if T help is necessary for induction of virus-specific cytotoxic T cells, it does not require host-restricted interactions between helper T cells and precursor cytotoxic T cells

  12. The role of p53 in the response to mitotic spindle damage

    International Nuclear Information System (INIS)

    Meek, D.W.

    2000-01-01

    The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)

  13. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    Science.gov (United States)

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  14. T-Cell-Specific Loss of the PI-3-Kinase p110α Catalytic Subunit Results in Enhanced Cytokine Production and Antitumor Response

    Directory of Open Access Journals (Sweden)

    Laura Aragoneses-Fenoll

    2018-02-01

    Full Text Available Class IA phosphatidylinositol 3-kinase (PI3K catalytic subunits p110α and p110δ are targets in cancer therapy expressed at high levels in T lymphocytes. The role of p110δ PI3K in normal or pathological immune responses is well established, yet the importance of p110α subunits in T cell-dependent immune responses is not clear. To address this problem, mice with p110α conditionally deleted in CD4+ and CD8+ T lymphocytes (p110α−/−ΔT were used. p110α−/−ΔT mice show normal development of T cell subsets, but slightly reduced numbers of CD4+ T cells in the spleen. “In vitro,” TCR/CD3 plus CD28 activation of naive CD4+ and CD8+ p110α−/−ΔT T cells showed enhanced effector function, particularly IFN-γ secretion, T-bet induction, and Akt, Erk, or P38 activation. Tfh derived from p110α−/−ΔT cells also have enhanced responses when compared to normal mice, and IL-2 expanded p110α−/−ΔT CD8+ T cells had enhanced levels of LAMP-1 and Granzyme B. By contrast, the expansion of p110α−/−ΔT iTreg cells was diminished. Also, p110α−/−ΔT mice had enhanced anti-keyhole limpet hemocyanin (KLH IFN-γ, or IL-4 responses and IgG1 and IgG2b anti-KLH antibodies, using CFA or Alum as adjuvant, respectively. When compared to WT mice, p110α−/−ΔT mice inoculated with B16.F10 melanoma showed delayed tumor progression. The percentage of CD8+ T lymphocytes was higher and the percentage of Treg cells lower in the spleen of tumor-bearing p110α−/−ΔT mice. Also, IFN-γ production in tumor antigen-activated spleen cells was enhanced. Thus, PI3K p110α plays a significant role in antigen activation and differentiation of CD4+ and CD8+ T lymphocytes modulating antitumor immunity.

  15. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  16. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  17. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

    Science.gov (United States)

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

    2002-08-22

    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  19. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  20. IL-27p28 Production by XCR1+ Dendritic Cells and Monocytes Effectively Predicts Adjuvant-Elicited CD8+ T Cell Responses.

    Science.gov (United States)

    Kilgore, Augustus M; Welsh, Seth; Cheney, Elizabeth E; Chitrakar, Alisha; Blain, Trevor J; Kedl, Benjamin J; Hunter, Chris A; Pennock, Nathan D; Kedl, Ross M

    2018-01-01

    It is well accepted that the innate response is a necessary prerequisite to the formation of the adaptive response. This is true for T cell responses against infections or adjuvanted subunit vaccination. However, specific innate parameters with predictive value for the magnitude of an adjuvant-elicited T cell response have yet to be identified. We previously reported how T cell responses induced by subunit vaccination were dependent on the cytokine IL-27. These findings were unexpected, given that T cell responses to an infection typically increase in the absence of IL-27. Using a novel IL-27p28-eGFP reporter mouse, we now show that the degree to which an adjuvant induces IL-27p28 production from dendritic cells and monocytes directly predicts the magnitude of the T cell response elicited. To our knowledge, these data are the first to identify a concrete innate correlate of vaccine-elicited cellular immunity, and they have significant practical and mechanistic implications for subunit vaccine biology.

  1. Increased Arf/p53 activity in stem cells, aging and cancer.

    Science.gov (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  2. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.

    2003-01-01

    Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation

  3. Protein expression of P13K and P53 in prediction of response to radiotherapy in cervical cancer

    International Nuclear Information System (INIS)

    Teja Kisnanto; Devita Tetriana; Iin Kurnia; Sudiono S; Mellova Amir; Budiningsih Siregar; Ramli; Andrijono; Setiawan Soetopo; Irwan; Tjahya Kurjana; Bethy S Hernowo; Maringan DL Tobing

    2015-01-01

    Cervical cancer is a malignant disease that is common in women and is the first order of malignant disease in Indonesia. Radiotherapy is the main treatment on cervical cancer, especially at an advanced stage (IIB-IIB). P13K and P-53 protein plays a role in the regulation of apoptosis (programmed cell death). The purpose of this study was to determine the protein expression of P13K and P-53 in the prediction of response to radiotherapy action in patients with cervical cancer. Microscopic preparations obtained from biopsy tissue cancer (IIB-IIIB) to 20 patients from RSCM and RSHS. The method used is the method of immunohistochemistry using P13K and P-53 protein biomarkers in cervical cancer tissue preparations. P13K protein expression value obtained by the method of immuno reactive Score (IRS). P13K protein positive expression marked in blue on the cell cytoplasm and P-53 protein is characterized by brown or dark colors contained in the cell nucleus. Results showed that IRS value by 10% a negative P13K, P13K IRS weaker by 70%, IRS P13K was at 15%, and the IRS P13K stronger by 5%. While the index positive P-53 was obtained by 75% and negative P-53 index by 5%. Radiotherapy response analysis showed that there were 75% good response and 25% a bad response. The conclusion from this study is the expression of the protein P13K and P-53 for response prediction of radiotherapy IRS P13K values obtained in response to both radiotherapy is higher compared with radiotherapy response is bad, and the P-53 protein is not found differences in response to radiotherapy between positive and negative expressions. (author)

  4. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    Directory of Open Access Journals (Sweden)

    Hui-Ching Chuang

    Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  5. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  6. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  7. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  8. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Jiawen [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg [Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School (Singapore); Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Department of Radiation Oncology, National Cancer Centre (Singapore)

    2015-02-27

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its

  9. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    International Nuclear Information System (INIS)

    Dai, Jiawen; Itahana, Koji; Baskar, Rajamanickam

    2015-01-01

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G 1 /S or G 2 /M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G 0 , therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in

  10. Mucorales-Specific T Cells in Patients with Hematologic Malignancies.

    Science.gov (United States)

    Potenza, Leonardo; Vallerini, Daniela; Barozzi, Patrizia; Riva, Giovanni; Gilioli, Andrea; Forghieri, Fabio; Candoni, Anna; Cesaro, Simone; Quadrelli, Chiara; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Codeluppi, Mauro; Mussini, Cristina; Colaci, Elisabetta; Messerotti, Andrea; Paolini, Ambra; Maccaferri, Monica; Fantuzzi, Valeria; Del Giovane, Cinzia; Stefani, Alessandro; Morandi, Uliano; Maffei, Rossana; Marasca, Roberto; Narni, Franco; Fanin, Renato; Comoli, Patrizia; Romani, Luigina; Beauvais, Anne; Viale, Pier Luigi; Latgè, Jean Paul; Lewis, Russell E; Luppi, Mario

    2016-01-01

    Invasive mucormycosis (IM) is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients. By using an enzyme linked immunospot assay, the presence of Mucorales-specific T cells in peripheral blood (PB) samples has been investigated at three time points during high-dose chemotherapy for hematologic malignancies. Mucorales-specific T cells producing interferon-γ, interleukin-10 and interleukin-4 were analysed in order to detect a correlation between the immune response and the clinical picture. Twenty-one (10.3%) of 204 patients, accounting for 32 (5.3%) of 598 PB samples, tested positive for Mucorales-specific T cells. Two groups could be identified. Group 1, including 15 patients without signs or symptoms of invasive fungal diseases (IFD), showed a predominance of Mucorales-specific T cells producing interferon-gamma. Group 2 included 6 patients with a clinical picture consistent with invasive fungal disease (IFD): 2 cases of proven IM and 4 cases of possible IFD. The proven patients had significantly higher number of Mucorales-specific T cells producing interleukin-10 and interleukin-4 and higher rates of positive samples by using derived diagnostic cut-offs when compared with the 15 patients without IFD. Mucorales-specific T cells can be detected and monitored in patients with hematologic malignancies at risk for IM. Mucorales-specific T cells polarized to the production of T helper type 2 cytokines are associated with proven IM and may be evaluated as a surrogate diagnostic marker for IM.

  11. Mucorales-Specific T Cells in Patients with Hematologic Malignancies.

    Directory of Open Access Journals (Sweden)

    Leonardo Potenza

    Full Text Available Invasive mucormycosis (IM is an emerging life-threatening fungal infection. It is difficult to obtain a definite diagnosis and to initiate timely intervention. Mucorales-specific T cells occur during the course of IM and are involved in the clearance of the infection. We have evaluated the feasibility of detecting Mucorales-specific T cells in hematological patients at risk for IM, and have correlated the detection of such cells with the clinical conditions of the patients.By using an enzyme linked immunospot assay, the presence of Mucorales-specific T cells in peripheral blood (PB samples has been investigated at three time points during high-dose chemotherapy for hematologic malignancies. Mucorales-specific T cells producing interferon-γ, interleukin-10 and interleukin-4 were analysed in order to detect a correlation between the immune response and the clinical picture. Twenty-one (10.3% of 204 patients, accounting for 32 (5.3% of 598 PB samples, tested positive for Mucorales-specific T cells. Two groups could be identified. Group 1, including 15 patients without signs or symptoms of invasive fungal diseases (IFD, showed a predominance of Mucorales-specific T cells producing interferon-gamma. Group 2 included 6 patients with a clinical picture consistent with invasive fungal disease (IFD: 2 cases of proven IM and 4 cases of possible IFD. The proven patients had significantly higher number of Mucorales-specific T cells producing interleukin-10 and interleukin-4 and higher rates of positive samples by using derived diagnostic cut-offs when compared with the 15 patients without IFD.Mucorales-specific T cells can be detected and monitored in patients with hematologic malignancies at risk for IM. Mucorales-specific T cells polarized to the production of T helper type 2 cytokines are associated with proven IM and may be evaluated as a surrogate diagnostic marker for IM.

  12. TP53inp1 Gene Is Implicated in Early Radiation Response in Human Fibroblast Cells

    Directory of Open Access Journals (Sweden)

    Nikolett Sándor

    2015-10-01

    Full Text Available Tumor protein 53-induced nuclear protein-1 (TP53inp1 is expressed by activation via p53 and p73. The purpose of our study was to investigate the role of TP53inp1 in response of fibroblasts to ionizing radiation. γ-Ray radiation dose-dependently induces the expression of TP53inp1 in human immortalized fibroblast (F11hT cells. Stable silencing of TP53inp1 was done via lentiviral transfection of shRNA in F11hT cells. After irradiation the clonogenic survival of TP53inp1 knockdown (F11hT-shTP cells was compared to cells transfected with non-targeting (NT shRNA. Radiation-induced senescence was measured by SA-β-Gal staining and autophagy was detected by Acridine Orange dye and microtubule-associated protein-1 light chain 3 (LC3B immunostaining. The expression of TP53inp1, GDF-15, and CDKN1A and alterations in radiation induced mitochondrial DNA deletions were evaluated by qPCR. TP53inp1 was required for radiation (IR induced maximal elevation of CDKN1A and GDF-15 expressions. Mitochondrial DNA deletions were increased and autophagy was deregulated following irradiation in the absence of TP53inp1. Finally, we showed that silencing of TP53inp1 enhances the radiation sensitivity of fibroblast cells. These data suggest functional roles for TP53inp1 in radiation-induced autophagy and survival. Taken together, we suppose that silencing of TP53inp1 leads radiation induced autophagy impairment and induces accumulation of damaged mitochondria in primary human fibroblasts.

  13. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  14. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  15. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. TCR Down-Regulation Controls Virus-Specific CD8+ T Cell Responses

    DEFF Research Database (Denmark)

    Bonefeld, Charlotte Menné; Haks, Mariëlle; Nielsen, Bodil

    2008-01-01

    The CD3gamma di-leucine-based motif plays a central role in TCR down-regulation. However, little is understood about the role of the CD3gamma di-leucine-based motif in physiological T cell responses. In this study, we show that the expansion in numbers of virus-specific CD8(+) T cells is impaired...... in mice with a mutated CD3gamma di-leucine-based motif. The CD3gamma mutation did not impair early TCR signaling, nor did it compromise recruitment or proliferation of virus-specific T cells, but it increased the apoptosis rate of the activated T cells by increasing down-regulation of the antiapoptotic...... molecule Bcl-2. This resulted in a 2-fold reduction in the clonal expansion of virus-specific CD8(+) T cells during the acute phase of vesicular stomatitis virus and lymphocytic choriomeningitis virus infections. These results identify an important role of CD3gamma-mediated TCR down-regulation in virus...

  17. Induction of B-cell lymphoma by UVB Radiation in p53 Haploinsufficient Mice

    International Nuclear Information System (INIS)

    Puebla-Osorio, Nahum; Miyahara, Yasuko; Coimbatore, Sreevidya; Limón-Flores, Alberto Y; Kazimi, Nasser; Ullrich, Stephen E; Zhu, Chengming

    2011-01-01

    The incidence of non-Hodgkin's lymphoma has increased over recent years. The exact etiology of lymphoma remains unknown. Ultraviolet light exposure has been associated with the development of internal lymphoid malignancies and some reports suggest that it may play a role in the development of lymphoma in humans. Here we describe the characterization and progression of lymphoma in p53 heterozygous mice exposed to UVB irradiation. UVB-irradiated p53 +/- mice developed enlargement of the spleen. Isolated spleen cells were transplanted into Rag deficient hosts. The UV-induced tumor cells were analyzed by flow cytometry. The tumor cells were tagged with GFP to study their metastatic potential. SKY and karyotypic analysis were carried out for the detection of chromosomal abnormalities. Functional assays included in vitro class switch recombination assay, immunoglobulin rearrangement assay, as well as cytokine profiling. UVB-exposed mice showed enlargement of the spleen and lymph nodes. Cells transplanted into Rag deficient mice developed aggressive tumors that infiltrated the lymph nodes, the spleen and the bone marrow. The tumor cells did not grow in immune competent syngeneic C57Bl/6 mice yet showed a modest growth in UV-irradiated B6 mice. Phenotypic analysis of these tumor cells revealed these cells are positive for B cell markers CD19 + , CD5 + , B220 + , IgM + and negative for T cell, NK or dendritic cell markers. The UV-induced tumor cells underwent robust in vitro immunoglobulin class switch recombination in response to lipopolysaccharide. Cytogenetic analysis revealed a t(14;19) translocation and trisomy of chromosome 6. These tumor cells secret IL-10, which can promote tumor growth and cause systemic immunosuppression. UV-irradiated p53 +/- mice developed lymphoid tumors that corresponded to a mature B cell lymphoma. Our results suggest that an indirect mechanism is involved in the development of internal tumors after chronic exposure to UV light. The

  18. Induction of B-cell lymphoma by UVB Radiation in p53 Haploinsufficient Mice

    Directory of Open Access Journals (Sweden)

    Ullrich Stephen E

    2011-01-01

    Full Text Available Abstract Background The incidence of non-Hodgkin's lymphoma has increased over recent years. The exact etiology of lymphoma remains unknown. Ultraviolet light exposure has been associated with the development of internal lymphoid malignancies and some reports suggest that it may play a role in the development of lymphoma in humans. Here we describe the characterization and progression of lymphoma in p53 heterozygous mice exposed to UVB irradiation. Methods UVB-irradiated p53+/- mice developed enlargement of the spleen. Isolated spleen cells were transplanted into Rag deficient hosts. The UV-induced tumor cells were analyzed by flow cytometry. The tumor cells were tagged with GFP to study their metastatic potential. SKY and karyotypic analysis were carried out for the detection of chromosomal abnormalities. Functional assays included in vitro class switch recombination assay, immunoglobulin rearrangement assay, as well as cytokine profiling. Results UVB-exposed mice showed enlargement of the spleen and lymph nodes. Cells transplanted into Rag deficient mice developed aggressive tumors that infiltrated the lymph nodes, the spleen and the bone marrow. The tumor cells did not grow in immune competent syngeneic C57Bl/6 mice yet showed a modest growth in UV-irradiated B6 mice. Phenotypic analysis of these tumor cells revealed these cells are positive for B cell markers CD19+, CD5+, B220+, IgM+ and negative for T cell, NK or dendritic cell markers. The UV-induced tumor cells underwent robust in vitro immunoglobulin class switch recombination in response to lipopolysaccharide. Cytogenetic analysis revealed a t(14;19 translocation and trisomy of chromosome 6. These tumor cells secret IL-10, which can promote tumor growth and cause systemic immunosuppression. Conclusion UV-irradiated p53+/- mice developed lymphoid tumors that corresponded to a mature B cell lymphoma. Our results suggest that an indirect mechanism is involved in the development of internal

  19. Modulation of Trypanosoma cruzi-specific T-cell responses after chemotherapy for chronic Chagas disease

    Directory of Open Access Journals (Sweden)

    María Cecilia Albareda

    2015-05-01

    Full Text Available The aim of this review is to describe the contributions of the knowledge of T-cell responses to the understanding of the physiopathology and the responsiveness to etiological treatment during the chronic phase of Chagas disease. T-helper (Th1 and interleukin (IL-10 Trypanosoma cruzi-specific T-cells have been linked to the asymptomatic phase or to severe clinical forms of the disease, respectively or vice versa, depending on the T. cruzi antigen source, the patient’s location and the performed immunological assays. Parasite-specific T-cell responses are modulated after benznidazole (BZ treatment in chronically T. cruzi-infected subjects in association with a significant decrease in T. cruzi-specific antibodies. Accumulating evidence has indicated that treatment efficacy during experimental infection with T. cruzi results from the combined action of BZ and the activation of appropriate immune responses in the host. However, strong support of this interaction in T. cruzi-infected humans remains lacking. Overall, the quality of T-cell responses might be a key factor in not only disease evolution, but also chemotherapy responsiveness. Immunological parameters are potential indicators of treatment response regardless of achievement of cure. Providing tools to monitor and provide early predictions of treatment success will allow the development of new therapeutic options.

  20. Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

    International Nuclear Information System (INIS)

    Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

    2005-01-01

    The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

  1. Cross-reactive microbial peptides can modulate HIV-specific CD8+ T cell responses.

    Directory of Open Access Journals (Sweden)

    Christopher W Pohlmeyer

    Full Text Available Heterologous immunity is an important aspect of the adaptive immune response. We hypothesized that this process could modulate the HIV-1-specific CD8+ T cell response, which has been shown to play an important role in HIV-1 immunity and control. We found that stimulation of peripheral blood mononuclear cells (PBMCs from HIV-1-positive subjects with microbial peptides that were cross-reactive with immunodominant HIV-1 epitopes resulted in dramatic expansion of HIV-1-specific CD8+ T cells. Interestingly, the TCR repertoire of HIV-1-specific CD8+ T cells generated by ex vivo stimulation of PBMCs using HIV-1 peptide was different from that of cells stimulated with cross-reactive microbial peptides in some HIV-1-positive subjects. Despite these differences, CD8+ T cells stimulated with either HIV-1 or cross-reactive peptides effectively suppressed HIV-1 replication in autologous CD4+ T cells. These data suggest that exposure to cross-reactive microbial antigens can modulate HIV-1-specific immunity.

  2. Impaired quality of the hepatitis B virus (HBV)-specific T-cell response in human immunodeficiency virus type 1-HBV coinfection.

    Science.gov (United States)

    Chang, J Judy; Sirivichayakul, Sunee; Avihingsanon, Anchalee; Thompson, Alex J V; Revill, Peter; Iser, David; Slavin, John; Buranapraditkun, Supranee; Marks, Pip; Matthews, Gail; Cooper, David A; Kent, Stephen J; Cameron, Paul U; Sasadeusz, Joe; Desmond, Paul; Locarnini, Stephen; Dore, Gregory J; Ruxrungtham, Kiat; Lewin, Sharon R

    2009-08-01

    Hepatitis B virus (HBV)-specific T cells play a key role both in the control of HBV replication and in the pathogenesis of liver disease. Human immunodeficiency virus type 1 (HIV-1) coinfection and the presence or absence of HBV e (precore) antigen (HBeAg) significantly alter the natural history of chronic HBV infection. We examined the HBV-specific T-cell responses in treatment-naïve HBeAg-positive and HBeAg-negative HIV-1-HBV-coinfected (n = 24) and HBV-monoinfected (n = 39) Asian patients. Peripheral blood was stimulated with an overlapping peptide library for the whole HBV genome, and tumor necrosis factor alpha and gamma interferon cytokine expression in CD8+ T cells was measured by intracellular cytokine staining and flow cytometry. There was no difference in the overall magnitude of the HBV-specific T-cell responses, but the quality of the response was significantly impaired in HIV-1-HBV-coinfected patients compared with monoinfected patients. In coinfected patients, HBV-specific T cells rarely produced more than one cytokine and responded to fewer HBV proteins than in monoinfected patients. Overall, the frequency and quality of the HBV-specific T-cell responses increased with a higher CD4+ T-cell count (P = 0.018 and 0.032, respectively). There was no relationship between circulating HBV-specific T cells and liver damage as measured by activity and fibrosis scores, and the HBV-specific T-cell responses were not significantly different in patients with either HBeAg-positive or HBeAg-negative disease. The quality of the HBV-specific T-cell response is impaired in the setting of HIV-1-HBV coinfection and is related to the CD4+ T-cell count.

  3. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    Science.gov (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  4. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    Science.gov (United States)

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  5. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  6. Detailed analysis of Epstein–Barr virus-specific CD4+ and CD8+ T cell responses during infectious mononucleosis

    Science.gov (United States)

    Scherrenburg, J; Piriou, E R W A N; Nanlohy, N M; van Baarle, D

    2008-01-01

    We studied simultaneously Epstein–Barr virus (EBV)-specific CD4+ and CD8+ T cell responses during and after infectious mononucleosis (IM), using a previously described 12-day stimulation protocol with EBNA1 or BZLF1 peptide pools. Effector function of EBV-specific T cells was determined after restimulation by measuring intracellular interferon-γ production. During IM, BZLF1-specifc CD4+ T cell responses were dominant compared with CD8+ T cell responses. EBNA1-specific CD4+ and CD8+ T cell responses were low and remained similar for 6 months. However, 6 months after IM, BZLF1-specific CD4+ T cell responses had declined, but CD8+ T cell responses had increased. At diagnosis, EBV-specific CD8+ T cells as studied by human leucocyte antigen class I tetramer staining comprised a tetramerbrightCD8bright population consisting mainly of CD27+ memory T cells and a tetramerdimCD8dim population consisting primarily of CD27- effector T cells. The remaining EBV-specific CD8+ T cell population 6 months after the diagnosis of IM consisted mainly of tetramerbrightCD8bright CD27+ T cells, suggesting preferential preservation of memory T cells after contraction of the EBV-specific T cell pool. PMID:18549439

  7. The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

    Science.gov (United States)

    Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

    2018-05-01

    In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.

    Science.gov (United States)

    Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana

    2013-08-01

    Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.

  9. Increased sequence diversity coverage improves detection of HIV-Specific T cell responses

    DEFF Research Database (Denmark)

    Frahm, N.; Kaufmann, D.E.; Yusim, K.

    2007-01-01

    The accurate identification of HIV-specific T cell responses is important for determining the relationship between immune response, viral control, and disease progression. HIV-specific immune responses are usually measured using peptide sets based on consensus sequences, which frequently miss res...

  10. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    Science.gov (United States)

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    Science.gov (United States)

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  12. Mycobacterium tuberculosis specific CD8(+ T cells rapidly decline with antituberculosis treatment.

    Directory of Open Access Journals (Sweden)

    Melissa R Nyendak

    Full Text Available Biomarkers associated with response to therapy in tuberculosis could have broad clinical utility. We postulated that the frequency of Mycobacterium tuberculosis (Mtb specific CD8(+ T cells, by virtue of detecting intracellular infection, could be a surrogate marker of response to therapy and would decrease during effective antituberculosis treatment.We sought to determine the relationship of Mtb specific CD4(+ T cells and CD8(+ T cells with duration of antituberculosis treatment.We performed a prospective cohort study, enrolling between June 2008 and August 2010, of HIV-uninfected Ugandan adults (n = 50 with acid-fast bacillus smear-positive, culture confirmed pulmonary TB at the onset of antituberculosis treatment and the Mtb specific CD4(+ and CD8(+ T cell responses to ESAT-6 and CFP-10 were measured by IFN-γ ELISPOT at enrollment, week 8 and 24.There was a significant difference in the Mtb specific CD8(+ T response, but not the CD4(+ T cell response, over 24 weeks of antituberculosis treatment (p<0.0001, with an early difference observed at 8 weeks of therapy (p = 0.023. At 24 weeks, the estimated Mtb specific CD8(+ T cell response decreased by 58%. In contrast, there was no significant difference in the Mtb specific CD4(+ T cell during the treatment. The Mtb specific CD4(+ T cell response, but not the CD8(+ response, was negatively impacted by the body mass index.Our data provide evidence that the Mtb specific CD8(+ T cell response declines with antituberculosis treatment and could be a surrogate marker of response to therapy. Additional research is needed to determine if the Mtb specific CD8(+ T cell response can detect early treatment failure, relapse, or to predict disease progression.

  13. Therapeutic Response to Non-genotoxic Activation of p53 by Nutlin3a Is Driven by PUMA-Mediated Apoptosis in Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Liz J. Valente

    2016-03-01

    Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.

  14. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  15. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  16. Arsenic promotes centrosome abnormalities and cell colony formation in p53 compromised human lung cells

    International Nuclear Information System (INIS)

    Liao Weiting; Lin Pinpin; Cheng, T.-S.; Yu, H.-S.; Chang, Louis W.

    2007-01-01

    Epidemiological evidence indicated that residents, especially cigarette smokers, in arseniasis areas had significantly higher lung cancer risk than those living in non-arseniasis areas. Thus, an interaction between arsenic and cigarette smoking in lung carcinogenesis was suspected. p53 dysfunction or mutation in lung epithelial cells was frequently observed in cigarette smokers. Our present study was to explore the differential effects by arsenic on H1355 cells (human lung adenocarcinoma cell line with mutation in p53), BEAS-2B (immortalized lung epithelial cell with functional p53) and pifithrin-α-treated BEAS-2B cells (p53-inhibited cells). These cells were treated with different doses of sodium arsenite (0, 0.1, 1, 5 and 10 μM) for 48 h. A greater reduction in cell viability was observed in the BEAS-2B cells vs. p53 compromised cells (H1355 or p53-inhibited BEAS-2B). Similar observation was also made on 7-day cell survival (growth) study. TUNEL analysis confirmed that there was indeed a significantly reduced arsenite-induced apoptosis found in p53-compromised cells. Centrosomal abnormality has been attributed to eventual chromosomal missegregation, aneuploidy and tumorigenesis. In our present study, reduced p21 and Gadd45a expressions and increased centrosomal abnormality (atopic and multiple centrosomes) were observed in both arsenite-treated H1355 and p53-inhibited BEAS-2B cells as compared with similarly treated BEAS-2B cells. Increased anchorage-independent growth (colony formation) of BEAS-2B cells co-treated with pifithrin-α and 5 μM sodium arsenite was also observed in soft agar. Our present investigation demonstrated that arsenic would act specifically on p53 compromised cells (either with p53 dysfunction or inhibited) to induce centrosomal abnormality and colony formation. These findings provided strong evidence on the carcinogenic promotional role of arsenic, especially under the condition of p53 dysfunction

  17. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    Science.gov (United States)

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  18. PD-L1-specific T cells

    DEFF Research Database (Denmark)

    Ahmad, Shamaila Munir; Borch, Troels Holz; Hansen, Morten

    2016-01-01

    -specific T cells that recognize both PD-L1-expressing immune cells and malignant cells. Thus, PD-L1-specific T cells have the ability to modulate adaptive immune reactions by reacting to regulatory cells. Thus, utilization of PD-L1-derived T cell epitopes may represent an attractive vaccination strategy...... for targeting the tumor microenvironment and for boosting the clinical effects of additional anticancer immunotherapy. This review summarizes present information about PD-L1 as a T cell antigen, depicts the initial findings about the function of PD-L1-specific T cells in the adjustment of immune responses...

  19. Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II peptide-pulsed DCs

    Directory of Open Access Journals (Sweden)

    Satthaporn Sukchai

    2009-03-01

    Full Text Available Abstract Background Optimal techniques for DC generation for immunotherapy in cancer are yet to be established. Study aims were to evaluate: (i DC activation/maturation milieu (TNF-α +/- IFN-α and its effects on CD8+ hTERT-specific T cell responses to class I epitopes (p540 or p865, (ii CD8+ hTERT-specific T cell responses elicited by vaccination with class I alone or both class I and II epitope (p766 and p672-pulsed DCs, prepared without IFN-α, (iii association between circulating T regulatory cells (Tregs and clinical responses. Methods Autologous DCs were generated from 10 patients (HLA-0201 with advanced cancer by culturing CD14+ blood monocytes in the presence of GM-CSF and IL-4 supplemented with TNF-α [DCT] or TNF-α and IFN-α [DCTI]. The capacity of the DCs to induce functional CD8+ T cell responses to hTERT HLA-0201 restricted nonapeptides was assessed by MHC tetramer binding and peptide-specific cytotoxicity. Each DC preparation (DCT or DCTI was pulsed with only one type of hTERT peptide (p540 or p865 and both preparations were injected into separate lymph node draining regions every 2–3 weeks. This vaccination design enabled comparison of efficacy between DCT and DCTI in generating hTERT peptide specific CD8+ T cells and comparison of class I hTERT peptide (p540 or p865-loaded DCT with or without class II cognate help (p766 and p672 in 6 patients. T regulatory cells were evaluated in 8 patients. Results (i DCTIs and DCTs, pulsed with hTERT peptides, were comparable (p = 0.45, t-test in inducing peptide-specific CD8+ T cell responses. (ii Class II cognate help, significantly enhanced (p (iii Clinical responders had significantly lower (p Conclusion Addition of IFN-α to ex vivo monocyte-derived DCs, did not significantly enhance peptide-specific T cell responses in vivo, compared with TNF-α alone. Class II cognate help significantly augments peptide-specific T cell responses. Clinically favourable responses were seen in patients

  20. An adaptive molecular timer in p53-meidated cell fate decision

    Science.gov (United States)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  1. Chemotherapy and radiation therapy elicits tumor specific T cell responses in a breast cancer patient

    International Nuclear Information System (INIS)

    Bernal-Estévez, David; Sánchez, Ramiro; Tejada, Rafael E.; Parra-López, Carlos

    2016-01-01

    Experimental evidence and clinical studies in breast cancer suggest that some anti-tumor therapy regimens generate stimulation of the immune system that accounts for tumor clinical responses, however, demonstration of the immunostimulatory power of these therapies on cancer patients continues to be a formidable challenge. Here we present experimental evidence from a breast cancer patient with complete clinical response after 7 years, associated with responsiveness of tumor specific T cells. T cells were obtained before and after anti-tumor therapy from peripheral blood of a 63-years old woman diagnosed with ductal breast cancer (HER2/neu+++, ER-, PR-, HLA-A*02:01) treated with surgery, followed by paclitaxel, trastuzumab (suspended due to cardiac toxicity), and radiotherapy. We obtained a leukapheresis before surgery and after 8 months of treatment. Using in vitro cell cultures stimulated with autologous monocyte-derived dendritic cells (DCs) that produce high levels of IL-12, we characterize by flow cytometry the phenotype of tumor associated antigens (TAAs) HER2/neu and NY-ESO 1 specific T cells. The ex vivo analysis of the TCR-Vβ repertoire of TAA specific T cells in blood and Tumor Infiltrating Lymphocytes (TILs) were performed in order to correlate both repertoires prior and after therapy. We evidence a functional recovery of T cell responsiveness to polyclonal stimuli and expansion of TAAs specific CD8+ T cells using peptide pulsed DCs, with an increase of CTLA-4 and memory effector phenotype after anti-tumor therapy. The ex vivo analysis of the TCR-Vβ repertoire of TAA specific T cells in blood and TILs showed that whereas the TCR-Vβ04-02 clonotype is highly expressed in TILs the HER2/neu specific T cells are expressed mainly in blood after therapy, suggesting that this particular TCR was selectively enriched in blood after anti-tumor therapy. Our results show the benefits of anti-tumor therapy in a breast cancer patient with clinical complete response in

  2. Mutant p53 - heat shock response oncogenic cooperation: a new mechanism of cancer cell survival

    Directory of Open Access Journals (Sweden)

    Evguenia eAlexandrova

    2015-04-01

    Full Text Available The main tumor suppressor function of p53 as a ‘guardian of the genome’ is to respond to cellular stress by transcriptional activation of apoptosis, growth arrest or senescence in damaged cells. Not surprisingly, mutations in the p53 gene are the most frequent genetic alteration in human cancers. Importantly, mutant p53 (mutp53 proteins not only lose their wild-type tumor suppressor activity, but also can actively promote tumor development. Two main mechanisms accounting for mutp53 proto-oncogenic activity are inhibition of the wild-type p53 in a dominant-negative fashion and gain of additional oncogenic activities known as gain-of-function (GOF. Here we discuss a novel mechanism of mutp53 GOF, which relies on its oncogenic cooperation with the heat shock machinery. This coordinated adaptive mechanism renders cancer cells more resistant to proteotoxic stress and provides both, a strong survival advantage to cancer cells and a promising means for therapeutic intervention.

  3. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    International Nuclear Information System (INIS)

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira

    2007-01-01

    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

  4. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    Science.gov (United States)

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or

  5. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  6. Effect of anti-IgE therapy on food allergen specific T cell responses in eosinophil associated gastrointestinal disorders

    Directory of Open Access Journals (Sweden)

    Prussin Calman

    2011-04-01

    Full Text Available Abstract Background Anti-IgE therapy inhibits mast cell and basophil activation, blocks IgE binding to both FcεRI and CD23 and down regulates FcεRI expression by antigen (Ag presenting cells (APCs. In addition to its classical role in immediate hypersensitivity, IgE has been shown in vitro to facilitate Ag presentation of allergens, whereby APC bound IgE preferentially takes up allergens for subsequent processing and presentation. The purpose of this study was to determine whether anti-IgE therapy, by blocking facilitated Ag presentation in vivo, attenuates allergen specific Th2 cell responses. Methods To test this hypothesis, food allergen specific T cell responses were examined during a 16-week clinical trial of omalizumab in nine subjects with eosinophilic gastroenteritis and food sensitization. Allergen specific T cell responses were measured using carboxyfluorescein succinimidyl ester dye dilution coupled with intracellular cytokine staining and polychromatic flow cytometry. Four independent indices of allergen specific T cell response (proliferation, Ag dose response, precursor frequency, and the ratio of Th2:Th1 cytokine expression were determined. Results Eight of the 9 subjects had measurable food allergen specific responses, with a median proliferation index of 112-fold. Allergen specific T cell proliferation was limited to CD4 T cells, whereas CD8 T cell did not proliferate. Food allergen specific responses were Th2 skewed relative to tetanus specific responses in the same subjects. In contradistinction to the original hypothesis, anti-IgE treatment did not diminish any of the four measured indices of allergen specific T cell response. Conclusions In sum, using multiple indices of T cell function, this study failed to demonstrate that anti-IgE therapy broadly or potently inhibits allergen specific T cell responses. As such, these data do not support a major role for IgE facilitated Ag presentation augmenting allergen specific T cell

  7. Reactivating p53 and Inducing Tumor Apoptosis (RITA Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin

    Directory of Open Access Journals (Sweden)

    Armin Wiegering

    2017-04-01

    Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number

  8. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  9. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  10. Mechanisms of cross-suppression of TNP-specific plaque forming cell responses by TMA-specific first-order T suppressor factor

    Energy Technology Data Exchange (ETDEWEB)

    Jendrisak, G.S.; Bellone, C.J.

    1986-03-05

    The addition of hybridoma-derived phenyltrimethylammonium (TMA)-specific first-order T suppressor factor (TsF/sub 1/) into cultures containing Brucella abortus coupled with the TMA and trinitrophenol haptens (TMA-BA-TNP) results in the cross-suppression of TNP-specific plaque forming cell (PFC) responses. The suppression mediated by TMA-TsF/sub 1/ is dependent on the presence of T cells and specific antigen (TMA). Subculturing of whole spleen cells with TMA-TsF/sub 1/ and specific soluble antigen (TMA-BSA) is able to induce suppressor T cells which cross-suppress the TNP-specific PFC of spleen cell cultures stimulated with TMA-BA-TNP in an antigen (TMA)-dependent manner at the effector phase of the response. The effector acting T suppressor cells (Tse) are nylon wool nonadherent and appears to require whole spleen cells in responding cultures for suppression, suggesting that the target of the Tse is not the TNP-specific B cell. The authors are presently characterizing the mechanisms of cross-suppression by TMA-TsF/sub 1/ and Tse utilizing the described primary in vitro antibody assay.

  11. Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

    Science.gov (United States)

    Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

    2016-01-01

    Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

  12. Neutral Polymer Micelle Carriers with pH-Responsive, Endosome-Releasing Activity Modulate Antigen Trafficking to Enhance CD8 T-Cell Responses

    Science.gov (United States)

    Keller, Salka; Wilson, John T; Patilea, Gabriela I; Kern, Hanna B; Convertine, Anthony J; Stayton, Patrick S

    2014-01-01

    Synthetic subunit vaccines need to induce CD8+ cytotoxic T-cell (CTL) responses for effective vaccination against intracellular pathogens. Most subunit vaccines primarily generate humoral immune responses, with a weaker than desired CD8+ cytotoxic T-cell response. Here, a neutral, pH-responsive polymer micelle carrier that alters intracellular antigen trafficking was shown to enhance CD8+ T-cell responses with a correlated increase in cytosolic delivery and a decrease in exocytosis. Polymer diblock carriers consisted of a N-(2-hydroxypropyl) methacrylamide corona block with pendant pyridyl disulfide groups for reversible conjugation of thiolated ovalbumin, and a tercopolymer ampholytic core-forming block composed of propylacrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The diblock copolymers self-assembled into 25–30 nm diameter micellar nanoparticles. Conjugation of ovalbumin to the micelles significantly enhanced antigen cross-presentation in vitro relative to free ovalbumin, an unconjugated physical mixture of ovalbumin and polymer, and a non pH-responsive micelle-ovalbumin control. Mechanistic studies in a murine dendritic cell line (DC2.4) demonstrated micelle-mediated enhancements in intracellular antigen retention and cytosolic antigen accumulation. Approximately 90% of initially internalized ovalbumin-conjugated micelles were retained in cells after 1.5 h, compared to only ~40% for controls. Furthermore, cells dosed with conjugates displayed 67-fold higher cytosolic antigen levels relative to soluble ovalbumin 4 h post uptake. Subcutaneous immunization of mice with ovalbumin-polymer conjugates significantly enhanced antigen-specific CD8+ T cell responses (0.4 % IFN-γ+ of CD8+) compared to immunization with soluble protein, ovalbumin and polymer mixture, and the control micelle without endosome-releasing activity. Additionally, pH-responsive carrier facilitated antigen delivery to antigen presenting cells in the

  13. Neutral polymer micelle carriers with pH-responsive, endosome-releasing activity modulate antigen trafficking to enhance CD8(+) T cell responses.

    Science.gov (United States)

    Keller, Salka; Wilson, John T; Patilea, Gabriela I; Kern, Hanna B; Convertine, Anthony J; Stayton, Patrick S

    2014-10-10

    Synthetic subunit vaccines need to induce CD8(+) cytotoxic T cell (CTL) responses for effective vaccination against intracellular pathogens. Most subunit vaccines primarily generate humoral immune responses, with a weaker than desired CD8(+) cytotoxic T cell response. Here, a neutral, pH-responsive polymer micelle carrier that alters intracellular antigen trafficking was shown to enhance CD8(+) T cell responses with a correlated increase in cytosolic delivery and a decrease in exocytosis. Polymer diblock carriers consisted of a N-(2-hydroxypropyl) methacrylamide corona block with pendent pyridyl disulfide groups for reversible conjugation of thiolated ovalbumin, and a tercopolymer ampholytic core-forming block composed of propylacrylic acid (PAA), dimethylaminoethyl methacrylate (DMAEMA), and butyl methacrylate (BMA). The diblock copolymers self-assembled into 25-30nm diameter micellar nanoparticles. Conjugation of ovalbumin to the micelles significantly enhanced antigen cross-presentation in vitro relative to free ovalbumin, an unconjugated physical mixture of ovalbumin and polymer, and a non-pH-responsive micelle-ovalbumin control. Mechanistic studies in a murine dendritic cell line (DC 2.4) demonstrated micelle-mediated enhancements in intracellular antigen retention and cytosolic antigen accumulation. Approximately 90% of initially internalized ovalbumin-conjugated micelles were retained in cells after 1.5h, compared to only ~40% for controls. Furthermore, cells dosed with conjugates displayed 67-fold higher cytosolic antigen levels relative to soluble ovalbumin 4h post uptake. Subcutaneous immunization of mice with ovalbumin-polymer conjugates significantly enhanced antigen-specific CD8(+) T cell responses (0.4% IFN-γ(+) of CD8(+)) compared to immunization with soluble protein, ovalbumin and polymer mixture, and the control micelle without endosome-releasing activity. Additionally, pH-responsive carrier facilitated antigen delivery to antigen presenting cells

  14. Gene expression patterns associated with p53 status in breast cancer

    International Nuclear Information System (INIS)

    Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

    2006-01-01

    Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

  15. Clonal analysis of T-cell responses to herpes simplex virus: isolation, characterization and antiviral properties of an antigen-specific helper T-cell clone.

    Science.gov (United States)

    Leung, K N; Nash, A A; Sia, D Y; Wildy, P

    1984-12-01

    A herpes simplex virus (HSV)-specific long-term T-cell clone has been established from the draining lymph node cells of BALB/c mice; the cells required repeated in vitro restimulation with UV-irradiated virus. The established T-cell clone expresses the Thy-1 and Lyt-1+2,3- surface antigens. For optimal proliferation of the cloned cells, both the presence of specific antigen and an exogenous source of T-cell growth factor are required. The proliferative response of the cloned T cells was found to be virus-specific but it did not distinguish between HSV-1 and HSV-2. Adoptive cell transfer of the cloned T cells helped primed B cells to produce anti-herpes antibodies: the response was antigen-specific and cell dose-dependent. The clone failed to produce a significant DTH reaction in vivo, but did produce high levels of macrophage-activating factor. Furthermore, the T-cell clone could protect from HSV infection, as measured by a reduction in local virus growth, and by enhanced survival following the challenge of mice with a lethal dose of virus. The mechanism(s) whereby this clone protects in vivo is discussed.

  16. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  17. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  18. Long-term nonprogression and broad HIV-1-specific proliferative T-cell responses

    Directory of Open Access Journals (Sweden)

    Nesrina eImami

    2013-03-01

    Full Text Available Complex mechanisms underlying the maintenance of fully functional, proliferative, HIV-1-specific T-cell responses involve processes from early T-cell development through to the final stages of T-cell differentiation and antigen recognition. Virus-specific proliferative CD4 and CD8 T-cell responses, important for the control of infection, are observed in some HIV-1+ patients during early stages of disease, and are maintained in long-term nonprogressing subjects. In the vast majority of HIV-1+ patients, full immune functionality is lost when proliferative HIV-1-specific T-cell responses undergo a variable progressive decline throughout the course of chronic infection. This appears irreparable despite administration of potent combination antiretroviral therapy, which to date is non-curative, necessitating life-long administration and the development of effective, novel, therapeutic interventions. While a sterilising cure, involving clearance of virus from the host, remains a primary aim, a functional cure may be a more feasible goal with considerable impact on worldwide HIV-1 infection. Such an approach would enable long-term co-existence of host and virus in the absence of toxic and costly drugs. Effective immune homeostasis coupled with a balanced response appropriately targeting conserved viral antigens, in a manner that avoids hyperactivation and exhaustion, may prove to be the strongest correlate of durable viral control. This review describes novel concepts underlying full immune functionality in the context of HIV-1 infection, which may be utilised in future strategies designed to improve upon existing therapy. The aim will be to induce long-term nonprogressor or elite controller status in every infected host, through immune-mediated control of viraemia and reduction of viral reservoirs, leading to lower HIV-1 transmission rates.

  19. Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

    Directory of Open Access Journals (Sweden)

    Krystelle Nganou-Makamdop

    Full Text Available Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS, resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2 = 0.60, p<0.0001. The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

  20. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  1. Regulation of CD8+ T cell responses to retinal antigen by local FoxP3+ regulatory T cells

    Directory of Open Access Journals (Sweden)

    Scott W McPherson

    2012-06-01

    Full Text Available While pathogenic CD4 T cells are well known mediators of autoimmune uveoretinitis, CD8 T cells can also be uveitogenic. Since preliminary studies indicated that C57BL/6 mice were minimally susceptible to autoimmune uveoretinitis induction by CD8 T cells, the basis of the retinal disease resistance was sought. Mice that express β-galactosidase (βgal on a retina-specific promoter (arrβgal mice were backcrossed to mice expressing green fluorescent protein and diphtheria toxin receptor under control of the Foxp3 promoter (Foxp3-DTR/GFP mice, and to T cell receptor transgenic mice that produce βgal specific CD8 T cells (BG1 mice. These mice were used to explore the role of regulatory T cells in the resistance to retinal autoimmune disease. Experiments with T cells from double transgenic BG1 x Foxp3-DTR/GFP mice transferred into Foxp3-DTR/GFP x arrβgal mice confirmed that the retina was well protected from attempts to induce disease by adoptive transfer of activated BG1 T cells. The successful induction of retinal disease following unilateral intraocular administration of diphtheria toxin to deplete regulatory T cells showed that the protective activity was dependent on local, toxin-sensitive regulatory T cells; the opposite, untreated eye remained disease-free. Although there were very few Foxp3+ regulatory T cells in the parenchyma of quiescent retina, and they did not accumulate in retina, their depletion by local toxin administration led to disease susceptibility. We propose that these regulatory T cells modulate the pathogenic activity of βgal-specific CD8 T cells in the retinas of arrβgal mice on a local basis, allowing immunoregulation to be responsive to local conditions.

  2. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    Science.gov (United States)

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  3. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  4. Successful generation of primary virus-specific and anti-tumor T-cell responses from the naive donor T-cell repertoire is determined by the balance between antigen-specific precursor T cells and regulatory T cells.

    NARCIS (Netherlands)

    Jedema, I.; Meent, M. van de; Pots, J.M.; Kester, M.G.; Beek, M.T. van der; Falkenburg, J.H.F.

    2011-01-01

    BACKGROUND: One of the major challenges in allogeneic stem cell transplantation is to find a balance between the harmful induction of graft-versus-host disease and the beneficial graft-versus-leukemia and pathogen-specific immune responses. Adoptive transfer of in-vitro generated donor T cells with

  5. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4⁺ and CD8⁺ T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.

    Science.gov (United States)

    Fornara, Chiara; Furione, Milena; Arossa, Alessia; Gerna, Giuseppe; Lilleri, Daniele

    2016-07-01

    To discriminate between primary (PI) and remote (RI) human cytomegalovirus (HCMV) infection, several immunological parameters were monitored for a 2-year period in 53 pregnant women with PI, and 33 pregnant women experiencing HCMV PI at least 5 years prior. Cytokine (IFN-γ and IL-2) production by and phenotype (effector/memory CD45RA(+)) of HCMV-specific CD4(+) and CD8(+) T-cells as well as the lymphoproliferative responses (LPR) were evaluated, with special reference to the comparison between a group of women transmitting (T) and a group of non-transmitting (NT) the infection to fetus. While HCMV-specific CD4(+) T-cells reached at 90 days post-infection (p.i.) values comparable to RI, CD8(+) T-cells reached at 60 days p.i. levels significantly higher and persisting throughout the entire follow-up. Instead, IL-2 production and lymphoproliferative responses were lower in PI than RI for the entire follow-up period. Effector memory CD45RA(+) CD4(+) and CD8(+) HCMV-specific T-cells increased until 90 days p.i., reaching and maintaining levels higher than RI. The comparison between T and NT women showed that, at 30 days p.i., in NT women there was a significantly higher IL-2 production by HCMV-specific CD4(+) T-cells, and at 60 days p.i. a significantly higher frequency of both specific CD4(+) and CD8(+) CD45RA(+) T-cells. HCMV T-cell response appears to correlate with virus transmission to fetus and some parameters (CD4(+) lymphoproliferation, and frequency of HCMV-specific CD8(+) IL2(+) T-cells) may help in dating PI during pregnancy. © 2015 Wiley Periodicals, Inc.

  6. Monitoring T-Cell Responses in Translational Studies: Optimization of Dye-Based Proliferation Assay for Evaluation of Antigen-Specific Responses

    Directory of Open Access Journals (Sweden)

    Anja Ten Brinke

    2017-12-01

    Full Text Available Adoptive therapy with regulatory T cells or tolerance-inducing antigen (Ag-presenting cells is innovative and promising therapeutic approach to control undesired and harmful activation of the immune system, as observed in autoimmune diseases, solid organ and bone marrow transplantation. One of the critical issues to elucidate the mechanisms responsible for success or failure of these therapies and define the specificity of the therapy is the evaluation of the Ag-specific T-cell responses. Several efforts have been made to develop suitable and reproducible assays. Here, we focus on dye-based proliferation assays. We highlight with practical examples the fundamental issues to take into consideration for implementation of an effective and sensitive dye-based proliferation assay to monitor Ag-specific responses in patients. The most critical points were used to design a road map to set up and analyze the optimal assay to assess Ag-specific T-cell responses in patients undergoing different treatments. This is the first step to optimize monitoring of tolerance induction, allowing comparison of outcomes of different clinical studies. The road map can also be applied to other therapeutic interventions, not limited to tolerance induction therapies, in which Ag-specific T-cell responses are relevant such as vaccination approaches and cancer immunotherapy.

  7. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  8. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  9. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  10. The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

    Directory of Open Access Journals (Sweden)

    Jennifer M. Smith

    2007-12-01

    Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

  11. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  12. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Energy Technology Data Exchange (ETDEWEB)

    Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  13. Characterisation in vivo of ways of induced deaths by p53, in the male germinal cells

    International Nuclear Information System (INIS)

    Coureuil, M.

    2006-10-01

    The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)

  14. Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

    Science.gov (United States)

    Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

    2009-01-01

    Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

  15. A High Frequency of HIV-Specific Circulating Follicular Helper T Cells Is Associated with Preserved Memory B Cell Responses in HIV Controllers.

    Science.gov (United States)

    Claireaux, M; Galperin, M; Benati, D; Nouël, A; Mukhopadhyay, M; Klingler, J; de Truchis, P; Zucman, D; Hendou, S; Boufassa, F; Moog, C; Lambotte, O; Chakrabarti, L A

    2018-05-08

    Follicular helper T cells (Tfh) play an essential role in the affinity maturation of the antibody response by providing help to B cells. To determine whether this CD4 + T cell subset may contribute to the spontaneous control of HIV infection, we analyzed the phenotype and function of circulating Tfh (cTfh) in patients from the ANRS CO21 CODEX cohort who naturally controlled HIV-1 replication to undetectable levels and compared them to treated patients with similarly low viral loads. HIV-specific cTfh (Tet + ), detected by Gag-major histocompatibility complex class II (MHC-II) tetramer labeling in the CD45RA - CXCR5 + CD4 + T cell population, proved more frequent in the controller group ( P = 0.002). The frequency of PD-1 expression in Tet + cTfh was increased in both groups (median, >75%) compared to total cTfh (<30%), but the intensity of PD-1 expression per cell remained higher in the treated patient group ( P = 0.02), pointing to the persistence of abnormal immune activation in treated patients. The function of cTfh, analyzed by the capacity to promote IgG secretion in cocultures with autologous memory B cells, did not show major differences between groups in terms of total IgG production but proved significantly more efficient in the controller group when measuring HIV-specific IgG production. The frequency of Tet + cTfh correlated with HIV-specific IgG production ( R = 0.71 for Gag-specific and R = 0.79 for Env-specific IgG, respectively). Taken together, our findings indicate that key cTfh-B cell interactions are preserved in controlled HIV infection, resulting in potent memory B cell responses that may play an underappreciated role in HIV control. IMPORTANCE The rare patients who spontaneously control HIV replication in the absence of therapy provide a unique model to identify determinants of an effective anti-HIV immune response. HIV controllers show signs of particularly efficient antiviral T cell responses, while their humoral response was until recently

  16. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    International Nuclear Information System (INIS)

    Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.

    2009-01-01

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.

  17. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  18. MDM2 inhibitor nutlin-3a induces apoptosis and senescence in cutaneous T-cell lymphoma: Role of p53

    DEFF Research Database (Denmark)

    Manfé, Valentina; Biskup, Edyta Urszula; Johansen, Peter

    2012-01-01

    cell lines, P53 mutation analysis identified a homozygous nonsense mutation (R196Stop in Hut-78) and a homozygous missense mutation (G245S in SeAx). In MyLa2000, Mac1, and Mac2a carrying wild-type P53, nutlin-3a induced apoptosis and senescence demonstrated by permanent G0/G1 cell-cycle block...... with intact p53 but also in Hut-78, SeAx, and Sézary cells. Thus, targeting p53 by nutlin-3a may constitute a therapeutic approach in CTCL because of increased apoptosis and senescence of tumor cells....

  19. Self-recognition specificity expressed by T cells from nude mice. Absence of detectable Ia-restricted T cells in nude mice that do exhibit self-K/D-restricted T cell responses

    International Nuclear Information System (INIS)

    Kruisbeek, A.M.; Davis, M.L.; Matis, L.A.; Longo, D.L.

    1984-01-01

    The presence in athymic nude mice of precursor T cells with self-recognition specificity for either H-2 K/D or H-2 I region determinants was investigated. Chimeras were constructed of lethally irradiated parental mice receiving a mixture of F1 nude mouse (6-8 wk old) spleen and bone marrow cells. The donor inoculum was deliberately not subjected to any T cell depletion procedure, so that any potential major histocompatibility complex-committed precursor T cells were allowed to differentiate and expand in the normal parental recipients. 3 mo after reconstitution, the chimeras were immunized with several protein antigens in complete Freund's adjuvant in the footpads and their purified draining lymph node T cells tested 10 d later for ability to recognize antigen on antigen-presenting cells of either parental haplotype. Also, their spleen and lymph node cells were tested for ability to generate a cytotoxic T lymphocyte (CTL) response to trinitrophenyl (TNP)-modified stimulator cells of either parental haplotype. It was demonstrated that T cell proliferative responses of these F1(nude)----parent chimeras were restricted solely to recognizing parental host I region determinants as self and expressed the Ir gene phenotype of the host. In contrast, CTL responses could be generated (in the presence of interleukin 2) to TNP-modified stimulator cells of either parental haplotype. Thus these results indicate that nude mice which do have CTL with self-specificity for K/D region determinants lack proliferating T cells with self-specificity for I region determinants. These results provide evidence for the concepts that development of the I region-restricted T cell repertoire is strictly an intrathymically determined event and that young nude mice lack the unique thymic elements responsible for education of I region-restricted T cells

  20. MiR-192-Mediated Positive Feedback Loop Controls the Robustness of Stress-Induced p53 Oscillations in Breast Cancer Cells.

    Directory of Open Access Journals (Sweden)

    Richard Moore

    2015-12-01

    Full Text Available The p53 tumor suppressor protein plays a critical role in cellular stress and cancer prevention. A number of post-transcriptional regulators, termed microRNAs, are closely connected with the p53-mediated cellular networks. While the molecular interactions among p53 and microRNAs have emerged, a systems-level understanding of the regulatory mechanism and the role of microRNAs-forming feedback loops with the p53 core remains elusive. Here we have identified from literature that there exist three classes of microRNA-mediated feedback loops revolving around p53, all with the nature of positive feedback coincidentally. To explore the relationship between the cellular performance of p53 with the microRNA feedback pathways, we developed a mathematical model of the core p53-MDM2 module coupled with three microRNA-mediated positive feedback loops involving miR-192, miR-34a, and miR-29a. Simulations and bifurcation analysis in relationship to extrinsic noise reproduce the oscillatory behavior of p53 under DNA damage in single cells, and notably show that specific microRNA abrogation can disrupt the wild-type cellular phenotype when the ubiquitous cell-to-cell variability is taken into account. To assess these in silico results we conducted microRNA-perturbation experiments in MCF7 breast cancer cells. Time-lapse microscopy of cell-population behavior in response to DNA double-strand breaks, together with image classification of single-cell phenotypes across a population, confirmed that the cellular p53 oscillations are compromised after miR-192 perturbations, matching well with the model predictions. Our study via modeling in combination with quantitative experiments provides new evidence on the role of microRNA-mediated positive feedback loops in conferring robustness to the system performance of stress-induced response of p53.

  1. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    Energy Technology Data Exchange (ETDEWEB)

    Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.

    2011-12-15

    We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.

  2. FoxP3+ regulatory T cells are distinct from leukemia cells in HTLV-1-associated adult T-cell leukemia.

    Science.gov (United States)

    Toulza, Frederic; Nosaka, Kisato; Takiguchi, Masafumi; Pagliuca, Tony; Mitsuya, Hiroaki; Tanaka, Yuetsu; Taylor, Graham P; Bangham, Charles R M

    2009-11-15

    Human T-lymphotropic virus type 1 (HTLV-1) is the causative agent of adult T-cell leukemia/lymphoma (ATLL). It has been postulated that ATLL cells might act as regulatory T cells (T(regs)) which, in common with ATLL cells, express both CD25 and FoxP3, and so contribute to the severe immune suppression typical of ATLL. We report here that the frequency of CD25(+) cells varied independently of the frequency of FoxP3(+) cells in both a cross-sectional study and in a longitudinal study of 2 patients with chronic ATLL. Furthermore, the capacity of ATLL cells to suppress proliferation of heterologous CD4(+)CD25(-) cells correlated with the frequency of CD4(+) FoxP3(+) cells but was independent of CD25 expression. Finally, the frequency of CD4(+)FoxP3(+) cells was inversely correlated with the lytic activity of HTLV-1-specific CTLs in patients with ATLL. We conclude that ATLL is not a tumor of FoxP3(+) regulatory T cells, and that a population of FoxP3(+) cells distinct from ATLL cells has regulatory functions and may impair the cell-mediated immune response to HTLV-1 in patients with ATLL.

  3. Grass-specific CD4+ T-cells exhibit varying degrees of cross-reactivity, implications for allergen-specific immunotherapy

    Science.gov (United States)

    Archila, LD; DeLong, JH; Wambre, E; James, EA; Robinson, DM; Kwok, WW

    2014-01-01

    Background Conceptually, allergic responses may involve cross-reactivity by antibodies or T-cells. While IgE cross-reactivity amongst grass pollen allergens has been observed, cross-reactivity at the allergen-specific T-cell level has been less documented. Identification of the patterns of cross-reactivity may improve our understanding, allowing optimization of better immunotherapy strategies. Objectives We use Phleum pratense as model for the studying of cross-reactivity at the allergen-specific CD4+ T cell level amongst DR04:01 restricted Pooideae grass pollen T-cell epitopes. Methods After In vitro culture of blood mononucleated cells from Grass-pollen allergic subjects with specific Pooideae antigenic epitopes, dual tetramer staining with APC-labeled DR04:01/Phleum pratense tetramers and PE-labeled DR04:01/Pooideae grass homolog tetramers was assessed to identify cross-reactivity amongst allergen-specific DR04:01-restricted T-cells in 6 subjects. Direct ex vivo staining enabled the comparison of frequency and phenotype of different Pooideae grass pollen reactive T-cells. Intracellular cytokine staining (ICS) assays were also used to examine phenotypes of these T-cells. Results T-cells with various degree of cross reactive profiles could be detected. Poa p 1 97-116, Lol p 1 221-240, Lol p 5a 199-218, and Poa p 5a 199-218 were identified as minimally-cross-reactive T-cell epitopes that do not show cross reactivity to Phl p 1 and Phl p 5a epitopes. Ex vivo tetramer staining assays demonstrated T-cells that recognized these minimally-cross reactive T-cell epitopes are present in Grass-pollen allergic subjects. Conclusions Our results suggest that not all Pooideae grass epitopes with sequence homology are cross-reactive. Non-cross reactive T-cells with comparable frequency, phenotype and functionality to Phl p-specific T-cells, suggest that a multiple allergen system should be considered for immunotherapy instead of a mono allergen system. PMID:24708411

  4. Grass-specific CD4(+) T-cells exhibit varying degrees of cross-reactivity, implications for allergen-specific immunotherapy.

    Science.gov (United States)

    Archila, L D; DeLong, J H; Wambre, E; James, E A; Robinson, D M; Kwok, W W

    2014-07-01

    Conceptually, allergic responses may involve cross-reactivity by antibodies or T-cells. While IgE cross-reactivity among grass-pollen allergens has been observed, cross-reactivity at the allergen-specific T-cell level has been less documented. Identification of the patterns of cross-reactivity may improve our understanding, allowing optimization of better immunotherapy strategies. We use Phleum pratense as model for the studying of cross-reactivity at the allergen-specific CD4(+) T cell level among DR04:01 restricted Pooideae grass-pollen T-cell epitopes. After in vitro culture of blood mono-nucleated cells from grass-pollen-allergic subjects with specific Pooideae antigenic epitopes, dual tetramer staining with APC-labelled DR04:01/Phleum pratense tetramers and PE-labelled DR04:01/Pooideae grass homolog tetramers was assessed to identify cross-reactivity among allergen-specific DR04:01-restricted T-cells in six subjects. Direct ex vivo staining enabled the comparison of frequency and phenotype of different Pooideae grass-pollen reactive T-cells. Intracellular cytokine staining (ICS) assays were also used to examine phenotypes of these T-cells. T-cells with various degrees of cross-reactive profiles could be detected. Poa p 1 97-116 , Lol p 1 221-240 , Lol p 5a 199-218 , and Poa p 5a 199-218 were identified as minimally cross-reactive T-cell epitopes that do not show cross-reactivity to Phl p 1 and Phl p 5a epitopes. Ex vivo tetramer staining assays demonstrated T-cells that recognized these minimally cross-reactive T-cell epitopes are present in Grass-pollen-allergic subjects. Our results suggest that not all Pooideae grass epitopes with sequence homology are cross-reactive. Non-cross-reactive T-cells with comparable frequency, phenotype and functionality to Phl p-specific T-cells suggest that a multiple allergen system should be considered for immunotherapy instead of a mono-allergen system. © 2014 John Wiley & Sons Ltd.

  5. Cellular response to DNA damage. Link between p53 and DNA-PK

    International Nuclear Information System (INIS)

    Salles-Passador, I.; Fotedar, R.; Fotedar, A.

    1999-01-01

    Cells which lack DNA-activated protein kinase (DNA-PK) are very susceptible to ionizing radiation and display an inability to repair double-strand DNA breaks. DNA-PK is a member of a protein kinase family that includes ATR and ATM which have strong homology in their carboxy-terminal kinase domain with Pl-3 kinase. ATM has been proposed to act upstream of p53 in cellular response to ionizing radiation. DNA-PK may similarly interact with p53 in cellular growth control and in mediation of the response to ionizing radiation. (author)

  6. Survivin-specific T-cell reactivity correlates with tumor response and patient survival

    DEFF Research Database (Denmark)

    Becker, Jürgen C; Andersen, Mads H; Hofmeister-Müller, Valeska

    2012-01-01

    Therapeutic vaccination directed to induce an anti-tumoral T-cell response is a field of extensive investigation in the treatment of melanoma. However, many vaccination trials in melanoma failed to demonstrate a correlation between the vaccine-specific immune response and therapy outcome. This has...

  7. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  8. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  9. Therapeutic targeting of the p53 pathway in cancer stem cells

    Science.gov (United States)

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  10. Heterologous prime-boost regimens with a recombinant chimpanzee adenoviral vector and adjuvanted F4 protein elicit polyfunctional HIV-1-specific T-Cell responses in macaques.

    Science.gov (United States)

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides

  11. Efficient generation of P53 biallelic knockout Diannan miniature pigs via TALENs and somatic cell nuclear transfer

    Directory of Open Access Journals (Sweden)

    Youfeng Shen

    2017-11-01

    Full Text Available Abstract Background Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Methods Transcription activator-like effector nucleases (TALENs were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. Results The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19 were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean

  12. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

  13. The ThPOK transcription factor differentially affects the development and function of self-specific CD8(+) T cells and regulatory CD4(+) T cells.

    Science.gov (United States)

    Twu, Yuh-Ching; Teh, Hung-Sia

    2014-03-01

    The zinc finger transcription factor ThPOK plays a crucial role in CD4 T-cell development and CD4/CD8 lineage decision. In ThPOK-deficient mice, developing T cells expressing MHC class II-restricted T-cell receptors are redirected into the CD8 T-cell lineage. In this study, we investigated whether the ThPOK transgene affected the development and function of two additional types of T cells, namely self-specific CD8 T cells and CD4(+) FoxP3(+) T regulatory cells. Self-specific CD8 T cells are characterized by high expression of CD44, CD122, Ly6C, 1B11 and proliferation in response to either IL-2 or IL-15. The ThPOK transgene converted these self-specific CD8 T cells into CD4 T cells. The converted CD4(+) T cells are no longer self-reactive, lose the characteristics of self-specific CD8 T cells, acquire the properties of conventional CD4 T cells and survive poorly in peripheral lymphoid organs. By contrast, the ThPOK transgene promoted the development of CD4(+) FoxP3(+) regulatory T cells resulting in an increased recovery of CD4(+) FoxP3(+) regulatory T cells that expressed higher transforming growth factor-β-dependent suppressor activity. These studies indicate that the ThPOK transcription factor differentially affects the development and function of self-specific CD8 T cells and CD4(+) FoxP3(+) regulatory T cells. © 2013 John Wiley & Sons Ltd.

  14. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    Science.gov (United States)

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  15. Normalized Synergy Predicts That CD8 Co-Receptor Contribution to T Cell Receptor (TCR and pMHC Binding Decreases As TCR Affinity Increases in Human Viral-Specific T Cells

    Directory of Open Access Journals (Sweden)

    Chad M. Williams

    2017-07-01

    Full Text Available The discovery of naturally occurring T cell receptors (TCRs that confer specific, high-affinity recognition of pathogen and cancer-associated antigens remains a major goal in cellular immunotherapies. The contribution of the CD8 co-receptor to the interaction between the TCR and peptide-bound major histocompatibility complex (pMHC has previously been correlated with the activation and responsiveness of CD8+ T cells. However, these studies have been limited to model systems of genetically engineered hybridoma TCRs or transgenic mouse TCRs against either a single epitope or an array of altered peptide ligands. CD8 contribution in a native human antigen-specific T cell response remains elusive. Here, using Hepatitis C Virus-specific precursor CTLs spanning a large range of TCR affinities, we discovered that the functional responsiveness of any given TCR correlated with the contribution of CD8 to TCR/pMHC binding. Furthermore, we found that CD8 contribution to TCR/pMHC binding in the two-dimensional (2D system was more accurately reflected by normalized synergy (CD8 cooperation normalized by total TCR/pMHC bonds rather than synergy (total CD8 cooperation alone. While synergy showed an increasing trend with TCR affinity, normalized synergy was demonstrated to decrease with the increase of TCR affinity. Critically, normalized synergy was shown to correlate with CTL functionality and peptide sensitivity, corroborating three-dimensional (3D analysis of CD8 contribution with respect to TCR affinity. In addition, we identified TCRs that were independent of CD8 for TCR/pMHC binding. Our results resolve the current discrepancy between 2D and 3D analysis on CD8 contribution to TCR/pMHC binding, and demonstrate that naturally occurring high-affinity TCRs are more capable of CD8-independent interactions that yield greater functional responsiveness even with CD8 blocking. Taken together, our data suggest that addition of the normalized synergy parameter to our

  16. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  17. Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

    Science.gov (United States)

    Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W

    2012-01-01

    Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, pmemory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

  18. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  19. The influence of the level of lamina propria invasion and the prevalence of p53 nuclear accumulation on survival in stage T1 transitional cell bladder cancer

    DEFF Research Database (Denmark)

    Hermann, G G; Horn, T; Steven, K

    1998-01-01

    PURPOSE: We assessed the influence of the level of lamina propria invasion and the prevalence of p53 nuclear immunoreactivity on the survival of patients with stage T1 transitional cell bladder cancer. MATERIALS AND METHODS: All patients presenting with stage T1 bladder cancer were prospectively...... and routinely grouped according to the level of lamina propria invasion. Invasion of the tumor stalk was defined as stage T1a, invasion of the lamina propria proper superficial to the level of muscularis mucosa as stage T1b and into or deeper than the muscularis mucosa as stage T1c. The p53 nuclear...... related to age, level of lamina propria invasion and presence of p53 nuclear accumulation. For this subpopulation overall survival was 67%, and 79% for stage T1a, 70% for stage T1b and 57% for stage T1c (p

  20. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    Science.gov (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  1. The expression of GST isoenzymes and p53 in non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    MĂźzeyyen Ozhavzali

    2010-06-01

    Full Text Available This study investigated the immunohistochemical staining characteristics of glutathione-S-transferase alpha, pi, mu, theta and p53 in non-small cell lung carcinoma and normal lung tissue from 50 patients. The relationships between expressions of the Glutathione-S-transferase isoenzymes and some clinicopathological features were also examined. Expression of glutathione-S-transferase pi, mu, alpha, theta and p53 was assessed by immunohistochemistry for primary lung carcinomas of 50 patients from the Sanitarium Education and Research Hospital, Ankara lung cancer collection. The relationships between expression of the glutathione-S-transferase isoenzymes, p53 in normal and tumor tissue by Student T test and the clinicopathological data were also examined by Spearman Rank tests. When the normal and tumor tissue of these cases were compared according to their staining intensity and percentage of positive staining, glutathione-S-transferase alpha, pi, mu, theta expressions in tumor cells was significantly higher than normal cells (p<0.05. There was no significant difference in the expression of p53 between normal and tumor cells (p>0.05. When the immunohistochemical results of glutathione-S-transferase isoenzymes and p53 were correlated with the clinical parameters, there were no significant associations between glutathione-S-transferases and p53 expressions and tumor stage, tumor grade and smoking status (p>0.05.

  2. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

    Science.gov (United States)

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

    2013-01-01

    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  3. p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

    Science.gov (United States)

    Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

    1996-12-20

    In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

  4. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.

    Science.gov (United States)

    Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete

    2018-06-11

    CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.

  5. Carbon-ion beam irradiation kills X-ray-resistant p53-null cancer cells by inducing mitotic catastrophe.

    Directory of Open Access Journals (Sweden)

    Napapat Amornwichet

    Full Text Available BACKGROUND AND PURPOSE: To understand the mechanisms involved in the strong killing effect of carbon-ion beam irradiation on cancer cells with TP53 tumor suppressor gene deficiencies. MATERIALS AND METHODS: DNA damage responses after carbon-ion beam or X-ray irradiation in isogenic HCT116 colorectal cancer cell lines with and without TP53 (p53+/+ and p53-/-, respectively were analyzed as follows: cell survival by clonogenic assay, cell death modes by morphologic observation of DAPI-stained nuclei, DNA double-strand breaks (DSBs by immunostaining of phosphorylated H2AX (γH2AX, and cell cycle by flow cytometry and immunostaining of Ser10-phosphorylated histone H3. RESULTS: The p53-/- cells were more resistant than the p53+/+ cells to X-ray irradiation, while the sensitivities of the p53+/+ and p53-/- cells to carbon-ion beam irradiation were comparable. X-ray and carbon-ion beam irradiations predominantly induced apoptosis of the p53+/+ cells but not the p53-/- cells. In the p53-/- cells, carbon-ion beam irradiation, but not X-ray irradiation, markedly induced mitotic catastrophe that was associated with premature mitotic entry with harboring long-retained DSBs at 24 h post-irradiation. CONCLUSIONS: Efficient induction of mitotic catastrophe in apoptosis-resistant p53-deficient cells implies a strong cancer cell-killing effect of carbon-ion beam irradiation that is independent of the p53 status, suggesting its biological advantage over X-ray treatment.

  6. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.

  7. Non-Canonical Cell Death Induced by p53

    Directory of Open Access Journals (Sweden)

    Atul Ranjan

    2016-12-01

    Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.

  8. Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage

    International Nuclear Information System (INIS)

    Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun

    2009-01-01

    Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis

  9. Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu

    2009-03-09

    Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.

  10. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  11. Ag85-focused T-cell immune response controls Mycobacterium avium chronic infection.

    Directory of Open Access Journals (Sweden)

    Bruno Cerqueira-Rodrigues

    Full Text Available CD4+ T cells are essential players for the control of mycobacterial infections. Several mycobacterial antigens have been identified for eliciting a relevant CD4+ T cell mediated-immune response, and numerous studies explored this issue in the context of Mycobacterium tuberculosis infection. Antigen 85 (Ag85, a highly conserved protein across Mycobacterium species, is secreted at the early phase of M. tuberculosis infection leading to the proliferation of Ag85-specific CD4+ T cells. However, in the context of Mycobacterium avium infection, little is known about the expression of this antigen and the elicited immune response. In the current work, we investigated if a T cell receptor (TCR repertoire mostly, but not exclusively, directed at Ag85 is sufficient to mount a protective immune response against M. avium. We show that P25 mice, whose majority of T cells express a transgenic TCR specific for Ag85, control M. avium infection at the same level as wild type (WT mice up to 20 weeks post-infection (wpi. During M. avium infection, Ag85 antigen is easily detected in the liver of 20 wpi mice by immunohistochemistry. In spite of the propensity of P25 CD4+ T cells to produce higher amounts of interferon-gamma (IFNγ upon ex vivo stimulation, no differences in serum IFNγ levels are detected in P25 compared to WT mice, nor enhanced immunopathology is detected in P25 mice. These results indicate that a T cell response dominated by Ag85-specific T cells is appropriate to control M. avium infection with no signs of immunopathology.

  12. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  13. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

    2011-01-01

    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  14. Characterisation in vivo of ways of induced deaths by p53, in the male germinal cells; Caracterisation in vivo des voies de mort induites par la p53, dans les cellules germinales males

    Energy Technology Data Exchange (ETDEWEB)

    Coureuil, M

    2006-10-15

    The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)

  15. Functionality of Dengue Virus Specific Memory T Cell Responses in Individuals Who Were Hospitalized or Who Had Mild or Subclinical Dengue Infection

    Science.gov (United States)

    Jeewandara, Chandima; Adikari, Thiruni N.; Gomes, Laksiri; Fernando, Samitha; Fernando, R. H.; Perera, M. K. T.; Ariyaratne, Dinuka; Kamaladasa, Achala; Salimi, Maryam; Prathapan, Shamini

    2015-01-01

    Background Although antibody responses to dengue virus (DENV) in naturally infected individuals have been extensively studied, the functionality of DENV specific memory T cell responses in relation to clinical disease severity is incompletely understood. Methodology/Principal findings Using ex vivo IFNγ ELISpot assays, and by determining cytokines produced in ELISpot supernatants, we investigated the functionality of DENV-specific memory T cell responses in a large cohort of individuals from Sri Lanka (n=338), who were naturally infected and were either hospitalized due to dengue or had mild or sub clinical dengue infection. We found that T cells of individuals with both past mild or sub clinical dengue infection and who were hospitalized produced multiple cytokines when stimulated with DENV-NS3 peptides. However, while DENV-NS3 specific T cells of those with mild/sub clinical dengue infection were more likely to produce only granzyme B (p=0.02), those who were hospitalized were more likely to produce both TNFα and IFNγ (p=0.03) or TNFα alone. We have also investigated the usefulness of a novel T cell based assay, which can be used to determine the past infecting DENV serotype. 92.4% of DENV seropositive individuals responded to at least one DENV serotype of this assay and none of the seronegatives responded. Individuals who were seronegative, but had received the Japanese encephalitis vaccine too made no responses, suggesting that the peptides used in this assay did not cross react with the Japanese encephalitis virus. Conclusions/significance The types of cytokines produced by DENV-specific memory T cells appear to influence the outcome of clinical disease severity. The novel T cell based assay, is likely to be useful in determining the past infecting DENV serotype in immune-epidemiological studies and also in dengue vaccine trials. PMID:25875020

  16. Ki-67 expression reveals strong, transient influenza specific CD4 T cell responses after adult vaccination.

    Science.gov (United States)

    Li, Xi; Miao, Hongyu; Henn, Alicia; Topham, David J; Wu, Hulin; Zand, Martin S; Mosmann, Tim R

    2012-06-29

    Although previous studies have found minimal changes in CD4 T cell responses after vaccination of adults with trivalent inactivated influenza vaccine, daily sampling and monitoring of the proliferation marker Ki-67 have now been used to reveal that a substantial fraction of influenza-specific CD4 T cells respond to vaccination. At 4-6 days after vaccination, there is a sharp rise in the numbers of Ki-67-expressing PBMC that produce IFNγ, IL-2 and/or TNFα in vitro in response to influenza vaccine or peptide. Ki-67(+) cell numbers then decline rapidly, and 10 days after vaccination, both Ki-67(+) and overall influenza-specific cell numbers are similar to pre-vaccination levels. These results provide a tool for assessing the quality and quantity of CD4 T cell responses to different influenza vaccines, and raise the possibility that the anti-influenza T cell memory response may be qualitatively altered by vaccination, even if the overall memory cell numbers do not change significantly. Copyright © 2012. Published by Elsevier Ltd.

  17. p53 represses autophagy in a cell cycle-dependent fashion.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

    2008-10-01

    Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

  18. Sensitivity and specificity of tritiated thymidine incorporation and ELISPOT assays in identifying antigen specific T cell immune responses

    Directory of Open Access Journals (Sweden)

    MacLeod Beth

    2007-09-01

    Full Text Available Abstract Background Standardization of cell-based immunologic monitoring is becoming increasingly important as methods for measuring cellular immunity become more complex. We assessed the ability of two commonly used cell-based assays, tritiated thymidine incorporation (proliferation and IFN-gamma ELISPOT, to predict T cell responses to HER-2/neu, tetanus toxoid (tt, and cytomegalovirus (CMV antigens. These antigens were determined to be low (HER-2/neu, moderate (tt, and robustly (CMV immunogenic proteins. Samples from 27 Stage II, III, and IV HER-2/neu positive breast cancer patients, vaccinated against the HER-2/neu protein and tt, were analyzed by tritiated thymidine incorporation and IFN-gamma ELISPOT for T cell response. Results Linear regression analysis indicates that both stimulation index (SI (p = 0.011 and IFN-gamma secreting precursor frequency (p Conclusion These data underscore the importance of taking into consideration the performance characteristics of assays used to measure T cell immunity. This consideration is particularly necessary when determining which method to utilize for assessing responses to immunotherapeutic manipulations in cancer patients.

  19. HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.

    Science.gov (United States)

    Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C

    2006-02-01

    HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.

  20. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, Akihisa

    2002-01-01

    We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)

  1. Cancer Patient T Cells Genetically Targeted to Prostate-Specific Membrane Antigen Specifically Lyse Prostate Cancer Cells and Release Cytokines in Response to Prostate-Specific Membrane Antigen

    Directory of Open Access Journals (Sweden)

    Michael C. Gong

    1999-06-01

    Full Text Available The expression of immunoglobulin-based artificial receptors in normal T lymphocytes provides a means to target lymphocytes to cell surface antigens independently of major histocompatibility complex restriction. Such artificial receptors have been previously shown to confer antigen-specific tumoricidal properties in murine T cells. We constructed a novel ζ chain fusion receptor specific for prostate-specific membrane antigen (PSMA termed Pz-1. PSMA is a cell-surface glycoprotein expressed on prostate cancer cells and the neovascular endothelium of multiple carcinomas. We show that primary T cells harvested from five of five patients with different stages of prostate cancer and transduced with the Pz-1 receptor readily lyse prostate cancer cells. Having established a culture system using fibroblasts that express PSMA, we next show that T cells expressing the Pz-1 receptor release cytokines in response to cell-bound PSMA. Furthermore, we show that the cytokine release is greatly augmented by B7.1-mediated costimulation. Thus, our findings support the feasibility of adoptive cell therapy by using genetically engineered T cells in prostate cancer patients and suggest that both CD4+ and CD8+ T lymphocyte functions can be synergistically targeted against tumor cells.

  2. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  3. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  4. Inverse relationship between TCTP/RhoA and p53/ /cyclin A/actin expression in ovarian cancer cells Inverse relationship between TCTP/RhoA and p53/ /cyclin A/actin expression in ovarian cancer cells

    Directory of Open Access Journals (Sweden)

    Malgorzata Kloc

    2012-10-01

    Full Text Available The translationally controlled tumor protein (TCTP plays a role in cell growth, cell cycle and cancer
    progression. TCTP controls negatively the stability of the p53 tumor suppressor protein and interacts with the
    cellular cytoskeleton. The deregulation of the actin and cytokeratin cytoskeleton is responsible for the increased
    migratory activity of tumor cells and is linked with poor patient outcome. Recent studies indicate that cyclin A,
    a key regulator of cell cycle, controls actin organization and negatively regulates cell motility via regulation of RhoA
    expression. We studied the organization of actin and cytokeratin cytoskeleton and the expression of TCTP, p53,
    cyclin A, RhoA and actin in HIO180 non-transformed ovarian epithelial cells, and OVCAR3 and SKOV3 (expressing
    low level of inducible p53 ovarian epithelial cancer cells with different metastatic potential. Immunostaining
    and ultrastructural analyses illustrated a dramatic difference in the organization of the cytokeratin and actin
    filaments in non-transformed versus cancer cell lines. We also determined that there is an inverse relationship between
    the level of TCTP/RhoA and actin/p53/cyclin A expression in ovarian cancer cell lines. This previously unidentified
    negative relationship between TCTP/RhoA and actin/p53/cyclin A may suggest that this interaction is linked
    with the high aggressiveness of ovarian cancers.The translationally controlled tumor protein (TCTP plays a role in cell growth, cell cycle and cancer
    progression. TCTP controls negatively the stability of the p53 tumor suppressor protein and interacts with the
    cellular cytoskeleton. The deregulation of the actin and cytokeratin cytoskeleton is responsible for the increased
    migratory activity of tumor cells and is linked with poor patient outcome. Recent studies indicate that cyclin A,
    a key regulator of cell cycle, controls actin organization

  5. Vaccination with lipid core peptides fails to induce epitope-specific T cell responses but confers non-specific protective immunity in a malaria model.

    Directory of Open Access Journals (Sweden)

    Simon H Apte

    Full Text Available Vaccines against many pathogens for which conventional approaches have failed remain an unmet public health priority. Synthetic peptide-based vaccines offer an attractive alternative to whole protein and whole organism vaccines, particularly for complex pathogens that cause chronic infection. Previously, we have reported a promising lipid core peptide (LCP vaccine delivery system that incorporates the antigen, carrier, and adjuvant in a single molecular entity. LCP vaccines have been used to deliver several peptide subunit-based vaccine candidates and induced high titre functional antibodies and protected against Group A streptococcus in mice. Herein, we have evaluated whether LCP constructs incorporating defined CD4(+ and/or CD8(+ T cell epitopes could induce epitope-specific T cell responses and protect against pathogen challenge in a rodent malaria model. We show that LCP vaccines failed to induce an expansion of antigen-specific CD8(+ T cells following primary immunization or by boosting. We further demonstrated that the LCP vaccines induced a non-specific type 2 polarized cytokine response, rather than an epitope-specific canonical CD8(+ T cell type 1 response. Cytotoxic responses of unknown specificity were also induced. These non-specific responses were able to protect against parasite challenge. These data demonstrate that vaccination with lipid core peptides fails to induce canonical epitope-specific T cell responses, at least in our rodent model, but can nonetheless confer non-specific protective immunity against Plasmodium parasite challenge.

  6. The Yin and Yang aspects of IL-27 in induction of cancer-specific T-cell responses and immunotherapy.

    Science.gov (United States)

    Li, Ming-Song; Liu, Zhenzhen; Liu, Jin-Qing; Zhu, Xiaotong; Liu, Zhihao; Bai, Xue-Feng

    2015-01-01

    Accumulating evidences from animal studies have indicated that both endogenous and exogenous IL-27, an IL-12 family of cytokine, can increase antitumor T-cell activities and inhibit tumor growth. IL-27 can modulate Treg responses, and program effector T cells into a unique T-effector stem cell (TSEC) phenotype, which enhances T-cell survival in the tumor microenvironment. However, animal studies also suggest that IL-27 induces molecular pathways such as IL-10, PD-L1 and CD39, which may downregulate tumor-specific T-cell responses. In this review paper, we will discuss the Yin and Yang aspects of IL-27 in the induction of tumor-specific T-cell responses, and the potential impacts of these functions of IL-27 in the design of cancer immunotherapy.

  7. The administration route is decisive for the ability of the vaccine adjuvant CAF09 to induce antigen-specific CD8(+) T-cell responses

    DEFF Research Database (Denmark)

    Schmidt, Signe Tandrup; Khadke, Swapnil; Korsholm, Karen Smith

    2016-01-01

    A prerequisite for vaccine-mediated induction of CD8(+) T-cell responses is the targeting of dendritic cell (DC) subsets specifically capable of cross-presenting antigen epitopes to CD8(+) T cells. Administration of a number of cationic adjuvants via the intraperitoneal (i.p.) route has been show...

  8. A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

    Science.gov (United States)

    Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

    2018-05-23

    PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

  9. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  10. Allergen and Epitope Targets of Mouse-Specific T Cell Responses in Allergy and Asthma

    Directory of Open Access Journals (Sweden)

    Véronique Schulten

    2018-02-01

    Full Text Available Mouse allergy has become increasingly common, mainly affecting laboratory workers and inner-city households. To date, only one major allergen, namely Mus m 1, has been described. We sought to identify T cell targets in mouse allergic patients. PBMC from allergic donors were expanded with either murine urine or epithelial extract and subsequently screened for cytokine production (IL-5 and IFNγ in response to overlapping peptides spanning the entire Mus m 1 sequence, peptides from various Mus m 1 isoforms [major urinary proteins (MUPs], peptides from mouse orthologs of known allergens from other mammalian species and peptides from proteins identified by immunoproteomic analysis of IgE/IgG immunoblots of mouse urine and epithelial extracts. This approach let to the identification of 106 non-redundant T cell epitopes derived from 35 antigens. Three major T cell-activating regions were defined in Mus m 1 alone. Moreover, our data show that immunodominant epitopes were largely shared between Mus m 1 and other MUPs even from different species, suggesting that sequence conservation in different allergens is a determinant for immunodominance. We further identified several novel mouse T cell antigens based on their homology to known mammalian allergens. Analysis of cohort-specific T cell responses revealed that rhinitis and asthmatic patients recognized different epitope repertoires. Epitopes defined herein can be formulated into an epitope “megapool” used to diagnose mouse allergy and study mouse-specific T cell responses directly ex vivo. This analysis of T cell epitopes provides a good basis for future studies to increase our understanding of the immunopathology associated with MO-allergy and asthma.

  11. Decreased HIV-specific T-regulatory responses are associated with effective DC-vaccine induced immunity.

    Directory of Open Access Journals (Sweden)

    Vedran Brezar

    2015-03-01

    Full Text Available The role of regulatory T cells (Tregs in vaccination has been poorly investigated. We have reported that vaccination with ex vivo-generated dendritic-cells (DC loaded with HIV-lipopeptides (LIPO-5-DC vaccine in HIV-infected patients was well tolerated and highly immunogenic. These responses and their relation to viral replication following analytical treatment interruption (ATI were variable. Here, we investigated whether the presence of HIV-specific Tregs might explain these differences. Co-expression of CD25, CD134, CD39 and FoxP3 was used to delineate both antigen-specific Tregs and effectors T cells (Teffs. Median LIPO-5 specific-CD25+CD134+ polyfunctional T cells increased from 0.1% (IQR 0-0.3 before vaccination (week -4 to 2.1% (IQR 1.1-3.9 at week 16 following 4 immunizations (p=0.001 and were inversely correlated with maximum viral load following ATI (r=-0.77, p=0.001. Vaccinees who displayed lower levels of HIV-specific CD4+CD134+CD25+CD39+FoxP3+ Tregs responded better to the LIPO-5-DC vaccine. After vaccination, the frequency of HIV-specific Tregs decreased (from 69.3 at week -4 to 31.7% at week 16 and inversely correlated with HIV-specific IFN-γ-producing cells (r=-0.64, p=0.002. We show that therapeutic immunization skewed the HIV-specific response from regulatory to effector phenotype which impacts on the magnitude of viral replication following ATI.

  12. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production.

    Directory of Open Access Journals (Sweden)

    Dana Austin

    Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.

  13. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  14. Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio

    2010-01-01

    The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

  15. Involvement of p53 and Bcl-2 in sensory cell degeneration in aging rat cochleae.

    Science.gov (United States)

    Xu, Yang; Yang, Wei Ping; Hu, Bo Hua; Yang, Shiming; Henderson, Donald

    2017-06-01

    p53 and Bcl-2 (B-cell lymphoma 2) are involved in the process of sensory cell degeneration in aging cochleae. To determine molecular players in age-related hair cell degeneration, this study examined the changes in p53 and Bcl-2 expression at different stages of apoptotic and necrotic death of hair cells in aging rat cochleae. Young (3-4 months) and aging (23-24 months) Fisher 344/NHsd rats were used. The thresholds of the auditory brainstem response (ABR) were measured to determine the auditory function. Immunolabeling was performed to determine the expression of p53 and Bcl-2 proteins in the sensory epithelium. Propidium iodide staining was performed to determine the morphologic changes in hair cell nuclei. Aging rats exhibited a significant elevation in ABR thresholds at all tested frequencies (p aging hair cells showing the early signs of apoptotic changes in their nuclei. The Bcl-2 expression increase was also observed in hair cells displaying early signs of necrosis. As the hair cell degenerative process advanced, p53 and Bcl-2 immunoreactivity became reduced or absent. In the areas where no detectable nuclear staining was present, p53 and Bcl-2 immunoreactivity was absent.

  16. Retention of the In Vitro Radiosensitizing Potential of Gemcitabine Under Anoxic Conditions, in p53 Wild-Type and p53-Deficient Non-Small-Cell Lung Carcinoma Cells

    International Nuclear Information System (INIS)

    Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip

    2011-01-01

    Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.

  17. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  18. S-phase checkpoint elements of the E2F-1 family increase radiosensitivity in fibrosarcoma cells lacking p53

    International Nuclear Information System (INIS)

    Bodis, Stephan; Pruschy, Martin; Wirbelauer, Christiane; Glanzmann, Christoph; Krek, Wilhelm

    1997-01-01

    Purpose: Correct advance of cells through the S-phase of the mammalian cell cycle depends on the timely controlled activity of the E2F-1 transcription factor by cyclin A-cdk2. We are studying the reproductive integrity and radiosensitation of isogenic mouse fibrosarcoma cells, differing only in their p53 status, after expression of E2F-1 wildtype (wt) and specific E2F-1 mutants (mt) lacking the cyclin-A-binding domain. In this tumor model system only p53 wild-type expressing tumor cells are sensitive to ionizing radiation in vitro and in vivo. Material and Methods: Either wild-type p53 or genetically engineered p53 'null' mouse embryo fibroblasts were transfected with the oncogenes E1A and ras. These otherwise isogenic fibrosarcoma cells, with a malignant phenotype and tumorigenic in nude mice, were transfected with retroviruses containing either E2F-1 wild-type or specific E2F-1 mutants lacking the cyclin-A binding domain. Reproductive integrity after E2F-1 transfection with or without ionizing radiation (RT) was tested using the clonogenic assay. Tumor cell morphology of treated cells is analyzed for cell death mechanism. Results: E2F-1 wild-type expression in fibrosarcoma cells induced a clear p53 dependent cell death. While clonogenic survival of p53 'null' tumor cells was only slightly reduced with the expression of E2F-1 wild type (survival fraction of 0.5), the clonogenic survival of p53 wild-type fibrosarcoma tumor cells was reduced by at least one logarithm (survival fraction of 0.05). However, expression of the specific E2F-1 mutant lacking the cyclin-A binding domain reduced clonogenic survival in both the p53 'null' and the p53 wild-type fibrosarcoma cells by at least 2 logarithms (survival fraction 0.01 for p53 'null' and 0.002 for p53 wild-type). The mean values of the survival fractions after 2 and 5 Gy radiation alone in p53 'null' fibrosarcoma cells (SF 2 and SF 5) were SF 2 0.7, SF 5 = 0.15, respectively. The combination of ionizing RT in the p53

  19. Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage

    Directory of Open Access Journals (Sweden)

    Marie-Jo Halaby

    2015-01-01

    Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.

  20. ATR-p53 restricts homologous recombination in response to replicative stress but does not limit DNA interstrand crosslink repair in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Bianca M Sirbu

    Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.

  1. Ex vivo detection of adenovirus specific CD4+ T-cell responses to HLA-DR-epitopes of the Hexon protein show a contracted specificity of THELPER cells following stem cell transplantation

    International Nuclear Information System (INIS)

    Serangeli, Celine; Bicanic, Oliver; Scheible, Michael H.; Wernet, Dorothee; Lang, Peter; Rammensee, Hans-Georg; Stevanovic, Stefan; Handgretinger, Rupert; Feuchtinger, Tobias

    2010-01-01

    Human adenovirus (HAdV) is a cause of significant morbidity and mortality in immunocompromised patients, especially after stem cell transplantation (SCT). Viral clearance has been attributed to CD4 + T-cell responses against the Hexon-protein, but the frequency of specific T HELPER cells is extremely low or not detectable ex vivo and preference for different CD4 + T-cell epitopes is variable among individuals. We therefore analyzed 44 healthy donors and 6 SCT-recipients for Hexon-specific CD4 + -responses ex vivo, to identify epitopes which would be broadly applicable. We selected 19 candidate epitopes with predicted restriction to HLA-DR1/DR3/DR4/DR7; 16 were located within the highly conserved regions, indicating cross-reactivity of T cells among HAdV-subspecies. Ten epitopes induced CD4 + -proliferation in >50% of individuals, confirmed by intracellular IFN-γ detection. Three SCT recipients who recovered from an infection with HAdV displayed reactivity towards only a single hexon epitope, whereas healthy individuals were responsive to two to eight epitopes (median 3). The ex vivo detection of Hexon-specific CD4 + T-cells, without any long-term culture in vitro, enables the detection and generation of HAdV-specific CD4 + T cells for adoptive T-cell transfer against HAdV-infection post SCT.

  2. Accessory signals in T-T cell interactions between antigen- and alloantigen-specific, human memory T cells generated in vitro

    DEFF Research Database (Denmark)

    Odum, N; Ryder, L P; Georgsen, J

    1990-01-01

    The potential of activated HLA class II-positive T cells as antigen-/alloantigen-presenting cells remains controversial. In our model system we use in vitro-primed, HLA class II-specific T cells of the memory T-cell phenotype, CD4+, CD29+ (4B4+), and CD45RO+ (UCHL-1). We have previously shown......), or a calcium ionophore (A23187) enabled Ta to elicit alloantigen-specific memory T-cell responses and to present purified protein derivative (PPD) to PPD-specific T-cell lines. The addition of irradiated, Epstein-Barr virus-transformed B-cell lines (EBV-LCL) (but not their supernatants) had a similar but less...

  3. Deficiency of G1 regulators P53, P21Cip1 and/or pRb decreases hepatocyte sensitivity to TGFβ cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Harrison David J

    2007-11-01

    Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of

  4. Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

    International Nuclear Information System (INIS)

    Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

    2008-01-01

    Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

  5. The dynamics of p53 in single cells: physiologically based ODE and reaction–diffusion PDE models

    International Nuclear Information System (INIS)

    Eliaš, Ján; Clairambault, Jean; Dimitrio, Luna; Natalini, Roberto

    2014-01-01

    The intracellular signalling network of the p53 protein plays important roles in genome protection and the control of cell cycle phase transitions. Recently observed oscillatory behaviour in single cells under stress conditions has inspired several research groups to simulate and study the dynamics of the protein with the aim of gaining a proper understanding of the physiological meanings of the oscillations. We propose compartmental ODE and PDE models of p53 activation and regulation in single cells following DNA damage and we show that the p53 oscillations can be retrieved by plainly involving p53–Mdm2 and ATM–p53–Wip1 negative feedbacks, which are sufficient for oscillations experimentally, with no further need to introduce any delays into the protein responses and without considering additional positive feedback. (paper)

  6. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  7. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  8. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  9. HIV-specific antibodies but not t-cell responses are associated with protection in seronegative partners of HIV-1-infected individuals in Cambodia.

    Science.gov (United States)

    Nguyen, Marie; Pean, Polidy; Lopalco, Lucia; Nouhin, Janin; Phoung, Viseth; Ly, Nary; Vermisse, Pierre; Henin, Yvette; Barré-Sinoussi, Françoise; Burastero, Samuele E; Reynes, Jean-Marc; Carcelain, Guislaine; Pancino, Gianfranco

    2006-08-01

    To study biological factors related to protection against HIV-1 infection in Cambodia, we recruited 48 partners of HIV-1-infected patients who remained uninfected (exposed uninfected individuals, EUs) despite unprotected sexual intercourse for more than 1 year and 49 unexposed controls (UCs). HIV-1-specific antibodies (IgA anti-gp41 and IgG anti-CD4-gp120 complex), T-cell responses, and cellular factors that may be involved in protection (peripheral blood mononuclear cell [PBMC] resistance to HIV-1 infection and beta-chemokine production) were evaluated. Anti-HIV-1 antibodies were higher in EUs than those in UCs (P = 0.01 and P = 0.04 for anti-gp41 and anti-CD4-gp120, respectively). We observed a decreased susceptibility to a primary Cambodian isolate, HIV-1KH019, in EU PBMCs as compared with UC PBMCs (P = 0.03). A weak T-cell response to one pool of HIV-1 Gag peptides was found by ELISpot in 1 of 19 EUs. Whereas T-cell specific immunity was not associated to protection, our results suggest that HIV-specific humoral immunity and reduced cell susceptibility to infection may contribute to protection against HIV-1 infection in Cambodian EUs.

  10. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  11. Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.

    Science.gov (United States)

    Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko

    2017-11-30

    Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.

  12. The prognostic significance of accumulation of p53 protein in stage III non-small cell lung cancer treated by radiotherapy

    International Nuclear Information System (INIS)

    Langendijk, J.A.; Thunnissen, F.B.J.M.; Lamers, R.J.S.; Jong, J.M.A. de; Velde, G.P.M. ten; Wouters, E.F.M.

    1995-01-01

    In the present study the prognostic significance of accumulation of nuclear p53 protein on survival and freedom from local progression was investigated. Formalin-fixed, paraffin-embedded sections obtained by bronchoscopy or mediastinoscopy were used to examine the expression of nuclear p53 protein using immunohistochemistry. In 37 cases (57%), overexpression of the p53 protein was detected. No relation was found between p53 expression and other pretreatment variables. Response to radiotherapy was found in 11 p53-negative cases (65%) versus 10 p53-positive cases (42%). Freedom from local progression was significantly better in the p53-negative cases as compared with the p53-positive cases. The p53-negative cases who responded to radiotherapy showed an excellent freedom from local progression rate after 2 years of 100%, whereas all p53-positive cases without response to radiotherapy showed local progression within 24 months. Overall survival between p53-negative and -positive cases did not differ, however the disease-specific survival was found to be worse in the p53-positive cases as compared to the negative cases (median survival 8.4 vs. 14.4 months (P < 0.05)). No correlation was found between p53 expression and the frequency of distant metastases. In conclusion, the results of this study suggest that p53 protein expression may be of prognostic value on freedom from local progression in non-small cell lung carcinoma

  13. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  14. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    Energy Technology Data Exchange (ETDEWEB)

    Nishida, Tamotsu, E-mail: nishida@gene.mie-u.ac.jp [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan); Yamada, Yoshiji [Department of Human Functional Genomics, Life Science Research Center, Mie University, 1577 Kurima-machiya, Tsu 514-8507 (Japan)

    2011-03-11

    Research highlights: {yields} SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. {yields} SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. {yields} SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. {yields} We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  15. The nucleolar SUMO-specific protease SMT3IP1/SENP3 attenuates Mdm2-mediated p53 ubiquitination and degradation

    International Nuclear Information System (INIS)

    Nishida, Tamotsu; Yamada, Yoshiji

    2011-01-01

    Research highlights: → SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. → SMT3IP1 competes with p53 for binding to the central acidic domain of Mdm2. → SMT3IP1 binding to Mdm2 inhibits Mdm2-mediated p53 ubiquitination and degradation. → We postulate that SMT3IP1 acts as a new regulator of the p53-Mdm2 pathway. -- Abstract: SUMO (small ubiquitin-like modifier) modification plays multiple roles in several cellular processes. Sumoylation is reversibly regulated by SUMO-specific proteases. SUMO-specific proteases have recently been implicated in cell proliferation and early embryogenesis, but the underlying mechanisms remain unknown. Here, we show that a nucleolar SUMO-specific protease, SMT3IP1/SENP3, controls the p53-Mdm2 pathway. We found that SMT3IP1 interacts with p53 and Mdm2, and desumoylates both proteins. Overexpression of SMT3IP1 in cells resulted in the accumulation of Mdm2 in the nucleolus and increased stability of the p53 protein. In addition, SMT3IP1 bound to the acidic domain of Mdm2, which also mediates the p53 interaction, and competed with p53 for binding. Increasing expression of SMT3IP1 suppressed Mdm2-mediated p53 ubiquitination and subsequent proteasomal degradation. Interestingly, the desumoylation activity of SMT3IP1 was not necessary for p53 stabilization. These results suggest that SMT3IP1 is a new regulator of the p53-Mdm2 pathway.

  16. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  17. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  18. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  19. P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent

    International Nuclear Information System (INIS)

    Dbaibo, G.; El-Assaad, W.

    2000-01-01

    Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation

  20. Evodiamine selectively targets cancer stem-like cells through the p53-p21-Rb pathway

    International Nuclear Information System (INIS)

    Han, Seula; Woo, Jong Kyu; Jung, Yuchae; Jeong, Dawoon; Kang, Minsook; Yoo, Young-Ji; Lee, Hani; Oh, Seung Hyun; Ryu, Jae-Ha; Kim, Woo-Young

    2016-01-01

    In spite of the recent improvements, the resistance to chemotherapy/radiotherapy followed by relapse is the main hurdle for the successful treatment of breast cancer, a leading cause of death in women. A small population of breast cancer cells that have stem-like characteristics (cancer stem-like cells; CSLC) may contribute to this resistance and relapse. Here, we report on a component of a traditional Chinese medicine, evodiamine, which selectively targets CSLC of breast cancer cell lines MCF7 and MDAMB 231 at a concentration that does show a little or no cytotoxic effect on bulk cancer cells. While evodiamine caused the accumulation of bulk cancer cells at the G2/M phase, it did not hold CSLC in a specific cell cycle phase but instead, selectively killed CSLC. This was not due to the culture of CSLC in suspension or without FBS. A proteomic analysis and western blotting revealed that evodiamine changed the expression of cell cycle regulating molecules more efficiently in CSLC cells than in bulk cancer cells. Surprisingly, evodiamine selectively activated p53 and p21 and decreased inactive Rb, the master molecules in G1/S checkpoint. These data collectively suggest a novel mechanism involving CSLC-specific targeting by evodiamine and its possible use to the therapy of breast cancer. - Highlights: • Evodiamine selectively kills breast cancer stem like cells at G1 phase. • Evodiamine utilizes different mechanism of cell cycle modulation in CSLC and in bulk cancer cells. • Evodiamine activate the p53, p21 and Rb pathway.

  1. Evodiamine selectively targets cancer stem-like cells through the p53-p21-Rb pathway

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seula [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Woo, Jong Kyu [College of Pharmacy, Gachon University, Incheon (Korea, Republic of); Jung, Yuchae; Jeong, Dawoon; Kang, Minsook; Yoo, Young-Ji; Lee, Hani [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Oh, Seung Hyun [College of Pharmacy, Gachon University, Incheon (Korea, Republic of); Ryu, Jae-Ha [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of); Kim, Woo-Young, E-mail: wykim@sookmyung.ac.kr [The Research Center for Cell Fate Control, College of Pharmacy, Sookmyung Women' s University, Seoul (Korea, Republic of)

    2016-01-22

    In spite of the recent improvements, the resistance to chemotherapy/radiotherapy followed by relapse is the main hurdle for the successful treatment of breast cancer, a leading cause of death in women. A small population of breast cancer cells that have stem-like characteristics (cancer stem-like cells; CSLC) may contribute to this resistance and relapse. Here, we report on a component of a traditional Chinese medicine, evodiamine, which selectively targets CSLC of breast cancer cell lines MCF7 and MDAMB 231 at a concentration that does show a little or no cytotoxic effect on bulk cancer cells. While evodiamine caused the accumulation of bulk cancer cells at the G2/M phase, it did not hold CSLC in a specific cell cycle phase but instead, selectively killed CSLC. This was not due to the culture of CSLC in suspension or without FBS. A proteomic analysis and western blotting revealed that evodiamine changed the expression of cell cycle regulating molecules more efficiently in CSLC cells than in bulk cancer cells. Surprisingly, evodiamine selectively activated p53 and p21 and decreased inactive Rb, the master molecules in G1/S checkpoint. These data collectively suggest a novel mechanism involving CSLC-specific targeting by evodiamine and its possible use to the therapy of breast cancer. - Highlights: • Evodiamine selectively kills breast cancer stem like cells at G1 phase. • Evodiamine utilizes different mechanism of cell cycle modulation in CSLC and in bulk cancer cells. • Evodiamine activate the p53, p21 and Rb pathway.

  2. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  3. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  4. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    Science.gov (United States)

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  5. SIGNALING TO THE P53 TUMOR SUPPRESSOR THROUGH PATHWAYS ACTIVATED BY GENOTOXIC AND NON-GENOTOXIC STRESSES.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2002-07-01

    The p53 tumor suppressor is a tetrameric transcription factor that is post-translational modified at {approx}18 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review the posttranslational modifications to p53 and the pathways that produce them in response to both genotoxic and non-genotoxic stresses.

  6. The p53/HSP70 inhibitor, 2-phenylethynesulfonamide, causes oxidative stress, unfolded protein response and apoptosis in rainbow trout cells

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Fanxing; Tee, Catherine; Liu, Michelle [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); Sherry, James P. [Aquatic Contaminants Research Division, Environment Canada, Burlington, Ontario L7R 4A6 (Canada); Dixon, Brian; Duncker, Bernard P. [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); Bols, Niels C., E-mail: ncbols@uwaterloo.ca [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada)

    2014-01-15

    Highlights: •2-Phenylethynesulfonamide (PES) is an inhibitor of p53 and HSP 70 in mammals. •In the fish epithelial cell line, RTgill-W1, PES enhanced ROS generation and was cytotoxic. •RTgill-W1 death was by apoptosis and blocked by the anti-oxidant N-acetylcysteine. •This is the first report linking PES-induced cell death to ROS. •With this background PES should be useful for studying fish cell survival pathways. -- Abstract: The effect of 2-phenylethynesulfonamide (PES), which is a p53 and HSP70 inhibitor in mammalian cells, was studied on the rainbow trout (Oncorhynchus mykiss) gill epithelial cell line, RTgill-W1, in order to evaluate PES as a tool for understanding the cellular survival pathways operating in fish. As judged by three viability assays, fish cells were killed by 24 h exposures to PES, but cell death was blocked by the anti-oxidant N-acetylcysteine (NAC). Cell death had several hallmarks of apoptosis: DNA laddering, nuclear fragmentation, Annexin V staining, mitochondrial membrane potential decline, and caspases activation. Reactive oxygen species (ROS) production peaked in several hours after the addition of PES and before cell death. HSP70 and BiP levels were higher in cultures treated with PES for 24 h, but this was blocked by NAC. As well, PES treatment caused HSP70, BiP and p53 to accumulate in the detergent-insoluble fraction, and this too was prevented by NAC. Of several possible scenarios to explain the results, the following one is the simplest. PES enhances the generation of ROS, possibly by inhibiting the anti-oxidant actions of p53 and HSP70. ER stress arises from the ROS and from PES inhibiting the chaperone activities of HSP70. The ER stress in turn initiates the unfolded protein response (UPR), but this fails to restore ER homeostasis so proteins aggregate and cells die. Despite these multiple actions, PES should be useful for studying fish cellular survival pathways.

  7. Transcriptome profiling identifies genes and pathways deregulated upon floxuridine treatment in colorectal cancer cells harboring GOF mutant p53

    Directory of Open Access Journals (Sweden)

    Arindam Datta

    2016-06-01

    Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.

  8. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  9. Microrna-31 mediates radiation induced apoptosis selectively in malignant tumour cells with dysfunctional P53

    International Nuclear Information System (INIS)

    Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir

    2016-01-01

    The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression

  10. Growth arrest-specific transcript 5 associated snoRNA levels are related to p53 expression and DNA damage in colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Jonathan Krell

    Full Text Available The growth arrest-specific transcript 5 gene (GAS5 encodes a long noncoding RNA (lncRNA and hosts a number of small nucleolar RNAs (snoRNAs that have recently been implicated in multiple cellular processes and cancer. Here, we investigate the relationship between DNA damage, p53, and the GAS5 snoRNAs to gain further insight into the potential role of this locus in cell survival and oncogenesis both in vivo and in vitro.We used quantitative techniques to analyse the effect of DNA damage on GAS5 snoRNA expression and to assess the relationship between p53 and the GAS5 snoRNAs in cancer cell lines and in normal, pre-malignant, and malignant human colorectal tissue and used biological techniques to suggest potential roles for these snoRNAs in the DNA damage response.GAS5-derived snoRNA expression was induced by DNA damage in a p53-dependent manner in colorectal cancer cell lines and their levels were not affected by DICER. Furthermore, p53 levels strongly correlated with GAS5-derived snoRNA expression in colorectal tissue.In aggregate, these data suggest that the GAS5-derived snoRNAs are under control of p53 and that they have an important role in mediating the p53 response to DNA damage, which may not relate to their function in the ribosome. We suggest that these snoRNAs are not processed by DICER to form smaller snoRNA-derived RNAs with microRNA (miRNA-like functions, but their precise role requires further evaluation. Furthermore, since GAS5 host snoRNAs are often used as endogenous controls in qPCR quantifications we show that their use as housekeeping genes in DNA damage experiments can lead to inaccurate results.

  11. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    International Nuclear Information System (INIS)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee

    2011-01-01

    Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.

  12. Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage.

    Directory of Open Access Journals (Sweden)

    Chengwan Zhang

    Full Text Available UTX is known as a general factor that activates gene transcription during development. Here, we demonstrate an additional essential role of UTX in the DNA damage response, in which it upregulates the expression of ku80 in Drosophila, both in cultured cells and in third instar larvae. We further showed that UTX mediates the expression of ku80 by the demethylation of H3K27me3 at the ku80 promoter upon exposure to ionizing radiation (IR in a p53-dependent manner. UTX interacts physically with p53, and both UTX and p53 are recruited to the ku80 promoter following IR exposure in an interdependent manner. In contrast, the loss of utx has little impact on the expression of ku70, mre11, hid and reaper, suggesting the specific regulation of ku80 expression by UTX. Thus, our findings further elucidate the molecular function of UTX.

  13. p53 levels, cell cycle kinetics and radiosensitivity in two SV40 transformed Wi38VA13 fibroblast strains

    International Nuclear Information System (INIS)

    Werner, F.; Zoelzer, F.; Streffer, C.

    2001-01-01

    Background: The tumor suppressor protein p53 which can mediate an ionizing radiation-induced G 1 arrest in mammalian cells, forms complexes with SV40 large T antigen (l-T-Ag). We have analyzed the p53 levels, the capability to undergo a G 1 arrest and the radiosensitivity of two SV40 transformed fibroblast strains differing in their large T antigen expression. Material and Methods: One of the two strains (VA13F) is the commercially available form of Wi38VA13, the other (VA13E) arose spontaneously from the original one in our laboratory. Their p53 levels were measured by means of flow cytometry (FCM) and Western blot (WB) with two p53 antibodies (Ab-3, clone PAb240; Ab-6, clone DO-1; both Oncogene Science). Cell cycle distributions were determined flow cytometrically after BrdU labeling at regular time intervals after exposure to 250 kV X-rays. Radiosensitivity was assessed in a clonogenicity assay. Results: The p53 levels of the two strains corresponded to their large T antigen expression, presumably due to complex formation between the two proteins. The strain with a high p53 level did not show a G 1 arrest and had a relatively high radiosensitivity, whereas the strain with a low p53 level showed a significant G 1 arrest and a lower radiosensitivity. Conclusion: These results suggest that 1. complex formation between the large T antigen and p53 reduces the latter's functionality; 2. in these two strains the G 1 arrest is one of the factors determining radiosensitivity. (orig.) [de

  14. Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

    Directory of Open Access Journals (Sweden)

    Rouba Hage-Sleiman

    Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

  15. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    Science.gov (United States)

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  16. MDM2, p53 and pRb Expression Prior to Definitive Chemoradiotherapy in Esophageal Carcinoma

    International Nuclear Information System (INIS)

    Yoon, Mee Sun; Nam, Taek Keun; Lee, Jae Hyuk; Cho, Sang Hee; Song, Ju Young; Ahn, Sung Ja; Chung, Ik Joo; Chung, Woong Ki; Nah, Byung Sik

    2007-01-01

    Purpose: This study evaluated the pretreatment expression patterns of MDM2, p53, and pRb proteins to determine if the expression patterns could predict the outcome of concurrent chemoradiotherapy (CCRT) for esophageal squamous cell carcinoma and aid in the decisions for the selection of treatment modalities. Materials and Methods: Fifty-one patients that were treated with definitive hemoradiotherapy for stage I∼ IVa esohageal squamous cell carcinoma were selected for this study. Radiotherapy was administered with daily 1.8∼2 Gy fractions up to a median dose of 54 Gy for primary tumors, and with four cycles of cisplatin/5-fluorouracil chemotherapy that was administered every 4 weeks, the first two cycles of which were administered concurrently with radiotherapy. Expression of MDM2, p53, and pRb was investigated by immunohistochemical analysis using pretreatment biopsy specimens. Results: MDM2, p53, and pRb were detected with high immunoreactivity in 19.6%, 27.5%, and 66.7% of the patients, respectively. However, there was no significant correlation between expression of these factors and clinical outcome. By the use of multivariate analysis with nine covariates-age, tumor location, tumor length, stage, pathological response, clinical response, MDM2 expression, p53 expression, and pRb expression, only pathological response and stage were significant factors for cause-specific survival. Conclusion: Expression of MDM2, p53, and pRb was not found to be clinically significant for predicting outcomes after CCRT in this study. Further studies with a larger patient population and longer follow-up periods are needed to re-evaluate the expression pattern and to identify new predictors for CCRT response

  17. The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

    International Nuclear Information System (INIS)

    Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

    2000-01-01

    The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53δ, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53δ cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of undifferentiated

  18. The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

    Energy Technology Data Exchange (ETDEWEB)

    Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura [Kyoto Univ. (Japan). Radiation Biology Center; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

    2000-09-01

    The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53{delta}, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53{delta} cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of

  19. p53/Surviving Ratio as a Parameter for Chemotherapy Induction Response in Children with Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Rinaldi Lenggana

    2016-11-01

    Full Text Available Acute myeloid leukemia (AML is a malignancy that is often found in children. Many studies into the failure of apoptosis function, or programmed cell death, is one of the most important regulatory mechanisms of cellular hemostasis which is closely linked to the development of cancer, are important. Also, regulation of the apoptotic (p53 and anti-apoptotic (surviving proteins influence treatment outcome. One role of p53 is to monitor cellular stress necessary to induce apoptosis. Surviving (BIRC5 is a group of proteins in the apoptosis inhibitor which works by inhibiting caspase-3. The role of surviving is considered very important in oncogenesis proliferation and cell growth regulation. Chemotherapy in childhood AML can inhibit cell growth and induce slowing as well as stopping the cell cycle. Thus, the aim of this study was to compare p53 and surviving before and after receiving induction chemotherapy in children with AML and also to determine the p53/surviving ratio. Peripheral blood mononuclear cells were collected from AML children before treatment and three months after starting their induction therapy. p53 and surviving were measured by flowcytometry using monoclonal antibodies. Data were analyzed by t-test for comparison between groups and Spearman’s test to find out the correlation between variables with a significant value of p < 0.05. A total of 8 children were evaluated. The intensity of p53 expression was not significantly increased after induction phase chemotherapy (p = 0.224, but surviving expression and the ratio of p53/surviving were significantly increased in the treatment group compared with the levels prior to chemotherapy (p = 0.002, p = 0.034, and there was a strong negative correlation between p53 and surviving after chemotherapy (r = −0.63, p = 0.049.

  20. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    Science.gov (United States)

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  1. Oncogenic RAS enables DNA damage- and p53-dependent differentiation of acute myeloid leukemia cells in response to chemotherapy.

    Directory of Open Access Journals (Sweden)

    Mona Meyer

    Full Text Available Acute myeloid leukemia (AML is a clonal disease originating from myeloid progenitor cells with a heterogeneous genetic background. High-dose cytarabine is used as the standard consolidation chemotherapy. Oncogenic RAS mutations are frequently observed in AML, and are associated with beneficial response to cytarabine. Why AML-patients with oncogenic RAS benefit most from high-dose cytarabine post-remission therapy is not well understood. Here we used bone marrow cells expressing a conditional MLL-ENL-ER oncogene to investigate the interaction of oncogenic RAS and chemotherapeutic agents. We show that oncogenic RAS synergizes with cytotoxic agents such as cytarabine in activation of DNA damage checkpoints, resulting in a p53-dependent genetic program that reduces clonogenicity and increases myeloid differentiation. Our data can explain the beneficial effects observed for AML patients with oncogenic RAS treated with higher dosages of cytarabine and suggest that induction of p53-dependent differentiation, e.g. by interfering with Mdm2-mediated degradation, may be a rational approach to increase cure rate in response to chemotherapy. The data also support the notion that the therapeutic success of cytotoxic drugs may depend on their ability to promote the differentiation of tumor-initiating cells.

  2. Influence of p53 and bcl-2 on chemosensitivity in benign and malignant prostatic cell lines.

    Science.gov (United States)

    Serafin, Antonio M; Bohm, Lothar

    2005-01-01

    The administration of cancer chemotherapeutic agents results in an increase in the apoptotic cells in the tumor: therefore, it has been assumed that anticancer drugs exhibit their cytotoxic effects via apoptotic signaling pathways. Characteristics that confer sensitivity to drug-induced apoptosis are, a functional p53 protein and expression of the apoptosis-promoting protein, bax. The role of p53 and bax/bcl-2 in drug-induced apoptosis was assessed in six prostate cell lines, 1532T, 1535T, 1542T, 1542N, BPH-1 and LNCaP using TD(50) concentrations of etoposide, vinblastine and estramustine. Cell death was monitored morphologically by fluorescent microscopy, and by flow cytometry (Annexin-V assay). Apoptotic morphology was rather low and ranged from 0.1% to 12.1%, 3.0% to 6.0% and 0.1% to 8.5% for etoposide, estramustine and vinblastine, respectively. Annexin-V binding and flow cytometry indicated apoptotic propensities of 0% to 4%, 0% to 3% and 0% to 5%, respectively. The percentage of cells responding to drug-induced apoptosis was, on average, higher in the tumor cell lines than in the normal cell lines, but showed no correlation with p53 status. The percentage of cells showing necrosis, assessed by Annexin binding and Propidium Iodide permeability in aqueous medium, tended to be much higher, and was found to be at the level of 5% to 30%. Immunoblotting demonstrated that bax and bcl-2 proteins were expressed at a basal level in all cell lines, but did not increase after exposure to TD(50) doses of the three drugs. The ratio of bax and bcl-2, measured by laser scanning densitometry, was not altered by the drug-induced DNA damage. The results suggest that apoptosis is not a major mechanism of drug-induced cell death in prostate cell lines and appears to be independent of p53 status and bax/bcl-2 expression.

  3. CCL22-specific T Cells

    DEFF Research Database (Denmark)

    Martinenaite, Evelina; Munir Ahmad, Shamaila; Hansen, Morten

    2016-01-01

    Tumor cells and tumor-infiltrating macrophages produce the chemokine CCL22, which attracts regulatory T cells (Tregs) into the tumor microenvironment, decreasing anticancer immunity. Here, we investigated the possibility of targeting CCL22-expressing cells by activating specific T cells. We...... analyzed the CCL22 protein signal sequence, identifying a human leukocyte antigen A2- (HLA-A2-) restricted peptide epitope, which we then used to stimulate peripheral blood mononuclear cells (PMBCs) to expand populations of CCL22-specific T cells in vitro. T cells recognizing an epitope derived from...... the signal-peptide of CCL22 will recognize CCL22-expressing cells even though CCL22 is secreted out of the cell. CCL22-specific T cells recognized and killed CCL22-expressing cancer cells. Furthermore, CCL22-specific T cells lysed acute monocytic leukemia cells in a CCL22 expression-dependent manner. Using...

  4. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status.

    Science.gov (United States)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna

    2015-08-01

    Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0-8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at lower doses whereas wild type cells only at higher doses. Secretion of IL-8 by TP53-/- control cells was many times lower than that by TP53+/+ but increased significantly after irradiation. Transcription of the NFκBIA was induced in irradiated TP53+/+ mainly, but in bystanders a higher level was observed in TP53-/- cells, suggesting that TP53 is required for induction of NFκB pathway after irradiation but another mechanism of activation must operate in

  5. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.

    2011-01-01

    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  6. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  7. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  8. T cell cytokine responses to stimulation with Ureaplasma parvum in pregnancy.

    Science.gov (United States)

    Friedland, Yael D; Lee-Pullen, Tracey F; Nathan, Elizabeth A; Watts, Rory; Keelan, Jeffrey A; Payne, Matthew S; Ireland, Demelza J

    2016-08-01

    Ureaplasma spp. are a common vaginal microorganism causally linked to inflammation-driven preterm birth (PTB). The nature of the immune response to Ureaplasma spp. may influence PTB risk. This study sought to define maternal T cell cytokine responses to in vitro stimulation with Ureaplasma parvum serovar 3 (UpSV3) in vaginally colonised (UP+) and non-colonised (UP-) pregnant women. Whole blood flow cytometry demonstrated an increase (p=0.027) in the baseline frequency of IFNγ-positive CD3(+)CD4(-)(CD8(+)) T cells in UP+ women. UpSV3 stimulation resulted in a significant and specific increase (p=0.001) in the frequency of IFNγ-positive CD3(+)CD4(-)(CD8(+)) T cells, regardless of vaginal colonisation status. UpSV3 stimulation also increased the frequency of IFNγ-positive CD3(+)CD4(+) T cells, particularly in the UP+ group (p=0.003). This is the first published study to examine T cell responses to Ureaplasma spp. Future appropriately-powered studies are needed to assess whether insufficient priming or a loss of tolerance to Ureaplasma spp. is occurring in UP+ women at risk of PTB. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Dose selenomethionine have radio-protective effect on cell lines with wild type p53?

    International Nuclear Information System (INIS)

    Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.

    2003-01-01

    Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines

  10. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  11. p53-Mediated Molecular Control of Autophagy in Tumor Cells

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    2018-03-01

    Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

  12. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    International Nuclear Information System (INIS)

    Adámik, Matej; Bažantová, Pavla; Navrátilová, Lucie; Polášková, Alena; Pečinka, Petr; Holaňová, Lucie; Tichý, Vlastimil; Brázdová, Marie

    2015-01-01

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed

  13. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    Energy Technology Data Exchange (ETDEWEB)

    Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)

    2015-01-02

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.

  14. Activation of p53 by nutlin-3a induces apoptosis and cellular senescence in human glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Ruth Villalonga-Planells

    2011-04-01

    Full Text Available Glioblastoma multiforme (GBM is the most common and aggressive primary brain tumor in adults. Despite concerted efforts to improve current therapies and develop novel clinical approaches, patient survival remains poor. As such, increasing attention has focused on developing new therapeutic strategies that specifically target the apoptotic pathway in order to improve treatment responses. Recently, nutlins, small-molecule antagonists of MDM2, have been developed to inhibit p53-MDM2 interaction and activate p53 signaling in cancer cells. Glioma cell lines and primary cultured glioblastoma cells were treated with nutlin-3a. Nutlin-3a induced p53-dependent G1- and G2-M cell cycle arrest and apoptosis in glioma cell lines with normal TP53 status. In addition, nutlin-arrested glioma cells show morphological features of senescence and persistent induction of p21 protein. Furthermore, senescence induced by nutlin-3a might be depending on mTOR pathway activity. In wild-type TP53 primary cultured cells, exposure to nutlin-3a resulted in variable degrees of apoptosis as well as cellular features of senescence. Nutlin-3a-induced apoptosis and senescence were firmly dependent on the presence of functional p53, as revealed by the fact that glioblastoma cells with knockdown p53 with specific siRNA, or cells with mutated or functionally impaired p53 pathway, were completely insensitive to the drug. Finally, we also found that nutlin-3a increased response of glioma cells to radiation therapy. The results provide a basis for the rational use of MDM2 antagonists as a novel treatment option for glioblastoma patients.

  15. Decline of influenza-specific CD8+ T cell repertoire in healthy geriatric donors

    Directory of Open Access Journals (Sweden)

    Ramachandra Lakshmi

    2011-08-01

    Full Text Available Abstract Background While influenza vaccination results in protective antibodies against primary infections, clearance of infection is primarily mediated through CD8+ T cells. Studying the CD8+ T cell response to influenza epitopes is crucial in understanding the disease associated morbidity and mortality especially in at risk populations such as the elderly. We compared the CD8+ T cell response to immunodominant and subdominant influenza epitopes in HLA-A2+ control, adult donors, aged 21-42, and in geriatric donors, aged 65 and older. Results We used a novel artificial Antigen Presenting Cell (aAPC based stimulation assay to reveal responses that could not be detected by enzyme-linked immunosorbent spot (ELISpot. 14 younger control donors and 12 geriatric donors were enrolled in this study. The mean number of influenza-specific subdominant epitopes per control donor detected by ELISpot was only 1.4 while the mean detected by aAPC assay was 3.3 (p = 0.0096. Using the aAPC assay, 92% of the control donors responded to at least one subdominant epitopes, while 71% of control donors responded to more than one subdominant influenza-specific response. 66% of geriatric donors lacked a subdominant influenza-specific response and 33% of geriatric donors responded to only 1 subdominant epitope. The difference in subdominant response between age groups is statistically significant (p = 0.0003. Conclusion Geriatric donors lacked the broad, multi-specific response to subdominant epitopes seen in the control donors. Thus, we conclude that aging leads to a decrease in the subdominant influenza-specific CTL responses which may contribute to the increased morbidity and mortality in older individuals.

  16. Engineering Specificity and Function of Therapeutic Regulatory T Cells

    Directory of Open Access Journals (Sweden)

    Jenny L. McGovern

    2017-11-01

    Full Text Available Adoptive therapy with polyclonal regulatory T cells (Tregs has shown efficacy in suppressing detrimental immune responses in experimental models of autoimmunity and transplantation. The lack of specificity is a potential limitation of Treg therapy, as studies in mice have demonstrated that specificity can enhance the therapeutic potency of Treg. We will discuss that vectors encoding T cell receptors or chimeric antigen receptors provide an efficient gene-transfer platform to reliably produce Tregs of defined antigen specificity, thus overcoming the considerable difficulties of isolating low-frequency, antigen-specific cells that may be present in the natural Treg repertoire. The recent observations that Tregs can polarize into distinct lineages similar to the Th1, Th2, and Th17 subsets described for conventional T helper cells raise the possibility that Th1-, Th2-, and Th17-driven pathology may require matching Treg subsets for optimal therapeutic efficacy. In the future, genetic engineering may serve not only to enforce FoxP3 expression and a stable Treg phenotype but it may also enable the expression of particular transcription factors that drive differentiation into defined Treg subsets. Together, established and recently developed gene transfer and editing tools provide exciting opportunities to produce tailor-made antigen-specific Treg products with defined functional activities.

  17. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  18. Clonal analysis of the T-cell response to in vivo expressed Mycobacterium tuberculosis protein Rv2034, using a CD154 expression based T-cell cloning method.

    Directory of Open Access Journals (Sweden)

    Susanna Commandeur

    Full Text Available Tuberculosis (TB, caused by Mycobacterium tuberculosis (Mtb, remains a leading cause of death worldwide. A better understanding of the role of CD4+ and CD8+ T cells, which are both important to TB protection, is essential to unravel the mechanisms of protection and to identify the key antigens seen by these T cells. We have recently identified a set of in vivo expressed Mtb genes (IVE-TB which is expressed during in vivo pulmonary infection in mice, and shown that their encoded antigens are potently recognized by polyclonal T cells from tuberculin skin test-positive, in vitro ESAT-6/CFP10-responsive individuals. Here we have cloned T cells specific for one of these newly identified in vivo expressed Mtb (IVE-TB antigens, Rv2034. T cells were enriched based on the expression of CD154 (CD40L, which represents a new method for selecting antigen-specific (low frequency T cells independent of their specific function. An Rv2034-specific CD4+ T-cell clone expressed the Th1 markers T-bet, IFN-γ, TNF-α, IL-2 and the cytotoxicity related markers granzyme B and CD107a as measured by flow cytometry. The clone specifically recognized Rv2034 protein, Rv2034 peptide p81-100 and Mtb lysate. Remarkably, while the recognition of the dominant p81-100 epitope was HLA-DR restricted, the T-cell clone also recognized a neighboring epitope (p88-107 in an HLA-DR- as well as HLA-DQ1-restricted fashion. Importantly, the T-cell clone was able to inhibit Mtb outgrowth from infected monocytes significantly. The characterization of the polyfunctional and Mtb inhibitory T-cell response to IVE-TB Rv2034 at the clonal level provides detailed further insights into the potential of IVE-TB antigens as new vaccine candidate antigens in TB. Our new approach allowed the identification of T-cell subsets that likely play a significant role in controlling Mtb infection, and can be applied to the analysis of T-cell responses in patient populations.

  19. Sequential Dysfunction and Progressive Depletion of Candida albicans-Specific CD4 T Cell Response in HIV-1 Infection

    Science.gov (United States)

    Liu, Fengliang; Fan, Xiuzhen; Auclair, Sarah; Ferguson, Monique; Sun, Jiaren; Soong, Lynn; Hou, Wei; Redfield, Robert R.; Birx, Deborah L.; Ratto-Kim, Silvia; Robb, Merlin L.; Kim, Jerome H.; Michael, Nelson L.; Hu, Haitao

    2016-01-01

    Loss of immune control over opportunistic infections can occur at different stages of HIV-1 (HIV) disease, among which mucosal candidiasis caused by the fungal pathogen Candida albicans (C. albicans) is one of the early and common manifestations in HIV-infected human subjects. The underlying immunological basis is not well defined. We have previously shown that compared to cytomegalovirus (CMV)-specific CD4 cells, C. albicans-specific CD4 T cells are highly permissive to HIV in vitro. Here, based on an antiretroviral treatment (ART) naïve HIV infection cohort (RV21), we investigated longitudinally the impact of HIV on C. albicans- and CMV-specific CD4 T-cell immunity in vivo. We found a sequential dysfunction and preferential depletion for C. albicans-specific CD4 T cell response during progressive HIV infection. Compared to Th1 (IFN-γ, MIP-1β) functional subsets, the Th17 functional subsets (IL-17, IL-22) of C. albicans-specific CD4 T cells were more permissive to HIV in vitro and impaired earlier in HIV-infected subjects. Infection history analysis showed that C. albicans-specific CD4 T cells were more susceptible to HIV in vivo, harboring modestly but significantly higher levels of HIV DNA, than CMV-specific CD4 T cells. Longitudinal analysis of HIV-infected individuals with ongoing CD4 depletion demonstrated that C. albicans-specific CD4 T-cell response was preferentially and progressively depleted. Taken together, these data suggest a potential mechanism for earlier loss of immune control over mucosal candidiasis in HIV-infected patients and provide new insights into pathogen-specific immune failure in AIDS pathogenesis. PMID:27280548

  20. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    Science.gov (United States)

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  1. Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.

    Directory of Open Access Journals (Sweden)

    Damiano Conte

    Full Text Available Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU. Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors.

  2. Antigen-specific T cell activation independently of the MHC: chimeric antigen receptor (CAR-redirected T cells.

    Directory of Open Access Journals (Sweden)

    Hinrich eAbken

    2013-11-01

    Full Text Available Adoptive T cell therapy has recently shown powerful in initiating a lasting anti-tumor response with spectacular therapeutic success in some cases. Specific T cell therapy, however, is limited since a number of cancer cells are not recognized by T cells due to various mechanisms including the limited availability of tumor-specific T cells and deficiencies in antigen processing or major histocompatibility complex (MHC expression of cancer cells. To make adoptive cell therapy applicable for the broad variety of cancer entities, patient's T cells are engineered ex vivo with pre-defined specificity by a recombinant chimeric antigen receptor (CAR which consists in the extracellular part of an antibody-derived domain for binding with a tumor-associated antigen and in the intracellular part of a TCR-derived signaling moiety for T cell activation. The specificity of CAR mediated T cell recognition is defined by the antibody domain, is independent of MHC presentation and can be extended to any target for which an antibody is available. We discuss the advantages and limitations of MHC-independent T cell targeting by an engineered CAR and review most significant progress recently made in early stage clinical trials to treat cancer.

  3. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  4. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  5. Over-expression of p53 mutants in LNCaP cells alters tumor growth and angiogenesis in vivo

    International Nuclear Information System (INIS)

    Perryman, L.A.; Blair, J.M.; Kingsley, E.A.; Szymanska, B.; Ow, K.T.; Wen, V.W.; MacKenzie, K.L.; Vermeulen, P.B.; Jackson, P.; Russell, P.J.

    2006-01-01

    This study has investigated the impact of three specific dominant-negative p53 mutants (F134L, M237L, and R273H) on tumorigenesis by LNCaP prostate cancer cells. Mutant p53 proteins were associated with an increased subcutaneous 'take rate' in NOD-SCID mice, and increased production of PSA. Tumors expressing F134L and R273H grew slower than controls, and were associated with decreased necrosis and apoptosis, but not hypoxia. Interestingly, hypoxia levels were increased in tumors expressing M237L. There was less proliferation in F134L-bearing tumors compared to control, but this was not statistically significant. Angiogenesis was decreased in tumors expressing F134L and R273H compared with M237L, or controls. Conditioned medium from F134L tumors inhibited growth of normal human umbilical-vein endothelial cells but not telomerase-immortalized bone marrow endothelial cells. F134L tumor supernatants showed lower levels of VEGF and endostatin compared with supernatants from tumors expressing other mutants. Our results support the possibility that decreased angiogenesis might account for reduced growth rate of tumor cells expressing the F134L p53 mutation

  6. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  7. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  8. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Comprehensive Analysis of CD8+-T-Cell Responses against Hepatitis C Virus Reveals Multiple Unpredicted Specificities

    OpenAIRE

    Lauer, Georg M.; Ouchi, Kei; Chung, Raymond T.; Nguyen, Tam N.; Day, Cheryl L.; Purkis, Deborah R.; Reiser, Markus; Kim, Arthur Y.; Lucas, Michaela; Klenerman, Paul; Walker, Bruce D.

    2002-01-01

    The hepatitis C virus (HCV)-specific CD8+-T-cell response is thought to play a critical role in HCV infection. Studies of these responses have largely relied on the analysis of a small number of previously described or predicted HCV epitopes, mostly restricted by HLA A2. In order to determine the actual breadth and magnitude of CD8+-T-cell responses in the context of diverse HLA class I alleles, we performed a comprehensive analysis of responses to all expressed HCV proteins. By using a panel...

  10. LRRK2 interacts with ATM and regulates Mdm2-p53 cell proliferation axis in response to genotoxic stress.

    Science.gov (United States)

    Chen, Zhongcan; Cao, Zhen; Zhang, Wei; Gu, Minxia; Zhou, Zhi Dong; Li, Baojie; Li, Jing; Tan, Eng King; Zeng, Li

    2017-11-15

    Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself contributes to cancer risk remains unknown. DNA damage causes cancer, and DNA damage responses are among the most important pathways in cancer biology. To understand the role of LRRK2 in DNA damage response pathway, we induced DNA damage by applying genotoxic stress to the cells with Adriamycin. We found that DNA damage enhances LRRK2 phosphorylation at Serine 910, Serine 935 and Serine 1292. We further showed that LRRK2 phosphorylation is abolished in the absence of ATM, suggesting that LRRK2 phosphorylation requires ATM. It should also be noted that LRRK2 interacts with ATM. In contrast, overexpression or knockdown of LRRK2 does not affect ATM phosphorylation, indicating that LRRK2 is the downstream target of ATM in response to DNA damage. Moreover, we demonstrated that LRRK2 increases the expression of p53 and p21 by increasing the Mdm2 phosphorylation in response to DNA damage. Loss-of-function in LRRK2 has the opposite effect to that of LRRK2. In addition, FACS analysis revealed that LRRK2 enhances cell cycle progression into S phase in response to DNA damage, a finding that was confirmed by 5-bromo-2'-deoxyuridine immunostaining. Taken together, our findings demonstrate that LRRK2 plays an important role in the ATM-Mdm2-p53 pathway that regulates cell proliferation in response to DNA damage. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Complex Biological Systems Analysis of Cell Cycling Models in Carcinogenesis: I. The essential roles of modifications in the c-Myc, TP53/p53, p27 and hTERT modules in Cancer Initiation and Progression

    CERN Document Server

    Prisecaru, V I

    2004-01-01

    A new approach to the integration of results from a modular, complex biological systems analysis of nonlinear dynamics in cell cycling network transformations that are leading to carcinogenesis is proposed. Carcinogenesis is a complex process that involves dynamically inter-connected biomolecules in the intercellular, membrane, cytosolic, nuclear and nucleolar compartments that form numerous inter-related pathways referred to as networks. One such network module contains the cell cyclins whose functions are essential to cell cycling and division. Cyclins are proteins that also link to several critical pro-apoptotic and other cell cycling/division components, such as: c-Myc, p27, the tumor suppressor gene TP53 and its product-- the p53 protein with key roles in controlling DNA repair, inducing apoptosis and activating p21 (which can depress cell cyclins if activated), mdm2(with its biosynthesis activated by p53 and also, in its turn, inhibiting p53), p21, the Thomsen-Friedenreich antigen(T- antigen),Rb,Bax, Ba...

  12. Molecular mechanism of X-ray-induced p53-dependent apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

    1999-03-01

    Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

  13. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  14. Antigen-specific immunotherapy in ovarian cancer and p53 as tumor antigen

    NARCIS (Netherlands)

    Vermeij, Renee; Leffers, Ninke; Melief, Cornelis J.; Daemen, Toos; Nijman, Hans W.

    This review discusses the results of different immunization strategies, identifies possible drawbacks in study design and provides potential solutions for augmentation of clinical efficacy. A potential target for cancer immunotherapy is p53, as approximately 50% of ovarian cancer cells carry p53

  15. Cytotoxic T lymphocyte responses in allogeneic radiation bone marrow chimeras. The chimeric host strictly dictates the self-repertoire of Ia-restricted T cells but not H-2K/D-restricted T cells

    International Nuclear Information System (INIS)

    Bradley, S.M.; Kruisbeek, A.M.; Singer, A.

    1982-01-01

    The present report has used fully H-2 allogeneic radiation bone marrow chimeras to assess the role of host restriction elements in determining the self-specificity of Ia- and H-2K/D-restricted T cells that participate in the generation of trinitrophenyl (TNP)-specific cytotoxic T lymphocytes (CTL). It was demonstrated that there exists a stringent requirement for the recognition of host thymic-type Ia determinants, but there exists only a preference for host thymic-type H-2K/D determinants. Indeed, once the stringent requirement for recognition of host Ia determinants was fulfilled, anti-TNP CTL were generated in response to TNP-modified stimulators that expressed either donor-type or host-type H-2K/D determinants. The CTL that were generated in response to TNP-modified donor-type stimulators were shown to be specific for TNP and restricted to the non-thymic H-2K/D determinants of the chimeric donor. Thus, these results demonstrate in a single immune response that the thymic hypothesis accurately predicts the self-specificity expressed by Ia-restricted T cells, but does not fully account for the self-specificity expressed by H-2K/D-restricted T cells. These results are consistent with the concept that H-2K/D-restricted T cells, but not Ia-restricted T cells, can differentiate into functional competence either intrathymically or extra-thymically. The results demonstrate that the generation of anti-TNP CTL responses involve two parallel sets of major histocompatibility complex-restricted cell interactions, an Ia-restricted TH-accessory cell interaction required for TH cell activation, and an H-2K/D-restricted pCTL-stimulator cell interaction required for pCTL stimulation. The interaction between activated TH cells and stimulated pCTL is mediated, at least in part, by nonspecific soluble helper factors

  16. Emulsified phosphatidylserine, simple and effective peptide carrier for induction of potent epitope-specific T cell responses.

    Science.gov (United States)

    Ichihashi, Toru; Satoh, Toshifumi; Sugimoto, Chihiro; Kajino, Kiichi

    2013-01-01

    To induce potent epitope-specific T cell immunity by a peptide-based vaccine, epitope peptides must be delivered efficiently to antigen-presenting cells (APCs) in vivo. Therefore, selecting an appropriate peptide carrier is crucial for the development of an effective peptide vaccine. In this study, we explored new peptide carriers which show enhancement in cytotoxic T lymphocyte (CTL) induction capability. Data from an epitope-specific in vivo CTL assay revealed that phosphatidylserine (PS) has a potent adjuvant effect among candidate materials tested. Further analyses showed that PS-conjugated antigens were preferentially and efficiently captured by professional APCs, in particular, by CD11c(+)CD11b(+)MHCII(+) conventional dendritic cells (cDCs) compared to multilamellar liposome-conjugates or unconjugated antigens. In addition, PS demonstrated the stimulatory capacity of peptide-specific helper T cells in vivo. This work indicates that PS is the easily preparable efficient carrier with a simple structure that delivers antigen to professional APCs effectively and induce both helper and cytotoxic T cell responses in vivo. Therefore, PS is a promising novel adjuvant for T cell-inducing peptide vaccines.

  17. Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

    Science.gov (United States)

    Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

    2016-01-01

    Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

  18. BRCA1 Expression is an Important Biomarker for Chemosensitivity: Suppression of BRCA1 Increases the Apoptosis via Up-regulation of p53 and p21 During Cisplatin Treatment in Ovarian Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ikuo Konishi

    2006-01-01

    Full Text Available BRCA1 is a tumor suppressor which plays a crucial role in the repair of DNA double-strand breaks, and its abnormality is responsible for hereditary ovarian cancer syndrome. It has recently been reported that reduced expression of BRCA1 is also common in sporadic ovarian carcinoma via its promoter hypermethylation, and that ovarian carcinoma patients negative for BRCA1 expression showed favorable prognosis. To address if BRCA1 expression plays a role in the chemotherapeutic response, we analyzed the effect of BRCA1 suppression on the sensitivity to cisplatin and paclitaxel in ovarian cancer cells. Specific siRNA for BRCA1 gene was transfected into 3 ovarian cancer cell lines with various p53 status. Reduced expression of BRCA1 by transfection of BRCA1-siRNA resulted in a 5.3-fold increase in sensitivity to cisplatin in p53-wild A2780 cells, but not in p53-mutated A2780/CDDP and p53-deleted SKOV3 cells. Regarding the sensitivity to paclitaxel, BRCA1 suppression caused no significant changes in all the 3 cell lines. For ionizing radiation sensitivity, BRCA1 suppression also showed a significant higher sensitivity in A2780 cells. Growth curve and cell cycle analyses showed no signifi cant differences between BRCA1-siRNA-transfected A2780 cells and control cells. However, cisplatin treatment under suppression of BRCA1 showed a significantly increased apoptosis along with up-regulation of p53 and p21 in A2780 cells. Accordingly, reduced expression of BRCA1 enhances the cisplatin sensitivity and apoptosis via up-regulation of p53 and p21, but does not affect the paclitaxel sensitivity. Expression of BRCA1 might be an important biomarker for cisplatin resistance in ovarian carcinoma.

  19. Role of DNA mismatch repair and p53 in signaling induction of apoptosis by alkylating agents.

    Science.gov (United States)

    Hickman, M J; Samson, L D

    1999-09-14

    All cells are unavoidably exposed to chemicals that can alkylate DNA to form genotoxic damage. Among the various DNA lesions formed, O(6)-alkylguanine lesions can be highly cytotoxic, and we recently demonstrated that O(6)-methylguanine (O(6)MeG) and O(6)-chloroethylguanine (O(6)CEG) specifically initiate apoptosis in hamster cells. Here we show, in both hamster and human cells, that the MutSalpha branch of the DNA mismatch repair pathway (but not the MutSbeta branch) is absolutely required for signaling the initiation of apoptosis in response to O(6)MeGs and is partially required for signaling apoptosis in response to O(6)CEGs. Further, O(6)MeG lesions signal the stabilization of the p53 tumor suppressor, and such signaling is also MutSalpha-dependent. Despite this, MutSalpha-dependent apoptosis can be executed in a p53-independent manner. DNA mismatch repair status did not influence the response of cells to other inducers of p53 and apoptosis. Thus, it appears that mismatch repair status, rather than p53 status, is a strong indicator of the susceptibility of cells to alkylation-induced apoptosis. This experimental system will allow dissection of the signal transduction events that couple a specific type of DNA base lesion with the final outcome of apoptotic cell death.

  20. Enhancement of P53-Mutant Human Colorectal Cancer Cells Radiosensitivity by Flavonoid Fisetin

    International Nuclear Information System (INIS)

    Chen Wenshu; Lee Yijang; Yu Yichu; Hsaio Chinghui

    2010-01-01

    Purpose: The aim of this study was to investigate whether fisetin is a potential radiosensitizer for human colorectal cancer cells, which are relatively resistant to radiotherapy. Methods and Materials: Cell survival was examined by clonogenic survival assay, and DNA fragmentation was assessed by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling assay. The effects of treatments on cell cycle distribution and apoptosis were examined by flow cytometry. Western blot analysis was performed to ascertain the protein levels of γ-H2AX, phospho-Chk2, active caspase-3, PARP cleavage, phospho-p38, phospho-AKT, and phospho-ERK1/2. Results: Fisetin pretreatment enhanced the radiosensitivity of p53-mutant HT-29 human colorectal cancer cells but not human keratocyte HaCaT cells; it also prolonged radiation-induced G 2 /M arrest, enhanced radiation-induced cell growth arrest in HT-29 cells, and suppressed radiation-induced phospho-H2AX (Ser-139) and phospho-Chk2 (Thr-68) in p53-mutant HT-29 cells. Pretreatment with fisetin enhanced radiation-induced caspase-dependent apoptosis in HT-29 cells. Fisetin pretreatment augmented radiation-induced phosphorylation of p38 mitogen-activated protein kinase, which is involved in caspase-mediated apoptosis, and SB202190 significantly reduced apoptosis and radiosensitivity in fisetin-pretreated HT-29 cells. By contrast, both phospho-AKT and phospho-ERK1/2, which are involved in cell proliferation and antiapoptotic pathways, were suppressed after irradiation combined with fisetin pretreatment. Conclusions: To our knowledge, this study is the first to provide evidence that fisetin exerts a radiosensitizing effect in p53-mutant HT-29 cells. Fisetin could potentially be developed as a novel radiosensitizer against radioresistant human cancer cells.

  1. Distinct modulation of allergic T cell responses by subcutaneous versus sublingual allergen-specific immunotherapy

    DEFF Research Database (Denmark)

    Schulten, Véronique; Tripple, Victoria; Andersen, Kristian Aasbjerg

    2016-01-01

    mechanisms involved have not been fully explored. OBJECTIVE: To compare changes in the allergen-specific T cell response induced by subcutaneous versus sublingual administration of allergen-specific immunotherapy (AIT). METHODS: Grass pollen allergic patients were randomized into groups receiving either SCIT...... injections, or SLIT tablets or neither. PBMC were tested for Timothy grass (TG)-specific cytokine production by ELISPOT after in vitro expansion with TG peptide pools. Phenotypic characterization of cytokine producing cells was performed by FACS. RESULTS: In the SCIT group, decreased IL-5 production...

  2. Vaccination of B-CLL patients with autologous dendritic cells can change the frequency of leukemia antigen-specific CD8+ T cells as well as CD4+CD25+FoxP3+ regulatory T cells toward an antileukemia response.

    Science.gov (United States)

    Hus, I; Schmitt, M; Tabarkiewicz, J; Radej, S; Wojas, K; Bojarska-Junak, A; Schmitt, A; Giannopoulos, K; Dmoszyńska, A; Roliński, J

    2008-05-01

    Recently, we described that vaccination with allogeneic dendritic cells (DCs) pulsed with tumor cell lysate generated specific CD8+ T cell response in patients with B-cell chronic lymphocytic leukemia (B-CLL). In the present study, the potential of autologous DCs pulsed ex vivo with tumor cell lysates to stimulate antitumor immunity in patients with B-CLL in early stages was evaluated. Twelve patients at clinical stage 0-2 as per Rai were vaccinated intradermally up to eight times with a mean number of 7.4 x 10(6) DCs pulsed with B-CLL cell lysate. We observed a decrease of peripheral blood leukocytes and CD19+/CD5+ leukemic cells in five patients, three patients showed a stable disease and four patients progressed despite DC vaccination. A significant increase of specific cytotoxic CD8+ T lymphocytes against the leukemia-associated antigens RHAMM or fibromodulin was detected in four patients after DC vaccination. In patients with a clinical response, an increase of interleukin 12 (IL-12) serum levels and a decrease of the frequency of CD4+CD25(+)FOXP3+ T regulatory cells were observed. Taken together, the study demonstrated that vaccination with autologous DC in CLL patients is feasible and safe. Immunological and to some extend hematological responses could be noted, justifying further investigation on this immunotherapeutical approach.

  3. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    Science.gov (United States)

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  4. P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

    Energy Technology Data Exchange (ETDEWEB)

    Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

    2002-03-01

    The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

  5. Enrofloxacin enhances the effects of chemotherapy in canine osteosarcoma cells with mutant and wild-type p53.

    Science.gov (United States)

    York, D; Withers, S S; Watson, K D; Seo, K W; Rebhun, R B

    2017-09-01

    Adjuvant chemotherapy improves survival time in dogs receiving adequate local control for appendicular osteosarcoma, but most dogs ultimately succumb to metastatic disease. The fluoroquinolone antibiotic enrofloxacin has been shown to inhibit survival and proliferation of canine osteosarcoma cells in vitro. Others have reported that fluoroquinolones may modulate cellular responses to DNA damaging agents and that these effects may be differentially mediated by p53 activity. We therefore determined p53 status and activity in three canine osteosarcoma cell lines and examined the effects of enrofloxacin when used alone or in combination with doxorubicin or carboplatin chemotherapy. Moresco and Abrams canine osteosarcoma cell lines contained mutations in p53, while no mutations were identified in the D17 cells or in a normal canine osteoblast cell line. The addition of enrofloxacin to either doxorubicin or carboplatin resulted in further reductions in osteosarcoma cell viability; this effect was apparent regardless of p53 mutational status or downstream activity. © 2016 John Wiley & Sons Ltd.

  6. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    Science.gov (United States)

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  7. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  8. Polyfunctional analysis of Gag and Nef specific CD8+ T-cell responses in HIV-1 infected Indian individuals.

    Science.gov (United States)

    Mendiratta, Sanjay; Vajpayee, Madhu; Mojumdar, Kamalika; Chauhan, Neeraj K; Sreenivas, Vishnubhatla

    2011-02-01

    Polyfunctional CD8+ T-cells have been described as most competent in controlling viral replication. We studied the impact of antigen persistence on the polyfunctional immune responses of CD8+ T-lymphocytes to HIV Gag and Nef peptides and polyclonal stimuli in 40 ART naïve HIV infected individuals and analyzed the alterations in T-cell functionality in early and late stages of infection. Significantly elevated level of global response and polyfunctional profile of CD8+ T-cells were observed to polyclonal stimulation, than HIV specific antigens in chronically infected individuals. However no key differences were observed in CD8+ T-cell functional profile in any of the 15 unique subsets for Gag and Nef specific antigens. The subjects in early stage of infection (defined as a gap of 6 months or less between seroconversion and enrolment and with no apparent clinical symptoms) had a higher degree of response functionality (4+ or 3+ different functions simultaneously) than in the late stage infection (defined as time duration since seroconversion greater than 6 months). The data suggest that persistence of antigen during chronic infection leads to functional impairment of HIV specific responses. Copyright © 2010 Elsevier Ltd. All rights reserved.

  9. A synthetic interaction screen identifies factors selectively required for proliferation and TERT transcription in p53-deficient human cancer cells.

    Directory of Open Access Journals (Sweden)

    Li Xie

    Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.

  10. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Programmed Death-1 expression on Epstein Barr virus specific CD8+ T cells varies by stage of infection, epitope specificity, and T-cell receptor usage.

    Directory of Open Access Journals (Sweden)

    Thomas C Greenough

    Full Text Available BACKGROUND: Programmed Death-1 (PD-1 is an inhibitory member of the CD28 family of molecules expressed on CD8+ T cells in response to antigenic stimulation. To better understand the role of PD-1 in antiviral immunity we examined the expression of PD-1 on Epstein-Barr virus (EBV epitope-specific CD8+ T cells during acute infectious mononucleosis (AIM and convalescence. METHODOLOGY/PRINCIPAL FINDINGS: Using flow cytometry, we observed higher frequencies of EBV-specific CD8+ T cells and higher intensity of PD-1 expression on EBV-specific CD8+ T cells during AIM than during convalescence. PD-1 expression during AIM directly correlated with viral load and with the subsequent degree of CD8+ T cell contraction in convalescence. Consistent differences in PD-1 expression were observed between CD8+ T cells with specificity for two different EBV lytic antigen epitopes. Similar differences were observed in the degree to which PD-1 was upregulated on these epitope-specific CD8+ T cells following peptide stimulation in vitro. EBV epitope-specific CD8+ T cell proliferative responses to peptide stimulation were diminished during AIM regardless of PD-1 expression and were unaffected by blocking PD-1 interactions with PD-L1. Significant variability in PD-1 expression was observed on EBV epitope-specific CD8+ T cell subsets defined by V-beta usage. CONCLUSIONS/SIGNIFICANCE: These observations suggest that PD-1 expression is not only dependent on the degree of antigen presentation, but also on undefined characteristics of the responding cell that segregate with epitope specificity and V-beta usage.

  12. Single-cell multiplexed cytokine profiling of CD19 CAR-T cells reveals a diverse landscape of polyfunctional antigen-specific response.

    Science.gov (United States)

    Xue, Qiong; Bettini, Emily; Paczkowski, Patrick; Ng, Colin; Kaiser, Alaina; McConnell, Timothy; Kodrasi, Olja; Quigley, Máire F; Heath, James; Fan, Rong; Mackay, Sean; Dudley, Mark E; Kassim, Sadik H; Zhou, Jing

    2017-11-21

    It remains challenging to characterize the functional attributes of chimeric antigen receptor (CAR)-engineered T cell product targeting CD19 related to potency and immunotoxicity ex vivo, despite promising in vivo efficacy in patients with B cell malignancies. We employed a single-cell, 16-plex cytokine microfluidics device and new analysis techniques to evaluate the functional profile of CD19 CAR-T cells upon antigen-specific stimulation. CAR-T cells were manufactured from human PBMCs transfected with the lentivirus encoding the CD19-BB-z transgene and expanded with anti-CD3/anti-CD28 coated beads. The enriched CAR-T cells were stimulated with anti-CAR or control IgG beads, stained with anti-CD4 RPE and anti-CD8 Alexa Fluor 647 antibodies, and incubated for 16 h in a single-cell barcode chip (SCBC). Each SCBC contains ~12,000 microchambers, covered with a glass slide that was pre-patterned with a complete copy of a 16-plex antibody array. Protein secretions from single CAR-T cells were captured and subsequently analyzed using proprietary software and new visualization methods. We demonstrate a new method for single-cell profiling of CD19 CAR-T pre-infusion products prepared from 4 healthy donors. CAR-T single cells exhibited a marked heterogeneity of cytokine secretions and polyfunctional (2+ cytokine) subsets specific to anti-CAR bead stimulation. The breadth of responses includes anti-tumor effector (Granzyme B, IFN-γ, MIP-1α, TNF-α), stimulatory (GM-CSF, IL-2, IL-8), regulatory (IL-4, IL-13, IL-22), and inflammatory (IL-6, IL-17A) functions. Furthermore, we developed two new bioinformatics tools for more effective polyfunctional subset visualization and comparison between donors. Single-cell, multiplexed, proteomic profiling of CD19 CAR-T product reveals a diverse landscape of immune effector response of CD19 CAR-T cells to antigen-specific challenge, providing a new platform for capturing CAR-T product data for correlative analysis. Additionally, such high

  13. Predictive effect of p53 and p21 alteration on chemotherapy response and survival in locally advanced adenocarcinoma of the esophagus

    NARCIS (Netherlands)

    Heeren, PAM; Kloppenberg, FWH; Hollema, H; Mulder, NH; Nap, RE; Plukker, JTM

    2004-01-01

    Background: Cell cycle regulating proteins (p53/p21) and proliferation index Ki-67 have been associated with prognosis and response to chemotherapy. The aim of this study was to determine the significance of these molecular markers on tumor response and prognostic effect in a group of esophageal

  14. Role of p53 status in radiation sensitivity and cell cycle progression

    International Nuclear Information System (INIS)

    Zellars, Richard C.; Loney, Tania; Schott, Ann F.; Davis, Mary A.; Maybaum, Jonathan; Clarke, Michael F.; Lawrence, Theodore S.

    1995-01-01

    Purpose: Although p53 function plays a major role in G1 arrest after radiation, the influence of p53 status on progress through other phases of the cell cycle and on radiation sensitivity of human tumors is less clear. We investigated these issues using cells with a conditional expression system for wild type p53. Methods: A temperature sensitive murine wild type p53 plasmid was used (Ginsberg D, et al: Mol. Cell.Biol . 11:582, 1991). At the permissive temperature (32 deg. C), this plasmid produces a protein which assumes a conformation that exhibits wild type p53 function. However, when cells are cultured at 38 deg. C, this protein assumes an inactive conformation. HT29 human colon cancer cells (which are p53 mutant) were transduced with this plasmid (designated PEP A and PEP G cells) or a control vector (designated CCH1 cells) using electroporation and Geneticin selection. The presence of murine p53 transcript in the PEP cells was confirmed by Northern analysis. Results: Cells were cultured under 3 conditions: 1) 38 deg. C at all times; 2) 32 deg. C for 24 hours prior to irradiation and 3) 32 deg. C for 24 hours after irradiation. We found that culturing under permissive temperatures produced a small decrease in surviving fraction in the PEP clones (0.61 ± 0.10 and 0.64 ± 0.07, for PEP A and G, respectively) but not the CCH1 controls (1.14 ± 0.15). PEP cells tended to be more radiosensitive than CCH1 cells (even under non-permissive conditions) and demonstrated a trend towards increased radiosensitivity under both Conditions 2 and 3. In addition, flow cytometry revealed that a 24 hour exposure to permissive conditions increased the fraction of cells in G1 slightly and in G2/M substantially. S phase was almost absent. Conclusion: Restoration of p53 function in HT29 human colon cancer cells using this temperature sensitive system produced increased cytotoxicity and radiation sensitivity as well as cell cycle redistribution. It will be important to assess the

  15. Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

    Science.gov (United States)

    Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

    2008-07-01

    We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

  16. Regulatory function of cytomegalovirus-specific CD4+CD27-CD28- T cells

    International Nuclear Information System (INIS)

    Tovar-Salazar, Adriana; Patterson-Bartlett, Julie; Jesser, Renee; Weinberg, Adriana

    2010-01-01

    CMV infection is characterized by high of frequencies of CD27 - CD28 - T cells. Here we demonstrate that CMV-specific CD4 + CD27 - CD28 - cells are regulatory T cells (T R ). CD4 + CD27 - CD28 - cells sorted from CMV-stimulated PBMC of CMV-seropositive donors inhibited de novo CMV-specific proliferation of autologous PBMC in a dose-dependent fashion. Compared with the entire CMV-stimulated CD4 + T-cell population, higher proportions of CD4 + CD27 - CD28 - T R expressed FoxP3, TGFβ, granzyme B, perforin, GITR and PD-1, lower proportions expressed CD127 and PD1-L and similar proportions expressed CD25, CTLA4, Fas-L and GITR-L. CMV-CD4 + CD27 - CD28 - T R expanded in response to IL-2, but not to CMV antigenic restimulation. The anti-proliferative effect of CMV-CD4 + CD27 - CD28 - T R significantly decreased after granzyme B or TGFβ inhibition. The CMV-CD4 + CD27 - CD28 - T R of HIV-infected and uninfected donors had similar phenotypes and anti-proliferative potency, but HIV-infected individuals had higher proportions of CMV-CD4 + CD27 - CD28 - T R . The CMV-CD4 + CD27 - CD28 - T R may contribute to the downregulation of CMV-specific and nonspecific immune responses of CMV-infected individuals.

  17. Tumor-specific CD4+ T cells develop cytotoxic activity and eliminate virus-induced tumor cells in the absence of regulatory T cells.

    Science.gov (United States)

    Akhmetzyanova, Ilseyar; Zelinskyy, Gennadiy; Schimmer, Simone; Brandau, Sven; Altenhoff, Petra; Sparwasser, Tim; Dittmer, Ulf

    2013-02-01

    The important role of tumor-specific cytotoxic CD8(+) T cells is well defined in the immune control of the tumors, but the role of effector CD4(+) T cells is poorly understood. In the current research, we have used a murine retrovirus-induced tumor cell line of C57BL/6 mouse origin, namely FBL-3 cells, as a model to study basic mechanisms of immunological control and escape during tumor formation. This study shows that tumor-specific CD4(+) T cells are able to protect against virus-induced tumor cells. We show here that there is an expansion of tumor-specific CD4(+) T cells producing cytokines and cytotoxic molecule granzyme B (GzmB) in the early phase of tumor growth. Importantly, we demonstrate that in vivo depletion of regulatory T cells (Tregs) and CD8(+) T cells in FBL-3-bearing DEREG transgenic mice augments IL-2 and GzmB production by CD4(+) T cells and increases FV-specific CD4(+) T-cell effector and cytotoxic responses leading to the complete tumor regression. Therefore, the capacity to reject tumor acquired by tumor-reactive CD4(+) T cells largely depends on the direct suppressive activity of Tregs. We suggest that a cytotoxic CD4(+) T-cell immune response may be induced to enhance resistance against oncovirus-associated tumors.

  18. Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wild-type p53-derived peptide

    DEFF Research Database (Denmark)

    Röpke, M; Hald, J; Guldberg, Per

    1996-01-01

    p53 genes, in a L9V/HLA-A2 specific and restricted fashion. Thus, the normal tolerance against endogenously processed p53 protein-derived self-epitopes can be broken by peptide-specific in vitro priming. p53 protein-derived wild-type peptides might thus represent tumor associated target molecules...

  19. Ubiquitin specific peptidase 5 mediates Histidine-rich protein Hpn induced cell apoptosis in hepatocellular carcinoma through P14-P53 signaling.

    Science.gov (United States)

    Liu, Yi; Wang, Wei-Mao; Zou, Li-Yi; Li, Li; Feng, Lu; Pan, Ming-Zhu; Lv, Min-Yi; Cao, Ying; Wang, Hua; Kung, Hsiang-Fu; Pang, Jian-Xin; Fu, Wei-Ming; Zhang, Jin-Fang

    2017-06-01

    Hpn is a small histidine-rich cytoplasmic protein from Helicobacter pylori and has been recognized as a high-risk factor for several cancers including gastric cancer, colorectal cancer, and MALT lymphoma. However, the relationship between Hpn and cancers remains elusive. In this study, we discovered that Hpn protein effectively suppressed cell growth and induced apoptosis in hepatocellular carcinoma (HCC). A two-dimensional gel electrophoresis and mass spectrometry-based comparative proteomics was performed to find the molecular targets of Hpn in HCC cells. It was identified that twelve proteins were differentially expressed, with USP5 being one of the most significantly downregulated protein. The P14 ARF -P53 signaling was activated by USP5 knockdown in HCC cells. Furthermore, USP5 overexpression significantly rescued the suppressive effect of Hpn on the viability of HCC cells. In conclusion, our study suggests that Hpn plays apoptosis-inducing roles through suppressing USP5 expression and activating the P14 ARF -P53 signaling. Therefore, Hpn may be a potential candidate for developing novel anti-HCC drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  1. p53 is involved in clearance of ionizing radiation-induced RAD51 foci in a human colon cancer cell line

    International Nuclear Information System (INIS)

    Orre, Lukas M.; Stenerloew, Bo; Dhar, Sumeer; Larsson, Rolf; Lewensohn, Rolf; Lehtioe, Janne

    2006-01-01

    We have investigated p53-related differences in cellular response to DNA damaging agents, focusing on p53s effects on RAD51 protein level and sub-cellular localization post exposure to ionizing radiation. In a human colon cancer cell line, HCT116 and its isogenic p53-/- subcell line we show here p53-independent RAD51 foci formation but interestingly the resolution of RAD51 foci showed clear p53 dependence. In p53 wt cells, but not in p53-/- cells, RAD51 protein level decreased 48 h post irradiation and fluorescence immunostaining showed resolution of RAD51 foci and relocalization of RAD51 to nucleoli at time points corresponding to the decrease in RAD51 protein level. Both cell lines rejoined DNA double strand breaks efficiently with similar kinetics and p53 status did not influence sensitivity to DNA damaging agents. We suggest that p53 has a role in RAD51 clearance post DSB repair and that nucleoli might be sites of RAD51 protein degradation

  2. Induction of Interleukin-10 Producing Dendritic Cells As a Tool to Suppress Allergen-Specific T Helper 2 Responses

    Directory of Open Access Journals (Sweden)

    Stefan Schülke

    2018-03-01

    Full Text Available Dendritic cells (DCs are gatekeepers of the immune system that control induction and polarization of primary, antigen-specific immune responses. Depending on their maturation/activation status, the molecules expressed on their surface, and the cytokines produced DCs have been shown to either elicit immune responses through activation of effector T cells or induce tolerance through induction of either T cell anergy, regulatory T cells, or production of regulatory cytokines. Among the cytokines produced by tolerogenic DCs, interleukin 10 (IL-10 is a key regulatory cytokine limiting und ultimately terminating excessive T-cell responses to microbial pathogens to prevent chronic inflammation and tissue damage. Because of their important role in preventing autoimmune diseases, transplant rejection, allergic reactions, or in controlling chronic inflammation DCs have become an interesting tool to modulate antigen-specific immune responses. For the treatment of allergic inflammation, the aim is to downregulate allergen-specific T helper 2 (Th2 responses and the associated clinical symptoms [allergen-driven Th2 activation, Th2-driven immunoglobulin E (IgE production, IgE-mediated mast cell and basophil activation, allergic inflammation]. Here, combining the presentation of allergens by DCs with a pro-tolerogenic, IL-10-producing phenotype is of special interest to modulate allergen-specific immune responses in the treatment of allergic diseases. This review discusses the reported strategies to induce DC-derived IL-10 secretion for the suppression of allergen-specific Th2-responses with a focus on IL-10 treatment, IL-10 transduction, and the usage of both whole bacteria and bacteria-derived components. Interestingly, while IL-10-producing DCs induced either by IL-10 treatment or IL-10 transduction are arrested in an immature/semi-mature state, treatment of DCs with live or killed bacteria as well as isolated bacterial components results in the induction of

  3. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  4. Emulsified phosphatidylserine, simple and effective peptide carrier for induction of potent epitope-specific T cell responses.

    Directory of Open Access Journals (Sweden)

    Toru Ichihashi

    Full Text Available BACKGROUND: To induce potent epitope-specific T cell immunity by a peptide-based vaccine, epitope peptides must be delivered efficiently to antigen-presenting cells (APCs in vivo. Therefore, selecting an appropriate peptide carrier is crucial for the development of an effective peptide vaccine. In this study, we explored new peptide carriers which show enhancement in cytotoxic T lymphocyte (CTL induction capability. METHODOLOGY/PRINCIPAL FINDINGS: Data from an epitope-specific in vivo CTL assay revealed that phosphatidylserine (PS has a potent adjuvant effect among candidate materials tested. Further analyses showed that PS-conjugated antigens were preferentially and efficiently captured by professional APCs, in particular, by CD11c(+CD11b(+MHCII(+ conventional dendritic cells (cDCs compared to multilamellar liposome-conjugates or unconjugated antigens. In addition, PS demonstrated the stimulatory capacity of peptide-specific helper T cells in vivo. CONCLUSIONS/SIGNIFICANCE: This work indicates that PS is the easily preparable efficient carrier with a simple structure that delivers antigen to professional APCs effectively and induce both helper and cytotoxic T cell responses in vivo. Therefore, PS is a promising novel adjuvant for T cell-inducing peptide vaccines.

  5. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae

    1999-01-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  6. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)

    1999-03-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  7. Cytokine production but lack of proliferation in peripheral blood mononuclear cells from chronic Chagas' disease cardiomyopathy patients in response to T. cruzi ribosomal P proteins.

    Directory of Open Access Journals (Sweden)

    Silvia A Longhi

    2014-06-01

    Full Text Available BACKGROUND: Trypanosoma cruzi ribosomal P proteins, P2β and P0, induce high levels of antibodies in patients with chronic Chagas' disease Cardiomyopathy (CCC. It is well known that these antibodies alter the beating rate of cardiomyocytes and provoke apoptosis by their interaction with β1-adrenergic and M2-muscarinic cardiac receptors. Based on these findings, we decided to study the cellular immune response to these proteins in CCC patients compared to non-infected individuals. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated proliferation, presence of surface activation markers and cytokine production in peripheral blood mononuclear cells (PBMC stimulated with P2β, the C-terminal portion of P0 (CP0 proteins and T. cruzi lysate from CCC patients predominantly infected with TcVI lineage. PBMC from CCC patients cultured with P2β or CP0 proteins, failed to proliferate and express CD25 and HLA-DR on T cell populations. However, multiplex cytokine assays showed that these antigens triggered higher secretion of IL-10, TNF-α and GM-CSF by PBMC as well as both CD4+ and CD8+ T cells subsets of CCC subjects. Upon T. cruzi lysate stimulation, PBMC from CCC patients not only proliferated but also became activated within the context of Th1 response. Interestingly, T. cruzi lysate was also able to induce the secretion of GM-CSF by CD4+ or CD8+ T cells. CONCLUSIONS/SIGNIFICANCE: Our results showed that although the lack of PBMC proliferation in CCC patients in response to ribosomal P proteins, the detection of IL-10, TNF-α and GM-CSF suggests that specific T cells could have both immunoregulatory and pro-inflammatory potential, which might modulate the immune response in Chagas' disease. Furthermore, it was possible to demonstrate for the first time that GM-CSF was produced by PBMC of CCC patients in response not only to recombinant ribosomal P proteins but also to parasite lysate, suggesting the value of this cytokine to evaluate T cells responses in T

  8. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  9. The p53 inhibitor, pifithrin-α, suppresses self-renewal of embryonic stem cells

    International Nuclear Information System (INIS)

    Abdelalim, Essam Mohamed; Tooyama, Ikuo

    2012-01-01

    Highlights: ► We determine the role of p53 in ES cells under unstressful conditions. ► PFT-α suppresses ES cell proliferation. ► PFT-α induces ES cell cycle arrest. ► PFT-α downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-α, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-α resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-α caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  10. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522 (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  11. Peptide immunisation of HLA-DR-transgenic mice permits the identification of a novel HLA-DRbeta1*0101- and HLA-DRbeta1*0401-restricted epitope from p53.

    Science.gov (United States)

    Rojas, José Manuel; McArdle, Stephanie E B; Horton, Roger B V; Bell, Matthew; Mian, Shahid; Li, Geng; Ali, Selman A; Rees, Robert C

    2005-03-01

    Because of the central role of CD4(+) T cells in antitumour immunity, the identification of the MHC class II-restricted peptides to which CD4(+) T cells respond has become a priority of tumour immunologists. Here, we describe a strategy permitting us to rapidly determine the immunogenicity of candidate HLA-DR-restricted peptides using peptide immunisation of HLA-DR-transgenic mice, followed by assessment of the response in vitro. This strategy was successfully applied to the reported haemaglutinin influenza peptide HA(307-319), and then extended to three candidate HLA-DR-restricted p53 peptides predicted by the evidence-based algorithm SYFPEITHI to bind to HLA-DRbeta1*0101 (HLA-DR1) and HLA-DRbeta1*0401 (HLA-DR4) molecules. One of these peptides, p53(108-122), consistently induced responses in HLA-DR1- and in HLA-DR4-transgenic mice. Moreover, this peptide was naturally processed by dendritic cells (DCs), and induced specific proliferation in the splenocytes of mice immunised with p53 cDNA, demonstrating that immune responses could be naturally mounted to the peptide. Furthermore, p53(108-122) peptide was also immunogenic in HLA-DR1 and HLA-DR4 healthy donors. Thus, the use of this transgenic model permitted the identification of a novel HLA-DR-restricted epitope from p53 and constitutes an attractive approach for the rapid identification of novel immunogenic MHC class II-restricted peptides from tumour antigens, which can ultimately be incorporated in immunotherapeutic protocols.

  12. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    Directory of Open Access Journals (Sweden)

    Zanatta Daniela B

    2010-06-01

    Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

  13. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    International Nuclear Information System (INIS)

    Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

    2010-01-01

    Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

  14. ZFAT plays critical roles in peripheral T cell homeostasis and its T cell receptor-mediated response

    International Nuclear Information System (INIS)

    Doi, Keiko; Fujimoto, Takahiro; Okamura, Tadashi; Ogawa, Masahiro; Tanaka, Yoko; Mototani, Yasumasa; Goto, Motohito; Ota, Takeharu; Matsuzaki, Hiroshi; Kuroki, Masahide; Tsunoda, Toshiyuki; Sasazuki, Takehiko; Shirasawa, Senji

    2012-01-01

    Highlights: ► We generated Cd4-Cre-mediated T cell-specific Zfat-deficient mice. ► Zfat-deficiency leads to reduction in the number of the peripheral T cells. ► Impaired T cell receptor-mediated response in Zfat-deficient peripheral T cells. ► Decreased expression of IL-7Rα, IL-2Rα and IL-2 in Zfat-deficient peripheral T cells. ► Zfat plays critical roles in peripheral T cell homeostasis. -- Abstract: ZFAT, originally identified as a candidate susceptibility gene for autoimmune thyroid disease, has been reported to be involved in apoptosis, development and primitive hematopoiesis. Zfat is highly expressed in T- and B-cells in the lymphoid tissues, however, its physiological function in the immune system remains totally unknown. Here, we generated the T cell-specific Zfat-deficient mice and demonstrated that Zfat-deficiency leads to a remarkable reduction in the number of the peripheral T cells. Intriguingly, a reduced expression of IL-7Rα and the impaired responsiveness to IL-7 for the survival were observed in the Zfat-deficient T cells. Furthermore, a severe defect in proliferation and increased apoptosis in the Zfat-deficient T cells following T cell receptor (TCR) stimulation was observed with a reduced IL-2Rα expression as well as a reduced IL-2 production. Thus, our findings reveal that Zfat is a critical regulator in peripheral T cell homeostasis and its TCR-mediated response.

  15. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  16. CD6 and Linker of Activated T Cells are Potential Interaction Partners for T Cell-Specific Adaptor Protein.

    Science.gov (United States)

    Hem, C D; Ekornhol, M; Granum, S; Sundvold-Gjerstad, V; Spurkland, A

    2017-02-01

    The T cell-specific adaptor protein (TSAd) contains several protein interaction domains, and is merging as a modulator of T cell activation. Several interaction partners for the TSAd proline-rich region and phosphotyrosines have been identified, including the Src and Tec family kinases lymphocyte-specific protein tyrosine kinase and interleukin 2-inducible T cell kinase. Via its Src homology 2 (SH2) domain, TSAd may thus function as a link between these enzymes and other signalling molecules. However, few binding partners to the TSAd SH2 domain in T cells are hitherto known. Through the use of in silico ligand prediction, peptide spot arrays, pull-down and immunoprecipitation experiments, we here report novel interactions between the TSAd SH2 domain and CD6 phosphotyrosine (pTyr) 629 and linker of activated T cells (LAT) pTyr 171 , pTyr 191 and pTyr 226 . © 2016 The Foundation for the Scandinavian Journal of Immunology.

  17. Cell surface area and membrane folding in glioblastoma cell lines differing in PTEN and p53 status.

    Directory of Open Access Journals (Sweden)

    Simon Memmel

    Full Text Available Glioblastoma multiforme (GBM is characterized by rapid growth, invasion and resistance to chemo-/radiotherapy. The complex cell surface morphology with abundant membrane folds, microvilli, filopodia and other membrane extensions is believed to contribute to the highly invasive behavior and therapy resistance of GBM cells. The present study addresses the mechanisms leading to the excessive cell membrane area in five GBM lines differing in mutational status for PTEN and p53. In addition to scanning electron microscopy (SEM, the membrane area and folding were quantified by dielectric measurements of membrane capacitance using the single-cell electrorotation (ROT technique. The osmotic stability and volume regulation of GBM cells were analyzed by video microscopy. The expression of PTEN, p53, mTOR and several other marker proteins involved in cell growth and membrane synthesis were examined by Western blotting. The combined SEM, ROT and osmotic data provided independent lines of evidence for a large variability in membrane area and folding among tested GBM lines. Thus, DK-MG cells (wild type p53 and wild type PTEN exhibited the lowest degree of membrane folding, probed by the area-specific capacitance C m = 1.9 µF/cm(2. In contrast, cell lines carrying mutations in both p53 and PTEN (U373-MG and SNB19 showed the highest C m values of 3.7-4.0 µF/cm(2, which corroborate well with their heavily villated cell surface revealed by SEM. Since PTEN and p53 are well-known inhibitors of mTOR, the increased membrane area/folding in mutant GBM lines may be related to the enhanced protein and lipid synthesis due to a deregulation of the mTOR-dependent downstream signaling pathway. Given that membrane folds and extensions are implicated in tumor cell motility and metastasis, the dielectric approach presented here provides a rapid and simple tool for screening the biophysical cell properties in studies on targeting chemo- or radiotherapeutically the

  18. P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors

    International Nuclear Information System (INIS)

    Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.

    1999-01-01

    Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy

  19. Prognostic value of p53 mutations in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji [Showa Univ., Tokyo (Japan). School of Medicine

    2001-05-01

    A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)

  20. Prognostic value of p53 mutations in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy

    International Nuclear Information System (INIS)

    Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji

    2001-01-01

    A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)

  1. A negative regulation loop of long noncoding RNA HOTAIR and p53 in non-small-cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zhai N

    2016-09-01

    Full Text Available Nailiang Zhai,1 Yongfu Xia,1 Rui Yin,2 Jinping Liu,3 Fuquan Gao1 1Department of Respiratory Medicine, Affiliated Hospital of Binzhou Medical University, 2Department of Respiratory Medicine, People’s Hospital of Binzhou City, 3Department of Pharmacology, Binzhou Medical University, Binzhou, Shandong, People’s Republic of China Abstract: Non-small-cell lung cancer (NSCLC is one of the leading causes of cancer-related death worldwide, and the 5-year survival rate is still low despite advances in diagnosis and therapeutics. A long noncoding RNA (lncRNA HOX antisense intergenic RNA (HOTAIR has been revealed to play important roles in NSCLC carcinogenesis but the detailed mechanisms are still unclear. In the current study, we aimed to investigate the regulation between the lncRNA HOTAIR and p53 in the NSCLC patient samples and cell lines. Our results showed that HOTAIR expression was significantly higher in the cancer tissues than that in the adjacent normal tissue, and was negatively correlated with p53 functionality rather than expression. When p53 was overexpressed in A549 cells, the lncRNA HOTAIR expression was downregulated, and the cell proliferation rate and cell invasion capacity decreased as a consequence. We identified two binding sites of p53 on the promoter region of HOTAIR, where the p53 protein would bind to and suppress the HOTAIR mRNA transcription. Inversely, overexpression of lncRNA HOTAIR inhibited the expression of p53 in A549 cells. Mechanistic studies revealed that HOTAIR modified the promoter of p53 and enhanced histone H3 lysine 27 trimethylation (H3K27me3. These studies identified a specific negative regulation loop of lncRNA HOTAIR and p53 in NSCLC cells, which revealed a new understanding of tumorigenesis in p53 dysfunction NSCLC cells. Keywords: NSCLC, LncRNA HOTAIR, p53, negative loop

  2. Effects of recombinant plasmid pEgr-p53 transfected stably in combination with X-irradiation on cell cycle progression and proliferation in human SKOV-3 tumor cells in vitro

    International Nuclear Information System (INIS)

    Dong Lihua; Liu Feng; Li Yanbo; Fu Shibo; Gong Shouliang

    2008-01-01

    Objective: To investigate the effect of recombinant plasmid pEgr-hp53 transfected stably in combination with X-ray irradiation on the cell cycle progression and the proliferation in human SKOV-3 tumor cells. Methods: pEgr-hp53 and pcDNA3.1 packaged with liposome were stably transfected into SKOV-3 cells in vitro. SKOV-3-hp53 and SKOV-3-vect were irradiated with 0, 0.5, 2.0 and 5.0 Gy X-rays, respectively, i.e. 8 experimental groups. The SKOV-3 cell proliferation and the cell cycle progression were measured with flow cytometry and cell growth curve, respectively. Results: Compared with 0 Gy group, the cell counts in SKOV-3- hp53 plus different doses of irradiation groups 2 d after irradiation decreased significantly (P 0 /G 1 cells increased significantly (P 2 /M cells decreased in varying degrees. The cell counts in SKOV-3-hp53 plus irradiation group were significantly lower than those in corresponding SKOV-3-vect plus irradiation group, the cell counts 4-8 d after irradiation with 0.5 Gy, 2 d after 2.0 Gy irradiation and 6 d after 5.0 Gy irradiation decreased significantly (P 0 /G 1 cells increased significantly (P 2 /M cells decreased significantly (P 1 arrest in SKOV-3 cells and inhibits the cell proliferation. Ionizing radiation can activate early growth response-1 (Egr-1) gene promoter and increase the expression of p53 gene, and enhance the inhibition of tumor cell growth. (authors)

  3. Vaccination Expands Antigen-Specific CD4+ Memory T Cells and Mobilizes Bystander Central Memory T Cells

    Science.gov (United States)

    Li Causi, Eleonora; Parikh, Suraj C.; Chudley, Lindsey; Layfield, David M.; Ottensmeier, Christian H.; Stevenson, Freda K.; Di Genova, Gianfranco

    2015-01-01

    CD4+ T helper memory (Thmem) cells influence both natural and vaccine-boosted immunity, but mechanisms for their maintenance remain unclear. Pro-survival signals from the common gamma-chain cytokines, in particular IL-7, appear important. Previously we showed in healthy volunteers that a booster vaccination with tetanus toxoid (TT) expanded peripheral blood TT-specific Thmem cells as expected, but was accompanied by parallel increase of Thmem cells specific for two unrelated and non cross-reactive common recall antigens. Here, in a new cohort of healthy human subjects, we compare blood vaccine-specific and bystander Thmem cells in terms of differentiation stage, function, activation and proliferative status. Both responses peaked 1 week post-vaccination. Vaccine-specific cytokine-producing Thmem cells were predominantly effector memory, whereas bystander cells were mainly of central memory phenotype. Importantly, TT-specific Thmem cells were activated (CD38High HLA-DR+), cycling or recently divided (Ki-67+), and apparently vulnerable to death (IL-7RαLow and Bcl-2 Low). In contrast, bystander Thmem cells were resting (CD38Low HLA-DR- Ki-67-) with high expression of IL-7Rα and Bcl-2. These findings allow a clear distinction between vaccine-specific and bystander Thmem cells, suggesting the latter do not derive from recent proliferation but from cells mobilized from as yet undefined reservoirs. Furthermore, they reveal the interdependent dynamics of specific and bystander T-cell responses which will inform assessments of responses to vaccines. PMID:26332995

  4. Caspase Activation and Aberrant Cell Growth in a p53+/+ Cell Line from a Li-Fraumeni Syndrome Family

    Directory of Open Access Journals (Sweden)

    Zaki A. Sherif

    2015-01-01

    Full Text Available Wild-type p53 is well known to induce cell cycle arrest and apoptosis to block aberrant cell growth. However, p53’s unique role in apoptosis and cell proliferation in Li-Fraumeni Syndrome (LFS has not been well elucidated. The aim of this study is to characterize the activity of wild-type p53 protein in LFS family dominated by a germline negative mutant p53. As expected, etoposide-treated wild-type p53-containing cell lines, LFS 2852 and control Jurkat, showed a greater rate of caspase- and annexin V-induced apoptotic cell death compared to the p53-mutant LFS 2673 cell line although mitochondrial and nuclear assays could not detect apoptosis in these organelles. The most intriguing part of the observation was the abnormal proliferation rate of the wild-type p53-containing cell line, which grew twice as fast as 2673 and Jurkat cells. This is important because apoptosis inducers acting through the mitochondrial death pathway are emerging as promising drugs against tumors where the role of p53 is not only to target gene regulation but also to block cell proliferation. This study casts a long shadow on the possible dysregulation of p53 mediators that enable cell proliferation. The deregulation of proliferation pathways represents an important anticancer therapeutic strategy for patients with the LFS phenotype.

  5. Association of Neisseria gonorrhoeae Opa(CEA with dendritic cells suppresses their ability to elicit an HIV-1-specific T cell memory response.

    Directory of Open Access Journals (Sweden)

    Qigui Yu

    Full Text Available Infection with Neisseria gonorrhoeae (N. gonorrhoeae can trigger an intense local inflammatory response at the site of infection, yet there is little specific immune response or development of immune memory. Gonococcal surface epitopes are known to undergo antigenic variation; however, this is unlikely to explain the weak immune response to infection since individuals can be re-infected by the same serotype. Previous studies have demonstrated that the colony opacity-associated (Opa proteins on the N. gonorrhoeae surface can bind human carcinoembryonic antigen-related cellular adhesion molecule 1 (CEACAM1 on CD4⁺ T cells to suppress T cell activation and proliferation. Interesting in this regard, N. gonorrhoeae infection is associated with impaired HIV-1 (human immunodeficiency virus type 1-specific cytotoxic T-lymphocyte (CTL responses and with transient increases in plasma viremia in HIV-1-infected patients, suggesting that N. gonorrhoeae may also subvert immune responses to co-pathogens. Since dendritic cells (DCs are professional antigen presenting cells (APCs that play a key role in the induction of an adaptive immune response, we investigated the effects of N. gonorrhoeae Opa proteins on human DC activation and function. While morphological changes reminiscent of DC maturation were evident upon N. gonorrhoeae infection, we observed a marked downregulation of DC maturation marker CD83 when the gonococci expressing CEACAM1-specific Opa(CEA, but not other Opa variants. Consistent with a gonococcal-induced defect in maturation, Opa(CEA binding to CEACAM1 reduced the DCs' capacity to stimulate an allogeneic T cell proliferative response. Moreover, Opa(CEA-expressing N. gonorrhoeae showed the potential to impair DC-dependent development of specific adaptive immunity, since infection with Opa(CEA-positive gonococci suppressed the ability of DCs to stimulate HIV-1-specific memory CTL responses. These results reveal a novel mechanism to explain

  6. Global Assessment of Dengue Virus-Specific CD4+ T Cell Responses in Dengue-Endemic Areas

    Directory of Open Access Journals (Sweden)

    Alba Grifoni

    2017-10-01

    Full Text Available BackgroundDengue is a major public health problem worldwide. Assessment of adaptive immunity is important to understanding immunopathology and to define correlates of protection against dengue virus (DENV. To enable global assessment of CD4+ T cell responses, we mapped HLA-DRB1-restricted DENV-specific CD4+ T cell epitopes in individuals previously exposed to DENV in the general population of the dengue-endemic region of Managua, Nicaragua.MethodsHLA class II epitopes in the population of Managua were identified by an in vitro IFNγ ELISPOT assay. CD4+ T cells purified by magnetic bead negative selection were stimulated with HLA-matched epitope pools in the presence of autologous antigen-presenting cells, followed by pool deconvolution to identify specific epitopes. The epitopes identified in this study were combined with those previously identified in the DENV endemic region of Sri Lanka, to generate a “megapool” (MP consisting of 180 peptides specifically designed to achieve balanced HLA and DENV serotype coverage. The DENV CD4MP180 was validated by intracellular cytokine staining assays.ResultsWe detected responses directed against a total of 431 epitopes, representing all 4 DENV serotypes, restricted by 15 different HLA-DRB1 alleles. The responses were associated with a similar pattern of protein immunodominance, overall higher magnitude of responses, as compared to what was observed previously in the Sri Lanka region. Based on these epitope mapping studies, we designed a DENV CD4 MP180 with higher and more consistent coverage, which allowed the detection of CD4+ T cell DENV responses ex vivo in various cohorts of DENV exposed donors worldwide, including donors from Nicaragua, Brazil, Singapore, Sri Lanka, and U.S. domestic flavivirus-naïve subjects immunized with Tetravalent Dengue Live-Attenuated Vaccine (TV005. This broad reactivity reflects that the 21 HLA-DRB1 alleles analyzed in this and previous studies account for more than 80

  7. p53 expression in biopsies from children with Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik

    2002-01-01

    based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

  8. Strategy for eliciting antigen-specific CD8+ T cell-mediated immune response against a cryptic CTL epitope of merkel cell polyomavirus large T antigen

    Directory of Open Access Journals (Sweden)

    Gomez Bianca P

    2012-10-01

    Full Text Available Abstract Background Merkel cell carcinoma (MCC is a relatively new addition to the expanding category of oncovirus-induced cancers. Although still comparably rare, the number of cases has risen dramatically in recent years. Further complicating this trend is that MCC is an extremely aggressive neoplasm with poor patient prognosis and limited treatment options for advanced disease. The causative agent of MCC has been identified as the merkel cell polyomavirus (MCPyV. The MCPyV-encoded large T (LT antigen is an oncoprotein that is theorized to be essential for virus-mediated tumorigenesis and is therefore, an excellent MCC antigen for the generation of antitumor immune responses. As a foreign antigen, the LT oncoprotein avoids the obstacle of immune tolerance, which normally impedes the development of antitumor immunity. Ergo, it is an excellent target for anti-MCC immunotherapy. Since tumor-specific CD8+ T cells lead to better prognosis for MCC and numerous other cancers, we have generated a DNA vaccine that is capable of eliciting LT-specific CD8+ T cells. The DNA vaccine (pcDNA3-CRT/LT encodes the LT antigen linked to a damage-associated molecular pattern, calreticulin (CRT, as it has been demonstrated that the linkage of CRT to antigens promotes the induction of antigen-specific CD8+ T cells. Results The present study shows that DNA vaccine-induced generation of LT-specific CD8+ T cells is augmented by linking CRT to the LT antigen. This is relevant since the therapeutic effects of the pcDNA3-CRT/LT DNA vaccine is mediated by LT-specific CD8+ T cells. Mice vaccinated with the DNA vaccine produced demonstrably more LT-specific CD8+ T cells. The DNA vaccine was also able to confer LT-specific CD8+ T cell-mediated protective and therapeutic effects to prolong the survival of mice with LT-expressing tumors. In the interest of determining the LT epitope which most MCC-specific CD8+ T cells recognize, we identified the amino acid sequence of the

  9. Ki-67 expression reveals strong, transient influenza specific CD4 T cell responses after adult vaccination

    OpenAIRE

    Li, Xi; Miao, Hongyu; Henn, Alicia; Topham, David J.; Wu, Hulin; Zand, Martin S.; Mosmann, Tim R.

    2012-01-01

    Although previous studies have found minimal changes in CD4 T cell responses after vaccination of adults with trivalent inactivated influenza vaccine, daily sampling and monitoring of the proliferation marker Ki-67 have now been used to reveal that a substantial fraction of influenza-specific CD4 T cells respond to vaccination. At 4–6 days after vaccination, there is a sharp rise in the numbers of Ki-67-expressing PBMC that produce IFNγ, IL-2 and/or TNFα in vitro in response to influenza vacc...

  10. Replication-deficient mutant Herpes Simplex Virus-1 targets professional antigen presenting cells and induces efficient CD4+ T helper responses.

    Science.gov (United States)

    Fiorentini, Simona; Marconi, Peggy; Avolio, Manuela; Marini, Elena; Garrafa, Emirena; Caracciolo, Sonia; Rossi, Daniele; Bozac, Alexandra; Becker, Pablo D; Gentili, Francesca; Facchetti, Fabio; Guzman, Carlos A; Manservigi, Roberto; Caruso, Arnaldo

    2007-07-01

    Both neutralizing antibodies and cytotoxic T-cells are necessary to control a viral infection. However, vigorous T helper responses are essential for their elicitation and maintenance. Here we show that a recombinant replication-deficient Herpes Simplex Virus (HSV)-1 vector encoding the Human Immunodeficiency Virus (HIV)-1 matrix protein p17 (T0-p17) was capable of infecting professional antigen presenting cells (APCs) in vitro and in vivo. The injection of T0-p17 in the mouse dermis generated a strong p17-specific CD4+ T helper response preceding both p17-specific humoral and effector T cell responses. Moreover, we show that T0-p17 infection did not interfere with the endogenous processing of the transgene encoded antigen, since infected APCs were able to evoke a strong recall response in vitro. Our results demonstrate that replication-deficient HSV vectors can be appealing candidates for the development of vaccines able to trigger T helper responses.

  11. Determining T-cell specificity to understand and treat disease

    DEFF Research Database (Denmark)

    Hadrup, Sine Reker; Newell, Evan W.

    2017-01-01

    Adaptive immune responses and immunopathogeneses are based on the ability of T cells to respond to specific antigens. Consequently, understanding T-cell recognition patterns in health and disease involves studying the complexity and genetic heterogeneity of the antigen recognition pathway, which...

  12. Interactions between Exosomes from Breast Cancer Cells and Primary Mammary Epithelial Cells Leads to Generation of Reactive Oxygen Species Which Induce DNA Damage Response, Stabilization of p53 and Autophagy in Epithelial Cells

    Science.gov (United States)

    Dutta, Sujoy; Warshall, Case; Bandyopadhyay, Chirosree; Dutta, Dipanjan; Chandran, Bala

    2014-01-01

    Exosomes are nanovesicles originating from multivesicular bodies and are released by all cell types. They contain proteins, lipids, microRNAs, mRNAs and DNA fragments, which act as mediators of intercellular communications by inducing phenotypic changes in recipient cells. Tumor-derived exosomes have been shown to play critical roles in different stages of tumor development and metastasis of almost all types of cancer. One of the ways by which exosomes affect tumorigenesis is to manipulate the tumor microenvironments to create tumor permissive “niches”. Whether breast cancer cell secreted exosomes manipulate epithelial cells of the mammary duct to facilitate tumor development is not known. To address whether and how breast cancer cell secreted exosomes manipulate ductal epithelial cells we studied the interactions between exosomes isolated from conditioned media of 3 different breast cancer cell lines (MDA-MB-231, T47DA18 and MCF7), representing three different types of breast carcinomas, and normal human primary mammary epithelial cells (HMECs). Our studies show that exosomes released by breast cancer cell lines are taken up by HMECs, resulting in the induction of reactive oxygen species (ROS) and autophagy. Inhibition of ROS by N-acetyl-L-cysteine (NAC) led to abrogation of autophagy. HMEC-exosome interactions also induced the phosphorylation of ATM, H2AX and Chk1 indicating the induction of DNA damage repair (DDR) responses. Under these conditions, phosphorylation of p53 at serine 15 was also observed. Both DDR responses and phosphorylation of p53 induced by HMEC-exosome interactions were also inhibited by NAC. Furthermore, exosome induced autophagic HMECs were found to release breast cancer cell growth promoting factors. Taken together, our results suggest novel mechanisms by which breast cancer cell secreted exosomes manipulate HMECs to create a tumor permissive microenvironment. PMID:24831807

  13. Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell-independent cytotoxic T cell responses to soluble proteins.

    Science.gov (United States)

    Sparwasser, T; Vabulas, R M; Villmow, B; Lipford, G B; Wagner, H

    2000-12-01

    Receptors for conserved molecular patterns associated with microbial pathogens induce synthesis of co-stimulatory molecules and cytokines in immature dendritic cells (DC), as do antigen-reactive CD4 T helper cells via CD40 signaling. Once activated, antigen-presenting DC may activate CD8 T cell responses in a T helper cell-independent fashion. Using immunostimulatory CpG-oligonucleotides (ODN) mimicking bacterial CpG-DNA, we tested whether CpG-DNA bypasses the need for T helper cells in CTL responses towards proteins by directly activating antigen-presenting DC to transit into professional APC. We describe that immature DC in situ constitutively process soluble proteins and generate CD8 T cell determinants yet CD8 T cell responses remain abortive. Induction of primary antigen-specific CD8 cytotoxic T lymphocyte (CTL)-mediated responses becomes initiated in wild-type as well as T helper cell-deficient mice, provided soluble protein and CpG-ODN are draining into the same lymph node. Specifically we show that CpG-ODN trigger antigen-presenting immature DC within the draining lymph node to acutely up-regulate co-stimulatory molecules and produce IL-12. These results provide new insights for generating in vivo efficient CTL responses to soluble proteins which may influence vaccination strategies.

  14. Estradiol agonists inhibit human LoVo colorectal-cancer cell proliferation and migration through p53.

    Science.gov (United States)

    Hsu, Hsi-Hsien; Kuo, Wei-Wen; Ju, Da-Tong; Yeh, Yu-Lan; Tu, Chuan-Chou; Tsai, Ying-Lan; Shen, Chia-Yao; Chang, Sheng-Huang; Chung, Li-Chin; Huang, Chih-Yang

    2014-11-28

    To investigate the effects of 17β-estradiol via estrogen receptors (ER) or direct administration of ER agonists on human colorectal cancer. LoVo cells were established from the Bioresource Collection and Research Center and cultured in phenol red-free DMEM (Sigma, United States). To investigate the effects of E2 and/or ER selective agonists on cellular proliferation, LoVo colorectal cells were treated with E2 or ER-selective agonists for 24 h and 48 h and subjected to the MTT (Sigma) assay to find the concentration. And investigate the effects of E2 and/or ER selective agonists on cell used western immunoblotting to find out the diversification of signaling pathways. In order to observe motility and migration the wound healing assay and a transwell chamber (Neuro Probe) plate were tased. For a quantitative measure, we counted the number of migrating cells to the wound area post-wounding for 24 h. We further examined the cellular migration-regulating factors urokinase-type plasminogen activator (u-PA), tissue-type plasminogen activator (t-PA) and matrix metalloproteinase (MMP)-9 in human LoVo cells so gelatin zymography that we used and gelatinolytic activity was visualized by Coomassie blue staining. And these results are presented as means ± SE, and statistical comparisons were made using Student's t-test. The structure was first compared with E2 and ER agonists. We then treated the LoVo cells with E2 and ER agonists (10(-8) mol/L) for 24 h and 48 h and subsequently measured the cell viability using MTT assay. Our results showed that treatment with 17β-estradiol and/or ER agonists in human LoVo colorectal cancer cells activated p53 and then up-regulated p21 and p27 protein levels, subsequently inhibiting the downstream target gene, cyclin D1, which regulates cell proliferation. Taken together, our findings demonstrate the anti-tumorigenesis effects of 17β-estradiol and/or ER agonists and suggest that these compounds may prove to be a potential alternative

  15. Zingiber officinale, Piper retrofractum and Combination Induced Apoptosis and p53 Expression in Myeloma and WiDr Cell Lines

    Directory of Open Access Journals (Sweden)

    HENY EKOWATI

    2012-09-01

    Full Text Available In previous studies, Zingiber officinale, Piper retrofractum, and the combination showed cytotoxic activity, induced apoptosis, and p53 expression of HeLa, T47D, and MCF-7 cell lines. This study was conducted to investigate the cytotoxic and apoptotic activity of Zingiber officinale (ZO, Piper retrofractum (PR, and the combination as well as their effect to p53 expression on Myeloma and WiDr cells. The powder of ZO, PR, and ZO + PR combination (1:1 were macerated with 96% ethanol for 3 x 24 hours. MTT cytotoxic assay was performed on Myeloma and WiDr cell lines. Apoptotic cells were stained with ethidium bromide and acridine orange. Imunohistochemical expression of p53 was examined on Myeloma and WiDr cell lines. Doxorubicin was used as positive control in all assays. Results showed that ZO, PR, and ZO + PR combination had cytotoxic activity on Myeloma cells with IC50 of 28, 36, and 55 mg/ml respectively and WiDr cell lines with IC50 of 74, 158, and 64 mg/ml respectively, induced apoptotic activity, and increased p53 expression on Myeloma and WiDr cells. These results suggest that ZO, PR, and their combination induced Myeloma and WiDr cells in apoptosis through p53 expression.

  16. The MDM2-inhibitor Nutlin-3 synergizes with cisplatin to induce p53 dependent tumor cell apoptosis in non-small cell lung cancer

    Science.gov (United States)

    Deben, Christophe; Wouters, An; de Beeck, Ken Op; van Den Bossche, Jolien; Jacobs, Julie; Zwaenepoel, Karen; Peeters, Marc; Van Meerbeeck, Jan; Lardon, Filip; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick

    2015-01-01

    The p53/MDM2 interaction has been a well-studied target for new drug design leading to the development of the small molecule inhibitor Nutlin-3. Our objectives were to combine Nutlin-3 with cisplatin (CDDP), a well-known activator of the p53 pathway, in a series of non-small cell lung cancer cell lines in order to increase the cytotoxic response to CDDP. We report that sequential treatment (CDDP followed by Nutlin-3), but not simultaneous treatment, resulted in strong synergism. Combination treatment induced p53's transcriptional activity, resulting in increased mRNA and protein levels of MDM2, p21, PUMA and BAX. In addition we report the induction of a strong p53 dependent apoptotic response and induction of G2/M cell cycle arrest. The strongest synergistic effect was observed at low doses of both CDDP and Nutlin-3, which could result in fewer (off-target) side effects while maintaining a strong cytotoxic effect. Our results indicate a promising preclinical potential, emphasizing the importance of the applied treatment scheme and the presence of wild type p53 for the combination of CDDP and Nutlin-3. PMID:26125230

  17. Frequent alteration of MDM2 and p53 in the molecular progression of recurring non-Hodgkin's lymphoma

    DEFF Research Database (Denmark)

    Møller, Michael Boe; Nielsen, O; Pedersen, Niels Tinggaard

    2002-01-01

    -Hodgkin's lymphoma. METHODS AND RESULTS: We have analysed sequential biopsies from 42 non-Hodgkin's lymphoma patients immunohistochemically for p53 alterations (based on p53 and p21Waf1 expression), as well as for expression of MDM2, p27Kip1 and cyclin D3. Relapse of follicle centre lymphoma was associated with p53...... alterations as 5/6 (83%) follicle centre lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. Of these cases, three showed transformation to diffuse large B-cell lymphoma. p53 alteration was also associated with relapse of de novo diffuse large B-cell lymphoma and T-cell non......-Hodgkin's lymphoma, as 2/5 (40%) diffuse large B-cell lymphomas and 3/9 (33%) T-cell non-Hodgkin's lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. No indolent non-Hodgkin's lymphoma case showed MDM2 over-expression at diagnosis, whereas 4/5 (80%) transformed diffuse large B-cell lymphomas...

  18. In Vitro Priming of Naı̈ve T-cells with p-Phenylenediamine and Bandrowski's Base.

    Science.gov (United States)

    Gibson, Andrew; Kim, Seung-Hyun; Faulkner, Lee; Evely, Jane; Pirmohamed, Munir; Park, Kevin B; Naisbitt, Dean J

    2015-10-19

    p-Phenylenediamine (PPD) is a component of hair dye formulations that is associated with T-cell mediated allergic contact dermatitis. Antigen-specific T-cells from allergic contact dermatitis patients are activated with either PPD or the oxidation product, Bandrowski's base. In nonallergic individuals, T-cells that are activated by Bandrowski's base, but not by PPD, are readily detectable. The aim of the current study was to use an in vitro T-cell priming assay to assess the activation of memory and naı̈ve T-cells from healthy donors with PPD and Bandrowski's base, and to compare these responses to those observed from allergic patients. Both PPD and Bandrowski's base-responsive clones were generated from allergic patients. The majority of Bandrowski's base-responsive clones were CD4+ and displayed a lack of PPD reactivity. In contrast, CD4+ and CD8+ clones displaying PPD reactivity were detected. Approximately 25% of these displayed low levels of reactivity to Bandrowski's base. Clones from the allergic patients secreted a range of cytokines including IFN-γ, Il-13, and Il-22. In healthy donors, Bandrowski's base-specific T-cell proliferative responses and cytokine secretion were detected with both naı̈ve and memory T-cells. T-cell clones generated from the Bandrowski's base-responsive cultures responded to Bandrowski's base but not PPD. PPD-specific naı̈ve and memory T-cell responses were not detected from healthy donors. These data show that Bandrowski's base stimulates pre-existing memory T-cells isolated from healthy donors and primes naı̈ve T-cells when the chemical is bound to autologous dendritic cells. Priming naı̈ve T-cells against PPD failed, suggesting an important individual susceptibility factor is missing from the in vitro T-cell priming assay.

  19. Delayed expression of apoptosis in X-irradiated human leukemic MOLT-4 cells transfected with mutant p53

    International Nuclear Information System (INIS)

    Nakano, Hisako; Yonekawa, Hiromichi; Shinohara, Kunio

    2003-01-01

    The effects of X-rays on cell survival, apoptosis, and long-term response in the development of cell death as measured by the dye exclusion test were studied in human leukemic MOLT-4 cells (p53 wild-type) stably transfected with a mutant p53 cDNA expression vector. Cell survival, as determined from colony-forming ability, was increased in an expression level dependent manner, but the increase was partial even with the highest-expressing clone (B3). This contrasts with the prior observation that cell death and apoptosis in B3 are completely inhibited at 24 h after irradiation with 1.8 Gy of X-rays. The examination of B3 cells incubated for longer than 24 h after X-irradiation showed a delay in the induction of cell death and apoptosis. Western blot analysis revealed that the time required to reach the highest level of wild-type p53 protein in B3 was longer than the time in MOLT-4 and that the p53 may be stabilized by the phosphorylation at Ser-15. These results suggest that the introduction of mutant p53 into MOLT-4 merely delays the development of apoptosis, during which the cells could repair the damage induced by X-rays, and results in the partial increase in cell survival. (author)

  20. T-cell response in human leishmaniasis

    DEFF Research Database (Denmark)

    Kharazmi, A; Kemp, K; Ismail, A

    1999-01-01

    In the present communication we provide evidence for the existence of a Th1/Th2 dichotomy in the T-cell response to Leishmania antigens in human leishmaniasis. Our data suggest that the pattern of IL-4 and IFN-gamma response is polarised in these patients. Lymphocytes from individuals recovered...... from cutaneous leishmaniasis (CL) responded by IFN-gamma production following stimulation with Leishmania antigens whereas cells from patients recovered from visceral leishmaniasis (VL) showed a mixed pattern of IFN-gamma and IL-4 responses. The cells producing these cytokines were predominantly CD4......+. Furthermore, IL-10 plays an important role in the development of post kala azar dermal leishmaniasis (PKDL) from VL. The balance between the parasitic-specific T-cell response plays an important regulatory role in determining the outcome of Leishmania infections in humans....

  1. Nicotine induces cell proliferation in association with cyclin D1 up-regulation and inhibits cell differentiation in association with p53 regulation in a murine pre-osteoblastic cell line

    International Nuclear Information System (INIS)

    Sato, Tsuyoshi; Abe, Takahiro; Nakamoto, Norimichi; Tomaru, Yasuhisa; Koshikiya, Noboru; Nojima, Junya; Kokabu, Shoichiro; Sakata, Yasuaki; Kobayashi, Akio; Yoda, Tetsuya

    2008-01-01

    Recent studies have suggested that nicotine critically affects bone metabolism. Many studies have examined the effects of nicotine on proliferation and differentiation, but the underlying molecular mechanisms remain unclear. We examined cell cycle regulators involved in the proliferation and differentiation of MC3T3-E1 cells. Nicotine induced cell proliferation in association with p53 down-regulation and cyclin D1 up-regulation. In differentiated cells, nicotine reduced alkaline phosphatase activity and mineralized nodule formation in dose-dependent manners. Furthermore, p53 expression was sustained in nicotine-treated cells during differentiation. These findings indicate that nicotine promotes the cell cycle and inhibits differentiation in association with p53 regulation in pre-osteoblastic cells

  2. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov

    2014-01-01

    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  3. Apoptosis, proliferation and p53, cyclin D1, and retinoblastoma gene expression in relation to radiation response in transitional cell carcinoma of the bladder

    International Nuclear Information System (INIS)

    Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry

    2001-01-01

    Purpose: To determine whether the apoptotic index, the Ki67 index, and the expression of the p53, cyclin D1, and retinoblastoma genes correlate with local control, overall survival, and time to distant metastases in invasive bladder cancer treated with external beam radiation. Methods and Materials: Paraffin-embedded pretreatment biopsies from 83 patients with invasive transitional cell carcinoma of the bladder were scored morphologically for apoptosis and immunohistochemically for Ki67, p53, cyclin D1, and retinoblastoma gene expression. Survival analysis methods were used to assess overall survival, local control, and freedom from distant metastases. A multiple proportional hazard (PH) regression analysis was performed to study the prognostic value of the above mentioned biologic parameters (all divided into two categories, except Ki67) in addition to classical prognostic factors such as T stage, histologic grade, multifocality of the tumor, and completeness of transurethral resection. All patients were treated with external beam radiation as sole treatment. Median follow-up for the 19 patients still living was 7.5 years. Results: Apoptotic index varied from 0% to 3.4% with a mean of 0.8% and a median of 0.6%. Ki67 index varied from 0% to 60% with a mean of 14% and a median of 12%. P53 protein was detectable in 61% of the tumors. Overexpression of cyclin D1 was observed in 39% of the tumors and loss of retinoblastoma protein in 23% of the tumors. High Ki67 index was found to be significantly associated with p53 expression (p=0.04) and cyclin D1 overexpression (p=0.023). Cyclin D1 overexpression was found more often in Rb-positive tumors than in Rb-negative tumors (p=0.006). Other associations between the markers are less clear. Biologic markers were not correlated with T stage or grade. In the PH analysis local control was found to be significantly better for tumors with wild-type p53 (p=0.028). Also, tumors with an apoptotic index above the median value (0

  4. ZFAT plays critical roles in peripheral T cell homeostasis and its T cell receptor-mediated response

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Keiko [Department of Cell Biology, Faculty of Medicine, Fukuoka University, Fukuoka (Japan); Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka (Japan); Central Research Institute of Life Sciences for the Next Generation of Women Scientists, Fukuoka University, Fukuoka (Japan); Fujimoto, Takahiro [Department of Cell Biology, Faculty of Medicine, Fukuoka University, Fukuoka (Japan); Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka (Japan); Okamura, Tadashi [Division of Animal Models, Department of Infectious Diseases, Research Institute, National Center for Global Health and Medicine, Tokyo (Japan); Ogawa, Masahiro [Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka (Japan); Tanaka, Yoko [Department of Cell Biology, Faculty of Medicine, Fukuoka University, Fukuoka (Japan); Mototani, Yasumasa; Goto, Motohito [Division of Animal Models, Department of Infectious Diseases, Research Institute, National Center for Global Health and Medicine, Tokyo (Japan); Ota, Takeharu; Matsuzaki, Hiroshi [Department of Cell Biology, Faculty of Medicine, Fukuoka University, Fukuoka (Japan); Kuroki, Masahide [Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka (Japan); Tsunoda, Toshiyuki [Department of Cell Biology, Faculty of Medicine, Fukuoka University, Fukuoka (Japan); Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka (Japan); Sasazuki, Takehiko [Institute for Advanced Study, Kyushu University, Fukuoka (Japan); Shirasawa, Senji, E-mail: sshirasa@fukuoka-u.ac.jp [Department of Cell Biology, Faculty of Medicine, Fukuoka University, Fukuoka (Japan); Central Research Institute for Advanced Molecular Medicine, Fukuoka University, Fukuoka (Japan)

    2012-08-17

    Highlights: Black-Right-Pointing-Pointer We generated Cd4-Cre-mediated T cell-specific Zfat-deficient mice. Black-Right-Pointing-Pointer Zfat-deficiency leads to reduction in the number of the peripheral T cells. Black-Right-Pointing-Pointer Impaired T cell receptor-mediated response in Zfat-deficient peripheral T cells. Black-Right-Pointing-Pointer Decreased expression of IL-7R{alpha}, IL-2R{alpha} and IL-2 in Zfat-deficient peripheral T cells. Black-Right-Pointing-Pointer Zfat plays critical roles in peripheral T cell homeostasis. -- Abstract: ZFAT, originally identified as a candidate susceptibility gene for autoimmune thyroid disease, has been reported to be involved in apoptosis, development and primitive hematopoiesis. Zfat is highly expressed in T- and B-cells in the lymphoid tissues, however, its physiological function in the immune system remains totally unknown. Here, we generated the T cell-specific Zfat-deficient mice and demonstrated that Zfat-deficiency leads to a remarkable reduction in the number of the peripheral T cells. Intriguingly, a reduced expression of IL-7R{alpha} and the impaired responsiveness to IL-7 for the survival were observed in the Zfat-deficient T cells. Furthermore, a severe defect in proliferation and increased apoptosis in the Zfat-deficient T cells following T cell receptor (TCR) stimulation was observed with a reduced IL-2R{alpha} expression as well as a reduced IL-2 production. Thus, our findings reveal that Zfat is a critical regulator in peripheral T cell homeostasis and its TCR-mediated response.

  5. Mir-34a mimics are potential therapeutic agents for p53-mutated and chemo-resistant brain tumour cells.

    Directory of Open Access Journals (Sweden)

    Yuen Ngan Fan

    Full Text Available Chemotherapeutic drug resistance and relapse remains a major challenge for paediatric (medulloblastoma and adult (glioblastoma brain tumour treatment. Medulloblastoma tumours and cell lines with mutations in the p53 signalling pathway have been shown to be specifically insensitive to DNA damaging agents. The aim of this study was to investigate the potential of triggering cell death in p53 mutated medulloblastoma cells by a direct activation of pro-death signalling downstream of p53 activation. Since non-coding microRNAs (miRNAs have the ability to fine tune the expression of a variety of target genes, orchestrating multiple downstream effects, we hypothesised that triggering the expression of a p53 target miRNA could induce cell death in chemo-resistant cells. Treatment with etoposide, increased miR-34a levels in a p53-dependent fashion and the level of miR-34a transcription was correlated with the cell sensitivity to etoposide. miR-34a activity was validated by measuring the expression levels of one of its well described target: the NADH dependent sirtuin1 (SIRT1. Whilst drugs directly targeting SIRT1, were potent to trigger cell death at high concentrations only, introduction of synthetic miR-34a mimics was able to induce cell death in p53 mutated medulloblastoma and glioblastoma cell lines. Our results show that the need of a functional p53 signaling pathway can be bypassed by direct activation of miR-34a in brain tumour cells.

  6. C/EBPβ represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf

    Science.gov (United States)

    Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC

    2013-01-01

    CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078

  7. Heterologous human/rat HER2-specific exosome-targeted T cell vaccine stimulates potent humoral and CTL responses leading to enhanced circumvention of HER2 tolerance in double transgenic HLA-A2/HER2 mice.

    Science.gov (United States)

    Xie, Yufeng; Wu, Jie; Xu, Aizhang; Ahmeqd, Shahid; Sami, Amer; Chibbar, Rajni; Freywald, Andrew; Zheng, Changyu; Xiang, Jim

    2018-03-07

    DNA vaccines composed of heterologous human HER2 and rat neu sequences induce stronger antibody response and protective antitumor immunity than either HER2 or neu DNA vaccines in transgenic mice. We previously developed HER2-specific exosome-targeted T-cell vaccine HER2-T EXO capable of stimulating HER2-specific CD8 + T-cell responses, but only leading to partial protective immunity in double-transgenic HLA-A2/HER2 mice with self-immune tolerance to HER2. Here, we constructed an adenoviral vector AdV HuRt expressing HuRt fusion protein composed of NH 2 -HER2 1-407 (Hu) and COOH-neu 408-690 (Rt) fragments, and developed a heterologous human/rat HER2-specific exosome-targeted T-cell vaccine HuRt-T EXO using polyclonal CD4 + T-cells uptaking exosomes released by AdV HuRt -transfected dendritic cells. We found that the HuRt-T EXO vaccine stimulates enhanced CD4 + T-cell responses leading to increased induction of HER2-specific antibody (∼70 µg/ml) compared to that (∼40 µg/ml) triggered by the homologous HER2-T EXO vaccine. By using PE-H-2K d /HER2 23-71 tetramer, we determined that HuRt-T EXO stimulates stronger HER2-specific CD8 + T-cell responses eradicating 90% of HER2-specific target cells, while HER2-T EXO -induced CD8 + T-cell responses only eliminating 53% targets. Furthermore, HuRt-T EXO , but not HER2-T EXO vaccination, is capable of suppressing early stage-established HER2-expressing 4T1 HER2 breast cancer in its lung metastasis or subcutaneous form in BALB/c mice, and of completely protecting transgenic HLA-A2/HER2 mice from growth of HLA-A2/HER2-expressing BL6-10 A2/HER2 melanoma. HuRt-T EXO -stimulated HER2-specific CD8 + T-cells not only are cytolytic to trastuzumab-resistant HLA-A2/HER2-expressing BT474/A2 breast tumor cells in vitro but also eradicates pre-established BT474/A2 tumors in athymic nude mice. Therefore, our novel heterologous human/rat HER2-specific T-cell vaccine HuRt-T EXO, circumventing HER2 tolerance, may provide a new

  8. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  9. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  10. HIV-specific CD8+ T cells: serial killers condemned to die?

    Science.gov (United States)

    Petrovas, Constantinos; Mueller, Yvonne M; Katsikis, Peter D

    2004-04-01

    An increasing body of evidence supports a key role for cytotoxic CD8+ T cells (CTL) in controlling HIV infection. Although a vigorous HIV-specific CD8+ T cell response is raised during the primary infection, these cells ultimately fail to control virus and prevent disease progression. The failure of CTL to control HIV infection has been attributed to a number of strategies HIV employs to evade the immune system. Recently, intrinsic defects in the CTL themselves have been proposed to contribute to the failure of CTL to control HIV. HIV-specific CD8+ T cells differ in their effector/memory phenotype from other virus-specific CD8+ T cells indicating that their differentiation status differs. This altered differentiation may affect effector functions as well as homing properties of these cells. Other studies have indicated that activation of HIV-specific CTL may be impaired and this contributes to their dysfunction. The effector function of these CTL may also be affected. There are conflicting reports about their ability to kill, whereas IFNgamma production does not appear to be impaired in these cells. In this review we focus on recent work indicating that apoptosis may be an important mechanism through which HIV evades the CTL response. In particular, HIV-specific CD8+ T cells are highly susceptible to CD95/Fas-induced apoptosis. This leads to the hypothesis that virus-specific cytotoxic T cells can be eliminated upon binding CD95L/FasL on HIV-infected cells. Understanding the intrinsic defects of CTL in HIV infection could lead to new therapeutic strategies and optimized vaccination protocols that enhance the HIV-specific cytotoxic response.

  11. Promoter hypermethylation of the DNA repair gene O(6)-methylguanine-DNA methyltransferase is associated with the presence of G:C to A:T transition mutations in p53 in human colorectal tumorigenesis.

    Science.gov (United States)

    Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G

    2001-06-15

    Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.

  12. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

  13. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    International Nuclear Information System (INIS)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd; Groesch, Sabine

    2008-01-01

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53 wt ) or being p(HCT-116 p53 -/- ), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53 -/- xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53 wt cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53 wt cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75 NTR , p53 and Bax

  14. G2-block after irradiation of cells with different p53 status

    International Nuclear Information System (INIS)

    Zoelzer, Friedo; Jagetia, Ganesh; Streffer, Christian

    2014-01-01

    Although it is clear that functional p53 is not required for radiation-induced G 2 block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G 2 compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G 2 phase itself. We observed the movement of BrdU-labeled cells through G 2 and M into G 1 . From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G 2 and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G 2 and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G 2 compartment alone is misleading when differences in the G 2 block are investigated and that the G 2 block itself is indeed independent of functional p53. (orig.) [de

  15. Ionizing radiation affects generation of MART-1-specific cytotoxic T cell responses by dendritic cells

    International Nuclear Information System (INIS)

    Liao, Y.P.; Wang, C.-C.; McBride, W.H.

    2003-01-01

    Full text: The human MART-1/Melan-A (MART-1) melanoma tumor antigen is known to be recognized by cytotoxic T lymphocytes (CTLs) and several groups are using this target for clinical immunotherapy. Most approaches use dendritic cells (DCs) that are potent antigen presentation cells for initiating CTL responses. In order for CTL recognition to occur, DCs must display 9-residue antigenic peptides on MHC class I molecules. These peptides are generated by proteasome degradation and then transported through the endoplasmic reticulum to the cell surface where they stabilize MHC class I expression. Our previous data showed that irradiation inhibits proteasome function and, therefore, we hypothesized that irradiation may inhibit antigen processing and CTL activation, as has been shown for proteasome inhibitors. To study the importance of irradiation effects on DCs, we studied the generation MART-1-specific CTL responses. Preliminary data showed that irradiation of murine bone marrow derived DCs did not affect expression of MHC class I, II, CD80, or CD86, as assessed by flow cytometric analyses 24-hour after irradiation. The effect of irradiation on MART-1 antigen processing by DCs was evaluated using DC transduced with adenovirus MART-1 (AdVMART1). C57BL/6 mice were immunized with AdVMART1 transduced DCs, with and without prior irradiation. IFN-γ production was measured by ELISPOT assays after 10-14 days of immunization. Prior radiation treatment resulted in a significant decrease in MART-1-specific T cell responses. The ability of irradiated and non-irradiated AdVMART1/DC vaccines to protect mice against growth of murine B16 tumors, which endogenously express murine MART-1, was also examined. AdVMART1/DC vaccination protected C57BL/6 mice against challenge with viable B16 melanoma cells while DCs irradiated (10 Gy) prior to AdVMART1 transduction abrogated protection. These results suggest that proteasome inhibition in DCs by irradiation may be a possible pathway in

  16. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  17. A Quantitative Analysis of Complexity of Human Pathogen-Specific CD4 T Cell Responses in Healthy M. tuberculosis Infected South Africans.

    Directory of Open Access Journals (Sweden)

    Cecilia S Lindestam Arlehamn

    2016-07-01

    Full Text Available We performed a quantitative analysis of the HLA restriction, antigen and epitope specificity of human pathogen specific responses in healthy individuals infected with M. tuberculosis (Mtb, in a South African cohort as a test case. The results estimate the breadth of T cell responses for the first time in the context of an infection and human population setting. We determined the epitope repertoire of eleven representative Mtb antigens and a large panel of previously defined Mtb epitopes. We estimated that our analytic methods detected 50-75% of the total response in a cohort of 63 individuals. As expected, responses were highly heterogeneous, with responses to a total of 125 epitopes detected. The 66 top epitopes provided 80% coverage of the responses identified in our study. Using a panel of 48 HLA class II-transfected antigen-presenting cells, we determined HLA class II restrictions for 278 epitope/donor recognition events (36% of the total. The majority of epitopes were restricted by multiple HLA alleles, and 380 different epitope/HLA combinations comprised less than 30% of the estimated Mtb-specific response. Our results underline the complexity of human T cell responses at a population level. Efforts to capture and characterize this broad and highly HLA promiscuous Mtb-specific T cell epitope repertoire will require significant peptide multiplexing efforts. We show that a comprehensive "megapool" of Mtb peptides captured a large fraction of the Mtb-specific T cells and can be used to characterize this response.

  18. Cdk5 phosphorylates non-genotoxically overexpressed p53 following inhibition of PP2A to induce cell cycle arrest/apoptosis and inhibits tumor progression

    Directory of Open Access Journals (Sweden)

    Kumari Ratna

    2010-07-01

    Full Text Available Abstract Background p53 is the most studied tumor suppressor and its overexpression may or may not cause cell death depending upon the genetic background of the cells. p53 is degraded by human papillomavirus (HPV E6 protein in cervical carcinoma. Several stress activated kinases are known to phosphorylate p53 and, among them cyclin dependent kinase 5 (Cdk5 is one of the kinase studied in neuronal cell system. Recently, the involvement of Cdk5 in phosphorylating p53 has been shown in certain cancer types. Phosphorylation at specific serine residues in p53 is essential for it to cause cell growth inhibition. Activation of p53 under non stress conditions is poorly understood. Therefore, the activation of p53 and detection of upstream kinases that phosphorylate non-genotoxically overexpressed p53 will be of therapeutic importance for cancer treatment. Results To determine the non-genotoxic effect of p53; Tet-On system was utilized and p53 inducible HPV-positive HeLa cells were developed. p53 overexpression in HPV-positive cells did not induce cell cycle arrest or apoptosis. However, we demonstrate that overexpressed p53 can be activated to upregulate p21 and Bax which causes G2 arrest and apoptosis, by inhibiting protein phosphatase 2A. Additionally, we report that the upstream kinase cyclin dependent kinase 5 interacts with p53 to phosphorylate it at Serine20 and Serine46 residues thereby promoting its recruitment on p21 and bax promoters. Upregulation and translocation of Bax causes apoptosis through intrinsic mitochondrial pathway. Interestingly, overexpressed activated p53 specifically inhibits cell-growth and causes regression in vivo tumor growth as well. Conclusion Present study details the mechanism of activation of p53 and puts forth the possibility of p53 gene therapy to work in HPV positive cervical carcinoma.

  19. Circulating rotavirus-specific T cells have a poor functional profile

    International Nuclear Information System (INIS)

    Parra, Miguel; Herrera, Daniel; Jácome, María Fernanda; Mesa, Martha C.; Rodríguez, Luz-Stella; Guzmán, Carolina; Angel, Juana; Franco, Manuel A.

    2014-01-01

    Frequencies of circulating T cells producing IFN-γ, TNF-α, and IL-2, and percentages of T cells proliferating after stimulation with rotavirus (RV), tetanus toxoid, and influenza were evaluated in PBMC derived from healthy adults and children. In addition, the potential anergic state of RV-specific T cells was analyzed by stimulation of PBMC with RV antigen in the presence of three anergy inhibitors (rIL-2, rIL-12, or DGKα-i). The quality and magnitude of RV-T cell responses were significantly lower than those of tetanus toxoid and influenza antigens. RV-CD4 T cell response was enriched in monofunctional IFN-γ + cells, while influenza-CD4 and tetanus toxoid-CD4 T cell responses were enriched in multifunctional T cells. Moreover, rIL-2 – unlike rIL-12 or DGKα-i – increased the frequencies of RV-CD4 TNF-α + , CD4 IFN-γ + , and CD8 IFN-γ + cells. Thus, circulating RV-T cells seem to have a relatively poor functional profile that may be partially reversed in vitro by the addition of rIL-2. - Highlights: • The quality and magnitude of circulating RV-T cell responses are relatively poor. • Circulating RV-CD4 T cells are enriched in monofunctional IFN-γ+ cells. • Treatment with rIL-2 increased the frequencies of cytokine secreting RV-T cells

  20. Changing T cell specificity by retroviral T cell receptor display

    NARCIS (Netherlands)

    Kessels, H. W.; van den Boom, M. D.; Spits, H.; Hooijberg, E.; Schumacher, T. N.

    2000-01-01

    The diversity of the T cell receptor (TCR) repertoire is limited, because of the processes of positive and negative T cell selection. To obtain T cells with specificities beyond the immune system's capacity, we have developed a strategy for retroviral TCR display. In this approach, a library of T

  1. A novel natural killer cell line (KHYG-1) from a patient with aggressive natural killer cell leukemia carrying a p53 point mutation.

    Science.gov (United States)

    Yagita, M; Huang, C L; Umehara, H; Matsuo, Y; Tabata, R; Miyake, M; Konaka, Y; Takatsuki, K

    2000-05-01

    We present the establishment of a natural killer (NK) leukemia cell line, designated KHYG-1, from the blood of a patient with aggressive NK leukemia, which both possessed the same p53 point mutation. The immunophenotype of the primary leukemia cells was CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16+, CD56+, CD57+ and HLA-DR+. A new cell line (KHYG-1) was established by culturing peripheral leukemia cells with 100 units of recombinant interleukin (IL)-2. The KHYG-1 cells showed LGL morphology with a large nucleus, coarse chromatin, conspicuous nucleoli, and abundant basophilic cytoplasm with many azurophilic granules. The immunophenotype of KHYG-1 cells was CD1-, CD2+, surface CD3-, cytoplasmic CD3epsilon+, CD7+, CD8alphaalpha+, CD16-, CD25-, CD33+, CD34-, CD56+, CD57-, CD122+, CD132+, and TdT-. Southern blot analysis of these cells revealed a normal germline configuration for the beta, delta, and gamma chains of the T cell receptor and the immunoglobulin heavy-chain genes. Moreover, the KHYG-1 cells displayed NK cell activity and IL-2-dependent proliferation in vitro, suggesting that they are of NK cell origin. Epstein-Barr virus (EBV) DNA was not detected in KHYG-1 cells by Southern blot analysis with a terminal repeat probe from an EBV genome. A point mutation in exon 7 of the p53 gene was detected in the KHYG-1 cells by PCR/SSCP analysis, and direct sequencing revealed the conversion of C to T at nucleotide 877 in codon 248. The primary leukemia cells also carried the same point mutation. Although the precise role of the p53 point mutation in leukemogenesis remains to be clarified, the establishment of an NK leukemia cell line with a p53 point mutation could be valuable in the study of leukemogenesis.

  2. Group 3 innate lymphoid cells mediate intestinal selection of commensal bacteria-specific CD4+ T cells

    Science.gov (United States)

    Hepworth, Matthew R.; Fung, Thomas C.; Masur, Samuel H.; Kelsen, Judith R.; McConnell, Fiona M.; Dubrot, Juan; Withers, David R.; Hugues, Stephanie; Farrar, Michael A.; Reith, Walter; Eberl, Gerard; Baldassano, Robert N.; Laufer, Terri M.; Elson, Charles O.; Sonnenberg, Gregory F.

    2015-01-01

    Inflammatory CD4+ T cell responses to self or commensal bacteria underlie the pathogenesis of autoimmunity and inflammatory bowel disease (IBD), respectively. While selection of self-specific T cells in the thymus limits responses to tissue antigens, the mechanisms that control selection of commensal bacteria-specific T cells remain poorly understood. Here we demonstrate that group 3 innate lymphoid cell (ILC3)-intrinsic expression of major histocompatibility complex class II (MHCII) is regulated similarly to thymic epithelial cells, and that MHCII+ ILC3s directly induce cell death of activated commensal bacteria-specific T cells. Further, MHCII on human colonic ILC3s was reduced in pediatric IBD patients. Collectively, these results define a selection pathway for commensal bacteria-specific CD4+ T cells in the intestine, and suggest that this process is dysregulated in human IBD. PMID:25908663

  3. Effect of p53 activation on cell growth, thymidine kinase-1 activity, and 3'-deoxy-3'fluorothymidine uptake

    International Nuclear Information System (INIS)

    Schwartz, Jeffrey L.; Tamura, Yasuko; Jordan, Robert; Grierson, John R.; Krohn, Kenneth A.

    2004-01-01

    The use of thymidine (TdR) and thymidine analogs such as 3'-deoxy-3'-fluorothymidine (FLT) as positron emission tomography (PET)-based tracers of tumor proliferation rate is based on the hypothesis that measurement of uptake of these nucleosides, a function primarily of thymidine kinase-1 (TK 1 ) activity, provides an accurate measure of cell proliferation in tumors. Tumor growth is influenced by many factors including the oxygen concentration within tumors and whether tumor cells have been exposed to cytotoxic therapies. The p53 gene plays an important role in regulating growth under both of these conditions. The goal of this study was to investigate the influence of p53 activation on cell growth, TK 1 activity, and FLT uptake. To accomplish this, TK 1 activity, S phase fraction, and the uptake of FLT were determined in plateau-phase and exponentially growing cultures of an isogenic pair of human tumor cell lines in which p53 expression was normal or inactivated by human papilloma virus type 16 E6 expression. Ionizing radiation exposure was used to stimulate p53 activity and to induce alterations in cell cycle progression. We found that exposure of cells to ionizing radiation induced dose-dependent changes in cell cycle progression in both cell lines. The relationship between S phase percentage, TK 1 activity, and FLT uptake were essentially unchanged in the p53-normal cell line. In contrast, TK 1 activity and FLT uptake remained high in the p53-deficient variant even when S phase percentage was low due to a p53-dependent G2 arrest. We conclude that a functional p53 response is required to maintain the normal relationship between TK1 activity and S phase percentage following radiation exposure

  4. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  5. Induction of non-responsiveness in human allergen-specific type 2 T helper cells.

    Science.gov (United States)

    Yssel, H; Fasler, S; Lamb, J; de Vries, J E

    1994-12-01

    Activation of allergen-reactive human T helper (Th)2 cells in the absence of professional antigen-presenting cells, induces non-responsiveness or anergy in these cells in vitro. This induction of anergy is accompanied by phenotypic modulation and altered cytokine production. Furthermore, peptide-treated Th2 cells fail to provide B-cell help for IgE synthesis. Recent studies indicate that impaired signal transduction via the T-cell receptor may account for the lack of responsiveness to antigenic stimulation. Here, we review present knowledge on the cell biology of non-responsive or anergic Th2 cells.

  6. G2-block after irradiation of cells with different p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Zoelzer, Friedo [University of South Bohemia in Ceske Budejovice, Department of Radiology, Toxicology and Civil Protection, Faculty of Health and Social Studies, Ceske Budejovice (Czech Republic); University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Jagetia, Ganesh [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Mizoram University, Department of Zoology, School of Life Sciences, Aizawl (India); Streffer, Christian [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany)

    2014-11-15

    Although it is clear that functional p53 is not required for radiation-induced G{sub 2} block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G{sub 2} compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G{sub 2} phase itself. We observed the movement of BrdU-labeled cells through G{sub 2} and M into G{sub 1}. From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G{sub 2} and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G{sub 2} and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G{sub 2} compartment alone is misleading when differences in the G{sub 2} block are investigated and that the G{sub 2} block itself is indeed independent of functional p53. (orig.) [German] Obwohl klar ist, dass ein funktionelles p53-Protein fuer die Ausbildung des strahleninduzierten G{sub 2}-Blocks nicht zwingend erforderlich ist, gibt es experimentelle Befunde, die nahe legen, dass p53 in diesem Zusammenhang doch eine gewisse Rolle spielt. Zum Beispiel bestaetigen wir hier fruehere Berichte, dass die Akkumulation von Zellen im G{sub 2}-Kompartiment bei p53-Mutanten deutlich spaeter nach Bestrahlung ihr Maximum erreicht als bei p53-Wildtypen. Es bleibt jedoch zu klaeren, ob dieser Unterschied seinen Grund in einem laengeren Block der G{sub 2}-Phase selbst hat. Beobachtet wurde die Bewegung von BrdU-markierten Zellen durch G{sub 2} und M nach G{sub 1}. Aus der zeitlichen Veraenderung des Anteils markierter Zellen im G{sub 1}-Kompartiment des naechsten Zellzyklus konnte die

  7. Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2

    Science.gov (United States)

    Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D

    2002-01-01

    A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296

  8. A recombinant antibody with the antigen-specific, major histocompatibility complex-restricted specificity of T cells

    DEFF Research Database (Denmark)

    Andersen, P S; Stryhn, A; Hansen, B E

    1996-01-01

    Specific recognition of peptide/major histocompatibility complex (MHC) molecule complexes by the T-cell receptor is a key reaction in the specific immune response. Antibodies against peptide/MHC complexes would therefore be valuable tools in studying MHC function and T-cell recognition and might ...

  9. Prognostic value of p53 in patients with muscle-invasive bladder cancer treated with preoperative radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Catherine S; Pollack, Alan; Czerniak, Bogdan A; Chyle, Valerian; Zagars, Gunar K; Dinney, Colin P; Benedict, William F

    1995-07-01

    Purpose/Objective: The overexpression of mutated and/or wild type p53 has been associated with poorer prognosis in patients with bladder cancer. However, most studies have involved a mixed patient population, including those with superficial and muscle-invasive disease, and some patients treated with adjuvant chemotherapy. In this study we examine the prognostic significance of p53 detected immunohistochemically in a cohort of patients with muscle-invasive transitional cell carcinoma of the bladder treated relatively uniformly with preoperative radiotherapy 4-6 weeks prior to radical cystectomy. Materials and Methods: Of 301 patients treated with preoperative radiotherapy (50 Gy in 25 fractions over 5 weeks) for muscle-invasive bladder cancer between 1960-1983, adequate material for immunohistochemical analysis of p53 was obtained in 107. Formalin-fixed paraffin-embedded archival tissue was stained using monoclonal anti-p53 antibody D01 (Oncogene Science, Manhasset, NY). The immunostaining of p53 was considered positive if greater than 20% of the tumor nuclei were stained. There were 82 men and 25 women with a mean age of 61 yr and no patient received neoadjuvant or adjuvant chemotherapy. All patients were without distant metastasis prior to treatment initiation. The median follow-up for those living (n=32) was 88 mo. The number of patients by clinical stage was 48 for T2, 30 for T3a, and 29 for T3b. Results: Overall, 46% of the patients were p53 positive, with 42% in Stage T2, 57% in Stage T3a, and 41% in Stage T3b. The distributions of potential patient prognostic factors by p53 positivity were investigated and the only association was with lymphatic-vascular invasion (p=0.04, chi-square). No correlation was seen between p53 staining and pathologic complete response (seen in 47%), clinical-to-pathologic downstaging (seen in 69%), clinical stage, tumor grade, tumor morphology, tumor number, tumor size, gender, patient age, pretreatment hemoglobin levels, BUN

  10. Natural killer cells promote early CD8 T cell responses against cytomegalovirus.

    Directory of Open Access Journals (Sweden)

    Scott H Robbins

    2007-08-01

    Full Text Available Understanding the mechanisms that help promote protective immune responses to pathogens is a major challenge in biomedical research and an important goal for the design of innovative therapeutic or vaccination strategies. While natural killer (NK cells can directly contribute to the control of viral replication, whether, and how, they may help orchestrate global antiviral defense is largely unknown. To address this question, we took advantage of the well-defined molecular interactions involved in the recognition of mouse cytomegalovirus (MCMV by NK cells. By using congenic or mutant mice and wild-type versus genetically engineered viruses, we examined the consequences on antiviral CD8 T cell responses of specific defects in the ability of the NK cells to control MCMV. This system allowed us to demonstrate, to our knowledge for the first time, that NK cells accelerate CD8 T cell responses against a viral infection in vivo. Moreover, we identify the underlying mechanism as the ability of NK cells to limit IFN-alpha/beta production to levels not immunosuppressive to the host. This is achieved through the early control of cytomegalovirus, which dramatically reduces the activation of plasmacytoid dendritic cells (pDCs for cytokine production, preserves the conventional dendritic cell (cDC compartment, and accelerates antiviral CD8 T cell responses. Conversely, exogenous IFN-alpha administration in resistant animals ablates cDCs and delays CD8 T cell activation in the face of NK cell control of viral replication. Collectively, our data demonstrate that the ability of NK cells to respond very early to cytomegalovirus infection critically contributes to balance the intensity of other innate immune responses, which dampens early immunopathology and promotes optimal initiation of antiviral CD8 T cell responses. Thus, the extent to which NK cell responses benefit the host goes beyond their direct antiviral effects and extends to the prevention of innate

  11. Precision cancer immunotherapy: optimizing dendritic cell-based strategies to induce tumor antigen-specific T-cell responses against individual patient tumors.

    Science.gov (United States)

    Osada, Takuya; Nagaoka, Koji; Takahara, Masashi; Yang, Xiao Yi; Liu, Cong-Xiao; Guo, Hongtao; Roy Choudhury, Kingshuk; Hobeika, Amy; Hartman, Zachary; Morse, Michael A; Lyerly, H Kim

    2015-05-01

    Most dendritic cell (DC)-based vaccines have loaded the DC with defined antigens, but loading with autologos tumor-derived antigens would generate DCs that activate personalized tumor-specific T-cell responses. We hypothesized that DC matured with an optimized combination of reagents and loaded with tumor-derived antigens using a clinically feasible electroporation strategy would induce potent antitumor immunity. We first studied the effects on DC maturation and antigen presentation of the addition of picibanil (OK432) to a combination of zoledronic acid, tumor necrosis factor-α, and prostaglandin E2. Using DC matured with the optimized combination, we tested 2 clinically feasible sources of autologous antigen for electroloading, total tumor mRNA or total tumor lysate, to determine which stimulated more potent antigen-specific T cells in vitro and activated more potent antitumor immunity in vivo. The combination of tumor necrosis factor-α/prostaglandin E2/zoledronic acid/OK432 generated DC with high expression of maturation markers and antigen-specific T-cell stimulatory function in vitro. Mature DC electroloaded with tumor-derived mRNA [mRNA electroporated dendritic cell (EPDC)] induced greater expansion of antigen-specific T cells in vitro than DC electroloaded with tumor lysate (lysate EPDC). In a therapeutic model of MC38-carcinoembryonic antigen colon cancer-bearing mice, vaccination with mRNA EPDC induced the most efficient anti-carcinoembryonic antigen cellular immune response, which significantly suppressed tumor growth. In conclusion, mature DC electroloaded with tumor-derived mRNA are a potent cancer vaccine, especially useful when specific tumor antigens for vaccination have not been identified, allowing autologous tumor, and if unavailable, allogeneic cell lines to be used as an unbiased source of antigen. Our data support clinical testing of this strategy.

  12. The type of adjuvant strongly influences the T-cell response during nanoparticle-based immunization

    Science.gov (United States)

    Knuschke, Torben; Epple, Matthias; Westendorf, Astrid M

    2014-01-01

    Potent vaccines require the ability to effectively induce immune responses. Especially for the control of infectious diseases with intracellular pathogens, like viruses or bacteria, potent T-cell responses are indispensable. Several delivery systems such as nanoparticles have been considered to boost the immunogenicity of pathogen derived peptides or subunits for the induction of potent T-cell responses. Since they can be further functionalized with immunostimulants, like Toll-like receptor (TLR) agonists, they improve the response by enhanced activation of the innate immune system. Currently, TLR agonists like unmethylated CpG oligonucleotides and the synthetic dsRNA derivate polyriboinosinic acid-polyribocytidylic acid (poly[I:C]) are widely used as vaccine adjuvants. CpG and poly(I:C) trigger different TLRs and therefore show differential signal transduction. Recently, we established biodegradable calcium phosphate (CaP) nanoparticles as potent T cell inducing vaccination vehicles. In this commentary we discuss the role of CpG and poly(I:C) for the effective induction of virus-specific T cells during immunization with CaP nanoparticles. The presented results underline the importance of the right formulation of vaccines for specific immunization purpose. PMID:23982325

  13. S(+)-ibuprofen destabilizes MYC/MYCN and AKT, increases p53 expression, and induces unfolded protein response and favorable phenotype in neuroblastoma cell lines.

    Science.gov (United States)

    Ikegaki, Naohiko; Hicks, Sakeenah L; Regan, Paul L; Jacobs, Joshua; Jumbo, Amina S; Leonhardt, Payton; Rappaport, Eric F; Tang, Xao X

    2014-01-01

    Neuroblastoma is a common pediatric solid tumor that exhibits a striking clinical bipolarity: favorable and unfavorable. The survival rate of children with unfavorable neuroblastoma remains low among all childhood cancers. MYCN and MYC play a crucial role in determining the malignancy of unfavorable neuroblastomas, whereas high-level expression of the favorable neuroblastoma genes is associated with a good disease outcome and confers growth suppression of neuroblastoma cells. A small fraction of neuroblastomas harbors TP53 mutations at diagnosis, but a higher proportion of the relapse cases acquire TP53 mutations. In this study, we investigated the effect of S(+)-ibuprofen on neuroblastoma cell lines, focusing on the expression of the MYCN, MYC, AKT, p53 proteins and the favorable neuroblastoma genes in vitro as biomarkers of malignancy. Treatment of neuroblastoma cell lines with S(+)-ibuprofen resulted in a significant growth suppression. This growth effect was accompanied by a marked decrease in the expression of MYC, MYCN, AKT and an increase in p53 expression in neuroblastoma cell lines without TP53 mutation. In addition, S(+)-ibuprofen enhanced the expression of some favorable neuroblastoma genes (EPHB6, CD44) and genes involved in growth suppression and differentiation (EGR1, EPHA2, NRG1 and SEL1L). Gene expression profile and Ingenuity pathway analyses using TP53-mutated SKNAS cells further revealed that S(+)-ibuprofen suppressed molecular pathways associated with cell growth and conversely enhanced those of cell cycle arrest and the unfolded protein response. Collectively, these results suggest that S(+)-ibuprofen or its related compounds may have the potential for therapeutic and/or palliative use for unfavorable neuroblastoma.

  14. TCR down-regulation controls virus-specific CD8+ T cell responses

    DEFF Research Database (Denmark)

    Bonefeld, Charlotte Menné; Haks, Mariëlle; Nielsen, Bodil

    2008-01-01

    in mice with a mutated CD3gamma di-leucine-based motif. The CD3gamma mutation did not impair early TCR signaling, nor did it compromise recruitment or proliferation of virus-specific T cells, but it increased the apoptosis rate of the activated T cells by increasing down-regulation of the antiapoptotic...

  15. Harnessing the p53-PUMA Axis to Overcome DNA Damage Resistance in Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiaoguang Zhou

    2014-12-01

    Full Text Available Resistance to DNA damage–induced apoptosis is a hallmark of cancer and a major cause of treatment failure and lethal disease outcome. A tumor entity that is largely resistant to DNA-damaging therapies including chemo- or radiotherapy is renal cell carcinoma (RCC. This study was designed to explore the underlying molecular mechanisms of DNA damage resistance in RCC to develop strategies to resensitize tumor cells to DNA damage–induced apoptosis. Here, we show that apoptosis-resistant RCC cells have a disconnect between activation of p53 and upregulation of the downstream proapoptotic protein p53 upregulated modulator of apoptosis (PUMA. We demonstrate that this disconnect is not caused by gene-specific repression through CCCTC-binding factor (CTCF but instead by aberrant chromatin compaction. Treatment with an HDAC inhibitor was found to effectively reactivate PUMA expression on the mRNA and protein level and to revert resistance to DNA damage–induced cell death. Ectopic expression of PUMA was found to resensitize a panel of RCC cell lines to four different DNA-damaging agents tested. Remarkably, all RCC cell lines analyzed were wild-type for p53, and a knockdown was likewise able to sensitize RCC cells to acute genotoxic stress. Taken together, our results indicate that DNA damage resistance in RCC is reversible, involves the p53-PUMA axis, and is potentially targetable to improve the oncological outcomes of RCC patients.

  16. Effect of the p53 gene status on the sensitivity of oral squamous cell carcinoma cells to boron neutron capture therapy

    International Nuclear Information System (INIS)

    Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.

    2006-01-01

    The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)

  17. Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

    International Nuclear Information System (INIS)

    Deocaris, Custer C.

    2004-01-01

    Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

  18. Functions of MDMX in the Modulation of the p53-Response

    Directory of Open Access Journals (Sweden)

    Kristiaan Lenos

    2011-01-01

    Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.

  19. Transfer of mRNA Encoding Invariant NKT Cell Receptors Imparts Glycolipid Specific Responses to T Cells and γδT Cells.

    Science.gov (United States)

    Shimizu, Kanako; Shinga, Jun; Yamasaki, Satoru; Kawamura, Masami; Dörrie, Jan; Schaft, Niels; Sato, Yusuke; Iyoda, Tomonori; Fujii, Shin-Ichiro

    2015-01-01

    Cell-based therapies using genetically engineered lymphocytes expressing antigen-specific T cell receptors (TCRs) hold promise for the treatment of several types of cancers. Almost all studies using this modality have focused on transfer of TCR from CD8 cytotoxic T lymphocytes (CTLs). The transfer of TCR from innate lymphocytes to other lymphocytes has not been studied. In the current study, innate and adaptive lymphocytes were transfected with the human NKT cell-derived TCRα and β chain mRNA (the Vα24 and Vβ11 TCR chains). When primary T cells transfected with NKT cell-derived TCR were subsequently stimulated with the NKT ligand, α-galactosylceramide (α-GalCer), they secreted IFN-γ in a ligand-specific manner. Furthermore when γδT cells were transfected with NKT cell-derived TCR mRNA, they demonstrated enhanced proliferation, IFN-γ production and antitumor effects after α-GalCer stimulation as compared to parental γδT cells. Importantly, NKT cell TCR-transfected γδT cells responded to both NKT cell and γδT cell ligands, rendering them bi-potential innate lymphocytes. Because NKT cell receptors are unique and universal invariant receptors in humans, the TCR chains do not yield mispaired receptors with endogenous TCR α and β chains after the transfection. The transfection of NKT cell TCR has the potential to be a new approach to tumor immunotherapy in patients with various types of cancer.

  20. Feasibility of Breast Conservation after Neoadjuvant Chemotherapy in 58 Patients with Locally Advanced Breast Cancer Using p53 and MDRI Genes as Predictors of Response

    International Nuclear Information System (INIS)

    Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.

    2002-01-01

    . Mutations were located in exons 4,6,7,8 and 10 of the p53 gene, including two mutations in the intron region affecting the splice sites. The seven non-responders showed p53 mutations while 6/51 responding patients had p53 mutations. Treatment failure was related to the presence of p53 gene mutations (ρ = 0.0(29). Presence of apoptosis was related to a normal p53 status and treatment response (ρ< 0.00(1). In patients responding to FEC, the mean percentage of apoptotic cells was seven. Of 7 patients with treatment failure, 5 had 0% and two patients had J % apoptotic cells. Twelve patients showed the specific band corresponding to the MDR1 mRNA. All patients with no response to neoadjuvant chemotherapy had MDR1 gene expression. MDR1 expression was significantly correlated with resistance to neoadjuvant chemotherapy ((ρ = 0.0026). The remaining five patients with MDR1 expression had (PR) to neoadjuvant chemotherapy and also had p53 mutations. Conclusion: In conclusion, the results of the present study compare favorably with previous studies in patients with locally advanced breast cancer (LABC). Our results suggest that breast conservation was feasible and safe for patients with LABC, with careful selection based on response to chemotherapy. We have demonstrated that p53 plays a distinct drug-specific role in chemoresistance. The response to a combination of FEC was directly related to normal p53 and tumor cell apoptosis in breast cancer patients. These results provide clinical evidence of a p53 dependent cytotoxic effect of these DNA-damaging agents. It seems that resistance to chemotherapy is a multifactorial phenomenon, in which many genes are involved

  1. A Recombinant Antibody with the Antigen-Specific, Major Histocompatibility Complex-Restricted Specificity of T Cells

    Science.gov (United States)

    Andersen, Peter S.; Stryhn, Anette; Hansen, Bjarke E.; Fugger, Lars; Engberg, Jan; Buus, Soren

    1996-03-01

    Specific recognition of peptide/major histocompatibility complex (MHC) molecule complexes by the T-cell receptor is a key reaction in the specific immune response. Antibodies against peptide/MHC complexes would therefore be valuable tools in studying MHC function and T-cell recognition and might lead to novel approaches in immunotherapy. However, it has proven difficult to generate antibodies with the specificity of T cells by conventional hybridoma techniques. Here we report that the phage display technology is a feasible alternative to generate antibodies recognizing specific, predetermined peptide/MHC complexes.

  2. Anti-inflammatory activity of chloroquine and amodiaquine through p21-mediated suppression of T cell proliferation and Th1 cell differentiation

    International Nuclear Information System (INIS)

    Oh, Sera; Shin, Ji Hyun; Jang, Eun Jung; Won, Hee Yeon; Kim, Hyo Kyeong; Jeong, Mi- Gyeong; Kim, Kwang Soo; Hwang, Eun Sook

    2016-01-01

    Chloroquine (CQ) and amodiaquine (AQ) have been used for treating or preventing malaria for decades, and their application has expanded into treating inflammatory disease in humans. CQ and AQ are applicable for controlling rheumatoid arthritis, but their molecular mechanisms of anti-inflammatory activity remain to be elucidated. In this study, we examined the effects of CQ and AQ on T cell activation and T cell-mediated immune response. CQ had no significant effect on T cell numbers, but decreased the population of T cells with a high division rate. However, AQ treatment significantly increased the number of cells with low division rates and eliminated cells with high division rates, resulting in the inhibition of T cell proliferation triggered by T cell receptor stimulation, of which inhibition occurred in developing effector T helper and regulatory T cells, regardless of the different exogenous cytokines. Interestingly, the cyclin-dependent kinase inhibitor p21 was significantly and dose-dependently increased by CQ, and more potently by AQ, while other cell cycle regulators were unchanged. Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus. Sustained treatment of developing T cells with either CQ or AQ suppressed IFN-γ production in a dose dependent manner and potently inhibited the differentiation of IFN-γ-producing Th1 cells. These results demonstrate that CQ and AQ increase the expression level of p21 and inhibit T cell proliferation and the development of IFN-γ-producing Th1 cells, thereby revealing beneficial roles in treating a wide range of chronic inflammatory diseases mediated by inflammatory T cells. -- Highlights: •T cell division rates are suppressed by chloroquine and amodiaquine treatment. •Chloroquine and amodiaquine potently increased the p21 expression. •The p21 induction is

  3. Anti-inflammatory activity of chloroquine and amodiaquine through p21-mediated suppression of T cell proliferation and Th1 cell differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sera; Shin, Ji Hyun; Jang, Eun Jung; Won, Hee Yeon; Kim, Hyo Kyeong; Jeong, Mi- Gyeong [College of Pharmacy and Graduate School of Pharmaceutical Sciences, Ewha Womans University, Seoul 120-750 (Korea, Republic of); Kim, Kwang Soo [Molecular Neurobiology Laboratory, Department of Psychiatry, McLean Hospital, Harvard Medical School, Belmont, MA 02478 (United States); Hwang, Eun Sook, E-mail: eshwang@ewha.ac.kr [College of Pharmacy and Graduate School of Pharmaceutical Sciences, Ewha Womans University, Seoul 120-750 (Korea, Republic of)

    2016-05-27

    Chloroquine (CQ) and amodiaquine (AQ) have been used for treating or preventing malaria for decades, and their application has expanded into treating inflammatory disease in humans. CQ and AQ are applicable for controlling rheumatoid arthritis, but their molecular mechanisms of anti-inflammatory activity remain to be elucidated. In this study, we examined the effects of CQ and AQ on T cell activation and T cell-mediated immune response. CQ had no significant effect on T cell numbers, but decreased the population of T cells with a high division rate. However, AQ treatment significantly increased the number of cells with low division rates and eliminated cells with high division rates, resulting in the inhibition of T cell proliferation triggered by T cell receptor stimulation, of which inhibition occurred in developing effector T helper and regulatory T cells, regardless of the different exogenous cytokines. Interestingly, the cyclin-dependent kinase inhibitor p21 was significantly and dose-dependently increased by CQ, and more potently by AQ, while other cell cycle regulators were unchanged. Both CQ and AQ elevated the transcription level of p21 though the activation of p53, but also blocked p21 protein degradation in the presence of cycloheximide, causing p21 protein accumulation mainly in the nucleus. Sustained treatment of developing T cells with either CQ or AQ suppressed IFN-γ production in a dose dependent manner and potently inhibited the differentiation of IFN-γ-producing Th1 cells. These results demonstrate that CQ and AQ increase the expression level of p21 and inhibit T cell proliferation and the development of IFN-γ-producing Th1 cells, thereby revealing beneficial roles in treating a wide range of chronic inflammatory diseases mediated by inflammatory T cells. -- Highlights: •T cell division rates are suppressed by chloroquine and amodiaquine treatment. •Chloroquine and amodiaquine potently increased the p21 expression. •The p21 induction is

  4. Differential programming of p53-deficient embryonic cells during rotenone block

    Science.gov (United States)

    Mitochondrial dysfunction has been implicated in chemical toxicities. The present study used an in vitro model to investigate the differential expression of metabolic pathways during cellular stress in p53- efficient embryonic fibroblasts compared to p53-deficient cells. These c...

  5. Circulating rotavirus-specific T cells have a poor functional profile

    Energy Technology Data Exchange (ETDEWEB)

    Parra, Miguel; Herrera, Daniel [Instituto de Genética Humana, Facultad de Medicina, Pontificia Universidad Javeriana, Pontificia Universidad Javeriana, Carrera 7 # 40-62, Bogotá (Colombia); Jácome, María Fernanda; Mesa, Martha C. [Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá (Colombia); Rodríguez, Luz-Stella [Instituto de Genética Humana, Facultad de Medicina, Pontificia Universidad Javeriana, Pontificia Universidad Javeriana, Carrera 7 # 40-62, Bogotá (Colombia); Guzmán, Carolina [Departamento de Pediatría, Hospital Universitario San Ignacio, Facultad de Medicina, Pontificia Universidad Javeriana, Bogotá (Colombia); Angel, Juana; Franco, Manuel A. [Instituto de Genética Humana, Facultad de Medicina, Pontificia Universidad Javeriana, Pontificia Universidad Javeriana, Carrera 7 # 40-62, Bogotá (Colombia)

    2014-11-15

    Frequencies of circulating T cells producing IFN-γ, TNF-α, and IL-2, and percentages of T cells proliferating after stimulation with rotavirus (RV), tetanus toxoid, and influenza were evaluated in PBMC derived from healthy adults and children. In addition, the potential anergic state of RV-specific T cells was analyzed by stimulation of PBMC with RV antigen in the presence of three anergy inhibitors (rIL-2, rIL-12, or DGKα-i). The quality and magnitude of RV-T cell responses were significantly lower than those of tetanus toxoid and influenza antigens. RV-CD4 T cell response was enriched in monofunctional IFN-γ{sup +} cells, while influenza-CD4 and tetanus toxoid-CD4 T cell responses were enriched in multifunctional T cells. Moreover, rIL-2 – unlike rIL-12 or DGKα-i – increased the frequencies of RV-CD4 TNF-α{sup +}, CD4 IFN-γ{sup +}, and CD8 IFN-γ{sup +} cells. Thus, circulating RV-T cells seem to have a relatively poor functional profile that may be partially reversed in vitro by the addition of rIL-2. - Highlights: • The quality and magnitude of circulating RV-T cell responses are relatively poor. • Circulating RV-CD4 T cells are enriched in monofunctional IFN-γ+ cells. • Treatment with rIL-2 increased the frequencies of cytokine secreting RV-T cells.

  6. Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination

    Directory of Open Access Journals (Sweden)

    Zhou Y

    2018-04-01

    Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had

  7. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  8. Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeyran eShahbazi

    2013-05-01

    Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

  9. Mutant p53 transfection of astrocytic cells results in altered cell cycle control, radiation sensitivity, and tumorigenicity

    International Nuclear Information System (INIS)

    Kanady, Kirk E.; Mei Su; Proulx, Gary; Malkin, David M.; Pardo, Francisco S.

    1995-01-01

    Introduction: Alterations in the p53 tumor suppressor gene are one of the most frequent genetic alterations in malignant gliomas. An understanding of the molecular genetic events leading to glial tumor progression would aid in designing therapeutic vectors for controlling these challenging tumor types. We investigated whether mutations in coding exons of the p53 gene result in functional changes altering cell cycle 'checkpoint' control and the intrinsic radiation sensitivity of glial cells. Methods: An astrocytic cell line was derived from a low grade astrocytoma and characterized to be of human karyotype and GFAP positivity. Additionally, the cellular population has never formed tumors in immune-deficient mice. At early passage ( 2 as parameters. Cell kinetic analyses after 2, 5, and 10 Gy of ionizing radiation were conducted using propidium iodide FACS analyses. Results: Overall levels of p53 expression were increased 5-10 fold in the transfected cellular populations. Astrocytic cellular populations transfected with mutant p53 revealed a statistically significant increase in levels of resistance to ionizing radiation in vitro (2-tailed test, SF2, MID). Astrocytic cellular populations transfected with mutant p53, unlike the parental cells, were tumorigenic in SCID mice. Cell kinetic analyses indicated that the untransfected cell line demonstrated dose dependent G1 and G2 arrests. Following transfection, however, the resultant cellular population demonstrated a predominant G2 arrest. Conclusions: Astrocytic cellular populations derived from low grade astrocytomas, are relatively radiation sensitive, non-tumorigenic, and have intact cell cycle ''checkpoints.'' Cellular populations resulting upon transfection of parental cells with a dominant negative p53 mutation, are relatively radiation resistant, when compared to both parental and mock-transfected cells. Transfected cells demonstrate abnormalities of cell cycle control at the G1/S checkpoint, increases in levels

  10. T cell subtypes and reciprocal inflammatory mediator expression differentiate P. falciparum memory recall responses in asymptomatic and symptomatic malaria patients in southeastern Haiti.

    Directory of Open Access Journals (Sweden)

    Jason S Lehmann

    Full Text Available Asymptomatic Plasmodium falciparum infection is responsible for maintaining malarial disease within human populations in low transmission countries such as Haiti. Investigating differential host immune responses to the parasite as a potential underlying mechanism could help provide insight into this highly complex phenomenon and possibly identify asymptomatic individuals. We performed a cross-sectional analysis of individuals who were diagnosed with malaria in Sud-Est, Haiti by comparing the cellular and humoral responses of both symptomatic and asymptomatic subjects. Plasma samples were analyzed with a P. falciparum protein microarray, which demonstrated serologic reactivity to 3,877 P. falciparum proteins of known serologic reactivity; however, no antigen-antibody reactions delineating asymptomatics from symptomatics were identified. In contrast, differences in cellular responses were observed. Flow cytometric analysis of patient peripheral blood mononuclear cells co-cultured with P. falciparum infected erythrocytes demonstrated a statistically significant increase in the proportion of T regulatory cells (CD4+ CD25+ CD127-, and increases in unique populations of both NKT-like cells (CD3+ CD8+ CD56+ and CD8mid T cells in asymptomatics compared to symptomatics. Also, CD38+/HLA-DR+ expression on γδ T cells, CD8mid (CD56- T cells, and CD8mid CD56+ NKT-like cells decreased upon exposure to infected erythrocytes in both groups. Cytometric bead analysis of the co-culture supernatants demonstrated an upregulation of monocyte-activating chemokines/cytokines in asymptomatics, while immunomodulatory soluble factors were elevated in symptomatics. Principal component analysis of these expression values revealed a distinct clustering of individual responses within their respective phenotypic groups. This is the first comprehensive investigation of immune responses to P. falciparum in Haiti, and describes unique cell-mediated immune repertoires that

  11. MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1

    Directory of Open Access Journals (Sweden)

    Olsson Hans

    2013-01-01

    Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in

  12. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Monti, Paola; Fronza, Gilberto [Mutagenesis Unit, Istituto di Ricerca e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, 16132 Genoa (Italy); Pereira, Clara [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Saraiva, Lucília, E-mail: lucilia.saraiva@ff.up.pt [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal)

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.

  13. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    International Nuclear Information System (INIS)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana; Monti, Paola; Fronza, Gilberto; Pereira, Clara; Saraiva, Lucília

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73

  14. Generation of TCR-Expressing Innate Lymphoid-like Helper Cells that Induce Cytotoxic T Cell-Mediated Anti-leukemic Cell Response.

    Science.gov (United States)

    Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin

    2018-06-05

    CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  16. Circulating rotavirus-specific T cells have a poor functional profile.

    Science.gov (United States)

    Parra, Miguel; Herrera, Daniel; Jácome, María Fernanda; Mesa, Martha C; Rodríguez, Luz-Stella; Guzmán, Carolina; Angel, Juana; Franco, Manuel A

    2014-11-01

    Frequencies of circulating T cells producing IFN-γ, TNF-α, and IL-2, and percentages of T cells proliferating after stimulation with rotavirus (RV), tetanus toxoid, and influenza were evaluated in PBMC derived from healthy adults and children. In addition, the potential anergic state of RV-specific T cells was analyzed by stimulation of PBMC with RV antigen in the presence of three anergy inhibitors (rIL-2, rIL-12, or DGKα-i). The quality and magnitude of RV-T cell responses were significantly lower than those of tetanus toxoid and influenza antigens. RV-CD4 T cell response was enriched in monofunctional IFN-γ(+) cells, while influenza-CD4 and tetanus toxoid-CD4 T cell responses were enriched in multifunctional T cells. Moreover, rIL-2--unlike rIL-12 or DGKα-i--increased the frequencies of RV-CD4 TNF-α(+), CD4 IFN-γ(+), and CD8 IFN-γ(+) cells. Thus, circulating RV-T cells seem to have a relatively poor functional profile that may be partially reversed in vitro by the addition of rIL-2. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. The cyclin-dependent kinase inhibitor 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole induces nongenotoxic, DNA replication-independent apoptosis of normal and leukemic cells, regardless of their p53 status

    International Nuclear Information System (INIS)

    Turinetto, Valentina; Porcedda, Paola; Orlando, Luca; De Marchi, Mario; Amoroso, Antonio; Giachino, Claudia

    2009-01-01

    Current chemotherapy of human cancers focuses on the DNA damage pathway to induce a p53-mediated cellular response leading to either G1 arrest or apoptosis. However, genotoxic treatments may induce mutations and translocations that result in secondary malignancies or recurrent disease. In addition, about 50% of human cancers are associated with mutations in the p53 gene. Nongenotoxic activation of apoptosis by targeting specific molecular pathways thus provides an attractive therapeutic approach. Normal and leukemic cells were evaluated for their sensitivity to 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) through cell viability and caspase activation tests. The apoptotic pathway induced by DRB was analysed by immunfluorescence and immunoblot analysis. H2AX phosphorylation and cell cycle analysis were performed to study the dependance of apoptosis on DNA damage and DNA replication, respectively. To investigate the role of p53 in DRB-induced apoptosis, specific p53 inhibitors were used. Statistical analysis on cell survival was performed with the test of independence. Here we report that DRB, an inhibitor of the transcriptional cyclin-dependent kinases (CDKs) 7 and 9, triggers DNA replication-independent apoptosis in normal and leukemic human cells regardless of their p53 status and without inducing DNA damage. Our data indicate that (i) in p53-competent cells, apoptosis induced by DRB relies on a cytosolic accumulation of p53 and subsequent Bax activation, (ii) in the absence of p53, it may rely on p73, and (iii) it is independent of ATM and NBS1 proteins. Notably, even apoptosis-resistant leukemic cells such as Raji were sensitive to DRB. Our results indicate that DRB represents a potentially useful cancer chemotherapeutic strategy that employs both the p53-dependent and -independent apoptotic pathways without inducing genotoxic stress, thereby decreasing the risk of secondary malignancies

  18. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    Directory of Open Access Journals (Sweden)

    Liang Y

    2018-03-01

    Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood

  19. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  20. Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways

    Directory of Open Access Journals (Sweden)

    Lisa Wiesmüller

    2001-01-01

    Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.

  1. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  2. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  3. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, A.; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, M.L.; Subramaniam, V.; Babkova, Z.; Martínek, T.; Lexa, M.; Adámik, Matěj

    2016-01-01

    Roč. 11, č. 12 (2016), č. článku e0167439. E-ISSN 1932-6203 R&D Projects: GA ČR GA13-36108S; GA ČR(CZ) GP204/06/P369; GA ČR GA15-02891S Institutional support: RVO:68081707 Keywords : c-terminal domain * suppressor protein p53 * supercoiled dna Subject RIV: BO - Biophysics Impact factor: 2.806, year: 2016

  4. Expression signature based on TP53 target genes doesn't predict response to TP53-MDM2 inhibitor in wild type TP53 tumors

    OpenAIRE

    Sonkin, Dmitriy

    2015-01-01

    eLife digest Damaged cells in the human body can develop into tumors if left unchecked. TP53 (also called p53) is a protein that normally helps to repair or eliminate these damaged cells and prevent tumors from forming. About half of all cancerous tumors have mutations that prevent TP53 from working. In tumors with normal TP53 (called TP53 wild type tumors), another protein that acts to keep TP53 in check is often overly active. This overactive protein (called MDM2) prevents TP53 from suppres...

  5. Dihydrolipoamide dehydrogenase-Lpd (Rv0462)-specific T cell recall responses are higher in healthy household contacts of TB: a novel immunodominant antigen from M. tuberculosis.

    Science.gov (United States)

    Devasundaram, Santhi; Raja, Alamelu

    2017-07-01

    The partial effectiveness against pulmonary tuberculosis (PTB), displayed by the existing tuberculosis (TB) vaccine, bacillus Calmette-Guérin (BCG), highlights the need for novel vaccines to replace or improve BCG. In TB immunology, antigen-specific cellular immune response is frequently considered indispensable. Latency-associated antigens are intriguing as targets for TB vaccine development. The mycobacterial protein, dihydrolipoamide dehydrogenase (Lpd; Rv0462), the third enzyme of the pyruvate dehydrogenase (PDH) complex, facilitates Mycobacterium tuberculosis to resist host reactive nitrogen intermediates. Multicolor flow cytometry analysis of whole-blood cultures showed higher Lpd-specific Th1 recall response (IFN-γ, TNF-α, and IL-2; P = 0.0006) and memory CD4 + and CD8 + T cells (CCR7 + CD45RA - and CCR7 - CD45RA - ) in healthy household contacts (HHC) of TB ( P < 0.0001), which is comparable with or higher than the standard antigens, ESAT-6 and CFP-10. The frequency of Lpd-specific multifunctional T cells was higher in HHC compared with PTB patients. However, there is no significant statistical correlation. Regulatory T cell (T reg ) analysis of HHCs and active TB patients demonstrated very low Lpd-specific CD4 + T regs relative to ESAT-6 and CFP-10. Our study demonstrates that the Lpd antigen induces a strong cellular immune response in healthy mycobacteria-infected individuals. In consideration of this population having demonstrated immunologic protection against active TB disease development, our data are encouraging about the possible use of Lpd as a target for further TB subunit vaccine development. © Society for Leukocyte Biology.

  6. Suberoyl bis-hydroxamic acid induces p53-dependent apoptosis of MCF-7 breast cancer cells

    Institute of Scientific and Technical Information of China (English)

    Zhi-gang ZHUANG; Fei FEI; Ying CHEN; Wei JIN

    2008-01-01

    Aim: To study the effects of suberoyl bis-hydroxamic acid (SBHA), an inhibitor of histone deacetylases, on the apoptosis of MCF-7 breast cancer cells. Meth-ods: Apoptosis in MCF-7 cells induced by SBHA was demonstrated by flow cytometric analysis, morphological observation, and DNA ladder. Mitochondrial membrane potential (△ψm) was measured using the fluorescent probe JC-1. The expressions of p53, p21, Bax, and PUMA were determined using RT-PCR or Western blotting analysis after the MCF-7 cells were treated with SBHA or p53 siRNA. Results: SBHA induced apoptosis in MCF-7 cells. The expressions of p53, p21, Bax, and PUMA were induced, and △ψm collapsed after treatment with SBHA. p53 siRNA abrogated the SBHA-induced apoptosis and the expressions of p53, p21, Bax, and PUMA. Conclusion: The activation of the p53 pathway is involved in SBHA-induced apoptosis in MCF-7 cells.

  7. Tissue specific heterogeneity in effector immune cell response

    Directory of Open Access Journals (Sweden)

    Saba eTufail

    2013-08-01

    Full Text Available Post pathogen invasion, migration of effector T-cell subsets to specific tissue locations is of prime importance for generation of robust immune response. Effector T cells are imprinted with distinct ‘homing codes’ (adhesion molecules and chemokine receptors during activation which regulate their targeted trafficking to specific tissues. Internal cues in the lymph node microenvironment along with external stimuli from food (vitamin A and sunlight (vitamin D3 prime dendritic cells, imprinting them to play centrestage in the induction of tissue tropism in effector T cells. B cells as well, in a manner similar to effector T cells, exhibit tissue tropic migration. In this review, we have focused on the factors regulating the generation and migration of effector T cells to various tissues alongwith giving an overview of tissue tropism in B cells.

  8. HJURP regulates cellular senescence in human fibroblasts and endothelial cells via a p53-dependent pathway.

    Science.gov (United States)

    Heo, Jong-Ik; Cho, Jung Hee; Kim, Jae-Ryong

    2013-08-01

    Holliday junction recognition protein (HJURP), a centromere protein-A (CENP-A) histone chaperone, mediates centromere-specific assembly of CENP-A nucleosome, contributing to high-fidelity chromosome segregation during cell division. However, the role of HJURP in cellular senescence of human primary cells remains unclear. We found that the expression levels of HJURP decreased in human dermal fibroblasts and umbilical vein endothelial cells in replicative or premature senescence. Ectopic expression of HJURP in senescent cells partially overcame cell senescence. Conversely, downregulation of HJURP in young cells led to premature senescence. p53 knockdown, but not p16 knockdown, abolished senescence phenotypes caused by HJURP reduction. These data suggest that HJURP plays an important role in the regulation of cellular senescence through a p53-dependent pathway and might contribute to tissue or organismal aging and protection of cellular transformation.

  9. Differential effects of garcinol and curcumin on histone and p53 modifications in tumour cells

    International Nuclear Information System (INIS)

    Collins, Hilary M; Kundu, Tapas K; Heery, David M; Abdelghany, Magdy K; Messmer, Marie; Yue, Baigong; Deeves, Sian E; Kindle, Karin B; Mantelingu, Kempegowda; Aslam, Akhmed; Winkler, G Sebastiaan

    2013-01-01

    Post-translational modifications (PTMs) of histones and other proteins are perturbed in tumours. For example, reduced levels of acetylated H4K16 and trimethylated H4K20 are associated with high tumour grade and poor survival in breast cancer. Drug-like molecules that can reprogram selected histone PTMs in tumour cells are therefore of interest as potential cancer chemopreventive agents. In this study we assessed the effects of the phytocompounds garcinol and curcumin on histone and p53 modification in cancer cells, focussing on the breast tumour cell line MCF7. Cell viability/proliferation assays, cell cycle analysis by flow cytometry, immunodetection of specific histone and p53 acetylation marks, western blotting, siRNA and RT-qPCR. Although treatment with curcumin, garcinol or the garcinol derivative LTK-14 hampered MCF7 cell proliferation, differential effects of these compounds on histone modifications were observed. Garcinol treatment resulted in a strong reduction in H3K18 acetylation, which is required for S phase progression. Similar effects of garcinol on H3K18 acetylation were observed in the osteosarcoma cells lines U2OS and SaOS2. In contrast, global levels of acetylated H4K16 and trimethylated H4K20 in MCF7 cells were elevated after garcinol treatment. This was accompanied by upregulation of DNA damage signalling markers such as γH2A.X, H3K56Ac, p53 and TIP60. In contrast, exposure of MCF7 cells to curcumin resulted in increased global levels of acetylated H3K18 and H4K16, and was less effective in inducing DNA damage markers. In addition to its effects on histone modifications, garcinol was found to block CBP/p300-mediated acetylation of the C-terminal activation domain of p53, but resulted in enhanced acetylation of p53K120, and accumulation of p53 in the cytoplasmic compartment. Finally, we show that the elevation of H4K20Me3 levels by garcinol correlated with increased expression of SUV420H2, and was prevented by siRNA targeting of SUV420H2. In

  10. Differential effects of garcinol and curcumin on histone and p53 modifications in tumour cells

    Directory of Open Access Journals (Sweden)

    Collins Hilary M

    2013-01-01

    Full Text Available Abstract Background Post-translational modifications (PTMs of histones and other proteins are perturbed in tumours. For example, reduced levels of acetylated H4K16 and trimethylated H4K20 are associated with high tumour grade and poor survival in breast cancer. Drug-like molecules that can reprogram selected histone PTMs in tumour cells are therefore of interest as potential cancer chemopreventive agents. In this study we assessed the effects of the phytocompounds garcinol and curcumin on histone and p53 modification in cancer cells, focussing on the breast tumour cell line MCF7. Methods Cell viability/proliferation assays, cell cycle analysis by flow cytometry, immunodetection of specific histone and p53 acetylation marks, western blotting, siRNA and RT-qPCR. Results Although treatment with curcumin, garcinol or the garcinol derivative LTK-14 hampered MCF7 cell proliferation, differential effects of these compounds on histone modifications were observed. Garcinol treatment resulted in a strong reduction in H3K18 acetylation, which is required for S phase progression. Similar effects of garcinol on H3K18 acetylation were observed in the osteosarcoma cells lines U2OS and SaOS2. In contrast, global levels of acetylated H4K16 and trimethylated H4K20 in MCF7 cells were elevated after garcinol treatment. This was accompanied by upregulation of DNA damage signalling markers such as γH2A.X, H3K56Ac, p53 and TIP60. In contrast, exposure of MCF7 cells to curcumin resulted in increased global levels of acetylated H3K18 and H4K16, and was less effective in inducing DNA damage markers. In addition to its effects on histone modifications, garcinol was found to block CBP/p300-mediated acetylation of the C-terminal activation domain of p53, but resulted in enhanced acetylation of p53K120, and accumulation of p53 in the cytoplasmic compartment. Finally, we show that the elevation of H4K20Me3 levels by garcinol correlated with increased expression of SUV420H2

  11. Selection of restriction specificities of virus-specific cytotoxic T cells in the thymus: no evidence for a crucial role of antigen-presenting cells

    International Nuclear Information System (INIS)

    Zinkernagel, R.M.

    1982-01-01

    The proposal was tested that (P1 X P2) F1 leads to P1 irradiation bone marrow chimeras expressed predominantly P1-restricted T cells because donor derived stem cells were exposed to recipient derived antigen-presenting cells in the thymus. Because P1 recipient-derived antigen-presenting cells are replaced only slowly after 6-8 wk by (P1 X P2) donor-derived antigen-presenting cells in the thymus and because replenished pools of mature T cells may by then prevent substantial numbers of P2-restricted T cells to be generated, a large portion of thymus cells and mature T cells were eliminated using the following treatments of 12-20-wk-old (P1 X P2) F1 leads to P1 irradiation bone marrow chimeras: (a) cortisone plus antilymphocyte serum, (b) Cytoxan, (c) three doses of sublethal irradiation (300 rad) 2d apart, and (d) lethal irradiation (850 rad) and reconstitution with T cell-depleted (P1 X P2) F1 stem cells. 12-20 wk after this second treatment, (P1 X P2) leads to P1 chimeras were infected with vaccinia-virus. Virus-specific cytotoxic T cell reactivity was expressed by chimeric T cells of (P1 X P[2) F1 origin and was restricted predominantly to P1. Virus-specific cytotoxic T cells, therefore, do not seem to be selected to measurable extent by the immigrating donor-derived antigen-presenting cells in the thymus; their selection depends apparently from the recipient-derived radioresistant thymus cells

  12. Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

    Science.gov (United States)

    Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

    2014-07-23

    The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko

    2012-01-01

    The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

  14. Phenylbutyrate Sensitizes Human Glioblastoma Cells Lacking Wild-Type P53 Function to Ionizing Radiation

    International Nuclear Information System (INIS)

    Lopez, Carlos A.; Feng, Felix Y.; Herman, Joseph M.; Nyati, Mukesh K.; Lawrence, Theodore S.; Ljungman, Mats

    2007-01-01

    Purpose: Histone deacetylase (HDAC) inhibitors induce growth arrest, differentiation, and apoptosis in cancer cells. Phenylbutyrate (PB) is a HDAC inhibitor used clinically for treatment of urea cycle disorders. Because of its low cytotoxicity, cerebrospinal fluid penetration, and high oral bioavailability, we investigated PB as a potential radiation sensitizer in human glioblastoma cell lines. Methods and Materials: Four glioblastoma cell lines were selected for this study. Phenylbutyrate was used at a concentration of 2 mM, which is achievable in humans. Western blots were used to assess levels of acetylated histone H3 in tumor cells after treatment with PB. Flow cytometry was used for cell cycle analysis. Clonogenic assays were performed to assess the effect of PB on radiation sensitivity. We used shRNA against p53 to study the role of p53 in radiosensitization. Results: Treatment with PB alone resulted in hyperacetylation of histones, confirmed by Western blot analysis. The PB alone resulted in cytostatic effects in three cell lines. There was no evidence of G 1 arrest, increase in sub-G 1 fraction or p21 protein induction. Clonogenic assays showed radiosensitization in two lines harboring p53 mutations, with enhancement ratios (± SE) of 1.5 (± 0.2) and 1.3 (± 0.1), respectively. There was no radiopotentiating effect in two cell lines with wild-type p53, but knockdown of wild-type p53 resulted in radiosensitization by PB. Conclusions: Phenylbutyrate can produce p21-independent cytostasis, and enhances radiation sensitivity in p53 mutant human glioblastoma cells in vitro. This suggests the potential application of combined PB and radiotherapy in glioblastoma harboring mutant p53

  15. Dynamics of p53: A Master Decider of Cell Fate

    Directory of Open Access Journals (Sweden)

    Qingyin Luo

    2017-02-01

    Full Text Available Cellular stress‐induced temporal alterations—i.e., dynamics—are typically exemplified  by the dynamics of p53 that serve as a master to determine cell fate. p53 dynamics were initially  identified as the variations of p53 protein levels. However, a growing number of studies have  shown that p53 dynamics are also manifested in variations in the activity, spatial location, and  posttranslational modifications of p53 proteins, as well as the interplay among all p53 dynamical  features. These are essential in determining a specific outcome of cell fate. In this review, we  discuss the importance of the multifaceted features of p53 dynamics and their roles in the cell fate  decision process, as well as their potential applications in p53‐based cancer therapy. The review  provides new insights into p53 signaling pathways and their potentials in the development of new  strategies in p53‐based cancer therapy.

  16. Beryllium-specific immune response in primary cells from healthy individuals

    International Nuclear Information System (INIS)

    Chaudhary, Anu; Sauer, Nancy N.; Gupta, Goutam

    2004-01-01

    The effect of beryllium (Be) exposure has been extensively studied in patients with chronic beryllium disease (CBD). CBD patients carry mutated MHC class II alleles and show a hyperproliferation of T cells upon Be exposure. The exact mechanism of Be-induced T-cell proliferation in these patients is not clearly understood. It is also not known how the inflammatory and suppressive cytokines maintain a balance in healthy individuals and how this balance is lost in CBD patients. To address these issues, we have initiated cellular and biochemical studies to identify Be-responsive cytokines and other cellular markers that help maintain a balance in healthy individuals. We have established an immune cell model derived from a mixture of peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs). In this article, we demonstrate that pro-inflammatory cytokine IL6 shows decreased release whereas suppressive cytokine IL10 shows enhanced release after 5-10 h of Be treatment. Furthermore, the Be-specific pattern of IL6 and IL10 release is dependent upon induction of threonine phosphorylation of a 45 kDa cytosolic protein (p45), as early as 90 min after Be treatment. Pharmacological inhibition of phosphatidylinositol 3' kinase (PI3'K) by wortmannin and p38 mitogen-activated protein kinase (MAPK) by SB203580 reveal that PI3'K mediates Be-specific p45 phosphorylation and IL6 release, whereas p38 MAPK regulates the release of IL6 and IL10 and the phosphorylation of p45 independent of metal-salt treatment. While the IL10 and IL6 release pathways are uncoupled in these cells, they are linked to phosphorylation of p45. These findings suggest that the balance between IL10 and IL6 release and the correlated p45 phosphorylation are important components of the Be-mediated immune response in healthy individuals

  17. Dissection of T-cell antigen specificity in human melanoma

    DEFF Research Database (Denmark)

    Andersen, Rikke Sick; Albæk Thrue, Charlotte; Junker, Niels

    2012-01-01

    Tumor-infiltrating lymphocytes (TIL) isolated from melanoma patients and expanded in vitro by interleukin (IL)-2 treatment can elicit therapeutic response after adoptive transfer, but the antigen specificities of the T cells transferred have not been determined. By compiling all known melanoma-as...... from different fragments of resected melanoma lesions. In summary, our findings provide an initial definition of T-cell populations contributing to tumor recognition in TILs although the specificity of many tumor-reactive TILs remains undefined....

  18. Semi-allogeneic dendritic cells can induce antigen-specific T-cell activation, which is not enhanced by concurrent alloreactivity.

    Science.gov (United States)

    Wells, James W; Cowled, Chris J; Darling, David; Guinn, Barbara-Ann; Farzaneh, Farzin; Noble, Alistair; Galea-Lauri, Joanna

    2007-12-01

    Alloreactive T-cell responses are known to result in the production of large amounts of proinflammatory cytokines capable of activating and maturing dendritic cells (DC). However, it is unclear whether these allogeneic responses could also act as an adjuvant for concurrent antigen-specific responses. To examine effects of simultaneous alloreactive and antigen-specific T-cell responses induced by semi-allogeneic DC. Semi-allogeneic DC were generated from the F(1) progeny of inbred strains of mice (C57BL/6 and C3H, or C57BL/6 and DBA). We directly primed antigen-specific CD8(+) and CD4(+) T-cells from OT-I and OT-II mice, respectively, in the absence of allogeneic responses, in vitro, and in the presence or absence of alloreactivity in vivo. In vitro, semi-allogeneic DC cross-presented ovalbumin (OVA) to naïve CD8(+) OT-I transgenic T-cells, primed naïve CD4(+) OT-II transgenic T-cells and could stimulate strong alloreactive T-cell proliferation in a primary mixed lymphocyte reaction (MLR). In vivo, semi-allogeneic DC migrated efficiently to regional lymph nodes but did not survive there as long as autologous DC. In addition, they were not able to induce cytotoxic T-lymphocyte (CTL) activity to a target peptide, and only weakly stimulated adoptively transferred OT-II cells. The CD4(+) response was unchanged in allo-tolerized mice, indicating that alloreactive T-cell responses could not provide help for concurrently activated antigen-specific responses. In an EL4 tumour-treatment model, vaccination with semi-allogeneic DC/EL4 fusion hybrids, but not allogeneic DC/EL4 hybrids, significantly increased mouse survival. Expression of self-Major histocompatibility complex (MHC) by semi-allogeneic DC can cause the induction of antigen-specific immunity, however, concurrently activated allogeneic bystander responses do not provide helper or adjuvant effects.

  19. RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

    2010-11-01

    Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

  20. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  1. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Manujendra N Saha

    Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

  2. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  3. Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle

    DEFF Research Database (Denmark)

    Skouv, J.; Jensen, P O; Forchhammer, J

    1994-01-01

    Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...

  4. Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.

    Science.gov (United States)

    Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S

    2016-06-21

    Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.

  5. Ellipticine induces apoptosis in T-cell lymphoma via oxidative DNA damage

    DEFF Research Database (Denmark)

    Savorani, Cecilia; Manfé, Valentina; Biskup, Edyta

    2015-01-01

    (CTCL), a disease that is progressive, chemoresistant and refractory to treatment. We tested the effect of ellipticine in three cell lines with different p53 status: MyLa2000 (p53(wt/wt)), SeAx ((G245S)p53) and Hut-78 ((R196Stop)p53). Ellipticine caused apoptosis in MyLa2000 and SeAx and restored...... the transcriptional activity of (G245S)p53 in SeAx. However, p53 siRNA knockdown experiments revealed that p53 was not required for ellipticine-induced apoptosis in CTCL. The lipophilic antioxidant α-tocopherol inhibited ellipticine-dependent apoptosis and we linked the apoptotic response to the oxidative DNA damage....... Our results provide evidence that ellipticine-induced apoptosis is exerted through DNA damage and does not require p53 activation in T-cell lymphoma....

  6. Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression

    Directory of Open Access Journals (Sweden)

    Takahiro Ebata

    2017-01-01

    Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.

  7. The impact of pregnancy on the HIV-1-specific T cell function in infected pregnant women.

    Science.gov (United States)

    Hygino, Joana; Vieira, Morgana M; Kasahara, Taissa M; Xavier, Luciana F; Blanco, Bernardo; Guillermo, Landi V C; Filho, Renato G S; Saramago, Carmen S M; Lima-Silva, Agostinho A; Oliveira, Ariane L; Guimarães, Vander; Andrade, Arnaldo F B; Bento, Cleonice A M

    2012-12-01

    Evidences indicate that pregnancy can alter the Ag-specific T-cell responses. This work aims to evaluate the impact of pregnancy on the in vitro HIV-1-specific immune response. As compared with non-pregnant patients, lower T-cell proliferation and higher IL-10 production were observed in T-cell cultures from pregnant patients following addition of either mitogens or HIV-1 antigens. In our system, the main T lymphocyte subset involved in producing IL-10 was CD4(+)FoxP3(-). Depletion of CD4(+) cells elevated TNF-α and IFN-γ production. Interestingly, the in vitro HIV-1 replication was lower in cell cultures from pregnant patients, and it was inversely related to IL-10 production. In these cultures, the neutralization of IL-10 by anti-IL-10 mAb elevated TNF-α release and HIV-1 replication. In conclusion, our results reveal that pregnancy-related events should favor the expansion of HIV-1-specific IL-10-secreting CD4(+) T-cells in HIV-1-infected women, which should, in the scenario of pregnancy, help to reduce the risk of vertical HIV-1 transmission. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. T-cell responses targeting HIV Nef uniquely correlate with infected cell frequencies after long-term antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Allison S Thomas

    2017-09-01

    Full Text Available HIV-specific CD8+ T-cell responses limit viral replication in untreated infection. After the initiation of antiretroviral therapy (ART, these responses decay and the infected cell population that remains is commonly considered to be invisible to T-cells. We hypothesized that HIV antigen recognition may persist in ART-treated individuals due to low-level or episodic protein expression. We posited that if persistent recognition were occurring it would be preferentially directed against the early HIV gene products Nef, Tat, and Rev as compared to late gene products, such as Gag, Pol, and Env, which have higher barriers to expression. Using a primary cell model of latency, we observed that a Nef-specific CD8+ T-cell clone exhibited low-level recognition of infected cells prior to reactivation and robust recognition shortly thereafter. A Gag-specific CD8+ T-cell clone failed to recognized infected cells under these conditions, corresponding with a lack of detectable Gag expression. We measured HIV-specific T-cell responses in 96 individuals who had been suppressed on ART for a median of 7 years, and observed a significant, direct correlation between cell-associated HIV DNA levels and magnitudes of IFN-γ-producing Nef/Tat/Rev-specific T-cell responses. This correlation was confirmed in an independent cohort (n = 18. Correlations were not detected between measures of HIV persistence and T-cell responses to other HIV antigens. The correlation with Nef/Tat/Rev-specific T-cells was attributable to Nef-specific responses, the breadth of which also correlated with HIV DNA levels. These results suggest that ongoing Nef expression in ART-treated individuals drives preferential maintenance and/or expansion of T-cells reactive to this protein, implying sensing of infected cells by the immune system. The direct correlation, however, suggests that recognition does not result in efficient elimination of infected cells. These results raise the possibility that

  9. p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer

    DEFF Research Database (Denmark)

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F

    2014-01-01

    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....

  10. Correlation between p53 expression and clinical-pathological characteristics of gastric cancer

    Directory of Open Access Journals (Sweden)

    Radovanović Dragče

    2011-01-01

    Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.

  11. Overexpression of p53 activated by small activating RNA suppresses the growth of human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Ge Q

    2016-01-01

    Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate

  12. 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) induces Fas-dependent activation-induced cell death in superantigen-primed T cells

    Energy Technology Data Exchange (ETDEWEB)

    Camacho, Iris A; Nagarkatti, Mitzi [Department of Microbiology and Immunology, Medical College of Virginia Campus, Virginia Commonwealth University, Richmond, VA 23298 (United States); Nagarkatti, Prakash S [Department of Pharmacology and Toxicology, PO Box 980613, Medical College of Virginia Campus, Virginia Commonwealth University, Richmond, VA 23298-0613 (United States)

    2002-10-01

    Immune response against a foreign antigen is characterized by a growth phase, in which antigen-specific T cells clonally expand, followed by a decline phase in which the activated T cells undergo apoptosis, a process termed activation-induced cell death (AICD). In the current study, we have investigated the phase at which 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) acts to downregulate the antigen-specific T cell response. To this end, C57BL/6 +/+ mice were injected with staphylococcal enterotoxin A (SEA) into the footpads (10 {mu}g/footpad), and simultaneously treated with TCDD (10 or 50 {mu}g/kg intraperitoneally). At various time points, the draining lymph node (LN) cells were analyzed for SEA-activated T cells. The data demonstrated that in C57BL/6 +/+ mice, TCDD treatment did not alter the growth phase but facilitated the decline phase of SEA-reactive T cells. TCDD caused a significant decrease in the percentage and absolute numbers of CD4{sup +} and CD8{sup +} SEA-responsive T cells expressing V{beta}3{sup +} and V{beta}11{sup +} but did not affect SEA-nonresponsive V{beta}8{sup +} T cells. Upon in vitro culture, TCDD-exposed SEA-immunized LN cells exhibited increased levels of apoptosis when compared with the vehicle controls. When Fas-deficient (C57BL/6 lpr/lpr) or Fas ligand defective (C57BL/6 gld/gld) mice were treated with TCDD, they failed to exhibit a decrease in percentage and cellularity of SEA-reactive T cells, thereby suggesting a role of Fas-Fas ligand interactions in the TCDD-induced downregulation of SEA-reactive T cell response. The resistance to TCDD-induced decrease in T cell responsiveness to SEA seen in Fas- and FasL-mutant mice was neither due to decreased aryl hydrocabon receptor (AhR) expression nor to altered T cell responsiveness to SEA. The current study demonstrates that TCDD does not prevent T cell activation, but prematurely induces Fas-based AICD, which may contribute to the deletion of antigen-primed T cells. (orig.)

  13. p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

    Science.gov (United States)

    Rieber, Manuel; Strasberg-Rieber, Mary

    2014-03-15

    Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  14. Bladder-like graphical representation of p53 gene alterations in some human cancers

    International Nuclear Information System (INIS)

    Helal, N.L.; Dorrah, M.; LI, C.

    2005-01-01

    the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

  15. Highly-Immunogenic Virally-Vectored T-cell Vaccines Cannot Overcome Subversion of the T-cell Response by HCV during Chronic Infection

    Directory of Open Access Journals (Sweden)

    Leo Swadling

    2016-08-01

    Full Text Available An effective therapeutic vaccine for the treatment of chronic hepatitis C virus (HCV infection, as an adjunct to newly developed directly-acting antivirals (DAA, or for the prevention of reinfection, would significantly reduce the global burden of disease associated with chronic HCV infection. A recombinant chimpanzee adenoviral (ChAd3 vector and a modified vaccinia Ankara (MVA, encoding the non-structural proteins of HCV (NSmut, used in a heterologous prime/boost regimen induced multi-specific, high-magnitude, durable HCV-specific CD4+ and CD8+ T-cell responses in healthy volunteers, and was more immunogenic than a heterologous Ad regimen. We now assess the immunogenicity of this vaccine regimen in HCV infected patients (including patients with a low viral load suppressed with interferon/ribavirin therapy, determine T-cell cross-reactivity to endogenous virus, and compare immunogenicity with that observed previously in both healthy volunteers and in HCV infected patients vaccinated with the heterologous Ad regimen. Vaccination of HCV infected patients with ChAd3-NSmut/MVA-NSmut was well tolerated. Vaccine-induced HCV-specific T-cell responses were detected in 8/12 patients; however, CD4+ T-cell responses were rarely detected, and the overall magnitude of HCV-specific T-cell responses was markedly reduced when compared to vaccinated healthy volunteers. Furthermore, HCV-specific cells had a distinct partially-functional phenotype (lower expression of activation markers, granzyme B, and TNFα production, weaker in vitro proliferation, and higher Tim3 expression, with comparable Tbet and Eomes expression compared to healthy volunteers. Robust anti-vector T-cells and antibodies were induced, showing that there is no global defect in immunity. The level of viremia at the time of vaccination did not correlate with the magnitude of the vaccine-induced T-cell response. Full-length, next-generation sequencing of the circulating virus demonstrated that T-cells

  16. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    International Nuclear Information System (INIS)

    Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A

    2012-01-01

    A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology

  17. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    Directory of Open Access Journals (Sweden)

    Kousparou Christina A

    2012-08-01

    Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.

  18. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  19. p53-independent early and late apoptosis is mediated by ceramide after exposure of tumor cells to photon or carbon ion irradiation

    International Nuclear Information System (INIS)

    Alphonse, Gersende; Maalouf, Mira; Battiston-Montagne, Priscillia; Ardail, Dominique; Beuve, Michaël; Rousson, Robert; Taucher-Scholz, Gisela; Fournier, Claudia; Rodriguez-Lafrasse, Claire

    2013-01-01

    To determine whether ceramide is responsible for the induction of p53-independent early or late apoptosis in response to high- and low-Linear-Energy-Transfer (LET) irradiation. Four cell lines displaying different radiosensitivities and p53-protein status were irradiated with photons or 33.4 or 184 keV/μm carbon ions. The kinetics of ceramide production was quantified by fluorescent microscopy or High-Performance-Liquid-Chromatogaphy and the sequence of events leading to apoptosis by flow cytometry. Regardless of the p53-status, both low and high-LET irradiation induced an early ceramide production in radiosensitive cells and late in the radioresistant. This production strongly correlated with the level of early apoptosis in radiosensitive cells and delayed apoptosis in the radioresistant ones, regardless of radiation quality, tumor type, radiosensitivity, or p53-status. Inhibition of caspase activity or ceramide production showed that, for both types of radiation, ceramide is essential for the initiation of early apoptosis in radiosensitive cells and late apoptosis following mitotic catastrophe in radioresistant cells. Ceramide is a determining factor in the onset of early and late apoptosis after low and high-LET irradiation and is the mediator of the p53-independent-apoptotic pathway. We propose that ceramide is the molecular bridge between mitotic catastrophe and the commitment phase of delayed apoptosis in response to irradiation

  20. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  1. Tracking of peptide-specific CD4+ T-cell responses after an acute resolving viral infection: a study of parvovirus B19

    DEFF Research Database (Denmark)

    Kasprowicz, Victoria; Isa, Adiba; Tolfvenstam, Thomas

    2006-01-01

    The evolution of peptide-specific CD4(+) T-cell responses to acute viral infections of humans is poorly understood. We analyzed the response to parvovirus B19 (B19), a ubiquitous and clinically significant pathogen with a compact and conserved genome. The magnitude and breadth of the CD4(+) T......-cell response to the two B19 capsid proteins were investigated using a set of overlapping peptides and gamma interferon-specific enzyme-linked immunospot assays of peripheral blood mononuclear cells (PBMCs) from a cohort of acutely infected individuals who presented with acute arthropathy. These were compared...... to those for a cohort of B19-specific immunoglobulin M-negative (IgM(-)), IgG(+) remotely infected individuals. Both cohorts of individuals were found to make broad CD4(+) responses. However, while the responses following acute infection were detectable ex vivo, responses in remotely infected individuals...

  2. Progesterone Prevents High-Grade Serous Ovarian Cancer by Inducing Necroptosis of p53-Defective Fallopian Tube Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Na-Yiyuan Wu

    2017-03-01

    Full Text Available High-grade serous ovarian carcinoma (HGSOC originates mainly from the fallopian tube (FT epithelium and always carries early TP53 mutations. We previously reported that tumors initiate in the FT fimbria epithelium because of apoptotic failure and the expansion of cells with DNA double-strand breaks (DSB caused by bathing of the FT epithelial cells in reactive oxygen species (ROSs and hemoglobin-rich follicular fluid (FF after ovulation. Because ovulation is frequent and HGSOC is rare, we hypothesized that luteal-phase progesterone (P4 could eliminate p53-defective FT cells. Here we show that P4, via P4 receptors (PRs, induces necroptosis in Trp53−/− mouse oviduct epithelium and in immortalized human p53-defective fimbrial epithelium through the TNF-α/RIPK1/RIPK3/MLKL pathway. Necroptosis occurs specifically at diestrus, recovers at the proestrus phase of the estrus cycle, and can be augmented with P4 supplementation. These results reveal the mechanism of the well-known ability of progesterone to prevent ovarian cancer.

  3. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  4. Role of signaling lymphocytic activation molecule in T helper cell responses

    Directory of Open Access Journals (Sweden)

    Jan E. de Vries

    1998-01-01

    Full Text Available Signaling lymphocytic activation molecule (SLAM; CDw150 is a 70 kDa glycoprotein. Signaling lymphocytic activation molecule is constitutively expressed on memory T cells, CD56+ T cells, a subset of T cell receptor γδ+ cells, immature thymocytes and, at low levels, on a proportion of peripheral blood B cells. Signaling lymphocytic activation molecule is rapidly upregulated on all T and B cells after activation. Engagement of SLAM by F(ab’2 fragments of an anti-SLAM monoclonal antibody (mAb A12 enhances antigen-specific T cell proliferation. In addition, mAb A12 was directly mitogenic for T cell clones and activated T cells. T cell proliferation induced by mAb A12 is independent of interleukin (IL-2, IL-4, IL-12 and IL-15, but is cyclosporin A sensitive. Ligation of SLAM during antigen-specific T cell proliferation resulted in upregulation of interferon (IFN-γ production, even by allergen-specific T helper cell (Th 2 clones, whereas the levels of IL-4 and IL-5 production were only marginally affected. The mAb A12 was unable to induce IL-4 and IL-5 production by Th1 clones. Co-stimulation of skin-derived Der P1-specific Th2 cells from patients with atopic dermatitis via SLAM resulted in the generation of a population of IFN-γ-producing cells, thereby reverting their phenotype to a Th0 pattern. Signaling lymphocytic activation molecule is a high-affinity self ligand mediating homophilic cell interaction. In addition, soluble SLAM enhances both T and B cell proliferation. Collectively, these data indicate that SLAM molecules act both as receptors and ligands that are not only involved in T cell expansion but also drive the expanding T cells during immune responses into the Th0/Th1 pathway. This suggests that signaling through SLAM plays a role in directing Th0/Th1 development.

  5. Enhanced Dendritic Cell-Mediated Antigen-Specific CD4+ T Cell Responses: IFN-Gamma Aids TLR Stimulation

    Directory of Open Access Journals (Sweden)

    Kuo-Ching Sheng

    2013-01-01

    Full Text Available Phenotypic maturation and T cell stimulation are two functional attributes of DCs critical for immune induction. The combination of antigens, including those from cancer, with Toll-like receptor (TLR ligands induces far superior cellular immune responses compared to antigen alone. In this study, IFN-gamma treatment of bone marrow-derived DC, followed by incubation with the TLR2, TLR4, or TLR9 agonists, enhanced DC activation compared to TLR ligation alone. Most notably, the upregulation of CD40 with LPS stimulation and CD86 with CpG stimulation was observed in in vitro cultures. Similarly, IFN-gamma coinjected with TLR ligands was able to promote DC activation in vivo, with DCs migrating from the site of immunization to the popliteal lymph nodes demonstrating increased expression of CD80 and CD86. The heightened DC activation translated to a drastic increase in T cell stimulatory capacity in both antigen independent and antigen dependent fashions. This is the first time that IFN-gamma has been shown to have a combined effect with TLR ligation to enhance DC activation and function. The results demonstrate the novel use of IFN-gamma together with TLR agonists to enhance antigen-specific T cell responses, for applications in the development of enhanced vaccines and drug targets against diseases including cancer.

  6. Effective CD4+ T-cell restoration in gut-associated lymphoid tissue of HIV-infected patients is associated with enhanced Th17 cells and polyfunctional HIV-specific T-cell responses.

    Science.gov (United States)

    Macal, M; Sankaran, S; Chun, T-W; Reay, E; Flamm, J; Prindiville, T J; Dandekar, S

    2008-11-01

    Human immunodeficiency virus (HIV) infection leads to severe CD4+ T-cell depletion in gut-associated lymphoid tissue (GALT) that persists despite the initiation of highly active antiretroviral therapy (HAART). It is not known whether restoration of gut mucosal CD4+ T cells and their functions is feasible during therapy and how that relates to immune correlates and viral reservoirs. Intestinal biopsies and peripheral blood samples from HIV-infected patients who were either HAART naive or on long-term HAART were evaluated. Our data demonstrated that gut CD4+ T-cell restoration ranged from modest (50%), compared with uninfected controls. Despite persistent CD4+ T-cell proviral burden and residual immune activation in GALT during HAART, effective CD4+ T-cell restoration (>50%) was achieved, which was associated with enhanced Th17 CD4+ T-cell accumulation and polyfunctional anti-HIV cellular responses. Our findings suggest that a threshold of>50% CD4+ T-cell restoration may be sufficient for polyfunctional HIV-specific T cells with implications in the evaluation of vaccines and therapeutics.

  7. p53 regulates the proliferation, differentiation and spontaneous transformation of mesenchymal stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Armesilla-Diaz, Alejandro, E-mail: aarmesilla@cib.csic.es [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain); Elvira, Gema; Silva, Augusto [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain)

    2009-12-10

    Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.

  8. Arecoline-induced phosphorylated p53 and p21(WAF1) protein expression is dependent on ATM/ATR and phosphatidylinositol-3-kinase in clone-9 cells.

    Science.gov (United States)

    Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea

    2009-06-01

    Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.

  9. Kinetics of T cell-activation molecules in response to Mycobacterium tuberculosis antigens

    Directory of Open Access Journals (Sweden)

    Antas Paulo RZ

    2002-01-01

    Full Text Available The phenotypic features acquired subsequent to antigen-specific stimulation in vitro were evaluated by means of the kinetic expressions of CD69 and CD25 activation molecules on T lymphocytes and assayed by flow cytometry in response to PPD, Ag85B, and ferritin in PPD-positive healthy control individuals. In response to PHA, CD69 staining on both CD4+ and CD8+ T cells became initially marked after 4 h, peaked at 24 h, and quickly decreased after 120 h. For CD25, a latter expression was detected around 8 h, having increased after 96 h. As expected, the response rate to the mycobacterial antigens was much lower than that to the mitogen. Positive staining was high after 96 h for CD25 and after 24 h for CD69. CD69 expression was significantly enhanced (p < 0.05 on CD8+ as compared to CD4+ T cells. High levels were also found between 96-120 h. Regarding Ag85B, CD25+ cells were mostly CD4+ instead of CD8+ T cells. Moreover, in response to ferritin, a lower CD25 expression was noted. The present data will allow further characterization of the immune response to new mycobacterial-specific antigens and their evaluation for possible inclusion in developing new diagnostic techniques for tuberculosis as well in a new vaccine to prevent the disease.

  10. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  11. Virus-specific regulatory T cells ameliorate encephalitis by repressing effector T cell functions from priming to effector stages.

    Directory of Open Access Journals (Sweden)

    Jingxian Zhao

    2014-08-01

    Full Text Available Several studies have demonstrated the presence of pathogen-specific Foxp3+ CD4 regulatory T cells (Treg in infected animals, but little is known about where and how these cells affect the effector T cell responses and whether they are more suppressive than bulk Treg populations. We recently showed the presence of both epitope M133-specific Tregs (M133 Treg and conventional CD4 T cells (M133 Tconv in the brains of mice with coronavirus-induced encephalitis. Here, we provide new insights into the interactions between pathogenic Tconv and Tregs responding to the same epitope. M133 Tregs inhibited the proliferation but not initial activation of M133 Tconv in draining lymph nodes (DLN. Further, M133 Tregs inhibited migration of M133 Tconv from the DLN. In addition, M133 Tregs diminished microglia activation and decreased the number and function of Tconv in the infected brain. Thus, virus-specific Tregs inhibited pathogenic CD4 T cell responses during priming and effector stages, particularly those recognizing cognate antigen, and decreased mortality and morbidity without affecting virus clearance. These cells are more suppressive than bulk Tregs and provide a targeted approach to ameliorating immunopathological disease in infectious settings.

  12. Human herpesvirus 6B inhibits cell proliferation by a p53-independent pathway

    DEFF Research Database (Denmark)

    Øster, Bodil; Kaspersen, M.D.; Kofod-Olsen, Emil

    2006-01-01

    BACKGROUND: Various forms of cellular stress can activate the tumour suppressor protein p53, an important regulator of cell cycle arrest, apoptosis, and cellular senescence. Cells infected by human herpesvirus 6B (HHV-6B) accumulate aberrant amounts of p53. OBJECTIVES: The aim of this study...

  13. p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells

    International Nuclear Information System (INIS)

    Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.

    2003-01-01

    The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC

  14. Disposable Amperometric Immunosensor for the Determination of Human P53 Protein in Cell Lysates Using Magnetic Micro-Carriers

    Directory of Open Access Journals (Sweden)

    María Pedrero

    2016-11-01

    Full Text Available An amperometric magnetoimmunosensor for the determination of human p53 protein is described in this work using a sandwich configuration involving the covalent immobilization of a specific capture antibody onto activated carboxylic-modified magnetic beads (HOOC-MBs and incubation of the modified MBs with a mixture of the target protein and horseradish peroxidase-labeled antibody (HRP-anti-p53. The resulting modified MBs are captured by a magnet placed under the surface of a disposable carbon screen-printed electrode (SPCE and the amperometric responses are measured at −0.20 V (vs. an Ag pseudo-reference electrode, upon addition of hydroquinone (HQ as a redox mediator and H2O2 as the enzyme substrate. The magnetoimmunosensing platform was successfully applied for the detection of p53 protein in different cell lysates without any matrix effect after a simple sample dilution. The results correlated accurately with those provided by a commercial ELISA kit, thus confirming the immunosensor as an attractive alternative for rapid and simple determination of this protein using portable and affordable instrumentation.

  15. Correlation between Expression of MVP, Index of p53 and AgNOR Value with Chemoradiotherapy Clinical Response of Cervical Cancer

    Directory of Open Access Journals (Sweden)

    I. Kurnia

    2014-12-01

    Full Text Available Cervical cancer is the most frequent cancer found in Indonesia. The primary treatment of cervical cancer at the locally advanced stage is usually performed by using radiotherapy and chemotherapy. The combination of the two techniques is often called chemoradioherapy. The response to chemoradiotherapy is influenced by biological and physical factors. Major vault protein (MVP is a ribonucleoprotein which contributes to drug resistance in some cancers. The purposes of this research were: (1 to determine the correlation between the expression of MVP and the index of p53, including AgNOR values and index of MIB-1; and (2 between MVP and chemoradiotherapy clinical response of cervical cancer. Twenty-one microscopic slides taken from biopsy tissues of cervical cancer patients before undergoing treatment were stained to identify MVP, p53, and MIB-1 by means of immunohistochemistry techniques and AgNORs staining. After undergoing chemoradiotherapy treatment, the patients’ clinical responses were observed by pelvic control method. Experimental results showed that there was a correlation between MVP and AgNOR value (P=0.05, but no correlation between MVP and index of p53 (P=0.729, including MIB-1 LI (P=0.63, in untreated cervical cancer. In addition, there was no association between MVP and chemoradioterapy response. In conclusion, MVP expression correlates with the process of cell proliferation before the G2 phase of cell cycle in untreated cancer cells. Those have no association with clinical responses after the completion of treatment.

  16. Correlation between expression of MVP, index of p53 and AgNOR value with chemoradiotherapy clinical response of cervical cancer

    International Nuclear Information System (INIS)

    Kurnia, I.; Tetriana, D.; Siregar, B.; Ramli, I.; Andrijono, A.; Soetopo, S.; Kurjana, T.; Hernowo, B.S.; Tobing, M.D.M.

    2014-01-01

    Cervical cancer is the most frequent cancer found in Indonesia. The primary treatment of cervical cancer at the locally advanced stage is usually performed by using radiotherapy and chemotherapy. The combination of the two techniques is often called chemoradiotherapy. The response to chemoradiotherapy is influenced by biological and physical factors. Major vault protein (MVP) is a ribonucleoprotein which contributes to drug resistance in some cancers. The purposes of this research were: (1) to determine the correlation between the expression of MVP and the index of p53, including AgNOR values and index of MIB-1; and (2) between MVP and chemoradiotherapy clinical response of cervical cancer. Twenty-one microscopic slides taken from biopsy tissues of cervical cancer patients before undergoing treatment were stained to identify MVP, p53, and MIB-1 by means of immunohistochemistry techniques and AgNORs staining. After undergoing chemoradiotherapy treatment, the patients’ clinical responses were observed by pelvic control method. Experimental results showed that there was a correlation between MVP and AgNOR value (P=0.05), but no correlation between MVP and index of p53 (P=0.729), including MIB-1 LI (P=0.63), in untreated cervical cancer. In addition, there was no association between MVP and chemoradiotherapy response. In conclusion, MVP expression correlates with the process of cell proliferation before the G2 phase of cell cycle in untreated cancer cells. Those have no association with clinical responses after the completion of treatment. (author)

  17. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

    Science.gov (United States)

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

    2003-08-01

    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

  18. Prognostic implications of molecular and immunohistochemical profiles of the Rb and p53 cell cycle regulatory pathways in primary non-small cell lung carcinoma.

    LENUS (Irish Health Repository)

    Burke, Louise

    2012-02-03

    PURPOSE: Many studies have highlighted the aberrant expression and prognostic significance of individual proteins in either the Rb (particularly cyclin D1, p16INK4A, and pRb) or the p53 (p53 and p21Waf1) pathways in non-small cell lung cancer. We hypothesize that cumulative abnormalities within each and between these pathways would have significant prognostic potential regarding survival. EXPERIMENTAL DESIGN: Our study population consisted of 106 consecutive surgically resected cases of predominantly early-stage non-small cell lung cancer from the National Cancer Institute-Mayo Clinic series, and assessment of proteins involved both immunohistochemical (cyclin D1, p21Waf1, pRb, p16INK4A, and p53) and mutational analysis (p53) in relationship to staging and survival. RESULTS: Cyclin D1 overexpression was noted in 48% of the tumors, p16INK4A negative in 53%, pRb negative in 17%, p53 immunopositive in 50%, p53 mutation frequency in 48%, and p21(Waf1) overexpression in 47%, none with prognostic significance. Cyclin D1 overexpression in pRb-negative tumors revealed a significantly worse prognosis with a mean survival of 2.3 years (P = 0.004). A simultaneous p53 mutation dramatically reduced the mean survival time to 0.9 years (P = 0.007). Cyclin D1 overexpression with either a p53 mutation or a p53 overexpression was also associated with a significantly poorer prognosis (P = 0.0033 and 0.0063, respectively). CONCLUSIONS: Some cumulative abnormalities in the Rb and p53 pathways (e.g., cyclin D1 overexpression and p53 mutations) significantly cooperate to predict a poor prognosis; however, the complexity of the cell cycle protein interaction in any given tumor warrants caution in interpreting survival results when specific protein abnormalities are taken in isolation.

  19. Effect of p53 activation on cell growth, thymidine kinase-1 activity, and 3'-deoxy-3'fluorothymidine uptake

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, Jeffrey L. E-mail: jschwart@u.washington.edu; Tamura, Yasuko; Jordan, Robert; Grierson, John R.; Krohn, Kenneth A

    2004-05-01

    The use of thymidine (TdR) and thymidine analogs such as 3'-deoxy-3'-fluorothymidine (FLT) as positron emission tomography (PET)-based tracers of tumor proliferation rate is based on the hypothesis that measurement of uptake of these nucleosides, a function primarily of thymidine kinase-1 (TK{sub 1}) activity, provides an accurate measure of cell proliferation in tumors. Tumor growth is influenced by many factors including the oxygen concentration within tumors and whether tumor cells have been exposed to cytotoxic therapies. The p53 gene plays an important role in regulating growth under both of these conditions. The goal of this study was to investigate the influence of p53 activation on cell growth, TK{sub 1} activity, and FLT uptake. To accomplish this, TK{sub 1} activity, S phase fraction, and the uptake of FLT were determined in plateau-phase and exponentially growing cultures of an isogenic pair of human tumor cell lines in which p53 expression was normal or inactivated by human papilloma virus type 16 E6 expression. Ionizing radiation exposure was used to stimulate p53 activity and to induce alterations in cell cycle progression. We found that exposure of cells to ionizing radiation induced dose-dependent changes in cell cycle progression in both cell lines. The relationship between S phase percentage, TK{sub 1} activity, and FLT uptake were essentially unchanged in the p53-normal cell line. In contrast, TK{sub 1} activity and FLT uptake remained high in the p53-deficient variant even when S phase percentage was low due to a p53-dependent G2 arrest. We conclude that a functional p53 response is required to maintain the normal relationship between TK1 activity and S phase percentage following radiation exposure.

  20. Efficacy and toxicity management of CAR-T-cell immunotherapy: a matter of responsiveness control or tumour-specificity?

    Science.gov (United States)

    Alonso-Camino, Vanesa; Harwood, Seandean Lykke; Álvarez-Méndez, Ana; Alvarez-Vallina, Luis

    2016-04-15

    Chimaeric antigen receptor (CAR)-expressing T-cells have demonstrated potent clinical efficacy in patients with haematological malignancies. However, the use of CAR-T-cells targeting solid tumour-associated antigens (TAAs) has been limited by organ toxicities related to activation of T-cell effector functions through the CAR. Most existing CARs recognize TAAs, which are also found in normal tissues. CAR-T-cell-mediated destruction of normal tissues constitutes a major roadblock to CAR-T-cell therapy, and must be avoided or mitigated. There is a broad range of strategies for modulating antigen responsiveness of CAR-T-cells, with varying degrees of complexity. Some of them might ameliorate the acute and chronic toxicities associated with current CAR constructs. However, further embellishments to CAR therapy may complicate clinical implementation and possibly create new immunogenicity issues. In contrast, the development of CARs targeting truly tumour-specific antigens might circumvent on-target/off-tumour toxicities without adding additional complexity to CAR-T-cell therapies, but these antigens have been elusive and may require novel selection strategies for their discovery. © 2016 Authors; published by Portland Press Limited.

  1. Phase 1 trial of ALT-801, an interleukin-2/T cell receptor fusion protein targeting p53 (aa264-272)/HLA-A*0201 complex, in patients with advanced malignancies

    Science.gov (United States)

    Fishman, Mayer N.; Thompson, John A.; Pennock, Gregory K.; Gonzalez, Rene; Diez, Luz M.; Daud, Adil I.; Weber, Jeffery S.; Huang, Bee Y.; Tang, Shamay; Rhode, Peter R.; Wong, Hing C.

    2014-01-01

    Purpose ALT-801 is a bifunctional fusion protein comprising interleukin-2 (IL-2) linked to a soluble, single-chain T cell receptor domain that recognizes a peptide epitope (aa264-272) of the human p53 antigen displayed on cancer cells in the context of HLA-A*0201 (p53+/HLA-A*0201). We evaluated the safety, pharmacokinetics and pharmacodynamics of ALT-801 in p53+/HLA-A*0201 patients with metastatic malignancies. Experimental Design p53+/HLA-A*0201 patients were treated with ALT-801 on a schedule of 4 daily 15-minute intravenous infusions, then 10 days rest and 4 more daily infusions. Cohorts of patients were treated at 0.015, 0.040, and 0.080 mg/kg/dose. Results Four, sixteen, and six patients were treated at the 0.015, 0.04 and 0.08 mg/kg cohorts, respectively. Two dose limiting toxicities (a grade 4 transient thrombocytopenia and a myocardial infarction) in the 0.08 mg/kg cohort established the maximum tolerated dose (MTD) at 0.04 mg/kg. Patients treated at the MTD experienced toxicities similar to those associated with high-dose IL-2 but of lesser severity. The serum half-life of ALT-801 was 4 hours and ALT-801 serum recovery was as expected based on the dose administered. ALT-801 treatment induced an increase of serum interferon-γ but not tumor necrosis factor-α. Response assessment showed 10 subjects with stable disease at at least 11 weeks, and in one who had melanoma metastasis, there is an ongoing complete absence of identifiable disease after resection of radiographically identified lesions. Conclusion This first-in-man study defines an ALT-801 regimen that can be administered safely and is associated with immunological changes of potential antitumor relevance. PMID:21994418

  2. Potential contribution of a novel Tax epitope-specific CD4+ T cells to graft-versus-Tax effect in adult T cell leukemia patients after allogeneic hematopoietic stem cell transplantation.

    Science.gov (United States)

    Tamai, Yotaro; Hasegawa, Atsuhiko; Takamori, Ayako; Sasada, Amane; Tanosaki, Ryuji; Choi, Ilseung; Utsunomiya, Atae; Maeda, Yasuhiro; Yamano, Yoshihisa; Eto, Tetsuya; Koh, Ki-Ryang; Nakamae, Hirohisa; Suehiro, Youko; Kato, Koji; Takemoto, Shigeki; Okamura, Jun; Uike, Naokuni; Kannagi, Mari

    2013-04-15

    Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is an effective treatment for adult T cell leukemia/lymphoma (ATL) caused by human T cell leukemia virus type 1 (HTLV-1). We previously reported that Tax-specific CD8(+) cytotoxic T lymphocyte (CTL) contributed to graft-versus-ATL effects in ATL patients after allo-HSCT. However, the role of HTLV-1-specific CD4(+) T cells in the effects remains unclear. In this study, we showed that Tax-specific CD4(+) as well as CD8(+) T cell responses were induced in some ATL patients following allo-HSCT. To further analyze HTLV-1-specific CD4(+) T cell responses, we identified a novel HLA-DRB1*0101-restricted epitope, Tax155-167, recognized by HTLV-1-specific CD4(+) Th1-like cells, a major population of HTLV-1-specific CD4(+) T cell line, which was established from an ATL patient at 180 d after allo-HSCT from an unrelated seronegative donor by in vitro stimulation with HTLV-1-infected cells from the same patient. Costimulation of PBMCs with both the identified epitope (Tax155-167) and known CTL epitope peptides markedly enhanced the expansion of Tax-specific CD8(+) T cells in PBMCs compared with stimulation with CTL epitope peptide alone in all three HLA-DRB1*0101(+) patients post-allo-HSCT tested. In addition, direct detection using newly generated HLA-DRB1*0101/Tax155-167 tetramers revealed that Tax155-167-specific CD4(+) T cells were present in all HTLV-1-infected individuals tested, regardless of HSCT. These results suggest that Tax155-167 may be the dominant epitope recognized by HTLV-1-specific CD4(+) T cells in HLA-DRB1*0101(+)-infected individuals and that Tax-specific CD4(+) T cells may augment the graft-versus-Tax effects via efficient induction of Tax-specific CD8(+) T cell responses.

  3. Mammary-specific inactivation of E-cadherin and p53 impairs functional gland development and leads to pleomorphic invasive lobular carcinoma in mice

    Directory of Open Access Journals (Sweden)

    Patrick W. B. Derksen

    2011-05-01

    Breast cancer is the most common malignancy in women of the Western world. Even though a large percentage of breast cancer patients show pathological complete remission after standard treatment regimes, approximately 30–40% are non-responsive and ultimately develop metastatic disease. To generate a good preclinical model of invasive breast cancer, we have taken a tissue-specific approach to somatically inactivate p53 and E-cadherin, the cardinal cell-cell adhesion receptor that is strongly associated with tumor invasiveness. In breast cancer, E-cadherin is found mutated or otherwise functionally silenced in invasive lobular carcinoma (ILC, which accounts for 10–15% of all breast cancers. We show that mammary-specific stochastic inactivation of conditional E-cadherin and p53 results in impaired mammary gland function during pregnancy through the induction of anoikis resistance of mammary epithelium, resulting in loss of epithelial organization and a dysfunctional mammary gland. Moreover, combined inactivation of E-cadherin and p53 induced lactation-independent development of invasive and metastatic mammary carcinomas, which showed strong resemblance to human pleomorphic ILC. Dissemination patterns of mouse ILC mimic the human malignancy, showing metastasis to the gastrointestinal tract, peritoneum, lung, lymph nodes and bone. Our results confirm that loss of E-cadherin contributes to both mammary tumor initiation and metastasis, and establish a preclinical mouse model of human ILC that can be used for the development of novel intervention strategies to treat invasive breast cancer.

  4. Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.

    Science.gov (United States)

    Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles

    2006-10-16

    The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.

  5. Multipolar mitosis of tetraploid cells: inhibition by p53 and dependency on Mos.

    Science.gov (United States)

    Vitale, Ilio; Senovilla, Laura; Jemaà, Mohamed; Michaud, Mickaël; Galluzzi, Lorenzo; Kepp, Oliver; Nanty, Lisa; Criollo, Alfredo; Rello-Varona, Santiago; Manic, Gwenola; Métivier, Didier; Vivet, Sonia; Tajeddine, Nicolas; Joza, Nicholas; Valent, Alexander; Castedo, Maria; Kroemer, Guido

    2010-04-07

    Tetraploidy can constitute a metastable intermediate between normal diploidy and oncogenic aneuploidy. Here, we show that the absence of p53 is not only permissive for the survival but also for multipolar asymmetric divisions of tetraploid cells, which lead to the generation of aneuploid cells with a near-to-diploid chromosome content. Multipolar mitoses (which reduce the tetraploid genome to a sub-tetraploid state) are more frequent when p53 is downregulated and the product of the Mos oncogene is upregulated. Mos inhibits the coalescence of supernumerary centrosomes that allow for normal bipolar mitoses of tetraploid cells. In the absence of p53, Mos knockdown prevents multipolar mitoses and exerts genome-stabilizing effects. These results elucidate the mechanisms through which asymmetric cell division drives chromosomal instability in tetraploid cells.

  6. Strategies to overcome HBV-specific T cell exhaustion: checkpoint inhibitors and metabolic re-programming.

    Science.gov (United States)

    Fisicaro, Paola; Boni, Carolina; Barili, Valeria; Laccabue, Diletta; Ferrari, Carlo

    2018-01-29

    HBV-specific T cells play a key role in antiviral protection and failure to control HBV is associated with severely dysfunctional T cell responses. Therefore, functional T cell reconstitution represents a potential way to treat chronically infected patients. The growing understanding of the dysregulated transcriptional/epigenetic and metabolic programs underlying T cell exhaustion allows to envisage functional T cell reconstitution strategies based on the combined/sequential use of compounds able to induce decline of antigen load, checkpoint modulation, metabolic and epigenetic reprogramming with possible boosting of functionally restored responses by specific vaccines. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Human T-Cell Clones from Autoimmune Thyroid Glands: Specific Recognition of Autologous Thyroid Cells

    Science.gov (United States)

    Londei, Marco; Bottazzo, G. Franco; Feldmann, Marc

    1985-04-01

    The thyroid glands of patients with autoimmune diseases such as Graves' disease and certain forms of goiter contain infiltrating activated T lymphocytes and, unlike cells of normal glands, the epithelial follicular cells strongly express histocompatability antigens of the HLA-DR type. In a study of such autoimmune disorders, the infiltrating T cells from the thyroid glands of two patients with Graves' disease were cloned in mitogen-free interleukin-2 (T-cell growth factor). The clones were expanded and their specificity was tested. Three types of clones were found. One group, of T4 phenotype, specifically recognized autologous thyroid cells. Another, also of T4 phenotype, recognized autologous thyroid or blood cells and thus responded positively in the autologous mixed lymphocyte reaction. Other clones derived from cells that were activated in vivo were of no known specificity. These clones provide a model of a human autoimmune disease and their analysis should clarify mechanisms of pathogenesis and provide clues to abrogating these undesirable immune responses.

  8. A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

    Directory of Open Access Journals (Sweden)

    Alfredo Ribeiro-Silva

    2003-06-01

    Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

  9. iNKT cells suppress the CD8+ T cell response to a murine Burkitt's-like B cell lymphoma.

    Directory of Open Access Journals (Sweden)

    Ryan L Bjordahl

    Full Text Available The T cell response to B cell lymphomas differs from the majority of solid tumors in that the malignant cells themselves are derived from B lymphocytes, key players in immune response. B cell lymphomas are therefore well situated to manipulate their surrounding microenvironment to enhance tumor growth and minimize anti-tumor T cell responses. We analyzed the effect of T cells on the growth of a transplantable B cell lymphoma and found that iNKT cells suppressed the anti-tumor CD8(+ T cell response. Lymphoma cells transplanted into syngeneic wild type (WT mice or Jalpha18(-/- mice that specifically lack iNKT cells grew initially at the same rate, but only the mice lacking iNKT cells were able to reject the lymphoma. This effect was due to the enhanced activity of tumor-specific CD8(+ T cells in the absence of iNKT cells, and could be partially reversed by reconstitution of iNKT cells in Jalpha 18(-/- mice. Treatment of tumor-bearing WT mice with alpha -galactosyl ceramide, an activating ligand for iNKT cells, reduced the number of tumor-specific CD8(+ T cells. In contrast, lymphoma growth in CD1d1(-/- mice that lack both iNKT and type II NKT cells was similar to that in WT mice, suggesting that type II NKT cells are required for full activation of the anti-tumor immune response. This study reveals a tumor-promoting role for iNKT cells and suggests their capacity to inhibit the CD8(+ T cell response to B cell lymphoma by opposing the effects of type II NKT cells.

  10. CMV-specific CD8 T Cell Differentiation and Localization: Implications for Adoptive Therapies

    Directory of Open Access Journals (Sweden)

    Corinne J Smith

    2016-09-01

    Full Text Available Human cytomegalovirus (HCMV is a ubiquitous virus that causes chronic infection, and thus is one of the most common infectious complications of immune suppression. Adoptive transfer of HCMV-specific T cells has emerged as an effective method to reduce the risk for HCMV infection and/or reactivation by restoring immunity in transplant recipients. However, the CMV-specific CD8+ T cell response is comprised of a heterogenous mixture of subsets with distinct functions and localization and it is not clear if current adoptive immunotherapy protocols can reconstitute the full spectrum of CD8+ T cell immunity. The aim of this review is to briefly summarize the role of these T cell subsets in CMV immunity and to describe how current adoptive immunotherapy practices might affect their reconstitution in patients. The bulk of the CMV-specific CD8+ T cell population is made up of terminally differentiated effector T cells with immediate effector function and a short life span. Self-renewing memory T cells within the CMV-specific population retain the capacity to expand and differentiate upon challenge and are important for the long-term persistence of the CD8+ T cell response. Finally mucosal organs, which are frequent sites of CMV reactivation, are primarily inhabited by tissue resident memory T cells, which do not recirculate. Future work on adoptive transfer strategies may need to focus on striking a balance between the formation of these subsets to ensure the development of long lasting and protective immune responses that can access the organs affected by CMV disease.

  11. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    Science.gov (United States)

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  12. Infections with Plasmodium falciparum during pregnancy affect VAR2CSA DBL-5 domain-specific T cell cytokine responses

    DEFF Research Database (Denmark)

    Gbédandé, Komi; Cottrell, Gilles; Vianou, Bertin

    2016-01-01

    BACKGROUND: Current knowledge of human immunological responses to pregnancy-associated malaria-specific Plasmodium falciparum protein VAR2CSA concerns almost exclusively B cell-driven antibody-mediated activity. Knowledge of VAR2CSA-specific T cell-mediated activity is minimal by comparison, with...

  13. Human Cytomegalovirus (HCMV)-Specific CD4+ T Cells Are Polyfunctional and Can Respond to HCMV-Infected Dendritic Cells In Vitro.

    Science.gov (United States)

    Jackson, Sarah E; Sedikides, George X; Mason, Gavin M; Okecha, Georgina; Wills, Mark R

    2017-03-15

    Human cytomegalovirus (HCMV) infection and periodic reactivation are generally well controlled by the HCMV-specific T cell response in healthy people. While the CD8 + T cell response to HCMV has been extensively studied, the HCMV-specific CD4 + T cell effector response is not as well understood, especially in the context of direct interactions with HCMV-infected cells. We screened the gamma interferon (IFN-γ) and interleukin-10 (IL-10) responses to 6 HCMV peptide pools (pp65, pp71, IE1, IE2, gB, and US3, selected because they were the peptides most frequently responded to in our previous studies) in 84 donors aged 23 to 74 years. The HCMV-specific CD4 + T cell response to pp65, IE1, IE2, and gB was predominantly Th1 biased, with neither the loss nor the accumulation of these responses occurring with increasing age. A larger proportion of donors produced an IL-10 response to pp71 and US3, but the IFN-γ response was still dominant. CD4 + T cells specific to the HCMV proteins studied were predominantly effector memory cells and produced both cytotoxic (CD107a expression) and cytokine (macrophage inflammatory protein 1β secretion) effector responses. Importantly, when we measured the CD4 + T cell response to cytomegalovirus (CMV)-infected dendritic cells in vitro , we observed that the CD4 + T cells produced a range of cytotoxic and secretory effector functions, despite the presence of CMV-encoded immune evasion molecules. CD4 + T cell responses to HCMV-infected dendritic cells were sufficient to control the dissemination of virus in an in vitro assay. Together, the results show that HCMV-specific CD4 + T cell responses, even those from elderly individuals, are highly functional and are directly antiviral. IMPORTANCE Human cytomegalovirus (HCMV) infection is carried for a lifetime and in healthy people is kept under control by the immune system. HCMV has evolved many mechanisms to evade the immune response, possibly explaining why the virus is never eliminated

  14. A novel protective MHC-I haplotype not associated with dominant Gag-specific CD8+ T-cell responses in SIVmac239 infection of Burmese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Naofumi Takahashi

    Full Text Available Several major histocompatibility complex class I (MHC-I alleles are associated with lower viral loads and slower disease progression in human immunodeficiency virus (HIV and simian immunodeficiency virus (SIV infections. Immune-correlates analyses in these MHC-I-related HIV/SIV controllers would lead to elucidation of the mechanism for viral control. Viral control associated with some protective MHC-I alleles is attributed to CD8+ T-cell responses targeting Gag epitopes. We have been trying to know the mechanism of SIV control in multiple groups of Burmese rhesus macaques sharing MHC-I genotypes at the haplotype level. Here, we found a protective MHC-I haplotype, 90-010-Id (D, which is not associated with dominant Gag-specific CD8+ T-cell responses. Viral loads in five D+ animals became significantly lower than those in our previous cohorts after 6 months. Most D+ animals showed predominant Nef-specific but not Gag-specific CD8+ T-cell responses after SIV challenge. Further analyses suggested two Nef-epitope-specific CD8+ T-cell responses exerting strong suppressive pressure on SIV replication. Another set of five D+ animals that received a prophylactic vaccine using a Gag-expressing Sendai virus vector showed significantly reduced viral loads compared to unvaccinated D+ animals at 3 months, suggesting rapid SIV control by Gag-specific CD8+ T-cell responses in addition to Nef-specific ones. These results present a pattern of SIV control with involvement of non-Gag antigen-specific CD8+ T-cell responses.

  15. Rapamycin and CHIR99021 Coordinate Robust Cardiomyocyte Differentiation From Human Pluripotent Stem Cells Via Reducing p53-Dependent Apoptosis.

    Science.gov (United States)

    Qiu, Xiao-Xu; Liu, Yang; Zhang, Yi-Fan; Guan, Ya-Na; Jia, Qian-Qian; Wang, Chen; Liang, He; Li, Yong-Qin; Yang, Huang-Tian; Qin, Yong-Wen; Huang, Shuang; Zhao, Xian-Xian; Jing, Qing

    2017-10-02

    Cardiomyocytes differentiated from human pluripotent stem cells can serve as an unexhausted source for a cellular cardiac disease model. Although small molecule-mediated cardiomyocyte differentiation methods have been established, the differentiation efficiency is relatively unsatisfactory in multiple lines due to line-to-line variation. Additionally, hurdles including line-specific low expression of endogenous growth factors and the high apoptotic tendency of human pluripotent stem cells also need to be overcome to establish robust and efficient cardiomyocyte differentiation. We used the H9-human cardiac troponin T-eGFP reporter cell line to screen for small molecules that promote cardiac differentiation in a monolayer-based and growth factor-free differentiation model. We found that collaterally treating human pluripotent stem cells with rapamycin and CHIR99021 during the initial stage was essential for efficient and reliable cardiomyocyte differentiation. Moreover, this method maintained consistency in efficiency across different human embryonic stem cell and human induced pluripotent stem cell lines without specifically optimizing multiple parameters (the efficiency in H7, H9, and UQ1 human induced pluripotent stem cells is 98.3%, 93.3%, and 90.6%, respectively). This combination also increased the yield of cardiomyocytes (1:24) and at the same time reduced medium consumption by about 50% when compared with the previous protocols. Further analysis indicated that inhibition of the mammalian target of rapamycin allows efficient cardiomyocyte differentiation through overcoming p53-dependent apoptosis of human pluripotent stem cells during high-density monolayer culture via blunting p53 translation and mitochondrial reactive oxygen species production. We have demonstrated that mammalian target of rapamycin exerts a stage-specific and multifaceted regulation over cardiac differentiation and provides an optimized approach for generating large numbers of functional

  16. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  17. Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression

    Directory of Open Access Journals (Sweden)

    Shang-Jui Wang

    2016-10-01

    Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.

  18. Platelet-derived growth factor (PDGF)-signaling mediates radiation-induced apoptosis in human prostate cancer cells with loss of p53 function

    International Nuclear Information System (INIS)

    Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.

    1997-01-01

    Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo

  19. Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.

    Science.gov (United States)

    Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C

    2017-12-01

    Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Upregulation of bacterial-specific Th1 and Th17 responses that are enriched in CXCR5+CD4+ T cells in non-small cell lung cancer.

    Science.gov (United States)

    Ma, Qin-Yun; Huang, Da-Yu; Zhang, Hui-Jun; Wang, Shaohua; Chen, Xiao-Feng

    2017-11-01

    The microbial community in the mucosal surfaces is involved in the development of human cancers, including gastric cancer and colorectal cancer. The respiratory tract in the lung also hosts a distinctive microbial community, but the correlation between this community and lung cancer is largely unknown. Here, we examined the Th1 and Th17 responses toward several bacterial antigens, in CD4 + T cells sourced from the peripheral blood (PB), the lung cancer (LC) tissue, and the gastrointestinal (GI) tract of non-small cell lung cancer (NSCLC) patients. Compared to healthy controls, the NSCLC patients presented significantly higher frequencies of Th1 and Th17 cells reacting to Streptococcus salivarius and S. agalactiae, in the PB, LC, and GI tract. Further investigation showed that the upregulation in anti-bacteria response was likely antigen-specific for two reasons. Firstly, the frequencies of Th1 and Th17 cells reacting to Escherichia coli, a typical GI bacterium, were not upregulated in the PB and the LC of NSCLC patients. Secondly, the S. salivarius and S. agalactiae responses could be partially blocked by Tü39, a MHC class II blocking antibody, suggesting that antigen-specific interaction between CD4 + T cells and antigen-presenting cells was required. We also found that S. salivarius and S. agalactiae could potently activate the monocytes to secrete higher levels of interleukin (IL)-6, IL-12, and tumor necrosis factor, which were Th1- and Th17-skewing cytokines. Interestingly, whereas CXCR5 + CD4 + T cells represented <20% of total CD4 + T cells, they represented 17%-82% of bacteria-specific Th1 or Th17 cells. Together, these data demonstrated that NSCLC patients presented a significant upregulation of bacterial-specific Th1 and Th17 responses that were enriched in CXCR5 + CD4 + T cells. Copyright © 2017 Elsevier B.V. All rights reserved.