WorldWideScience

Sample records for p53-inducible gene product

  1. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  2. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  3. Infrequent alterations of the P53 gene in rat skin cancers induced by ionising-radiation

    International Nuclear Information System (INIS)

    Jin, Y.; Burns, F.J.; Garte, S.J.; Hosselet, S.; New York Univ., NY

    1996-01-01

    Radiation carcinogenesis almost certainly involves multiple genetic alterations. Identification of such genetic alterations would provide information to help understand better the molecular mechanism or radiation carcinogenesis. The energy released by ionizing radiation has the potential to produce DNA strand breaks, major gene deletions or rearrangements, and other base damages. Alterations of the p53 gene, a common tumour suppressor gene altered in human cancers, were examined in radiation-induced rat skin cancers. Genomic DNA from a total of 33rat skin cancers induced by ionizing radiation was examined by Southern blot hybridization for abnormal restriction fragment patterns in the p53 gene. A abnormal p53 restriction pattern was found in one of 16 cancers induced by electron radiation and in one of nine cancers induced by neon ions. The genomic DNA from representative cancers, including the two with an abnormal restriction pattern was further examined by polymerase chain reaction amplification and direct sequencing in exons 5-8 of the p53 gene. The results showed that one restriction fragment length polymorphism (RFLP)-positive cancer induced by electron radiation had a partial gene deletion which was defined approximately between exons 2-8, while none of the other cancers showed sequence changes. Our results indicate that the alterations in the critical binding region of the p53 gene are infrequent in rat skin cancers induced by either electron or neon ion radiation. (Author)

  4. Chronic ultraviolet exposure-induced p53 gene alterations in sencar mouse skin carcinogenesis model

    International Nuclear Information System (INIS)

    Tong, Ying; Smith, M.A.; Tucker, S.B.

    1997-01-01

    Alterations of the tumor suppressor gene p53 have been found in ultraviolet radiation (UVR) related human skin cancers and in UVR-induced murine skin tumors. However, links between p53 gene alterations and the stages of carcinogenesis induced by UVR have not been clearly defined. We established a chronic UVR exposure-induced Sencar mouse skin carcinogenesis model to determine the frequency of p53 gene alterations in different stages of carcinogenesis, including UV-exposed skin, papillomas, squamous-cell carcinomas (SCCs), and malignant spindle-cell tumors (SCTs). A high incidence of SCCs and SCTs were found in this model. Positive p53 nuclear staining was found in 10137 (27%) of SCCs and 12124 (50%) of SCTs, but was not detected in normal skin or papillomas. DNA was isolated from 40 paraffin-embedded normal skin, UV-exposed skin, and tumor sections. The p53 gene (exons 5 and 6) was amplified from the sections by using nested polymerase chain reaction (PCR). Subsequent single-strand conformation polymorphism (SSCP) assay and sequencing analysis revealed one point mutation in exon 6 (coden 193, C → A transition) from a UV-exposed skin sample, and seven point mutations in exon 5 (codens 146, 158, 150, 165, and 161, three C → T, two C → A, one C → G, and one A → T transition, respectively) from four SCTs, two SCCs and one UV-exposed skin sample. These experimental results demonstrate that alterations in the p53 gene are frequent events in chronic UV exposure-induced SCCs and later stage SCTs in Sencar mouse skin. 40 refs., 5 figs., 1 tab

  5. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  6. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  7. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  8. The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

    Directory of Open Access Journals (Sweden)

    Jennifer M. Smith

    2007-12-01

    Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

  9. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  10. Gene expression patterns associated with p53 status in breast cancer

    International Nuclear Information System (INIS)

    Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

    2006-01-01

    Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

  11. Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeyran eShahbazi

    2013-05-01

    Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

  12. Molecular mechanism of X-ray-induced p53-dependent apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

    1999-03-01

    Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

  13. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    Science.gov (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  14. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  15. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    Science.gov (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  16. Overexpression of the p53 tumor suppressor gene product in primary lung adenocarcinomas is associated with cigarette smoking

    NARCIS (Netherlands)

    Westra, W. H.; Offerhaus, G. J.; Goodman, S. N.; Slebos, R. J.; Polak, M.; Baas, I. O.; Rodenhuis, S.; Hruban, R. H.

    1993-01-01

    Mutations in the p53 tumor suppressor gene are frequently observed in primary lung adenocarcinomas, suggesting that these mutations are critical events in the malignant transformation of airway cells. These mutations are often associated with stabilization of the p53 gene product, resulting in the

  17. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production.

    Directory of Open Access Journals (Sweden)

    Dana Austin

    Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.

  18. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    Science.gov (United States)

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  19. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  20. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  1. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  2. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  3. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  4. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  5. TAF6delta controls apoptosis and gene expression in the absence of p53.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Wilhelm

    Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

  6. Restoration of mp53 to wtp53 by chemical chaperones restores p53-dependent apoptosis after radiotherapy

    International Nuclear Information System (INIS)

    Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.

    2003-01-01

    The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future

  7. Isolation and characterization of DUSP11, a novel p53 target gene

    DEFF Research Database (Denmark)

    Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

    2009-01-01

    target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

  8. Inhibition of human colorectal adenocarcinoma cells with AdCMV-p53 gene transfection induced by irradiation

    International Nuclear Information System (INIS)

    Liu Bing; Min Fengling; Xie Yi; Zhou Qingming; Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong; Li Wenjian; Hao Jifang; Zhou Guangming; Gao Qingxiang

    2006-01-01

    The effect of AdCMV-p53 gene transfection induced by γ-ray irradiation on human colorectal adenocarcinoma cells was investigated. The HT-29 cells were irradiated by 0.5, 1.0, 2.0 Gy 60 Co γ-rays, then were transfected with AdCMV-GFP (a replication of deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein) or AdCMV-p53 (a replication of deficient recombinant adenoviral vector containing a CMV promoter and carrying human wild p53 gene). Cytotoxity was measured by clonogenic survival assay; apoptosis and the p53 expression were determined by flow cytometry. The results show that the pre-exposure of 0.5 Gy 60 Co γ-rays significantly enhanced the inhibition of HT-29 cells with AdCMV-53 transfection and promoted cell apoptosis. The inhibition rates for the groups of pre-exposure with 0.5 Gy and transfection with 40 and 80 MOI AdCMV-p53 were 50% and 20% higher than those for the groups of the mere transfection, and 40% more than the mere irradiation group. In the case of higher than 0.5 Gy pre-exposure, no significant difference was found between the pre-exposure with transfection group and the mere irradiation group. So 0.5 Gy pre-irradiation and AdCMV-p53 transfection obviously increases the inhibition of HT-29 cells with AdCMV-p53 transfection. The optimum condition is the lower than 1.0 Gy pre-exposure combined with the lower than 80 MOI AdCMV-p53 transfection. (authors)

  9. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

    1993-01-01

    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  10. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  11. Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.

    Science.gov (United States)

    Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei

    2013-07-01

    Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  12. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  13. Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes

    International Nuclear Information System (INIS)

    Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.

    2008-01-01

    Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53

  14. Alterations in the K-ras and p53 genes in rat lung tumors

    Energy Technology Data Exchange (ETDEWEB)

    Belinsky, S.A.; Swafford, D.S.; Finch, G.L.; Mitchell, C.E. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)] [and others

    1997-06-01

    Activation of the K-ras protooncogene and inactivation of the p53 tumor suppressor gene are events common to many types of human cancers. Molecular epidemiology studies have associated mutational profiles in these genes with specific exposures. The purpose of this paper is to review investigations that have examined the role of the K-ras and p53 genes in lung tumors induced in the F344 rat by mutagenic and nonmutagenic exposures. Mutation profiles within the K-ras and p53 genes, if present in rat lung tumors, would help to define some of the molecular mechanisms underlying cancer induction by various environmental agents. Pulmonary adenocarcinomas or squamous cell carcinomas were induced by tetranitromethane (TNM), 4-methylnitrosamino-1-(3-pyridyl)-1-butanone (NNK), beryllium metal, plutonium-239, X-ray, diesel exhaust, or carbon black. These agents were chosen because the tumors they produced could arise via different types of DNA damage. Mutation of the K-ras gene was determined by approaches that included DNA transfection, direct sequencing, mismatch hybridization, and restriction fragment length polymorphism analysis. The frequency for mutation of the K-ras gene was exposure dependent. The transition mutations formed could have been derived from deamination of cytosine. Alteration in the p53 gene was assessed by immunohistochemical analysis for p53 protein and single-strand conformation polymorphism (SSCP) analysis of exons 4 to 9. None of the 93 adenocarinomas examined was immunoreactive toward the anti-p53 antibody CM1. In contrast, 14 of 71 squamous cell carcinomas exhibited nuclear p53 immunoreactivity with no correlation to type of exposure. However, SSCP analysis only detected mutations in 2 of 14 squamous cell tumors that were immunoreactive, suggesting that protein stabilization did not stem from mutations within the p53 gene. Thus, the p53 gene does not appear to be involved in the genesis of most rat lung tumors. 2 figs., 2 tabs., 48 refs.

  15. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  16. Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation

    International Nuclear Information System (INIS)

    Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli

    2004-01-01

    Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)

  17. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  18. Absence of p53 gene mutations in mice colon pre-cancerous stage induced by o-nitrotoluene

    Directory of Open Access Journals (Sweden)

    Nahed A Hussien

    2014-01-01

    Conclusion: The results from the present study indicate that point mutations in the p53 gene, in the coding region (exons 5-8 and outside it (exons 10, 11, are not involved in the development of the colon precancerous stage induced by o-nt in mice.

  19. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  20. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation

    International Nuclear Information System (INIS)

    Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki

    2001-01-01

    We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)

  2. ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

    International Nuclear Information System (INIS)

    Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

    2007-01-01

    We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

  3. Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio

    2010-01-01

    The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

  4. Polymorphism at codon 36 of the p53 gene.

    Science.gov (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  5. Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2005-01-01

    In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)

  6. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  7. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  8. Combination of heavy-ion radiotherapy and p53-gene therapy by radio- and hypoxia-sensitizing promoter for glioma

    International Nuclear Information System (INIS)

    Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie

    2006-01-01

    In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)

  9. Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

    DEFF Research Database (Denmark)

    Savelyeva, I.; Dobbelstein, M.

    2011-01-01

    to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

  10. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  11. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  12. Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

    International Nuclear Information System (INIS)

    Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil

    2007-01-01

    Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent

  13. Cellular inactivation of nitric oxide induces p53-dependent ...

    African Journals Online (AJOL)

    Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.

  14. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)

    2015-11-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.

  15. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    International Nuclear Information System (INIS)

    Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.

    2015-01-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.

  16. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  17. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  18. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  19. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

  20. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    International Nuclear Information System (INIS)

    Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

    2011-01-01

    Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

  1. Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

    Energy Technology Data Exchange (ETDEWEB)

    Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

  2. Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation

    Energy Technology Data Exchange (ETDEWEB)

    Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)

    2007-07-15

    Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses

  3. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  5. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  6. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  7. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    Directory of Open Access Journals (Sweden)

    Liu Jun

    2004-07-01

    Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.

  8. BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells

    International Nuclear Information System (INIS)

    Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei

    2004-01-01

    BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies

  9. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  10. TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

    International Nuclear Information System (INIS)

    Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen

    2014-01-01

    Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence

  11. Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki

    2004-01-01

    We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)

  12. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    Science.gov (United States)

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  13. P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

    Directory of Open Access Journals (Sweden)

    Rejane Mattar

    2004-01-01

    Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

  14. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    Science.gov (United States)

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  15. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  16. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  17. Arecoline-induced phosphorylated p53 and p21(WAF1) protein expression is dependent on ATM/ATR and phosphatidylinositol-3-kinase in clone-9 cells.

    Science.gov (United States)

    Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea

    2009-06-01

    Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.

  18. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    Science.gov (United States)

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  19. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    Directory of Open Access Journals (Sweden)

    Hui-Ching Chuang

    Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  20. p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression

    International Nuclear Information System (INIS)

    Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo

    1997-01-01

    Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2

  1. 3-MCPD 1-Palmitate Induced Tubular Cell Apoptosis In Vivo via JNK/p53 Pathways

    Science.gov (United States)

    Liu, Man; Huang, Guoren; Wang, Thomas T.Y.; Sun, Xiangjun; Yu, Liangli (Lucy)

    2016-01-01

    Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing induced food contaminants with nephrotoxicity but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD esters using 3-MCPD 1-palmitate (MPE) as a probe compound in Sprague Dawley rats. Microarray analysis of the kidney from the Sprague Dawley rats treated with MPE, using Gene Ontology categories and KEGG pathways, revealed that MPE altered mRNA expressions of the genes involved in the mitogen-activated protein kinase (JNK and ERK), p53, and apoptotic signal transduction pathways. The changes in the mRNA expressions were confirmed by qRT-PCR and Western blot analyses and were consistent with the induction of tubular cell apoptosis as determined by histopathological, TUNEL, and immunohistochemistry analyses in the kidneys of the Sprague Dawley rats. Additionally, p53 knockout attenuated the apoptosis, and the apoptosis-related protein bax expression and cleaved caspase-3 activation induced by MPE in the p53 knockout C57BL/6 mice, whereas JNK inhibitor SP600125 but not ERK inhibitor U0126 inhibited MPE-induced apoptosis, supporting the conclusion that JNK/p53 might play a critical role in the tubular cell apoptosis induced by MPE and other 3-MCPD fatty acid esters. PMID:27008853

  2. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  3. p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

    International Nuclear Information System (INIS)

    Tierney, L.A.; Hahn, F.F.; Lechner, J.F.

    1996-01-01

    Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to 239 PuO 2 and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185 erbB2 ) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and 239 PuO 2 -induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs

  4. RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.

    Science.gov (United States)

    Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh

    2011-07-01

    The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.

  5. The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

    Science.gov (United States)

    Noda, Takeshi

    2011-12-01

    I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Inhibition of cyclobutane pyrimidine dimer formation in epidermal p53 gene of UV-irradiated mice by alpha-tocopherol

    International Nuclear Information System (INIS)

    Chen, W.; Barthelman, M.; Martinez, J.; Alberts, D.; Gensler, H.L.

    1997-01-01

    Mutations or alterations in the p53 gene have been observed in 50-100% of ultraviolet light (UV)-induced squamous cell carcinoma in humans and animals. Most of the mutations occurred at dipyrimidine sequences, suggesting that pyrimidine dimers in the p53 gene play a role in the pathogenesis of cutaneous squamous cell carcinoma. We previously showed that topical alpha-tocopherol prevents UV-induced skin carcinogenesis in the mouse. In the present study we asked whether topical alpha-tocopherol reduces the level of UV-induced cyclobutane pyrimidine dimers in the murine epidermal p53 gene. Mice received six dorsal applications of 25 mg each of alpha-tocopherol, on alternate days, before exposure to 500 J/m2 of UV-B irradiation. Mice were killed at selected times after irradiation. The level of dimers in the epidermal p53 gene was measured using the T4 endonuclease V assay with quantitative Southern hybridization. Topical alpha-tocopherol caused a 55% reduction in the formation of cyclobutane pyrimidine dimers in the epidermal p53 gene. The rate of reduction of pyrimidine dimers between 1 and 10 hours after irradiation was similar in UV-irradiated mice, regardless of alpha-tocopherol treatment. Therefore, the lower level of cyclobutane pyrimidine dimers in UV-irradiated mice treated with alpha-tocopherol than in control UV-irradiated mice resulted from the prevention of formation of the dimers, and not from enhanced repair of these lesions. Our results indicate that alpha-tocopherol acts as an effective sunscreen in vivo, preventing the formation of premutagenic DNA lesions in a gene known to be important in skin carcinogenesis

  7. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    NARCIS (Netherlands)

    Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent

  8. Analysis of the K-ras and p53 pathways in x-ray-induced lung tumors in the rat

    Energy Technology Data Exchange (ETDEWEB)

    Belinsky, S.A.; Middleton, S.K.; Hahn, F.F.; Nikula, K.J. [Inhalation Toxicology Research Inst., Albuquerque, NM (United States); Picksley, S.M. [Medical Sciences Inst., Dundee (United Kingdom)

    1996-04-01

    The risk from exposure to low-dose radiation in conjunction with cigarette smoking has not been estimated due in part to lmited knowledge surrounding the molecular mechanisms underlying radiation-induced cancers. The purpose of this investigation was to determine the frequency for alterations in genes within the K-ras and p53 signal and cell cycle regulatory pathways, respectively, in X-ray-induced lung tumors in the F344/N rat. These tumors were examined for genetic alterations in the K-ras, c-raf-1, p53, mdm2 and cip1 genes. No K-ras mutations were detected by sequencing in 18 squamous cell carcinomas (SCCs) or 17 adenocarcinomas. However, using a K-ras codon 12 mutation selection assay, a codon 12 GGT {r_arrow} GAT mutation was detected in one SCC, suggesting that activation of the K-ras proto-oncogene is both a rare and late event. Single-strand conformation polymorphism (SSCP) analysis of the kinase-binding domain of the c-raf-1 gene did not detect any polymorphisms. Three of 18 SCCs but none of the adenocarcinomas showed p53 nuclear immunoreactivity. Single-strand conformation polymorphism analysis of exons 4-9 of the p53 gene detected only an exon 9 mutation in one SCC. Mutations were not detected in the three SCCs with immunoreactive p53 protein. No amplification of the mdm2 gene was detected; however, nuclear mdm2 immunoreactivity was present in one of the three SCCs that stained positive for the p53 protein. The complete cDNA of the rat cip1 gene comprising 810 bases was cloned and sequenced. The frequency of somatic mutations in exon 2 of the cip1 gene was determined by SSCP analysis. No alterations in electrophoretic mobility were detected. The results of this investigation indicate that alterations in the K-ras and p53 pathways do not play a major role in the genesis of X-ray-induced lung tumors in the rat. 49 refs., 5 figs.

  9. Overexpression of p53, MDM2 proteins in some atr radiation-induced skin ulcers

    International Nuclear Information System (INIS)

    Gu Qingyang; Gao Yabing; Wang Dewen; Cui Yufang; Zhao Po; Yang Zhixiang; Zhou Jie

    2000-01-01

    An animal model of radiation-induced skin ulcer was set up with 140 rats, which were locally irradiated with 35-55 Gy γ-rays. The pathological changes were observed for 1 year. Immunohistochemical studies were performed in 72 rat radiation skin ulcer specimens using anti-p53 and anti-MDM2 proteins polyclonal antibodies. The results showed that the positive rate for overexpression of p53 protein was 9.7%, and for that of MDM2 was 19.4%. The overexpression of p53 was mainly seen in the nuclei of activated squamous epithelial cells, and in fibroblasts, endotheliocytes in deeper part of the skin ulcers. The overexpression of MDM2 had the same localizations. It is suggested that the changes of p53 and MDM2, genes and proteins, may be related to the cancer transformation and poor healing of radiation-induced skin ulcers

  10. Estrogen-Related Receptor Alpha Confers Methotrexate Resistance via Attenuation of Reactive Oxygen Species Production and P53 Mediated Apoptosis in Osteosarcoma Cells

    Directory of Open Access Journals (Sweden)

    Peng Chen

    2014-01-01

    Full Text Available Osteosarcoma (OS is a malignant tumor mainly occurring in children and adolescents. Methotrexate (MTX, a chemotherapy agent, is widely used in treating OS. However, treatment failures are common due to acquired chemoresistance, for which the underlying molecular mechanisms are still unclear. In this study, we report that overexpression of estrogen-related receptor alpha (ERRα, an orphan nuclear receptor, promoted cell survival and blocked MTX-induced cell death in U2OS cells. We showed that MTX induced ROS production in MTX-sensitive U2OS cells while ERRα effectively blocked the ROS production and ROS associated cell apoptosis. Our further studies demonstrated that ERRα suppressed ROS induction of tumor suppressor P53 and its target genes NOXA and XAF1 which are mediators of P53-dependent apoptosis. In conclusion, this study demonstrated that ERRα plays an important role in the development of MTX resistance through blocking MTX-induced ROS production and attenuating the activation of p53 mediated apoptosis signaling pathway, and points to ERRα as a novel target for improving osteosarcoma therapy.

  11. p53 as the focus of gene therapy: past, present and future.

    Science.gov (United States)

    Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

    2018-01-15

    Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  12. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  13. SCGB3A2 Inhibits Acrolein-Induced Apoptosis through Decreased p53 Phosphorylation.

    Science.gov (United States)

    Kurotani, Reiko; Shima, Reika; Miyano, Yuki; Sakahara, Satoshi; Matsumoto, Yoshie; Shibata, Yoko; Abe, Hiroyuki; Kimura, Shioko

    2015-04-28

    Chronic obstructive pulmonary disease (COPD), a major global health problem with increasing morbidity and mortality rates, is anticipated to become the third leading cause of death worldwide by 2020. COPD arises from exposure to cigarette smoke. Acrolein, which is contained in cigarette smoke, is the most important risk factor for COPD. It causes lung injury through altering apoptosis and causes inflammation by augmenting p53 phosphorylation and producing reactive oxygen species (ROS). Secretoglobin (SCGB) 3A2, a secretory protein predominantly present in the epithelial cells of the lungs and trachea, is a cytokine-like small molecule having anti-inflammatory, antifibrotic, and growth factor activities. In this study, the effect of SCGB3A2 on acrolein-related apoptosis was investigated using the mouse fibroblast cell line MLg as the first step in determining the possible therapeutic value of SCGB3A2 in COPD. Acrolein increased the production of ROS and phosphorylation of p53 and induced apoptosis in MLg cells. While the extent of ROS production induced by acrolein was not affected by SCGB3A2, p53 phosphorylation was significantly decreased by SCGB3A2. These results demonstrate that SCGB3A2 inhibited acrolein-induced apoptosis through decreased p53 phosphorylation, not altered ROS levels.

  14. SCGB3A2 Inhibits Acrolein-Induced Apoptosis through Decreased p53 Phosphorylation

    International Nuclear Information System (INIS)

    Kurotani, Reiko; Shima, Reika; Miyano, Yuki; Sakahara, Satoshi; Matsumoto, Yoshie; Shibata, Yoko; Abe, Hiroyuki; Kimura, Shioko

    2015-01-01

    Chronic obstructive pulmonary disease (COPD), a major global health problem with increasing morbidity and mortality rates, is anticipated to become the third leading cause of death worldwide by 2020. COPD arises from exposure to cigarette smoke. Acrolein, which is contained in cigarette smoke, is the most important risk factor for COPD. It causes lung injury through altering apoptosis and causes inflammation by augmenting p53 phosphorylation and producing reactive oxygen species (ROS). Secretoglobin (SCGB) 3A2, a secretory protein predominantly present in the epithelial cells of the lungs and trachea, is a cytokine-like small molecule having anti-inflammatory, antifibrotic, and growth factor activities. In this study, the effect of SCGB3A2 on acrolein-related apoptosis was investigated using the mouse fibroblast cell line MLg as the first step in determining the possible therapeutic value of SCGB3A2 in COPD. Acrolein increased the production of ROS and phosphorylation of p53 and induced apoptosis in MLg cells. While the extent of ROS production induced by acrolein was not affected by SCGB3A2, p53 phosphorylation was significantly decreased by SCGB3A2. These results demonstrate that SCGB3A2 inhibited acrolein-induced apoptosis through decreased p53 phosphorylation, not altered ROS levels

  15. Expression of p53 Target Genes in the Early Phase of Long-Term Potentiation in the Rat Hippocampal CA1 Area

    Directory of Open Access Journals (Sweden)

    Vladimir O. Pustylnyak

    2015-01-01

    Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.

  16. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-01-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  17. Low-level overexpression of p53 promotes warfarin-induced calcification of porcine aortic valve interstitial cells by activating Slug gene transcription.

    Science.gov (United States)

    Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei

    2018-03-09

    The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    Science.gov (United States)

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  19. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    Science.gov (United States)

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  20. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

    1993-01-01

    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  1. Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

    Science.gov (United States)

    Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

    2003-04-01

    Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

  2. Neem oil limonoids induces p53-independent apoptosis and autophagy.

    Science.gov (United States)

    Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan

    2012-11-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.

  3. Neem oil limonoids induces p53-independent apoptosis and autophagy

    Science.gov (United States)

    Chandra, Dhyan

    2012-01-01

    Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764

  4. Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

    Science.gov (United States)

    Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

    2011-11-01

    Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

  5. Characterisation in vivo of ways of induced deaths by p53, in the male germinal cells

    International Nuclear Information System (INIS)

    Coureuil, M.

    2006-10-01

    The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)

  6. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  7. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  8. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  9. p53 gene mutation hotspots in skin cancer and ultraviolet induced mutation

    International Nuclear Information System (INIS)

    Ikehata, Hironobu

    1998-01-01

    Presence of certain hotspots is known in the mutation of p53 gene in skin cancer, which are codons 177, 196, 245, 248, 278 and 282 located in the exon 5-8. In these regions, mutations like C to T and CC to TT are frequent and thereby suggest that they are resulted from pyrimidine-dimers produced by ultraviolet light (UV). In cyclobutane pyrimidine dimerization (CPD), conversion of cytosine to thymine by deamination is suggested to be the primary reaction. Although studies using UVC (254 nm) suggesting that the mutation hotspots are low repair efficiency regions could not completely explain the all hotspots, those using UVB and sunlight (UVB and UVA) revealed that CPD was efficiently produced even in such regions as not explained by studies with UVC alone. Therefore, the latter studies are conceivably reasonable since the skin cancer is induced by natural sunlight. Exon 5-8 DNA is completely methylated and the absorption coefficient of 5-methylcytosine is 5-6 times as large as that of cytosine at wavelength around 290 nm. These indicate the importance of UVB in mutation of mammalian cells possessing the ability to methylate DNA. (K.H.)

  10. Characterization and role of p53 family members in the symbiont-induced morphogenesis of the Euprymna scolopes light organ.

    Science.gov (United States)

    Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J

    2006-08-01

    Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.

  11. Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression

    International Nuclear Information System (INIS)

    Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo

    2009-01-01

    A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.

  12. AAVPG: A vigilant vector where transgene expression is induced by p53

    Energy Technology Data Exchange (ETDEWEB)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.

  13. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    Science.gov (United States)

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  14. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    Energy Technology Data Exchange (ETDEWEB)

    Saquib, Quaiser [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Attia, Sabry M. [Department of Pharmacology, College of Pharmacy, King Saud University, Riyadh (Saudi Arabia); Siddiqui, Maqsood A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Aboul-Soud, Mourad A.M. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Biochemistry Department, Faculty of Agriculture, Cairo University, 12613 Giza (Egypt); Al-Khedhairy, Abdulaziz A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Giesy, John P. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Canada S7N 5B3 (Canada); Zoology Department and Center for Integrative Toxicology, Michigan State University, East Lansing 48824 (United States); Musarrat, Javed, E-mail: musarratj1@yahoo.com [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Microbiology, Faculty of Agricultural Sciences, AMU, Aligarh (India)

    2012-02-15

    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced

  15. Phorate-induced oxidative stress, DNA damage and transcriptional activation of p53 and caspase genes in male Wistar rats

    International Nuclear Information System (INIS)

    Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed

    2012-01-01

    Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G 2 /M arrest and appearance of a distinctive SubG 1 peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced activities of

  16. Conditional inactivation of PDCD2 induces p53 activation and cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Celine J. Granier

    2014-08-01

    Full Text Available PDCD2 (programmed cell death domain 2 is a highly conserved, zinc finger MYND domain-containing protein essential for normal development in the fly, zebrafish and mouse. The molecular functions and cellular activities of PDCD2 remain unclear. In order to better understand the functions of PDCD2 in mammalian development, we have examined PDCD2 activity in mouse blastocyst embryos, as well as in mouse embryonic stem cells (ESCs and embryonic fibroblasts (MEFs. We have studied mice bearing a targeted PDCD2 locus functioning as a null allele through a splicing gene trap, or as a conditional knockout, by deletion of exon2 containing the MYND domain. Tamoxifen-induced knockout of PDCD2 in MEFs, as well as in ESCs, leads to defects in progression from the G1 to the S phase of cell cycle, associated with increased levels of p53 protein and p53 target genes. G1 prolongation in ESCs was not associated with induction of differentiation. Loss of entry into S phase of the cell cycle and marked induction of nuclear p53 were also observed in PDCD2 knockout blastocysts. These results demonstrate a unique role for PDCD2 in regulating the cell cycle and p53 activation during early embryonic development of the mouse.

  17. Immunohistochemical study of p53 overexpression in radiation-induced colon cancers

    International Nuclear Information System (INIS)

    Minami, Kazunori; Hayashi, Nobuyuki; Mokarim, A.; Matsuzaki, Sumihiro; Ito, Masahiro; Sekine, Ichiro.

    1998-01-01

    The expressions of p53 and proliferating cell nuclear antigen (PCNA) were studied immunohistochemically from paraffin sections of 7 cases (9 lesions) of radiation-induced colon cancer and 42 cases of spontaneous colon cancer. Age distribution of radiation-induced and spontaneous colon cancer were 68.1 years (range, 56 to 77 years) and 67.4 years (range, 31 to 85 years), respectively. Among the radiation-induced colon cancers, there were 3 lesions of mucinous carcinoma (33%), a much higher than found for spontaneous mucinous cancer. Immunohistochemically, p53 protein expression was detected in 7/9 (78%) of radiation-induced cancers and in 23/42 (55%) of spontaneous colon cancers. χ 2 analysis found no significant differences between radiation-induced and spontaneous colon cancers in age distribution or p53-positive staining for frequency, histopathology, or Dukes'' classification. In radiation colitis around the cancers including aberrant crypts, spotted p53 staining and abnormal and scattered PCNA-positive staining were observed. In histologically normal cells, p53 staining was almost absent and PCNA-positive staining was regularly observed in the lower half of the crypt. In radiation colitis including aberrant glands, cellular proliferation increased and spotted p53 expression was observed. This study suggests that radiation colitis and aberrant glands might possess malignant potential and deeply associate with carcinogenesis of radiation-induced colon cancer. (author)

  18. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  19. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo

    1997-01-01

    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  20. p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.

    Science.gov (United States)

    Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R

    1999-05-01

    The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.

  1. The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

    International Nuclear Information System (INIS)

    Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.

    1996-01-01

    Background and purpose: Experimental studies have implicated the normal or 'wild type' p53 protein (i.e. WTp53) in the cellular response to ionizing radiation and other DNA damaging agents. Whether altered WTp53 protein function can lead to changes in cellular radiosensitivity and/or clinical radiocurability remains an area of ongoing study. In this review, we describe the potential implications of altered WTp53 protein function in normal and tumour cells as it relates to clinical radiotherapy, and describe novel treatment strategies designed to re-institute WTp53 protein function as a means of sensitizing cells to ionizing radiation. Methods and Materials: A number of experimental and clinical studies are critically reviewed with respect to the role of the p53 protein as a determinant of cellular oncogenesis, genomic stability, apoptosis, DNA repair and radioresponse in normal and transformed mammalian cells. Results: In normal fibroblasts, exposure to ionizing radiation leads to a G1 cell cycle delay (i.e. a 'G1 checkpoint') as a result of WTp53-mediated inhibition of G1-cyclin-kinase and retinoblastoma (pRb) protein function. The G1 checkpoint response is absent in tumour cells which express a mutant form of the p53 protein (i.e. MTp53), leading to acquired radioresistance in vitro. Depending on the cell type studied, this increase in cellular radiation survival can be mediated through decreased radiation-induced apoptosis, or altered kinetics of the radiation-induced G1 checkpoint. Recent biochemical studies support an indirect role for the p53 protein in both nucleotide excision and recombinational DNA repair pathways. However, based on clinicopathologic data, it remains unclear as to whether WTp53 protein function can predict for human tumour radiocurability and normal tissue radioresponse. Conclusions: Alterations in cell cycle control secondary to aberrant WTp53 protein function may be clinically significant if they lead to the acquisition of mutant

  2. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  3. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Wan, Chunhua [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Ma, Xa; Shi, Shangshi [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Zhao, Jianya; Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Han, Jingling; Xiao, Jing; Wang, Xiaoke [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Shengyang [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Junkang, E-mail: Jiang_junkang@163.com [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China)

    2014-12-15

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is

  4. Pivotal roles of p53 transcription-dependent and -independent pathways in manganese-induced mitochondrial dysfunction and neuronal apoptosis

    International Nuclear Information System (INIS)

    Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang

    2014-01-01

    Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H 2 O 2 production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly

  5. Aberrations of the p53 pathway components p53, MDM2 and CDKN2A appear independent in diffuse large B cell lymphoma

    DEFF Research Database (Denmark)

    Møller, Michael Boe; Ino, Y; Gerdes, A M

    1999-01-01

    The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...

  6. Carbon-ion beam irradiation kills X-ray-resistant p53-null cancer cells by inducing mitotic catastrophe.

    Directory of Open Access Journals (Sweden)

    Napapat Amornwichet

    Full Text Available BACKGROUND AND PURPOSE: To understand the mechanisms involved in the strong killing effect of carbon-ion beam irradiation on cancer cells with TP53 tumor suppressor gene deficiencies. MATERIALS AND METHODS: DNA damage responses after carbon-ion beam or X-ray irradiation in isogenic HCT116 colorectal cancer cell lines with and without TP53 (p53+/+ and p53-/-, respectively were analyzed as follows: cell survival by clonogenic assay, cell death modes by morphologic observation of DAPI-stained nuclei, DNA double-strand breaks (DSBs by immunostaining of phosphorylated H2AX (γH2AX, and cell cycle by flow cytometry and immunostaining of Ser10-phosphorylated histone H3. RESULTS: The p53-/- cells were more resistant than the p53+/+ cells to X-ray irradiation, while the sensitivities of the p53+/+ and p53-/- cells to carbon-ion beam irradiation were comparable. X-ray and carbon-ion beam irradiations predominantly induced apoptosis of the p53+/+ cells but not the p53-/- cells. In the p53-/- cells, carbon-ion beam irradiation, but not X-ray irradiation, markedly induced mitotic catastrophe that was associated with premature mitotic entry with harboring long-retained DSBs at 24 h post-irradiation. CONCLUSIONS: Efficient induction of mitotic catastrophe in apoptosis-resistant p53-deficient cells implies a strong cancer cell-killing effect of carbon-ion beam irradiation that is independent of the p53 status, suggesting its biological advantage over X-ray treatment.

  7. A importância do gene p53 na carcinogênese humana The importance of the p53 gene in human carcinogenesis

    Directory of Open Access Journals (Sweden)

    Agnes C. Fett-Conte

    2002-04-01

    Full Text Available Existem várias razões que justificam o título de "guardião do genoma" do gene P53. Seu envolvimento, direto ou indireto, tem sido observado na etiopatogenia de praticamente todas as neoplasias humanas, incluindo as leucemias e linfomas. Conhecer seus mecanismos de ação é fundamental para compreender os aspectos moleculares da carcinogênese. O presente trabalho apresenta uma revisão sobre as características deste gene e sua importância no diagnóstico, prognóstico e terapêutica, o que faz dele um alvo em potencial das estratégias de terapia gênica.There are several reasons which justify the name of 'guardian of the genome' given to the P53 gene. Its involvement either directly or indirectly has been observed in the pathology of practically all human neoplasias, including leukemia and lymphomas. Knowledge of its mechanisms of action is fundamental to understand molecular aspects of carcinogenesis. This work presents a revision of the characteristics of this gene and its importance in the diagnosis, prognosis and treatment and why this makes it a potential target for gene therapy strategies.

  8. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  9. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  10. Free radical scavenger edaravone suppresses X-ray-induced apoptosis through p53 inhibition in MOLT-4 cells

    International Nuclear Information System (INIS)

    Sasano, Nakashi; Shiraishi, Kenshiro; Igaki, Hiroshi; Nakagawa, Keiichi; Enomoto, Atsushi; Hosoi, Yoshio; Matsumoto, Yoshihisa; Miyagawa, Kiyoshi; Katsumura, Yosuke

    2007-01-01

    Edaravone, a clinical drug used widely for the treatment of acute cerebral infarction, is reported to scavenge free radicals. In the present study, we investigated the radioprotective effect of edaravone on X-ray-induced apoptosis in MOLT-4 cells. Apoptosis was determined by the dye exclusion test, Annexin V binding assay, cleavage of caspase, and DNA fragmentation. We found that edaravone significantly suppressed the X-ray-induced apoptosis. The amount of intracellular reactive oxygen species (ROS) production was determined by the chloromethyl-2', 7'-dichlorodihydro-fluorescein diacetate system. We found that the intracellular ROS production by X-irradiation was completely suppressed by the addition of edaravone. The accumulation and phosphorylation of p53 and the expression of p21 WAF1 , a target protein of p53, which were induced by X-irradiation, were also suppressed by adding edaravone. We conclude that the free radical scavenger edaravone suppresses X-ray-induced apoptosis in MOLT-4 cells by inhibiting p53. (author)

  11. Free radical scavenger edaravone suppresses X-ray-induced apoptosis through p53 inhibition in MOLT-4 cells

    Energy Technology Data Exchange (ETDEWEB)

    Sasano, Nakashi; Shiraishi, Kenshiro; Igaki, Hiroshi; Nakagawa, Keiichi [Tokyo Univ., Graduate School of Medicine, Tokyo (Japan); Enomoto, Atsushi; Hosoi, Yoshio; Matsumoto, Yoshihisa; Miyagawa, Kiyoshi [Tokyo Univ., Faculty of Medicine, Tokyo (Japan); Katsumura, Yosuke [Tokyo Univ., Graduate School of Engineering, Tokyo (Japan)

    2007-11-15

    Edaravone, a clinical drug used widely for the treatment of acute cerebral infarction, is reported to scavenge free radicals. In the present study, we investigated the radioprotective effect of edaravone on X-ray-induced apoptosis in MOLT-4 cells. Apoptosis was determined by the dye exclusion test, Annexin V binding assay, cleavage of caspase, and DNA fragmentation. We found that edaravone significantly suppressed the X-ray-induced apoptosis. The amount of intracellular reactive oxygen species (ROS) production was determined by the chloromethyl-2', 7'-dichlorodihydro-fluorescein diacetate system. We found that the intracellular ROS production by X-irradiation was completely suppressed by the addition of edaravone. The accumulation and phosphorylation of p53 and the expression of p21{sup WAF1}, a target protein of p53, which were induced by X-irradiation, were also suppressed by adding edaravone. We conclude that the free radical scavenger edaravone suppresses X-ray-induced apoptosis in MOLT-4 cells by inhibiting p53. (author)

  12. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  13. TGFbeta induces apoptosis and EMT in primary mouse hepatocytes independently of p53, p21Cip1 or Rb status

    International Nuclear Information System (INIS)

    Sheahan, Sharon; Bellamy, Christopher O; Harland, Stephen N; Harrison, David J; Prost, Sandrine

    2008-01-01

    such as proliferation and the presence of other regulatory proteins as suggested by the consequences of p53, p21 Cip1 double deficiency. Similarly, p53, p21 Cip1 and pRB deficiency had no effect on the morphological changes and loss of cell adhesion which is thought to be critical for metastasis. This indicates that possible association of these genes with metastasis potential would be unlikely to involve TGFβ-induced EMT

  14. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    Energy Technology Data Exchange (ETDEWEB)

    Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  15. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    International Nuclear Information System (INIS)

    Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

    2007-01-01

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  16. Probucol Attenuates Cyclophosphamide-induced Oxidative Apoptosis, p53 and Bax Signal Expression in Rat Cardiac Tissues

    Directory of Open Access Journals (Sweden)

    Yousif A. Asiri

    2010-01-01

    Full Text Available Cyclophosphamide (CP is a widely used drug in cancer chemotherapy and immunosuppression, which could cause toxicity of the normal cells due to its toxic metabolites. Probucol, a cholesterol-lowering drug, acts as potential inhibitor of DNA damage and shows to protect against doxorubicin-induced cardiomyopathy by enhancing the endogenous antioxidant system including glutathione peroxidase, catalase and superoxide dismutase. This study examined the possible protective effects of probucol, a lipid-lowering compound with strong antioxidant properties, against CPinduced cardiotoxicity. This objective could be achieved through studying the gene expression-based on the possible protective effects of probucol against CP-induced cardiac failure in rats. Adult male Wistar albino rats were assigned into four treatment groups: Animals in the first (control and second (probucol groups were injected intraperitoneally with corn oil and probucol (61 mg/kg/day, respectively, for two weeks. Animals in the third (CP and fourth (probucol plus CP groups were injected with the same doses of corn oil and probucol (61 mg/kg/day, respectively, for one week before and one week after a single dose of CP (200 mg/kg, I.P.. The p53, Bax, Bcl2 and oxidative genes signal expression were measured by real time PCR. CP-induced cardiotoxicity was clearly observed by a significant increase in serum creatine phosphokinase isoenzyme (CK-MB (117%, lactate dehydrogenase (LDH (64%, free (69% and esterified cholesterol (42% and triglyceride (69% compared to control group. In cardiac tissues, CP significantly increases the mRNA expression levels of apoptotic genes, p53 with two-fold and Bax with 1.6-fold, and decreases the anti-apoptotic gene Bcl2 with 0.5-fold. Moreover, CP caused downregulation of antioxidant genes, glutathione peroxidase, catalase, and superoxide dismutase and increased the lipid peroxidation and decreased adenosine triphosphate (ATP (40% and ATP/ADP (44% in cardiac

  17. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  18. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  19. A Dual Role of P53 in Regulating Colistin-Induced Autophagy in PC-12 Cells

    Directory of Open Access Journals (Sweden)

    Ziyin Lu

    2017-10-01

    Full Text Available This study aimed to investigate the mechanism of p53 in regulating colistin-induced autophagy in PC-12 cells. Importantly, cells were treated with 125 μg/ml colistin for 12 and 24 h after transfection with p53 siRNA or recombinant plasmid. The hallmarks of autophagy and apoptosis were examined by real-time PCR and western blot, fluorescence/immunofluorescence microscopy, and electron microscopy. The results showed that silencing of p53 leads to down-regulation of Atg5 and beclin1 for 12 h while up-regulation at 24 h and up-regulation of p62 noted. The ratio of LC3-II/I and autophagic vacuoles were significantly increased at 24 h, but autophagy flux was blocked. The cleavage of caspase3 and PARP (poly ADP-ribose polymerase were enhanced, while PC-12-sip53 cells exposed to 3-MA showed down-regulation of apoptosis. By contrast, the expression of autophagy-related genes and protein reduced in p53 overexpressing cells following a time dependent manner. Meanwhile, there was an increase in the expression of activated caspase3 and PARP, condensed and fragmented nuclei were evident. Conclusively, the data supported that silencing of p53 promotes impaired autophagy, which acts as a pro-apoptotic induction factor in PC-12 cells treated with colistin for 24 h, and overexpression of p53 inhibits autophagy and accelerates apoptosis. Hence, it has been suggested that p53 could not act as a neuro-protective target in colistin-induced neurotoxicity.

  20. Desferrioxamine Attenuates Doxorubicin-Induced Acute Cardiotoxicity through TFG-β/Smad p53 Pathway in Rat Model

    Directory of Open Access Journals (Sweden)

    Othman A. Al-Shabanah

    2012-01-01

    Full Text Available Interaction of doxorubicin DOX with iron and the consequent generation of reactive oxygen species (ROS is a major player in DOX-induced cardiomyopathy. Accordingly, this study has been initiated to investigate the preventive effect of the iron chelator, desferrioxamine (DFX, against DOX-induced acute cardiotoxicity in rats. Male Wistar albino rats were divided into four groups and were injected intraperitoneally (I.P. with normal saline, a single dose of DOX (15 mg/kg, a single dose of DFX (250 mg/kg and a combined treatment with DFX (250 mg/kg 30 min prior to a single dose of DOX, (15 mg/kg. A single dose of DOX significantly increased mRNA expression of TGF-β, Smad2, Smad4, CDKN2A and p53 and significantly decreased Samd7 and Mdm2 mRNA expression levels. Administration of DFX prior to DOX resulted in a complete reversal of DOX-induced alteration in cardiac enzymes and gene expression to normal levels. Data from this study suggest that (1 DOX induces its acute cardiotoxicity secondary to increasing genes expression of TGF-β/Smad pathway. (2 DOX increases apoptosis through upregulation of CDKN2A and p53 and downregulation of Mdm2 gene expression. (3 The preventive effect of DFX against DOX-induced cardiotoxicity is mediated via the TGF-β1/Smad pathway.

  1. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  2. Specific UV-induced mutation spectrum in the p53 gene of skin tumors from DNA-repair-deficient xeroderma pigmentosum patients

    International Nuclear Information System (INIS)

    Dumaz, N.; Drougard, C.; Sarasin, A.; Daya-Grosjean, L.

    1993-01-01

    The UV component of sunlight is the major carcinogen involved in the etiology of skin cancers. The authors have studied the rare, hereditary syndrome xeroderma pigmentosum (XP), which is characterized by a very high incidence of cutaneous tumors on exposed skin at an early age, probably due to a deficiency in excision repair of UV-induced lesions. It is interesting to determine the UV mutation spectrum in XP skin tumors in order to correlate the absence of repair of specific DNA lesions and the initiation of skin tumors. The p53 gene is frequently mutated in human cancers and represents a good target for studying mutation spectra since there are >100 potential sites for phenotypic mutations. Using reverse transcription-PCR and single-strand conformation polymorphism to analyze >40 XP skin tumors (mainly basal and squamous cell carcinomas), the authors have found that 40% (17 out of 43) contained at least one point mutation on the p53 gene. All the mutations were located at dipyrimidine sites, essentially at CC sequences, which are hot spots for UV-induced DNA lesions. Sixty-one percent of these mutations were tandem CC → TT mutations considered to be unique to UV-induced lesions; these mutations are not observed in internal human tumors. All the mutations, except two, must be due to translesion synthesis of unrepaired dipyrimidine lesions left on the nontranscribed strand. These results show the existence of preferential repair of UV lesions [either pyrimidine dimers or pyrimidine-pyrimidone (6-4) photoproducts] on the transcribed strand in human tissues

  3. Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression

    Directory of Open Access Journals (Sweden)

    Takahiro Ebata

    2017-01-01

    Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.

  4. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  5. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined

  6. Characterisation in vivo of ways of induced deaths by p53, in the male germinal cells; Caracterisation in vivo des voies de mort induites par la p53, dans les cellules germinales males

    Energy Technology Data Exchange (ETDEWEB)

    Coureuil, M

    2006-10-15

    The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)

  7. Interferon-β induces cellular senescence in cutaneous human papilloma virus-transformed human keratinocytes by affecting p53 transactivating activity.

    Directory of Open Access Journals (Sweden)

    Maria V Chiantore

    Full Text Available Interferon (IFN-β inhibits cell proliferation and affects cell cycle in keratinocytes transformed by both mucosal high risk Human Papilloma Virus (HPV and cutaneous HPV E6 and E7 proteins. In particular, upon longer IFN-β treatments, cutaneous HPV38 expressing cells undergo senescence. IFN-β appears to induce senescence by upregulating the expression of the tumor suppressor PML, a well known IFN-induced gene. Indeed, experiments in gene silencing via specific siRNAs have shown that PML is essential in the execution of the senescence programme and that both p53 and p21 pathways are involved. IFN-β treatment leads to a modulation of p53 phosphorylation and acetylation status and a reduction in the expression of the p53 dominant negative ΔNp73. These effects allow the recovery of p53 transactivating activity of target genes involved in the control of cell proliferation. Taken together, these studies suggest that signaling through the IFN pathway might play an important role in cellular senescence. This additional understanding of IFN antitumor action and mechanisms influencing tumor responsiveness or resistance appears useful in aiding further promising development of biomolecular strategies in the IFN therapy of cancer.

  8. A Biomimic Reconstituted High-Density-Lipoprotein-Based Drug and p53 Gene Co-delivery System for Effective Antiangiogenesis Therapy of Bladder Cancer

    Science.gov (United States)

    Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao

    2015-07-01

    A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.

  9. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    Science.gov (United States)

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  10. Microrna-31 mediates radiation induced apoptosis selectively in malignant tumour cells with dysfunctional P53

    International Nuclear Information System (INIS)

    Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir

    2016-01-01

    The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression

  11. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  12. Platelet-derived growth factor (PDGF)-signaling mediates radiation-induced apoptosis in human prostate cancer cells with loss of p53 function

    International Nuclear Information System (INIS)

    Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.

    1997-01-01

    Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo

  13. Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

    Science.gov (United States)

    Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

    2012-06-01

    Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

  14. Aspalathin Reverts Doxorubicin-Induced Cardiotoxicity through Increased Autophagy and Decreased Expression of p53/mTOR/p62 Signaling

    Directory of Open Access Journals (Sweden)

    Rabia Johnson

    2017-09-01

    Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.

  15. Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.

    Science.gov (United States)

    Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens

    2005-04-01

    The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.

  16. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  17. Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

    International Nuclear Information System (INIS)

    Deocaris, Custer C.

    2004-01-01

    Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

  18. Alterations in tumour suppressor gene p53 in human gliomas from ...

    Indian Academy of Sciences (India)

    Unknown

    Alterations in the tumour suppressor p53 gene are among the most common defects seen in a variety of human cancers. ..... rangement of the EGF receptor gene in primary human brain tumors ... the INK4A gene in superficial bladder tumors.

  19. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  20. Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

    International Nuclear Information System (INIS)

    Irshad, S.; Nawaz, T.

    2008-01-01

    Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

  1. Status and advances of p53-gene therapy and radiotherapy in malignant tumor

    International Nuclear Information System (INIS)

    Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

    2006-01-01

    Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

  2. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  3. Ectopic AP4 expression induces cellular senescence via activation of p53 in long-term confluent retinal pigment epithelial cells.

    Science.gov (United States)

    Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay

    2015-11-15

    When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

    Energy Technology Data Exchange (ETDEWEB)

    Denamur, Sophie; Boland, Lidvine [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Beyaert, Maxime [Université catholique de Louvain, de Duve Institute, Laboratory of Physiological Chemistry, UCL B1.75.08, avenue Hippocrate, 75 B -1200 Brussels (Belgium); Verstraeten, Sandrine L. [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Fillet, Marianne [University of Liege, CIRM, Department of Pharmacy, Laboratory for the Analysis of Medicines, Quartier Hopital, Avenue Hippocrate, 15, B36, Tower 4, 4000 Liège 1 (Belgium); Tulkens, Paul M. [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium); Bontemps, Françoise [Université catholique de Louvain, de Duve Institute, Laboratory of Physiological Chemistry, UCL B1.75.08, avenue Hippocrate, 75 B -1200 Brussels (Belgium); Mingeot-Leclercq, Marie-Paule [Université catholique de Louvain, Louvain Drug Research Institute, Cellular and Molecular Pharmacology, UCL B1.73.05, avenue E. Mounier, 73 – B1200 Brussels (Belgium)

    2016-10-15

    Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasome by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.

  5. Subcellular mechanisms involved in apoptosis induced by aminoglycoside antibiotics: Insights on p53, proteasome and endoplasmic reticulum

    International Nuclear Information System (INIS)

    Denamur, Sophie; Boland, Lidvine; Beyaert, Maxime; Verstraeten, Sandrine L.; Fillet, Marianne; Tulkens, Paul M.; Bontemps, Françoise; Mingeot-Leclercq, Marie-Paule

    2016-01-01

    Gentamicin, an aminoglycoside used to treat severe bacterial infections, may cause acute renal failure. In the renal cell line LLC-PK1, gentamicin accumulates in lysosomes, induces alterations of their permeability, and triggers the mitochondrial pathway of apoptosis via activation of caspase-9 and -3 and changes in Bcl-2 family proteins. Early ROS production in lysosomes has been associated with gentamicin induced lysosomal membrane permeabilization. In order to better understand the multiple interconnected pathways of gentamicin-induced apoptosis and ensuing renal cell toxicity, we investigated the effect of gentamicin on p53 and p21 levels. We also studied the potential effect of gentamicin on proteasome by measuring the chymotrypsin-, trypsin- and caspase-like activities, and on endoplasmic reticulum by determining phopho-eIF2α, caspase-12 activation and GRP78 and 94. We observed an increase in p53 levels, which was dependent on ROS production. Accumulation of p53 resulted in accumulation of p21 and of phospho-eIF2α. These effects could be related to an impairment of proteasome as we demonstrated an inhibition of trypsin-and caspase-like activities. Moderate endoplasmic reticulum stress could also participate to cellular toxicity induced by gentamicin, with activation of caspase-12 without change in GRP74 and GRP98. All together, these data provide new mechanistic insights into the apoptosis induced by aminoglycoside antibiotics on renal cell lines. - Highlights: • Gentamicin induces apoptosis through p53 pathway. • Gentamicin inhibits proteosomal activity. • Gentamicin activates caspase-12.

  6. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  7. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    Science.gov (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  8. Inhibitory effect of Survivin promoter-regulated oncolytic adenovirus carrying P53 gene against gallbladder cancer.

    Science.gov (United States)

    Liu, Chen; Sun, Bin; An, Ni; Tan, Weifeng; Cao, Lu; Luo, Xiangji; Yu, Yong; Feng, Feiling; Li, Bin; Wu, Mengchao; Su, Changqing; Jiang, Xiaoqing

    2011-12-01

    Gene therapy has become an important strategy for treatment of malignancies, but problems remains concerning the low gene transferring efficiency, poor transgene expression and limited targeting specific tumors, which have greatly hampered the clinical application of tumor gene therapy. Gallbladder cancer is characterized by rapid progress, poor prognosis, and aberrantly high expression of Survivin. In the present study, we used a human tumor-specific Survivin promoter-regulated oncolytic adenovirus vector carrying P53 gene, whose anti-cancer effect has been widely confirmed, to construct a wide spectrum, specific, safe, effective gene-viral therapy system, AdSurp-P53. Examining expression of enhanced green fluorecent protein (EGFP), E1A and the target gene P53 in the oncolytic adenovirus system validated that Survivin promoter-regulated oncolytic adenovirus had high proliferation activity and high P53 expression in Survivin-positive gallbladder cancer cells. Our in vitro cytotoxicity experiment demonstrated that AdSurp-P53 possessed a stronger cytotoxic effect against gallbladder cancer cells and hepatic cancer cells. The survival rate of EH-GB1 cells was lower than 40% after infection of AdSurp-P53 at multiplicity of infection (MOI) = 1 pfu/cell, while the rate was higher than 90% after infection of Ad-P53 at the same MOI, demonstrating that AdSurp-P53 has a potent cytotoxicity against EH-GB1 cells. The tumor growth was greatly inhibited in nude mice bearing EH-GB1 xenografts when the total dose of AdSurp-P53 was 1 × 10(9) pfu, and terminal dUTP nick end-labeling (TUNEL) revealed that the apoptotic rate of cancer cells was (33.4 ± 8.4)%. This oncolytic adenovirus system overcomes the long-standing shortcomings of gene therapy: poor transgene expression and targeting of only specific tumors, with its therapeutic effect better than the traditional Ad-P53 therapy regimen already on market; our system might be used for patients with advanced gallbladder cancer and

  9. Cyclophilin B induces chemoresistance by degrading wild type p53 via interaction with MDM2 in colorectal cancer.

    Science.gov (United States)

    Choi, Tae Gyu; Nguyen, Minh Nam; Kim, Jieun; Jo, Yong Hwa; Jang, Miran; Nguyen, Ngoc Ngo Yen; Yun, Hyeong Rok; Choe, Wonchae; Kang, Insug; Ha, Joohun; Tang, Dean G; Kim, Sung Soo

    2018-06-06

    Colorectal cancer (CRC) is one of the leading causes of cancer-related deaths worldwide. Chemoresistance is a major problem for effective therapy in CRC. Here, we investigated the mechanism by which peptidylprolyl isomerase B (PPIB; cyclophilin B, CypB) regulates chemoresistance in CRC. We found that CypB is a novel wild type p53 (p53WT)-inducible gene but a negative regulator of p53WT in response to oxaliplatin treatment. Overexpression of CypB shortens the half-life of p53WT and inhibits oxaliplatin-induced apoptosis in CRC cells, whereas knockdown of CypB lengthens the half-life of p53WT and stimulates p53WT dependent apoptosis. CypB interacts directly with MDM2, and enhances MDM2-dependent p53WT ubiquitination and degradation. Furthermore, we firmly validated using bioinformatics analyses that overexpression of CypB is associated with poor prognosis in CRC progression and chemoresistance. Hence, we suggest a novel mechanism of chemoresistance caused by overexpressed CypB, which may help to develop new anti-cancer drugs. We also propose that CypB may be utilized as a predictive biomarker in CRC patients. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  10. Gene alterations in radiation-induced F344 rat lung tumors

    International Nuclear Information System (INIS)

    Kelly, G.; Hahn, F.F.

    1994-01-01

    The p53 tumor suppressor gene is frequently altered in all major histopathologic types of human lung tumors. Reported p53 mutations include base substitutions, allelic loss, rearrangements, and deletions. Point mutations resulting in base substitutions are clustered within a highly conserved region of the gene encoding exons 508, and mutations in this region substantially extend the half-life of the p53 protein. In addition to its prominent importance in lung carcinogenesis, the p53 gene plays a critical role in the cellular response to genetic damage caused by radiation. Specifically, the protein product of p53 induces a pause or block at the G 1 to S boundary of the cell cycle following radiation-caused DNA damage. This G 1 block may allow the cell time to repair the damaged DNA prior to replication. Cells lacking a functional p53 protein fail to pause for repair and consequently accumulate mutations in the genome at an accelerated rate. p53 has also been implicated as a controlling factor in apoptosis or in programmed cell death induced by DNA-damaging agents, such as ionizing radiation. The p53 gene is mutated in approximately 50% of squamous cell carcinomas from uranium miners who inhaled high doses of radon daughters. The purpose of the present study was to determine if a similar percentage of squamous cell carcinomas with p53 mutations developed in the lungs of rats exposed to aerosols of 239 PuO 2

  11. The sirtuin 1/2 inhibitor tenovin-1 induces a nonlinear apoptosis-inducing factor-dependent cell death in a p53 null Ewing's sarcoma cell line.

    Science.gov (United States)

    Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen

    2018-06-01

    The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.

  12. Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.

    Science.gov (United States)

    Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles

    2006-10-16

    The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.

  13. RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

    2010-11-01

    Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

  14. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  15. Suberoyl bis-hydroxamic acid induces p53-dependent apoptosis of MCF-7 breast cancer cells

    Institute of Scientific and Technical Information of China (English)

    Zhi-gang ZHUANG; Fei FEI; Ying CHEN; Wei JIN

    2008-01-01

    Aim: To study the effects of suberoyl bis-hydroxamic acid (SBHA), an inhibitor of histone deacetylases, on the apoptosis of MCF-7 breast cancer cells. Meth-ods: Apoptosis in MCF-7 cells induced by SBHA was demonstrated by flow cytometric analysis, morphological observation, and DNA ladder. Mitochondrial membrane potential (△ψm) was measured using the fluorescent probe JC-1. The expressions of p53, p21, Bax, and PUMA were determined using RT-PCR or Western blotting analysis after the MCF-7 cells were treated with SBHA or p53 siRNA. Results: SBHA induced apoptosis in MCF-7 cells. The expressions of p53, p21, Bax, and PUMA were induced, and △ψm collapsed after treatment with SBHA. p53 siRNA abrogated the SBHA-induced apoptosis and the expressions of p53, p21, Bax, and PUMA. Conclusion: The activation of the p53 pathway is involved in SBHA-induced apoptosis in MCF-7 cells.

  16. The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

    Science.gov (United States)

    Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

    2018-05-01

    In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  18. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  19. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  20. NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

    Directory of Open Access Journals (Sweden)

    Labhart Paul

    2007-05-01

    Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

  1. Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction

    Directory of Open Access Journals (Sweden)

    Louis Chesler

    2008-11-01

    Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.

  2. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

    Science.gov (United States)

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

    2003-08-01

    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its

  3. MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

    Science.gov (United States)

    Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

    2017-01-01

    The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

  4. Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination

    Directory of Open Access Journals (Sweden)

    Zhou Y

    2018-04-01

    Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had

  5. Signal transduction of p53-independent apoptotic pathway induced by hexavalent chromium in U937 cells

    International Nuclear Information System (INIS)

    Hayashi, Yoko; Kondo, Takashi; Zhao Qingli; Ogawa Ryohei; Cui Zhengguo; Feril, Loreto B.; Teranishi, Hidetoyo; Kasuya, Minoru

    2004-01-01

    It has been reported that the hexavalent chromium compound (Cr(VI)) can induce both p53-dependent and p53-independent apoptosis. While a considerable amount of information is available on the p53-dependent pathway, only little is known about the p53-independent pathway. To elucidate the p53-independent mechanism, the roles of the Ca 2+ -calpain- and mitochondria-caspase-dependent pathways in apoptosis induced by Cr(VI) were investigated. When human lymphoma U937 cells, p53 mutated cells, were treated with 20 μM Cr(VI) for 24 h, nuclear morphological changes and DNA fragmentation were observed. Production of hydroxyl radicals revealed by electron paramagnetic resonance (EPR)-spin trapping, and increase of intracellular calcium ion concentration monitored by digital imaging were also observed in Cr(VI)-treated cells. An intracellular Ca 2+ chelator, BAPTA-AM, and calpain inhibitors suppressed the Cr(VI)-induced DNA fragmentation. The number of cells showing low mitochondrial membrane potential (MMP), high level of superoxide anion radicals (O 2 - ), and high activity of caspase-3, which are indicators of mitochondria-caspase-dependent pathway, increased significantly in Cr(VI)-treated cells. An antioxidant, N-acetyl-L-cysteine (NAC), decreased DNA fragmentation and inhibited the changes in MMP, O 2 - formation, and activation of caspase-3 induced by Cr(VI). No increase of the expressions of Fas and phosphorylated JNK was observed after Cr(VI) treatment. Cell cycle analysis revealed that the fraction of G2/M phase tended to increase after 24 h of treatment, suggesting that Cr(VI)-induced apoptosis is related to the G2 block. These results indicate that Ca 2+ -calpain- and mitochondria-caspase-dependent pathways play significant roles in the Cr(VI)-induced apoptosis via the G2 block, which are independent of JNK and Fas activation. The inhibition of apoptosis and all its signal transductions by NAC suggests that intracellular reactive oxygen species (ROS) are

  6. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    Science.gov (United States)

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  7. The relationship among human papilloma virus infection, survivin, and p53 gene in lung squamous carcinoma tissue

    International Nuclear Information System (INIS)

    Yue-Hua Wang; De-jie Chen; Tie-Nan Yi

    2010-01-01

    To study the relationship between the infection of human papillomavirus (HPV) type 16, type 18, the expression of survivin, and the mutation of p53 gene in lung squamous carcinoma tissue for the research of pathogenesis of lung carcinoma.This study was carried out at the Laboratory of Molecular Biology, Xiangfan Central Hospital of Hubei Province, China from September 2008 to May 2010. Forty-five specimens of lung squamous carcinoma tissue confirmed by histopathology were the excisional specimens taken by the Thoracic Surgery of Xiangfan Central Hospital. Normal tissue, closely adjacent to the fresh carcinoma specimens, was used as the control group for p53 gene mutation analysis. Sixteen surgical excisional specimens of benign lung disease were used as a control group of non-carcinomatous diseases. Human papillomavirus DNA were detected by polymerase chain reaction (PCR), and we used the PCR-single-strand conformation polymorphism-ethidium bromide (PCR-SSCP-EB) method to detect the mutations of the p53 gene. The expression of the survivin gene was detected by immunohistochemistry methods. Approximately 68.9% of 45 lung squamous carcinoma tissue had p53 gene mutations. The mutation rate of exon 5-8 p53 were 15.6%, 17.8%, 15.6% and 20%. Approximately 42.2% of lung squamous cell carcinoma samples were shown to be positive for HPV DNA expression and 62.2% were positive for survivin expression. There was an inverse correlation between the presence of HPV infections and mutations of p53 gene; and the mutations of p53 gene and expression of survivin had a positive relationship. Mutation of p53 gene and HPV infection may facilitate each other in the generation of lung squamous cell carcinoma. Abnormal expression of the survivin gene may take part in the onset and progression of lung squamous cell carcinoma (Author).

  8. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  9. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    OpenAIRE

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...

  10. Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner

    International Nuclear Information System (INIS)

    Panta, Sushil; Yamakuchi, Munekazu; Shimizu, Toshiaki; Takenouchi, Kazunori; Oyama, Yoko; Koriyama, Toyoyasu; Kojo, Tsuyoshi; Hashiguchi, Teruto

    2017-01-01

    In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclear localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β 3 -integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β 3 -integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β 3 -integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β 3 -integrin pathway in endothelial cells.

  11. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  12. Overexpression of 15-lipoxygenase-1 induces growth arrest through phosphorylation of p53 in human colorectal cancer cells.

    Science.gov (United States)

    Kim, Jong-Sik; Baek, Seung Joon; Bottone, Frank G; Sali, Tina; Eling, Thomas E

    2005-09-01

    To investigate the function of 15-lipoxygenase-1 (15-LOX-1) in human colorectal cancer, we overexpressed 15-LOX-1 in HCT-116 human colorectal cancer cells. Clones expressing the highest levels of 15-LOX-1 displayed reduced viability compared with the HCT-116-Vector control cells. Further, by cell cycle gene array analyses, the cyclin-dependent kinase inhibitor p21WAF1/CIP1 and MDM2 genes were up-regulated in 15-LOX-1-overexpressing cells. The induction of p21(WAF1/CIP1) and MDM2 were linked to activation of p53 by 15-LOX-1, as there was a dramatic induction of phosphorylated p53 (Ser15) in 15-LOX-1-overesxpressing cells. However, the 15-LOX-1 metabolites 13(S)-hydroxyoctadecadienoic acid and 15(S)-hydroxyeicosatetraenoic acid failed to induce phosphorylation of p53 at Ser15, and the 15-LOX-1 inhibitor PD146176 did not inhibit the phosphorylation of p53 at Ser15 in 15-LOX-1-overexpressing cells. Nonetheless, the growth-inhibitory effects of 15-LOX-1 were p53 dependent, as 15-LOX-1 overexpression had no effect on cell growth in p53 (-/-) HCT-116 cells. Finally, treatment of HCT-116-15-LOX-1 cells with different kinase inhibitors suggested that the effects of 15-LOX-1 on p53 phosphorylation and activation were due to effects on DNA-dependent protein kinase. Collectively, these findings suggest a new mechanism to explain the biological activity of 15-LOX-1, where 15-LOX plays a stoichiometric role in activating a DNA-dependent protein kinase-dependent pathway that leads to p53-dependent growth arrest.

  13. Benzene activates caspase-4 and -12 at the transcription level, without an association with apoptosis, in mouse bone marrow cells lacking the p53 gene

    Energy Technology Data Exchange (ETDEWEB)

    Yi, Jung-Yeon; Han, Jeong-Hee; Yoon, Byung-Il [Kangwon National University, School of Veterinary Medicine, Chuncheon, Gangwon (Korea); Hirabayashi, Yoko; Kodama, Yukio; Kanno, Jun [National Institute of Health Sciences, Division of Cellular and Molecular Toxicology, Center for Biological Safety and Research, Tokyo (Japan); Choi, Yang-Kyu [Konkuk University, College of Veterinary Medicine, Seoul (Korea); Inoue, Tohru [National Institute of Health Sciences, Biological Safety and Research Center, Tokyo (Japan)

    2009-08-15

    Benzene is a well-known environmental pollutant that can induce hematotoxicity, aplastic anemia, acute myelogenous leukemia, and lymphoma. However, although benzene metabolites are known to induce oxidative stress and disrupt the cell cycle, the mechanism underlying lympho/leukemogenicity is not fully understood. Caspase-4 (alias caspase-11) and -12 are inflammatory caspases implicated in inflammation and endoplasmic reticulum stress-induced apoptosis. The objectives of this study were to investigate the altered expression of caspase-4 and -12 in mouse bone marrow after benzene exposure and to determine whether their alterations are associated with benzene-induced bone marrow toxicity, especially cellular apoptosis. In addition, we evaluated whether the p53 gene is involved in regulating the mechanism, using both wild-type (WT) mice and mice lacking the p53 gene. For this study, 8-week-old C57BL/6 mice [WT and p53 knockout (KO)] were administered a benzene solution (150 mg/kg diluted in corn oil) via oral gavage once daily, 5 days/week, for 1 or 2 weeks. Blood and bone marrow cells were collected and cell counts were measured using a Coulter counter. Total mRNA and protein extracts were prepared from the harvested bone marrow cells. Then qRT-PCR and Western blotting were performed to detect changes in the caspases at the mRNA and protein level, respectively. A DNA fragmentation assay and Annexin-V staining were carried out on the bone marrow cells to detect apoptosis. Results indicated that when compared to the control, leukocyte number and bone marrow cellularity decreased significantly in WT mice. The expression of caspase-4 and -12 mRNA increased significantly after 12 days of benzene treatment in the bone marrow cells of benzene-exposed p53KO mice. However, apoptosis detection assays indicated no evidence of apoptosis in p53KO or WT mice. In addition, no changes of other apoptosis-related caspases, such as caspase-3 and -9, were found in WT or p53KO mice at the

  14. p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers

    Science.gov (United States)

    Shai, Anny; Pitot, Henry C.; Lambert, Paul F.

    2010-01-01

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729

  15. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  16. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  17. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    Science.gov (United States)

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  18. Transactivation of bad by vorinostat-induced acetylated p53 enhances doxorubicin-induced cytotoxicity in cervical cancer cells.

    Science.gov (United States)

    Lee, Sook-Jeong; Hwang, Sung-Ook; Noh, Eun Joo; Kim, Dong-Uk; Nam, Miyoung; Kim, Jong Hyeok; Nam, Joo Hyun; Hoe, Kwang-Lae

    2014-02-14

    Vorinostat (VOR) has been reported to enhance the cytotoxic effects of doxorubicin (DOX) with fewer side effects because of the lower DOX dosage in breast cancer cells. In this study, we investigated the novel mechanism underlying the synergistic cytotoxic effects of VOR and DOX co-treatment in cervical cancer cells HeLa, CaSki and SiHa cells. Co-treatment with VOR and DOX at marginal doses led to the induction of apoptosis through caspase-3 activation, poly (ADP-ribose) polymerase cleavage and DNA micronuclei. Notably, the synergistic growth inhibition induced by the co-treatment was attributed to the upregulation of the pro-apoptotic protein Bad, as the silencing of Bad expression using small interfering RNA (siRNA) abolished the phenomenon. As siRNA against p53 did not result in an increase in acetylated p53 and the consequent upregulation of Bad, the observed Bad upregulation was mediated by acetylated p53. Moreover, a chromatin immunoprecipitation analysis showed that the co-treatment of HeLa cells with VOR and DOX increased the recruitment of acetylated p53 to the bad promoter, with consequent bad transactivation. Conversely, C33A cervical cancer cells containing mutant p53 co-treated with VOR and DOX did not exhibit Bad upregulation, acetylated p53 induction or consequent synergistic growth inhibition. Together, the synergistic growth inhibition of cervical cancer cell lines induced by co-treatment with VOR and DOX can be attributed to the upregulation of Bad, which is induced by acetylated p53. These results show for the first time that the acetylation of p53, rather than histones, is a mechanism for the synergistic growth inhibition induced by VOR and DOX co-treatments.

  19. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    Science.gov (United States)

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  20. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  1. Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

    2016-04-22

    The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.

  2. Study of cellular signaling of apoptosis induced by different types of ionizing radiations in lymphoblastoid cells differing in their P53 status

    International Nuclear Information System (INIS)

    Fischer, Barbara

    2004-01-01

    of this caspase following exposure to fast neutrons was evaluated. Results show that neither Fas expression nor activation by direct receptor agglomeration is induced by fast neutrons, suggesting that Fas is not implicated in fast neutron-induced apoptosis. In order to identify genes that would be involved in fast neutron TK6 and NH32 response, gene expression after irradiation was then examined. These results provide preliminary data on the apoptotic mechanisms involved after irradiation with fast neutrons and make it possible to direct future investigations towards the TNF receptor, the MAPKinase or the ceramide pathway. the induction of apoptosis by carbon ions has also been studied to highlight the common characteristics of radiations at LET level concerning the induction of apoptosis. As for fast neutrons, p53 is involved in the sensitivity of TK6 cells to carbon ions. The apoptosis induced by these radiations is also dependent on the type-3 caspases. In conclusion, this work provides new data concerning the induction of apoptosis by ionizing radiation at high LET. For the first time the involvement of p53 in radiation-induced apoptosis at high LET is clearly shown. Quantitative and qualitative differences in the progress of fast neutron induced apoptosis with p53 have also been demonstrated. This allowed to establish a first model of signaling the apoptosis induced by these radiations at high LET [fr

  3. Fisetin Induces Apoptosis Through p53-Mediated Up-Regulation of DR5 Expression in Human Renal Carcinoma Caki Cells.

    Science.gov (United States)

    Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu

    2017-08-02

    Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.

  4. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  5. Growth of the Developing Cerebral Cortex Is Controlled by MicroRNA-7 through the p53 Pathway

    Directory of Open Access Journals (Sweden)

    Andrew Pollock

    2014-05-01

    Full Text Available Proper growth of the mammalian cerebral cortex is crucial for normal brain functions and is controlled by precise gene-expression regulation. Here, we show that microRNA-7 (miR-7 is highly expressed in cortical neural progenitors and describe miR-7 sponge transgenic mice in which miR-7-silencing activity is specifically knocked down in the embryonic cortex. Blocking miR-7 function causes microcephaly-like brain defects due to reduced intermediate progenitor (IP production and apoptosis. Upregulation of miR-7 target genes, including those implicated in the p53 pathway, such as Ak1 and Cdkn1a (p21, is responsible for abnormalities in neural progenitors. Furthermore, ectopic expression of Ak1 or p21 and specific blockade of miR-7 binding sites in target genes using protectors in vivo induce similarly reduced IP production. Using conditional miRNA sponge transgenic approaches, we uncovered an unexpected role for miR-7 in cortical growth through its interactions with genes in the p53 pathway.

  6. Cytotoxic effects of replication-competent adenoviruses on human esophageal carcinoma are enhanced by forced p53 expression

    International Nuclear Information System (INIS)

    Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi

    2015-01-01

    Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized

  7. A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

    Directory of Open Access Journals (Sweden)

    Alfredo Ribeiro-Silva

    2003-06-01

    Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

  8. Fluoxetine protects against IL-1β-induced neuronal apoptosis via downregulation of p53.

    Science.gov (United States)

    Shan, Han; Bian, Yaqi; Shu, Zhaoma; Zhang, Linxia; Zhu, Jialei; Ding, Jianhua; Lu, Ming; Xiao, Ming; Hu, Gang

    2016-08-01

    Fluoxetine, a selective serotonin reuptake inhibitor, exerts neuroprotective effects in a variety of neurological diseases including stroke, but the underlying mechanism remains obscure. In the present study, we addressed the molecular events in fluoxetine against ischemia/reperfusion-induced acute neuronal injury and inflammation-induced neuronal apoptosis. We showed that treatment of fluoxetine (40 mg/kg, i.p.) with twice injections at 1 h and 12 h after transient middle cerebral artery occlusion (tMCAO) respectively alleviated neurological deficits and neuronal apoptosis in a mouse ischemic stroke model, accompanied by inhibiting interleukin-1β (IL-1β), Bax and p53 expression and upregulating anti-apoptotic protein Bcl-2 level. We next mimicked neuroinflammation in ischemic stroke with IL-1β in primary cultured cortical neurons and found that pretreatment with fluoxetine (1 μM) prevented IL-1β-induced neuronal apoptosis and upregulation of p53 expression. Furthermore, we demonstrated that p53 overexpression in N2a cell line abolished the anti-apoptotic effect of fluoxetine, indicating that p53 downregulation is required for the protective role of fluoxetine in IL-1β-induced neuronal apoptosis. Fluoxetine downregulating p53 expression could be mimicked by SB203580, a specific inhibitor of p38, but blocked by anisomycin, a p38 activator. Collectively, our findings have revealed that fluoxetine protects against IL-1β-induced neuronal apoptosis via p38-p53 dependent pathway, which give us an insight into the potential of fluoxetine in terms of opening up novel therapeutic avenues for neurological diseases including stroke. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

    OpenAIRE

    Meng, X; Carlson, NR; Dong, J; Zhang, Y

    2015-01-01

    The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...

  10. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

    Science.gov (United States)

    Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

    2005-07-01

    To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

  11. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  12. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  13. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  14. Synergistic induction of profibrotic PAI-1 by TGF-β and radiation depends on p53

    International Nuclear Information System (INIS)

    Niemantsverdriet, Maarten; Jong, Edwin de; Langendijk, Johannes A.; Kampinga, Harm H.; Coppes, Robert P.

    2010-01-01

    Radiation-induced fibrosis is a severe side effect of radiotherapy. TGF-β and radiation synergistically induce expression of the profibrotic PAI-1 gene and this cooperation potentially involves p53. Here, we demonstrate that p53 is both indispensable and sufficient for the radiation effect inducing synergistic activation of PAI-1 by radiation and TGF-β.

  15. The critical role of catalase in prooxidant and antioxidant function of p53

    Science.gov (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  16. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Monti, Paola; Fronza, Gilberto [Mutagenesis Unit, Istituto di Ricerca e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, 16132 Genoa (Italy); Pereira, Clara [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Saraiva, Lucília, E-mail: lucilia.saraiva@ff.up.pt [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal)

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.

  17. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    International Nuclear Information System (INIS)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana; Monti, Paola; Fronza, Gilberto; Pereira, Clara; Saraiva, Lucília

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73

  18. Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity

    International Nuclear Information System (INIS)

    Meiller, A.

    2004-03-01

    Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein

  19. SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes

    OpenAIRE

    Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.

    2015-01-01

    Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...

  20. The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.

    Science.gov (United States)

    Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna

    2018-03-01

    Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.

  1. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  2. Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors

    International Nuclear Information System (INIS)

    Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.

    2010-01-01

    Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)

  3. Fisetin Induces Apoptosis Through p53-Mediated Up-Regulation of DR5 Expression in Human Renal Carcinoma Caki Cells

    Directory of Open Access Journals (Sweden)

    Kyoung-jin Min

    2017-08-01

    Full Text Available Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose polymerase (PARP, which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5 expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.

  4. Nuclear localization signal of ING4 plays a key role in its binding to p53

    International Nuclear Information System (INIS)

    Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang

    2005-01-01

    ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53

  5. Interactions of Chromatin Context, Binding Site Sequence Content, and Sequence Evolution in Stress-Induced p53 Occupancy and Transactivation

    OpenAIRE

    Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.

    2015-01-01

    Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...

  6. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  7. Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

    Directory of Open Access Journals (Sweden)

    Rouba Hage-Sleiman

    Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

  8. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    Science.gov (United States)

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  10. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    International Nuclear Information System (INIS)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna

    2015-01-01

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  11. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)

    2015-08-15

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  12. p21-LacZ reporter mice reflect p53-dependent toxic insult

    International Nuclear Information System (INIS)

    Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.

    2008-01-01

    There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity

  13. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  14. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Manujendra N Saha

    Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

  15. Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

    International Nuclear Information System (INIS)

    Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

    2005-01-01

    The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

  16. Complex Biological Systems Analysis of Cell Cycling Models in Carcinogenesis: I. The essential roles of modifications in the c-Myc, TP53/p53, p27 and hTERT modules in Cancer Initiation and Progression

    CERN Document Server

    Prisecaru, V I

    2004-01-01

    A new approach to the integration of results from a modular, complex biological systems analysis of nonlinear dynamics in cell cycling network transformations that are leading to carcinogenesis is proposed. Carcinogenesis is a complex process that involves dynamically inter-connected biomolecules in the intercellular, membrane, cytosolic, nuclear and nucleolar compartments that form numerous inter-related pathways referred to as networks. One such network module contains the cell cyclins whose functions are essential to cell cycling and division. Cyclins are proteins that also link to several critical pro-apoptotic and other cell cycling/division components, such as: c-Myc, p27, the tumor suppressor gene TP53 and its product-- the p53 protein with key roles in controlling DNA repair, inducing apoptosis and activating p21 (which can depress cell cyclins if activated), mdm2(with its biosynthesis activated by p53 and also, in its turn, inhibiting p53), p21, the Thomsen-Friedenreich antigen(T- antigen),Rb,Bax, Ba...

  17. On the mechanistic differences of benzene-induced leukemogenesis between wild type and p53 knockout mice

    International Nuclear Information System (INIS)

    Hirabayashi, Yoko; Yoon, Byung-Il; Kawasaki, Yasushi; Li, Guang-Xun; Kanno, Jun; Inoue, Tohru

    2003-01-01

    Leukemia induction by benzene inhalation was first reported by Le Noire in 1887, described multiple cases of leukemia among Parisian cobblers. However, experimental induction of leukemia by benzene exposure was not succeeded for a hundred years, until Snyder et al. and our group reported it nearly 20 years ago. Nevertheless, the mechanistic background of benzene-induced leukemia was still an enigma until recently a benzene-induced peculiar cell kinetics of the stem/progenitor cells has been elucidated by our study, demonstrated a marked repeated oscillatory decrease in peripheral blood and bone marrow (BM) cellularity during and after benzene exposure, which epigenetically preceded and developed the leukemia more than a year later. We utilized the BUUV (bromodeoxyuridine + UV exposure) method to study stem/progenitor cell kinetics during and/or after benzene exposure. Using these methods, we were able to measure the labeling rate, cycling fraction of clonogenic progenitor cells, and other cell cycle parameters. The cycling fraction of stem/progenitor cells was found not to turn into an active hematopoiesis but to remain low during benzene inhalation and further we found evidence that the cycling fraction depression may be mediated in part by a slowing of stem/progenitor cell cycling perse by up-regulation of p21. The benzene induced leukemogenicity between mice carrying wild-type p53 and mice lacking p53 seem to differ from one another. In the case of p53 knockout mouse, DNA damage such as weak mutagenicity and or chromosomal damages are retained, and those damages participated in the induction of a consequent activation of proto-oncogenes and the like, which led cells to further neoplastic changes. In contrast, in the case of wild type mice, a dramatic oscillational change in the cell cycle of the stem cell compartment seems to be an important factor for mice carrying the p53 gene. (author)

  18. Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage

    International Nuclear Information System (INIS)

    Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun

    2009-01-01

    Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis

  19. Berberine induces p53-dependent cell cycle arrest and apoptosis of human osteosarcoma cells by inflicting DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu

    2009-03-09

    Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.

  20. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  1. p53 and PTEN/MMAC1/TEP1 gene therapy of human prostate PC-3 carcinoma xenograft, using transferrin-facilitated lipofection gene delivery strategy.

    Science.gov (United States)

    Seki, Masafumi; Iwakawa, Jun; Cheng, Helen; Cheng, Pi-Wan

    2002-04-10

    We previously reported that supplementation of a cationic liposome with transferrin (Tf) greatly enhanced lipofection efficiency (P.-W. Cheng, Hum. Gene Ther. 1996;7:275-282). In this study, we examined the efficacy of p53 and PTEN tumor suppressor gene therapy in a mouse xenograft model of human prostate PC-3 carcinoma cells, using a vector consisting of dimyristoyloxypropyl-3-dimethylhydroxyethyl ammonium bromide (DMRIE)-cholesterol (DC) and Tf. When the volume of the tumors grown subcutaneously in athymic nude mice reached 50-60 mm(3), three intratumoral injections of the following four formulations were performed during week 1 and then during week 3: (1) saline, (2) DC + Tf + pCMVlacZ, (3) DC + Tf + pCMVPTEN, and (4) DC + Tf + pCMVp53 (standard formulation). There was no significant difference in tumor volume and survival between group 1 and group 2 animals. As compared with group 1 controls, group 3 animals had slower tumor growth during the first 3 weeks but thereafter their tumor growth rate was similar to that of the controls. By day 2 posttreatment, group 4 animals had significantly lower tumor volume relative to initial tumor volume as well as controls at the comparable time point. Also, animals treated with p53 survived longer. Treatment with DC, Tf, pCMVp53, DC + pCMVp53, or Tf + pCMVp53 had no effect on tumor volume or survival. Expression of p53 protein and apoptosis were detected in tumors treated with the standard formulation, thus associating p53 protein expression and apoptosis with efficacy. However, p53 protein was expressed in only a fraction of the tumor cells, suggesting a role for bystander effects in the efficacy of p53 gene therapy. We conclude that intratumoral gene delivery by a nonviral vector consisting of a cationic liposome and Tf can achieve efficacious p53 gene therapy of prostate cancer.

  2. Maximal killing of lymphoma cells by DNA damage–inducing therapy requires not only the p53 targets Puma and Noxa, but also Bim

    OpenAIRE

    Happo, Lina; Cragg, Mark S.; Phipson, Belinda; Haga, Jon M.; Jansen, Elisa S.; Herold, Marco J.; Dewson, Grant; Michalak, Ewa M.; Vandenberg, Cassandra J.; Smyth, Gordon K.; Strasser, Andreas; Cory, Suzanne; Scott, Clare L.

    2010-01-01

    DNA-damaging chemotherapy is the backbone of cancer treatment, although it is not clear how such treatments kill tumor cells. In nontransformed lymphoid cells, the combined loss of 2 proapoptotic p53 target genes, Puma and Noxa, induces as much resistance to DNA damage as loss of p53 itself. In Eμ-Myc lymphomas, however, lack of both Puma and Noxa resulted in no greater drug resistance than lack of Puma alone. A third B-cell lymphoma-2 homology domain (BH)3-only gene, Bim, although not a dire...

  3. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  4. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  5. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    Science.gov (United States)

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514

  6. Dihydroptychantol A, a macrocyclic bisbibenzyl derivative, induces autophagy and following apoptosis associated with p53 pathway in human osteosarcoma U2OS cells

    International Nuclear Information System (INIS)

    Li Xia; Wu, William K.K.; Sun Bin; Cui Min; Liu Shanshan; Gao Jian; Lou Hongxiang

    2011-01-01

    Dihydroptychantol A (DHA), a novel macrocyclic bisbibenzyl compound extracted from liverwort Asterella angusta, has antifungal and multi-drug resistance reversal properties. Here, the chemically synthesized DHA was employed to test its anti-cancer activities in human osteosarcoma U2OS cells. Our results demonstrated that DHA induced autophagy followed by apoptotic cell death accompanied with G 2 /M-phase cell cycle arrest in U2OS cells. DHA-induced autophagy was morphologically characterized by the formation of double membrane-bound autophagic vacuoles recognizable at the ultrastructural level. DHA also increased the levels of LC3-II, a marker of autophagy. Surprisingly, DHA-mediated apoptotic cell death was potentiated by the autophagy inhibitor 3-methyladenine, suggesting that autophagy may play a protective role that impedes the eventual cell death. Furthermore, p53 was shown to be involved in DHA-meditated autophagy and apoptosis. In this connection, DHA increased nuclear expression of p53, induced p53 phosphorylation, and upregulated p53 target gene p21 Waf1/Cip1 . In contrast, cytoplasmic p53 was reduced by DHA, which contributed to the stimulation of autophagy. In relation to the cell cycle, DHA decreased the expression of cyclin B 1 , a cyclin required for progression through the G 2 /M phase. Taken together, DHA induces G 2 /M-phase cell cycle arrest and apoptosis in U2OS cells. DHA-induced apoptosis was preceded by the induction of protective autophagy. DHA-mediated autophagy and apoptosis are associated with the cytoplasmic and nuclear functions of p53.

  7. p53 Gene (NY-CO-13 Levels in Patients with Chronic Myeloid Leukemia: The Role of Imatinib and Nilotinib

    Directory of Open Access Journals (Sweden)

    Hayder M. Al-kuraishy

    2018-01-01

    Full Text Available The p53 gene is also known as tumor suppressor p53. The main functions of the p53 gene are an anticancer effect and cellular genomic stability via various pathways including activation of DNA repair, induction of apoptosis, and arresting of cell growth at the G1/S phase. Normally, the p53 gene is inactivated by mouse double minute 2 proteins (mdm2, but it is activated in chronic myeloid leukemia (CML. Tyrosine kinase inhibitors are effective chemotherapeutic agents in the management of CML. The purpose of the present study was to evaluate the differential effect of imatinib and nilotinib on p53 gene serum levels in patients with CML. A total number of 60 patients with chronic myeloid leukemia with ages ranging from 47 to 59 years were recruited from the Iraqi Hematology Center. They started with tyrosine kinase inhibitors as first-line chemotherapy. They were divided into two groups—Group A, 29 patients treated with imatinib and Group B, 31 patients treated with nilotinib—and compared with 28 healthy subjects for evaluation p53 serum levels regarding the selective effect of either imatinib or nilotinib. There were significantly (p < 0.01 high p53 gene serum levels in patients with CML (2.135 ± 1.44 ng/mL compared to the control (0.142 ± 0.11 ng/mL. Patients with CML that were treated with either imatinib or nilotinib showed insignificant differences in most of the hematological profile (p > 0.05 whereas, p53 serum levels were high (3.22 ± 1.99 ng/mL in nilotinib-treated patients and relatively low (1.18 ± 0.19 ng/mL in imatinib-treated patients (p = 0.0001. Conclusions: Nilotinib is more effective than imatinib in raising p53 serum levels in patients with chronic myeloid leukemia.

  8. SCO2 induces p53-mediated apoptosis by Thr845 phosphorylation of ASK-1 and dissociation of the ASK-1-Trx complex.

    Science.gov (United States)

    Madan, Esha; Gogna, Rajan; Kuppusamy, Periannan; Bhatt, Madan; Mahdi, Abbas Ali; Pati, Uttam

    2013-04-01

    p53 prevents cancer via cell cycle arrest, apoptosis, and the maintenance of genome stability. p53 also regulates energy-generating metabolic pathways such as oxidative phosphorylation (OXPHOS) and glycolysis via transcriptional regulation of SCO2 and TIGAR. SCO2, a cytochrome c oxidase assembly factor, is a metallochaperone which is involved in the biogenesis of cytochrome c oxidase subunit II. Here we have shown that SCO2 functions as an apoptotic protein in tumor xenografts, thus providing an alternative pathway for p53-mediated apoptosis. SCO2 increases the generation of reactive oxygen species (ROS) and induces dissociation of the protein complex between apoptosis signal-regulating kinase 1 (ASK-1) (mitogen-activated protein kinase kinase kinase [MAPKKK]) and its cellular inhibitor, the redox-active protein thioredoxin (Trx). Furthermore, SCO2 induces phosphorylation of ASK-1 at the Thr(845) residue, resulting in the activation of the ASK-1 kinase pathway. The phosphorylation of ASK-1 induces the activation of mitogen-activated protein kinase kinases 4 and 7 (MAP2K4/7) and MAP2K3/6, which switches the c-Jun N-terminal protein kinase (JNK)/p38-dependent apoptotic cascades in cancer cells. Exogenous addition of the SCO2 gene to hypoxic cancer cells and hypoxic tumors induces apoptosis and causes significant regression of tumor xenografts. We have thus discovered a novel apoptotic function of SCO2, which activates the ASK-1 kinase pathway in switching "on" an alternate mode of p53-mediated apoptosis. We propose that SCO2 might possess a novel tumor suppressor function via the ROS-ASK-1 kinase pathway and thus could be an important candidate for anticancer gene therapy.

  9. P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

    Energy Technology Data Exchange (ETDEWEB)

    Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

    2002-03-01

    The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

  10. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

    Science.gov (United States)

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

    2012-12-01

    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  11. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  12. SIAH1-induced p34SEI-1 polyubiquitination/degradation mediates p53 preferential vitamin C cytotoxicity.

    Science.gov (United States)

    Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok

    2015-03-01

    Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.

  13. High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Zhihong CHEN

    2011-10-01

    Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

  14. Bladder-like graphical representation of p53 gene alterations in some human cancers

    International Nuclear Information System (INIS)

    Helal, N.L.; Dorrah, M.; LI, C.

    2005-01-01

    the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer

  15. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  16. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  17. Transcriptome profiling identifies genes and pathways deregulated upon floxuridine treatment in colorectal cancer cells harboring GOF mutant p53

    Directory of Open Access Journals (Sweden)

    Arindam Datta

    2016-06-01

    Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.

  18. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    Science.gov (United States)

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  19. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  20. Rapid detection of single nucleotide mutation in p53 gene based on ...

    Indian Academy of Sciences (India)

    mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

  1. Increased Arf/p53 activity in stem cells, aging and cancer.

    Science.gov (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  2. Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle

    DEFF Research Database (Denmark)

    Skouv, J.; Jensen, P O; Forchhammer, J

    1994-01-01

    Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...

  3. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro

    2016-05-01

    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  4. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  5. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  6. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  7. A systems biology approach to investigate the effect of pH-induced gene regulation on solvent production by Clostridium acetobutylicum in continuous culture

    Directory of Open Access Journals (Sweden)

    Bahl Hubert

    2011-01-01

    Full Text Available Abstract Background Clostridium acetobutylicum is an anaerobic bacterium which is known for its solvent-producing capabilities, namely regarding the bulk chemicals acetone and butanol, the latter being a highly efficient biofuel. For butanol production by C. acetobutylicum to be optimized and exploited on an industrial scale, the effect of pH-induced gene regulation on solvent production by C. acetobutylicum in continuous culture must be understood as fully as possible. Results We present an ordinary differential equation model combining the metabolic network governing solvent production with regulation at the genetic level of the enzymes required for this process. Parameterizing the model with experimental data from continuous culture, we demonstrate the influence of pH upon fermentation products: at high pH (pH 5.7 acids are the dominant product while at low pH (pH 4.5 this switches to solvents. Through steady-state analyses of the model we focus our investigations on how alteration in gene expression of C. acetobutylicum could be exploited to increase butanol yield in a continuous culture fermentation. Conclusions Incorporating gene regulation into the model of solvent production by C. acetobutylicum enables an accurate representation of the pH-induced switch to solvent production to be obtained and theoretical investigations of possible synthetic-biology approaches to be pursued. Steady-state analyses suggest that, to increase butanol yield, alterations in the expression of single solvent-associated genes are insufficient; a more complex approach targeting two or more genes is required.

  8. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  9. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

    Science.gov (United States)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

    2016-01-07

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Cdk5 phosphorylates non-genotoxically overexpressed p53 following inhibition of PP2A to induce cell cycle arrest/apoptosis and inhibits tumor progression

    Directory of Open Access Journals (Sweden)

    Kumari Ratna

    2010-07-01

    Full Text Available Abstract Background p53 is the most studied tumor suppressor and its overexpression may or may not cause cell death depending upon the genetic background of the cells. p53 is degraded by human papillomavirus (HPV E6 protein in cervical carcinoma. Several stress activated kinases are known to phosphorylate p53 and, among them cyclin dependent kinase 5 (Cdk5 is one of the kinase studied in neuronal cell system. Recently, the involvement of Cdk5 in phosphorylating p53 has been shown in certain cancer types. Phosphorylation at specific serine residues in p53 is essential for it to cause cell growth inhibition. Activation of p53 under non stress conditions is poorly understood. Therefore, the activation of p53 and detection of upstream kinases that phosphorylate non-genotoxically overexpressed p53 will be of therapeutic importance for cancer treatment. Results To determine the non-genotoxic effect of p53; Tet-On system was utilized and p53 inducible HPV-positive HeLa cells were developed. p53 overexpression in HPV-positive cells did not induce cell cycle arrest or apoptosis. However, we demonstrate that overexpressed p53 can be activated to upregulate p21 and Bax which causes G2 arrest and apoptosis, by inhibiting protein phosphatase 2A. Additionally, we report that the upstream kinase cyclin dependent kinase 5 interacts with p53 to phosphorylate it at Serine20 and Serine46 residues thereby promoting its recruitment on p21 and bax promoters. Upregulation and translocation of Bax causes apoptosis through intrinsic mitochondrial pathway. Interestingly, overexpressed activated p53 specifically inhibits cell-growth and causes regression in vivo tumor growth as well. Conclusion Present study details the mechanism of activation of p53 and puts forth the possibility of p53 gene therapy to work in HPV positive cervical carcinoma.

  11. Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

    Science.gov (United States)

    Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

    2013-01-01

    Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

  12. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    Science.gov (United States)

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  13. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    International Nuclear Information System (INIS)

    Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.

    2009-01-01

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.

  14. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  15. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  16. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  17. Clinical and pathological associations with p53 tumour-suppressor gene mutations and expression of p21WAF1/Cip1 in colorectal carcinoma

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M.; Polak, M.; Mulder, J. W.; van den Berg, F. M.; Hamilton, S. R.; Offerhaus, G. J.

    1996-01-01

    Inactivation of the p53 tumour-suppressor gene is common in a wide variety of human neoplasms. In the majority of cases, single point mutations in the protein-encoding sequence of p53 lead to positive immunohistochemistry (IHC) for the p53 protein, and are accompanied by loss of the wild-type

  18. Andrographolide induces vascular smooth muscle cell apoptosis through a SHP-1-PP2A-p38MAPK-p53 cascade.

    Science.gov (United States)

    Chen, Yu-Ying; Hsieh, Cheng-Ying; Jayakumar, Thanasekaran; Lin, Kuan-Hung; Chou, Duen-Suey; Lu, Wan-Jung; Hsu, Ming-Jen; Sheu, Joen-Rong

    2014-07-10

    The abnormal growth of vascular smooth muscle cells (VSMCs) is considered a critical pathogenic process in inflammatory vascular diseases. We have previously demonstrated that protein phosphatase 2 A (PP2A)-mediated NF-κB dephosphorylation contributes to the anti-inflammatory properties of andrographolide, a novel NF-κB inhibitor. In this study, we investigated whether andrographolide causes apoptosis, and characterized its apoptotic mechanisms in rat VSMCs. Andrographolide activated the p38 mitogen-activated protein kinase (p38MAPK), leading to p53 phosphorylation. Phosphorylated p53 subsequently transactivated the expression of Bax, a pro-apoptotic protein. Transfection with pp2a small interfering RNA (siRNA) suppressed andrographolide-induced p38MAPK activation, p53 phosphorylation, and caspase 3 activation. Andrographolide also activated the Src homology 1 domain-containing protein tyrosine phosphatase (SHP-1), and induced PP2A dephosphorylation, both of which were inhibited by the SHP-1 inhibitor sodium stibogluconate (SSG) or shp-1 siRNA. SSG or shp-1 siRNA prevented andrographolide-induced apoptosis. These results suggest that andrographolide activates the PP2A-p38MAPK-p53-Bax cascade, causing mitochondrial dysfunction and VSMC death through an SHP-1-dependent mechanism.

  19. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    Science.gov (United States)

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  20. Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

    Science.gov (United States)

    Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

    2015-12-01

    Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

  1. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.

    2011-01-01

    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  2. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  3. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    OpenAIRE

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasm...

  4. Activation of the Nkx2.5–Calr–p53 signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish

    Directory of Open Access Journals (Sweden)

    Yanyi Sun

    2017-10-01

    Full Text Available Hyperglycemia is an independent risk factor for diabetic cardiomyopathy in humans; however, the underlying mechanisms have not been thoroughly elucidated. Zebrafish (Danio rerio was used in this study as a novel vertebrate model to explore the signaling pathways of human adult cardiomyopathy. Hyperglycemia was induced by alternately immersing adult zebrafish in a glucose solution or water. The hyperglycemic fish gradually exhibited some hallmarks of cardiomyopathy such as myocardial hypertrophy and apoptosis, myofibril loss, fetal gene reactivation, and severe arrhythmia. Echocardiography of the glucose-treated fish demonstrated diastolic dysfunction at an early stage and systolic dysfunction at a later stage, consistent with what is observed in diabetic patients. Enlarged hearts with decreased myocardial density, accompanied by decompensated cardiac function, indicated that apoptosis was critical in the pathological process. Significant upregulation of the expression of Nkx2.5 and its downstream targets calreticulin (Calr and p53 was noted in the glucose-treated fish. High-glucose stimulation in vitro evoked marked apoptosis of primary cardiomyocytes, which was rescued by the p53 inhibitor pifithrin-μ. In vitro experiments were performed using compound treatment and genetically via cell infection. Genetically, knockout of Nkx2.5 induced decreased expression of Nkx2.5, Calr and p53. Upregulation of Calr resulted in increased p53 expression, whereas the level of Nkx2.5 remained unchanged. An adult zebrafish model of hyperglycemia-induced cardiomyopathy was successfully established. Hyperglycemia-induced myocardial apoptosis was mediated, at least in part, by activation of the Nkx2.5–Calr–p53 pathway in vivo, resulting in cardiac dysfunction and hyperglycemia-induced cardiomyopathy.

  5. Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?

    International Nuclear Information System (INIS)

    Blackburn, Anneke C; Jerry, D Joseph

    2002-01-01

    The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer

  6. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

    DEFF Research Database (Denmark)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice

    2016-01-01

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

  7. The pharmacodynamics of the p53-Mdm2 targeting drug Nutlin: the role of gene-switching noise.

    Directory of Open Access Journals (Sweden)

    Krzysztof Puszynski

    2014-12-01

    Full Text Available In this work we investigate, by means of a computational stochastic model, how tumor cells with wild-type p53 gene respond to the drug Nutlin, an agent that interferes with the Mdm2-mediated p53 regulation. In particular, we show how the stochastic gene-switching controlled by p53 can explain experimental dose-response curves, i.e., the observed inter-cell variability of the cell viability under Nutlin action. The proposed model describes in some detail the regulation network of p53, including the negative feedback loop mediated by Mdm2 and the positive loop mediated by PTEN, as well as the reversible inhibition of Mdm2 caused by Nutlin binding. The fate of the individual cell is assumed to be decided by the rising of nuclear-phosphorylated p53 over a certain threshold. We also performed in silico experiments to evaluate the dose-response curve after a single drug dose delivered in mice, or after its fractionated administration. Our results suggest that dose-splitting may be ineffective at low doses and effective at high doses. This complex behavior can be due to the interplay among the existence of a threshold on the p53 level for its cell activity, the nonlinearity of the relationship between the bolus dose and the peak of active p53, and the relatively fast elimination of the drug.

  8. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    Science.gov (United States)

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  9. Effect of radiation combined with p53 gene therapy and endostatin on mouse prostate cancer

    International Nuclear Information System (INIS)

    Zhang Min; Ren Jun; Xu Bo; Gao Xianshu; He Zhisong; He Xiaoming; Zhang Ming; Liu Chaoxing; He Xinyong; Cao Guangming; Zhang Shaolong

    2009-01-01

    Objective: To test the hypothesis that p53 gene therapy combined with endostatin can enhance tumor response to radiation therapy of RM-1 mouse xenograft prostate cancer and to investigate its mechanism. Methods: A mouse prostate cancer model was established. Then mice with xenograft tumor were randomly divided into group A (control), B (radiation), C (radiation and rAdp53), D (radiation and rh-endostatin) and E (radiation and rAdp53 and rhendostatin). On day 1, rAdp53 was injected intra-tumorously with 1 x 10 10 vp per animal to group C and E. From day 1 to 14, rh-endostatin was given 15 mg/kg intraperitoneally daily to group D and E. On day 4 single fraction of 15 Gy was given to tumors in groups B, C, D and E. Normal saline was injected intra-tumorously or intraperitoneaUy accordingly as control. No treatment was done to group A. Tumor volume was measured daily. Samples were collected on Days 5, 10 and 15. Ki67, CD31, p53 and VEGF were detected by means of immunohistochemistry. Results: (1) Radiation alone, radiation combined with intra-tumorous injection of Adp53 and/or intraperitoneal injection of rhendostatin resulted in tumor growth arrest of RM-1 cells in vivo (P = 0.000). Radiation combined with both rAdp53 and rhendostatin was the most effective treatment (P < 0.05). (2) All the four treatment groups had a decreased expression of mutant type P53 (P = 0.000). The expression of Ki67 in groups B and C were equal (P 0.05) and increasing (P = 0.000), respectively. Group D had a up-down-up curve (P < 0.05), but group E had a up-down one. On day 5 the expresion of VEGF in group E was the lowest (P < 0.05). An increased expression of MVD compared with the control was shown, and MVD in groups C, D and E were always higher than that in the control (P < 0.05). Conclusions: The limitation of radiotherapy could be overcome by combination with beth p53 gene therapy and endostatin on the growth of mouse prostate cancer cell. Radiation, rAdp53 and endostatin have their

  10. Palmitate induces VSMC apoptosis via toll like receptor (TLR)4/ROS/p53 pathway.

    Science.gov (United States)

    Zhang, Yuanjun; Xia, Guanghao; Zhang, Yaqiong; Liu, Juxiang; Liu, Xiaowei; Li, Weihua; Lv, Yaya; Wei, Suhong; Liu, Jing; Quan, Jinxing

    2017-08-01

    Toll-like receptor 4 (TLR4) has been implicated in vascular inflammation, as well as in the pathogenesis of atherosclerosis and diabetes. Vascular smooth muscle cell (VSMC) apoptosis has been shown to induce plaque vulnerability in atherosclerosis. Previous studies reported that palmitate induced apoptosis in VSMCs; however, the role of TLR4 in palmitate-induced apoptosis in VSMCs has not yet been defined. In this study, we investigated whether or not palmitate-induced apoptosis depended on the activation of the TLR4 pathway. VSMCs were treated with or without palmitate, CRISPR/Cas9z-mediated genome editing methods were used to deplete TLR4 expression, while NADPH oxidase inhibitors were used to inhibit reactive oxygen species (ROS) generation. Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, ROS was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) method, the mRNA and protein expression levels of caspase 3, caspase 9, BCL-2 and p53 were studied by real-time polymerase chain reaction (RT-PCR) and ELISA. Palmitate significantly promotes VSMC apoptosis, ROS generation, and expression of caspase 3, caspase 9 and p53; while NADPH oxidase inhibitor pretreatment markedly attenuated these effects. Moreover, knockdown of TLR4 significantly blocked palmitate-induced ROS generation and VSMC apoptosis accompanied by inhibition of caspase 3, caspase 9, p53 expression and restoration of BCL-2 expression. Our results suggest that palmitate-induced apoptosis depends on the activation of the TLR4/ROS/p53 signaling pathway, and that TLR4 may be a potential therapeutic target for the prevention and treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

    Science.gov (United States)

    White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

    2014-08-01

    The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

  12. Exogenous wild type p53 gene affects radiosensitivity of human lung adenocarcinoma cell line under hypoxia

    International Nuclear Information System (INIS)

    Wang Jianhua; Wang Feng; Liu Yongping; Zhang Yaping; Ni Yan; Li Shirong

    2008-01-01

    Objective: To evaluate the effect of exogenous wild type p53 (wtp53) gene on radiosensitivity of human lung adenocarcinoma cell line under hypoxia. Methods: Human lung adenocarcinoma cell line A549 was transfected with adenovirus carrying recombinant exogenous wtp53. Four irradiation groups were studied: normal cell (Group A), wtp53 transfected cell (Group B), normal cell under hypoxia (Group C) and wtp53 transfected cell under hypoxia(Group D). Cells were irradiated with 9 MeV electron beams. Cellular survival fraction was analyzed. Multi-target single-hit model was used to plot the survival curve. D 0 , D q , oxygen enhancement ratio (OER), sensitizing enhancement ratio (SER) and other parameters were used to evaluate the effects of wtp53 gene on radiosensitivity of A549. The cell apoptotic rate of each group was examined by flow cytometry. Results: OER was 1.75 and 0.81 before and after wtp53 transfection. SER was 1.77 in oxic circumstance and 3.84 under hypoxia. The cell apoptotic rate of Group A and B was lower than Group C and D (F=7.92, P=0.048), with Group A lower than B and Group C lower than D (F=82.50, P=0.001). But Group B and D were similar(t=2.04, P=0.111). Conclusions: Hypoxia can increase the radiation resistance of lung adenocarcinoma cell line A549. The wtp53 can promote apoptosis and improve tumor radiosensitivity, especially under hypoxia. (authors)

  13. [CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

    Science.gov (United States)

    Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

    2012-01-01

    In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

  14. Naphthoquinone Derivative PPE8 Induces Endoplasmic Reticulum Stress in p53 Null H1299 Cells

    Directory of Open Access Journals (Sweden)

    Jin-Cherng Lien

    2015-01-01

    Full Text Available Endoplasmic reticulum (ER plays a key role in synthesizing secretory proteins and sensing signal function in eukaryotic cells. Responding to calcium disturbance, oxidation state change, or pharmacological agents, ER transmembrane protein, inositol-regulating enzyme 1 (IRE1, senses the stress and triggers downstream signals. Glucose-regulated protein 78 (GRP78 dissociates from IRE1 to assist protein folding and guard against cell death. In prolonged ER stress, IRE1 recruits and activates apoptosis signal-regulating kinase 1 (ASK1 as well as downstream JNK for cell death. Naphthoquinones are widespread natural phenolic compounds. Vitamin K3, a derivative of naphthoquinone, inhibits variant tumor cell growth via oxygen uptake and oxygen stress. We synthesized a novel naphthoquinone derivative PPE8 and evaluated capacity to induce ER stress in p53 null H1299 and p53 wild-type A549 cells. In H1299 cells, PPE8 induced ER enlargement, GRP78 expression, and transient IER1 activation. Activated IRE1 recruited ASK1 for downstream JNK phosphorylation. IRE1 knockdown by siRNA attenuated PPE8-induced JNK phosphorylation and cytotoxicity. Prolonged JNK phosphorylation may be involved in PPE8-induced cytotoxicity. Such results did not arise in A549 cells, but p53 knockdown by siRNA restored PPE8-induced GRP78 expression and JNK phosphorylation. We offer a novel compound to induce ER stress and cytotoxicity in p53-deficient cancer cells, presenting an opportunity for treatment.

  15. Connection between cell phone use, p53 gene expression in different zones of glioblastoma multiforme and survival prognoses

    Directory of Open Access Journals (Sweden)

    Reza Akhavan-Sigari

    2014-08-01

    Full Text Available The aim of this paper is to investigate p53 gene expression in the central and peripheral zones of glioblastoma multiforme using a real-time reverse transcription polymerase chain reaction (RT-PCR technique in patients who use cell phones ≥3 hours a day and determine its relationship to clinicopathological findings and overall survival. Sixty-three patients (38 males and 25 females, diagnosed with glioblastoma multiforme (GBM, underwent tumor resection between 2008 and 2011. Patient ages ranged from 25 to 88 years, with a mean age of 55. The levels of expression of p53 in the central and peripheral zone of the GBM were quantified by RT-PCR. Data on p53 gene expression from the central and peripheral zone, the related malignancy and the clinicopatholagical findings (age, gender, tumor location and size, as well as overall survival, were analyzed. Forty-one out of 63 patients (65% with the highest level of cell phone use (≥3 hours/day had higher mutant type p53 expression in the peripheral zone of the glioblastoma; the difference was statistically significant (P=0.034. Results from the present study on the use of mobile phones for ≥3 hours a day show a consistent pattern of increased risk for the mutant type of p53 gene expression in the peripheral zone of the glioblastoma, and that this increase was significantly correlated with shorter overall survival time. The risk was not higher for ipsilateral exposure. We found that the mutant type of p53 gene expression in the peripheral zone of the glioblastoma was increased in 65% of patients using cell phones ≥3 hours a day.

  16. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  17. Deficiency of G1 regulators P53, P21Cip1 and/or pRb decreases hepatocyte sensitivity to TGFβ cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Harrison David J

    2007-11-01

    Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of

  18. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    Science.gov (United States)

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  19. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

    Science.gov (United States)

    Li, Runqin; Zhang, Yinglin

    2016-01-01

    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  20. Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.

    Science.gov (United States)

    Suppiah, Aravind; Greenman, John

    2013-08-07

    Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.

  1. Molecular biologic study about the non-small cell lung carcinoma (2) : p53 gene alteration in non-small cell lung carcinoma

    International Nuclear Information System (INIS)

    Park, Jong Ho; Zo, Jae Ill; Paik, Hee Jong; Kim, Mi Hee

    1996-12-01

    The main purpose of this research was to identify of the p53 and 3p gene alteration in non-small cell lung cancer patients residing in Korea. Furthermore, we analyzed the relationship between the p53 and 3p gene alterations and the clinicopathologic results of lung cancer patients. And we have investigated the role of PCR-LOH in analyzing tumor samples for LOH of defined chromosomal loci. We have used the 40 samples obtained from the lung cancer patients who were diagnosed and operated curatively at Korea Cancer Center Hospital. We have isolated the high molecular weight. DNA from the tumors and normal tissues. And we have amplified the DNA with PCR method and used the microsatellite assay method to detect the altered p53 and 3p gene. The conclusions were as follow: 1) The 3p gene alteration was observed in 9/39 (23.1%) and p53 gene alteration was observed in 15/40 (37.5%) of resected non-small cell lung cancer. 2) There was no correlations between the 3p or p53 gene alterations and prognosis of patients, but further study is necessary. 3) PCR-LOH is a very useful tool for analyzing small amount of tumor samples for loss of heterozygosity of defined chromosomal loci. (author). 10 refs

  2. Rb and p53 gene deletions in lung adenocarcinomas from irradiated and control mice

    International Nuclear Information System (INIS)

    Zhang, Y.; Woloschak, G.E.

    1997-01-01

    This study was conducted on mouse lung adenocarcinoma tissues that were formalin-treated and paraffin-embedded 25 years ago to investigate the large gene deletions of mRb and p53 in B6CF 1 male mice. A total of 80 lung tissue samples from irradiated mice and 40 lung samples from nonirradiated controls were randomly selected and examined in the mRb portion of this study. The results showed a significant (P 0.05) from that for spontaneous lung adenocarcinomas or lung adenocarcinomas from mice exposed to single-dose γ irradiation at a similar total dose. mRb fragments 3 (71%) and 5 (67%), the parts of the gene that encoded the pocket binding region of Rb protein to adenovirus E1A and SV40 T-antigen, were the most frequently deleted fragments. p53 gene deletion analysis was carried out on normal lungs and lung adenocarcinomas that were initially found to bear mRb deletions. Exons 1,4,5,6, and 9 were chosen to be analyzed

  3. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    Science.gov (United States)

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  4. Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.

    Science.gov (United States)

    Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei

    2016-11-01

    Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.

  5. p53 dependent apoptotic cell death induces embryonic malformation in Carassius auratus under chronic hypoxia.

    Directory of Open Access Journals (Sweden)

    Paramita Banerjee Sawant

    Full Text Available Hypoxia is a global phenomenon affecting recruitment as well as the embryonic development of aquatic fauna. The present study depicts hypoxia induced disruption of the intrinsic pathway of programmed cell death (PCD, leading to embryonic malformation in the goldfish, Carrasius auratus. Constant hypoxia induced the early expression of pro-apoptotic/tumor suppressor p53 and concomitant expression of the cell death molecule, caspase-3, leading to high level of DNA damage and cell death in hypoxic embryos, as compared to normoxic ones. As a result, the former showed delayed 4 and 64 celled stages and a delay in appearance of epiboly stage. Expression of p53 efficiently switched off expression of the anti-apoptotic Bcl-2 during the initial 12 hours post fertilization (hpf and caused embryonic cell death. However, after 12 hours, simultaneous downregulation of p53 and Caspase-3 and exponential increase of Bcl-2, caused uncontrolled cell proliferation and prevented essential programmed cell death (PCD, ultimately resulting in significant (p<0.05 embryonic malformation up to 144 hpf. Evidences suggest that uncontrolled cell proliferation after 12 hpf may have been due to downregulation of p53 abundance, which in turn has an influence on upregulation of anti-apoptotic Bcl-2. Therefore, we have been able to show for the first time and propose that hypoxia induced downregulation of p53 beyond 12 hpf, disrupts PCD and leads to failure in normal differentiation, causing malformation in gold fish embryos.

  6. Human herpesvirus 6B induces phosphorylation of p53 in its regulatory domain by a CK2- and p38-independent pathway

    DEFF Research Database (Denmark)

    Øster, Bodil; Bundgaard, B; Hupp, T R

    2008-01-01

    Here, we demonstrate that human herpesvirus 6B (HHV-6B) infection upregulates the tumour suppressor p53 and induces phosphorylation of p53 at Ser392. Interestingly, phosphorylation at the equivalent site has previously been shown to correlate with p53 tumour suppression in murine models. Although...

  7. Therapeutic Response to Non-genotoxic Activation of p53 by Nutlin3a Is Driven by PUMA-Mediated Apoptosis in Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Liz J. Valente

    2016-03-01

    Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.

  8. Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

    International Nuclear Information System (INIS)

    Lu Qin; Niu Huanzhang; Zhu Guangyu; An Yanli; Qiu Dinghong; Teng Gaojun

    2007-01-01

    Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 μg)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 μg, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

  9. Investigation of transfection efficacy with transcatheter arterial transporting transferring to enhance p53 gene

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Lu; Huanzhang, Niu; Guangyu, Zhu; Yanli, An; Dinghong, Qiu; Gaojun, Teng [Radiologic Department, Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the function of transferrin-DNA complex, transported by transferrin(Tf) and trans-arterial injection via interventional approach be the duel-target-orientated delivery and the transferring into malignant cells to get more effective therapy. Methods: p53-LipofectAMINE ligand with different concentrations of Tf (0, 10, 25, 50, 100 {mu}g)transfected the 4 strains including LM6,Hep3B,YY and L02 in vitro to evaluate the gene transfection efficiency through western blot. Then, after setting up the VX2 hepatocarcinoma models, we delivered the Tf-p53-LipofectAMlNE complex into the hepatic arteries via interventional techniques to analyse the transfection efficiency in vivo. Results: Tf, within the range of l0 100 {mu}g, could increase gene transfection efficiency mediated by liposome, and the efficiency increases with the raise of Tf concentration. Combination with interventional technique to inject Tf-DNA complex into tumor arteries, gene transfection efficiency was enhanced in rabbit models. Conclusion: Tf can enhance gene-liposome transfection efficiency, furthermore with combination of interventional catheter technique, there would be a potential duel-target-orientated gene therapy method. (authors)

  10. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    Directory of Open Access Journals (Sweden)

    Zanatta Daniela B

    2010-06-01

    Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet

  11. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    International Nuclear Information System (INIS)

    Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E

    2010-01-01

    Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19

  12. Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

    Science.gov (United States)

    La Perle, K M; Jhiang, S M; Capen, C C

    2000-08-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice anaplasia and invasiveness of thyroid carcinomas.

  13. UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53Ser-15 phosphorylation

    International Nuclear Information System (INIS)

    Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader; Shahin, Allen; Patel, Mahendra; Galadari, Sehamuddin

    2009-01-01

    Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser 15 . Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not prevent Dubca cell apoptosis, suggesting that p53 Ser-15 phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.

  14. The cyclin-dependent kinase inhibitor 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole induces nongenotoxic, DNA replication-independent apoptosis of normal and leukemic cells, regardless of their p53 status

    International Nuclear Information System (INIS)

    Turinetto, Valentina; Porcedda, Paola; Orlando, Luca; De Marchi, Mario; Amoroso, Antonio; Giachino, Claudia

    2009-01-01

    Current chemotherapy of human cancers focuses on the DNA damage pathway to induce a p53-mediated cellular response leading to either G1 arrest or apoptosis. However, genotoxic treatments may induce mutations and translocations that result in secondary malignancies or recurrent disease. In addition, about 50% of human cancers are associated with mutations in the p53 gene. Nongenotoxic activation of apoptosis by targeting specific molecular pathways thus provides an attractive therapeutic approach. Normal and leukemic cells were evaluated for their sensitivity to 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) through cell viability and caspase activation tests. The apoptotic pathway induced by DRB was analysed by immunfluorescence and immunoblot analysis. H2AX phosphorylation and cell cycle analysis were performed to study the dependance of apoptosis on DNA damage and DNA replication, respectively. To investigate the role of p53 in DRB-induced apoptosis, specific p53 inhibitors were used. Statistical analysis on cell survival was performed with the test of independence. Here we report that DRB, an inhibitor of the transcriptional cyclin-dependent kinases (CDKs) 7 and 9, triggers DNA replication-independent apoptosis in normal and leukemic human cells regardless of their p53 status and without inducing DNA damage. Our data indicate that (i) in p53-competent cells, apoptosis induced by DRB relies on a cytosolic accumulation of p53 and subsequent Bax activation, (ii) in the absence of p53, it may rely on p73, and (iii) it is independent of ATM and NBS1 proteins. Notably, even apoptosis-resistant leukemic cells such as Raji were sensitive to DRB. Our results indicate that DRB represents a potentially useful cancer chemotherapeutic strategy that employs both the p53-dependent and -independent apoptotic pathways without inducing genotoxic stress, thereby decreasing the risk of secondary malignancies

  15. Zoledronic acid produces combinatory anti-tumor effects with cisplatin on mesothelioma by increasing p53 expression levels.

    Directory of Open Access Journals (Sweden)

    Shinya Okamoto

    Full Text Available We examined anti-tumor effects of zoledronic acid (ZOL, one of the bisphosphonates agents clinically used for preventing loss of bone mass, on human mesothelioma cells bearing the wild-type p53 gene. ZOL-treated cells showed activation of caspase-3/7, -8 and -9, and increased sub-G1 phase fractions. A combinatory use of ZOL and cisplatin (CDDP, one of the first-line anti-cancer agents for mesothelioma, synergistically or additively produced the cytotoxicity on mesothelioma cells. Moreover, the combination achieved greater anti-tumor effects on mesothelioma developed in the pleural cavity than administration of either ZOL or CDDP alone. ZOL-treated cells as well as CDDP-treated cells induced p53 phosphorylation at Ser 15, a marker of p53 activation, and up-regulated p53 protein expression levels. Down-regulation of p53 levels with siRNA however did not influence the ZOL-mediated cytotoxicity but negated the combinatory effects by ZOL and CDDP. In addition, ZOL treatments augmented cytotoxicity of adenoviruses expressing the p53 gene on mesothelioma. These data demonstrated that ZOL-mediated augmentation of p53, which was not linked with ZOL-induced cytotoxicity, played a role in the combinatory effects with a p53 up-regulating agent, and suggests a possible clinical use of ZOL to mesothelioma with anti-cancer agents.

  16. Understanding the role of p53 in adaptive response to radiation-induced germline mutations

    International Nuclear Information System (INIS)

    Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.

    2003-01-01

    Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline

  17. Differential effects of p53 on bystander phenotypes induced by gamma ray and high LET heavy ion radiation

    Science.gov (United States)

    He, Mingyuan; Dong, Chen; Konishi, Teruaki; Tu, Wenzhi; Liu, Weili; Shiomi, Naoko; Kobayashi, Alisa; Uchihori, Yukio; Furusawa, Yoshiya; Hei, Tom K.; Dang, Bingrong; Shao, Chunlin

    2014-04-01

    High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.

  18. Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

    Science.gov (United States)

    Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

    2006-04-01

    p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

  19. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  20. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  1. Radioadaptive response and radiation-induced teratogenesis in the late period of organogenesis in mice. Involvement of p53-dependent apoptosis

    International Nuclear Information System (INIS)

    Wang, Bing; Ohyama, Harumi; Nose, Masako; Yukawa, Osami; Yamada, Takeshi; Hayata, Isamu

    2003-01-01

    In the past 5 years, a series of study was done at our institute to investigate radiation effects on the embryogenesis in mice with an emphasis on mechanisms involved in the radiation-induced adaptive response and the role of radiation-induced apoptosis played in teratogenesis in the late period of organogenesis. Using the limb bud system, we first found that radiation-induced apoptosis is involved in malformations, namely, radiation-induced apoptosis in the predigital regions of embryonic limb buds is responsible for digital defects in ICR mice. Examination of embryonic C57BL/6J mice with different p53 status led to further finding that susceptibility to the radiation-induced apoptosis and digital defects depends on both the p53 status and the radiation dose. p53 wild-type mice appeared to be the most sensitive, while p53 knockout mice were the most resistant. These results indicate that p53-dependent apoptosis mediates radiation-induced digital defects. The existence of a radioadaptive response in fetuses, i.e., the priming dose significantly decreases the apoptosis induction, prenatal death, and digital defects in the living fetuses induced by the challenging dose, was found first in ICR strain mice and later confirmed again in C57BL/6J mice. p53 heterozygous embryos did not show the radioadaptive response, indicating the involvement of p53 in the radioadaptive response. (author)

  2. Stabilization of alanine substituted p53 protein at Ser15, Thr18, and Ser20 in response to ionizing radiation

    International Nuclear Information System (INIS)

    Yamauchi, Motohiro; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami

    2004-01-01

    Phosphorylation of p53 at Ser15, Thr18, and Ser20 has been thought to be important for p53 stabilization in response to ionizing radiation. In the present study, we examined the X-ray-induced stabilization of Ala-substituted p53 protein at Ser15, Thr18, and Ser20, whose gene expression was controlled under an ecdyson-inducible promoter. We found that all single-, double-, or triple-Ala-substituted p53 at Ser15, Yhr18, and Ser20 were accumulated in the nucleus similarly to wild-type p53 after X-irradiation. These results indicate that the phosphorylation of p53 at Ser15, Thr18, and Ser20 is not necessarily needed for p53 stabilization in response to ionizing radiation

  3. Ursodeoxycholic acid protects cardiomyocytes against cobalt chloride induced hypoxia by regulating transcriptional mediator of cells stress hypoxia inducible factor 1α and p53 protein.

    Science.gov (United States)

    Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah

    2017-10-01

    In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile

  4. P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors

    International Nuclear Information System (INIS)

    Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.

    1999-01-01

    Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy

  5. Evidence that expression of a mutated p53 gene attenuates apoptotic cell death in human gastric intestinal-type carcinomas in vivo.

    Science.gov (United States)

    Ishida, M; Gomyo, Y; Ohfuji, S; Ikeda, M; Kawasaki, H; Ito, H

    1997-05-01

    To examine in vivo the validity of the results of experiments in vitro, we analyzed the relationship between p53 gene status and apoptotic cell death of human gastric intestinal-type adenocarcinomas. Surgical specimens were classified into two categories: 18 gastric cancers with nuclear p53 protein (A), and 17 gastric cancers without nuclear p53 protein (B). Polymerase chain reaction-single strand conformation polymorphism disclosed a shifted band that corresponded to a mutation in the p53 gene in 13 cases (72%) in category A and 3 cases (18%) in category B, the frequency being significantly higher in the former (P terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL). The TUNEL index [TI; (the number of TUNEL-positive apoptotic cells/the total number of tumor cells) x 100] was 3.8 +/- 1.4% in category A and 4.9 +/- 1.2% in category B, the value being significantly lower in the former (P gastric cancer, in accordance with the previous in vitro finding that p53 gene mutation provides a possible selective advantage for tumor cell proliferation, and (2) apoptosis is related not only to expression of p53 and the stage of the cell cycle, but also to p53-independent and cell cycle-independent events.

  6. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

    Energy Technology Data Exchange (ETDEWEB)

    Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J.; Fortunato, Elizabeth A., E-mail: lfort@uidaho.edu

    2016-10-15

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.

  7. Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

    Science.gov (United States)

    Kashofer, Karl; Regauer, Sigrid

    2017-08-01

    This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

  8. The prognostic value of p53 mutation in pediatric marrow hypoplasia

    Directory of Open Access Journals (Sweden)

    Sharaf Alzahraa EA

    2011-06-01

    Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.

  9. Relation between radiotherapy-induced acute injury of mucosa of nasopharyngeal carcinoma and p53 polymorphisms

    International Nuclear Information System (INIS)

    Wang Changsheng; Xiao Shaowen; Zhang Shanwen

    2007-01-01

    Objective: To explore the relation between p53 genetic polymorphisms and radiotherapy-induced acute injury of mucosa of oral cavity mucosa. Methods: The total of 56 patients with NPC treated by radiotherapy alone or with chemoradiotherapy synchronically were genotyped for the p53 codon 72 pro-Arg SNP using PCR-RFLP assays, and were ranked according to the acute injury of oral cavity mucosa. Results: There was no difference in acute injury of oral cavity mucosa between the p53 Pro allele carriers and the other carriers (P>0.05); the high single dose (P<0.01) and concomitant chemoradiotherapy (P<0.05) resulted in increase in acute injury of oral cavity mucosa. Conclusion: Those results suggest that p53 SNP may not associate with radiotherapeutic acute injury of oral cavity mucosa. (authors)

  10. Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling

    Directory of Open Access Journals (Sweden)

    Joerg eReichrath

    2014-06-01

    Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity

  11. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  12. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  13. Friend or Foe: MicroRNAs in the p53 network.

    Science.gov (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  14. Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.

    Directory of Open Access Journals (Sweden)

    Alejo Efeyan

    Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.

  15. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  16. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  17. Effect of radon and its progeny on the expression and mutation of p53 in lung tissues of mice

    International Nuclear Information System (INIS)

    Piao Chunnan; Tian Mei; Liu Jianxiang; Ruan Jianlei; Su Xu

    2010-01-01

    Objective: To explore the effect of radon and its progeny on the expression and mutations of p53 in lung tissue of mouse model. Methods: Apoptosis was detected by terminal deoxynucleotidy transferase-mediated dUTP-biotin nick end labeling. The expression of p53 gene was analyzed by immunohistochemistry, Western blot and realtime-PCR. PCR-SSCP was used to detect the mutation of p53 in lung tissues. Results: Compared with those in the control group, the apoptotic index were increased significantly in 30 WLM and 60 WLM groups (t=18.11, -10.30, P<0.05). The p53 protein was increased significantly (t=-11.08, P<0.05; t=-7.00, P<0.05) in 30 WLM and 60 WLM groups. The mutation of p53 gene was not detected in lungs of radon-exposure mice. Conclusions: Lung and bronchus might be the targets of radon and its progeny, and p53 gene plays an important role in the progression of radon-induced lung injury. (authors)

  18. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  19. Activation of p53 by nutlin-3a induces apoptosis and cellular senescence in human glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Ruth Villalonga-Planells

    2011-04-01

    Full Text Available Glioblastoma multiforme (GBM is the most common and aggressive primary brain tumor in adults. Despite concerted efforts to improve current therapies and develop novel clinical approaches, patient survival remains poor. As such, increasing attention has focused on developing new therapeutic strategies that specifically target the apoptotic pathway in order to improve treatment responses. Recently, nutlins, small-molecule antagonists of MDM2, have been developed to inhibit p53-MDM2 interaction and activate p53 signaling in cancer cells. Glioma cell lines and primary cultured glioblastoma cells were treated with nutlin-3a. Nutlin-3a induced p53-dependent G1- and G2-M cell cycle arrest and apoptosis in glioma cell lines with normal TP53 status. In addition, nutlin-arrested glioma cells show morphological features of senescence and persistent induction of p21 protein. Furthermore, senescence induced by nutlin-3a might be depending on mTOR pathway activity. In wild-type TP53 primary cultured cells, exposure to nutlin-3a resulted in variable degrees of apoptosis as well as cellular features of senescence. Nutlin-3a-induced apoptosis and senescence were firmly dependent on the presence of functional p53, as revealed by the fact that glioblastoma cells with knockdown p53 with specific siRNA, or cells with mutated or functionally impaired p53 pathway, were completely insensitive to the drug. Finally, we also found that nutlin-3a increased response of glioma cells to radiation therapy. The results provide a basis for the rational use of MDM2 antagonists as a novel treatment option for glioblastoma patients.

  20. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  1. A novel radiation-induced p53 mutation is not implicated in radiation resistance via a dominant-negative effect.

    Directory of Open Access Journals (Sweden)

    Yunguang Sun

    Full Text Available Understanding the mutations that confer radiation resistance is crucial to developing mechanisms to subvert this resistance. Here we describe the creation of a radiation resistant cell line and characterization of a novel p53 mutation. Treatment with 20 Gy radiation was used to induce mutations in the H460 lung cancer cell line; radiation resistance was confirmed by clonogenic assay. Limited sequencing was performed on the resistant cells created and compared to the parent cell line, leading to the identification of a novel mutation (del at the end of the DNA binding domain of p53. Levels of p53, phospho-p53, p21, total caspase 3 and cleaved caspase 3 in radiation resistant cells and the radiation susceptible (parent line were compared, all of which were found to be similar. These patterns held true after analysis of p53 overexpression in H460 cells; however, H1299 cells transfected with mutant p53 did not express p21, whereas those given WT p53 produced a significant amount, as expected. A luciferase assay demonstrated the inability of mutant p53 to bind its consensus elements. An MTS assay using H460 and H1299 cells transfected with WT or mutant p53 showed that the novel mutation did not improve cell survival. In summary, functional characterization of a radiation-induced p53 mutation in the H460 lung cancer cell line does not implicate it in the development of radiation resistance.

  2. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov

    2014-01-01

    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  3. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Tzu-Chin [Chest Clinic, Chung Shan Medical University Hospital, Taichung, Taiwan (China); Lin, Yi-Chin [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Chen, Hsiao-Ling [Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan (China); Huang, Pei-Ru; Liu, Shang-Yu [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Yeh, Shu-Lan, E-mail: suzyyeh@csmu.edu.tw [Department of Nutritional Science, Chung Shan Medical University, Taichung, Taiwan (China); Department of Nutrition, Chung Shan Medical University Hospital, Taichung, Taiwan (China)

    2016-02-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  4. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase

    International Nuclear Information System (INIS)

    Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan

    2016-01-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation. - Highlights: • Genistein enhances the antitumor effect of TSA through p53-associated pathways. • Genistein enhances TSA-induced histone acetylation commonly. • An acetyltransferase inhibitor diminishes the antitumor effect of genistein + TSA. • TSA in combination with genistein increases the expression of p300. • Genistein given by i.p. injection increases the antitumor effect of TSA in vivo.

  5. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  6. Evaluation of bax, bcl-2, p21 and p53 genes expression variations on cerebellum of BALB/c mice before and after birth under mobile phone radiation exposure.

    Science.gov (United States)

    Ghatei, Najmeh; Nabavi, Ariane Sadr; Toosi, Mohammad Hossein Bahreyni; Azimian, Hosein; Homayoun, Mansour; Targhi, Reza Ghasemnezhad; Haghir, Hossein

    2017-09-01

    The increasing rate of over using cell phones has been considerable in youths and pregnant women. We examined the effect of mobile phones radiation on genes expression variation on cerebellum of BALB/c mice before and after of the birth. In this study, a mobile phone jammer, which is an instrument to prevent receiving signals between cellular phones and base transceiver stations (two frequencies 900 and 1800 MHz) for exposure was used and twelve pregnant mice (BALB/c) divided into two groups (n=6), first group irradiated in pregnancy period (19th day), the second group did not irradiate in pregnancy period. After childbirth, offspring were classified into four groups (n=4): Group1: control, Group 2: B1 (Irradiated after birth), Group 3: B2 (Irradiated in pregnancy period and after birth), Group 4: B3 (Irradiated in pregnancy period). When maturity was completed (8-10 weeks old), mice were dissected and cerebellum was isolated. The expression level of bax , bcl-2, p21 and p53 genes examined by real-time reverse transcription polymerase chain reaction (Real-Time RT- PCR). The data showed that mobile phone radio waves were ineffective on the expression level of bcl-2 and p53 genes) P >0.05(. Also gene expression level of bax decreased and gene expression level of p21 increased comparing to the control group ( P mobile phone radiations did not induce apoptosis in cells of the cerebellum and the injured cells can be repaired by cell cycle arrest.

  7. Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

    Science.gov (United States)

    Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

    2010-12-01

    Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

  8. Lactose binding to human galectin-7 (p53-induced gene 1) induces long-range effects through the protein resulting in increased dimer stability and evidence for positive cooperativity

    Science.gov (United States)

    Ermakova, Elena; Miller, Michelle C; Nesmelova, Irina V; López-Merino, Lara; Berbís, Manuel Alvaro; Nesmelov, Yuri; Tkachev, Yaroslav V; Lagartera, Laura; Daragan, Vladimir A; André, Sabine; Cañada, F Javier; Jiménez-Barbero, Jesús; Solís, Dolores; Gabius, Hans-Joachim; Mayo, Kevin H

    2013-01-01

    The product of p53-induced gene 1 is a member of the galectin family, i.e., galectin-7 (Gal-7). To move beyond structural data by X-ray diffraction, we initiated the study of the lectin by nuclear magnetic resonance (NMR) and circular dichroism spectroscopies, and molecular dynamics (MD) simulations. In concert, our results indicate that lactose binding to human Gal-7 induces long-range effects (minor conformational shifts and changes in structural dynamics) throughout the protein that result in stabilization of the dimer state, with evidence for positive cooperativity. Monte Carlo fits of 15N-Gal-7 HSQC titrations with lactose using a two-site model yield K1 = 0.9 ± 0.6 × 103 M−1 and K2 = 3.4 ± 0.8 × 103 M−1. Ligand binding-induced stabilization of the Gal-7 dimer was supported by several lines of evidence: MD-based calculations of interaction energies between ligand-loaded and ligand-free states, gel filtration data and hetero-FRET spectroscopy that indicate a highly reduced tendency for dimer dissociation in the presence of lactose, CD-based thermal denaturation showing that the transition temperature of the lectin is significantly increased in the presence of lactose, and saturation transfer difference (STD) NMR using a molecular probe of the monomer state whose presence is diminished in the presence of lactose. MD simulations with the half-loaded ligand-bound state also provided insight into how allosteric signaling may occur. Overall, our results reveal long-range effects on Gal-7 structure and dynamics, which factor into entropic contributions to ligand binding and allow further comparisons with other members of the galectin family. PMID:23376190

  9. Effect of UV C irradiation on P53 in FADD+/+ and FADD-/- cells

    International Nuclear Information System (INIS)

    Matic, Igor; Radnic, Maja; Marijanovic, Inga; Furcic, Ivana; Nagy, Biserka

    2008-01-01

    The dominant paradigm of tumor biology is that evasion from apoptosis is one of the crucial features of malignant diseases and that the efficiency of cancer therapy depends on P53-dependent apoptosis. Because of the importance of apoptotic pathways in protecting cells against malignant transformation, disruption of apoptosis is extremely common in cancer cells, and is frequently due to mutations in the P53 tumor suppressor gene. Fas-associated death domain (FADD) is an adapter protein that is required for apoptosis induced by all known death receptors. FADD is implicated in death receptor-independent apoptotic response, such as DNA damage. We used embryonic fibroblasts derived from FADD knockout mice and their genetic counterparts. We predicted that UV exposure induces a loss of FADD function and leads to mutations in P53. Loss of FADD expression causes deregulation of apoptosis and expansion of mutated cells and initiation of cancer. We predicted that FADD dysfunction may be potentially advantageous for tumor growth and that FADD can act as a tumor suppressor. Cells were irradiated with UV C light (254 nm) using a germicidal lamp (Upland, CA). The culture media was drained before the irradiation and fresh media was added after. In the first experiment we irradiated cells with a dose of 25 J/m 2 and after 5 days we isolated genomic DNA but part of the cells were irradiated again with the same dose. After 5 days DNA were isolated so the cumulative irradiation dose was 50 J/m 2 . In the second experiment cells were irradiated ones with the dose of 40 J/m 2 and DNA was isolated after 18 days. Lethal dosage for each cell line is 50 J/m 2 . Genomic DNA was analyzed by allele-specific polymerase chain reaction (AS-PCR) for CC to TT mutation at codons 154-155 and 175-176 in exon 5 and for C to T mutations at codons 270 and 275 in exon 8 of the P53 gene. The mutant-specific forward primer was used for each mutation. The reverse primers for amplification of mutations were

  10. The p53 inhibitor, pifithrin-α, suppresses self-renewal of embryonic stem cells

    International Nuclear Information System (INIS)

    Abdelalim, Essam Mohamed; Tooyama, Ikuo

    2012-01-01

    Highlights: ► We determine the role of p53 in ES cells under unstressful conditions. ► PFT-α suppresses ES cell proliferation. ► PFT-α induces ES cell cycle arrest. ► PFT-α downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-α, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-α resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-α caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  11. The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522 (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2012-04-13

    Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.

  12. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  13. Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

    International Nuclear Information System (INIS)

    Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

    2015-01-01

    Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

  14. Survivin inhibits anti-growth effect of p53 activated by aurora B

    International Nuclear Information System (INIS)

    Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee

    2005-01-01

    Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53

  15. miR-125b targets DNMT3b and mediates p53 DNA methylation involving in the vascular smooth muscle cells proliferation induced by homocysteine

    Energy Technology Data Exchange (ETDEWEB)

    Cao, ChengJian [Key Laboratory of Basic Research in Cardio-Cerebral Vascular Diseases, Ningxia Medical University, Yinchuan (China); Zhang, HuiPing [Department of Prenatal Diagnosis Center, General Hospital of Ningxia Medical University, Yinchuan (China); Zhao, Li [Department of Medical Laboratory, Ningxia Medical University, Yinchuan (China); Zhou, Longxia [Department of Basic Medicine, Ningxia Medical University, Yinchuan (China); Zhang, Minghao; Xu, Hua [Key Laboratory of Basic Research in Cardio-Cerebral Vascular Diseases, Ningxia Medical University, Yinchuan (China); Department of Basic Medicine, Ningxia Medical University, Yinchuan (China); Han, Xuebo [Department of Medical Laboratory, Ningxia Medical University, Yinchuan (China); Li, Guizhong; Yang, Xiaoling [Key Laboratory of Basic Research in Cardio-Cerebral Vascular Diseases, Ningxia Medical University, Yinchuan (China); Department of Basic Medicine, Ningxia Medical University, Yinchuan (China); Jiang, YiDeng, E-mail: jyjcyxy@yeah.net [Key Laboratory of Basic Research in Cardio-Cerebral Vascular Diseases, Ningxia Medical University, Yinchuan (China); Department of Basic Medicine, Ningxia Medical University, Yinchuan (China)

    2016-09-10

    MicroRNAs (miRNAs) are short non-coding RNA and play crucial roles in a wide array of biological processes, including cell proliferation, differentiation and apoptosis. Our previous studies found that homocysteine(Hcy) can stimulate the proliferation of vascular smooth muscle cells (VSMCs), however, the underlying mechanisms were not fully elucidated. Here, we found proliferation of VSMCs induced by Hcy was of correspondence to the miR-125b expression reduced both in vitro and in the ApoE knockout mice, the hypermethylation of p53, its decreased expression, and DNA (cytosine-5)-methyltransferase 3b (DNMT3b) up-regulated. And, we found DNMT3b is a target of miR-125b, which was verified by the Dual-Luciferase reporter assay and western blotting. Besides, the siRNA interference for DNMT3b significantly decreased the methylation level of p53, which unveiled the causative role of DNMT3b in p53 hypermethylation. miR-125b transfection further confirmed its regulative roles on p53 gene methylation status and the VSMCs proliferation. Our data suggested that a miR-125b-DNMT3b-p53 signal pathway may exist in the VSMCs proliferation induced by Hcy.

  16. miR-125b targets DNMT3b and mediates p53 DNA methylation involving in the vascular smooth muscle cells proliferation induced by homocysteine

    International Nuclear Information System (INIS)

    Cao, ChengJian; Zhang, HuiPing; Zhao, Li; Zhou, Longxia; Zhang, Minghao; Xu, Hua; Han, Xuebo; Li, Guizhong; Yang, Xiaoling; Jiang, YiDeng

    2016-01-01

    MicroRNAs (miRNAs) are short non-coding RNA and play crucial roles in a wide array of biological processes, including cell proliferation, differentiation and apoptosis. Our previous studies found that homocysteine(Hcy) can stimulate the proliferation of vascular smooth muscle cells (VSMCs), however, the underlying mechanisms were not fully elucidated. Here, we found proliferation of VSMCs induced by Hcy was of correspondence to the miR-125b expression reduced both in vitro and in the ApoE knockout mice, the hypermethylation of p53, its decreased expression, and DNA (cytosine-5)-methyltransferase 3b (DNMT3b) up-regulated. And, we found DNMT3b is a target of miR-125b, which was verified by the Dual-Luciferase reporter assay and western blotting. Besides, the siRNA interference for DNMT3b significantly decreased the methylation level of p53, which unveiled the causative role of DNMT3b in p53 hypermethylation. miR-125b transfection further confirmed its regulative roles on p53 gene methylation status and the VSMCs proliferation. Our data suggested that a miR-125b-DNMT3b-p53 signal pathway may exist in the VSMCs proliferation induced by Hcy.

  17. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  18. Estudo do polimorfismo genético no gene p53 (códon 72 em câncer colorretal Role of the genetic polymorphism of p53 (codon 72 gene in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Jacqueline Miranda de Lima

    2006-03-01

    Full Text Available RACIONAL: Polimorfismos genéticos são variações genéticas que podem ocorrer em seqüências codificadoras e não-codificadoras, levando a alterações qualitativas e/ou quantitativas das proteínas em questão. O p53 é o gene mais comumente alterado no câncer humano. O polimorfismo desse gene no códon 72 ocorre por substituição de uma base e tem sido associado a maior risco de câncer. OBJETIVO: Determinar a possível associação entre o polimorfismo no códon 72 (72 arginina/prolina do gene p53 e câncer colorretal. CASUÍSTICA E MÉTODOS: Foram avaliados em 100 pacientes com câncer colorretal e em 100 indivíduos sem câncer, pareados quanto ao sexo idade, o hábito de fumar, o etilismo e no grupo caso o estádio, o grau de diferenciação e a evolução da doença. O genótipo (72 arginina/prolina foi determinado por PCR, utilizando-se primers (seqüências de nucleotídeos específicos. RESULTADOS: O genótipo homozigoto arginina/arginina foi prevalente em 56% no grupo controle e em 58% no grupo caso. Não se observou diferença entre os dois grupos. No estádio IV este genótipo foi mais freqüente quando comparado ao estádio I (80% versus 14%. Não se observou diferença entre as variações do genótipo e fumo, álcool, evolução clínica ou grau de diferenciação. CONCLUSÃO: A prevalência do genótipo arginina/arginina foi a mais freqüente nos dois grupos. Não foi encontrada correlação entre maior risco de câncer e o polimorfismo no códon 72 prolina/arginina do gene p53. Apesar do pequeno número de doentes com câncer em estádio avançado (IV, estes tiveram maior prevalência do genótipo arginina/arginina.BACKGROUND: Polymorphisms are genetic variations that can occur in sequences of codons, leading to defective proteins. p53 is the most commonly gene affected in human cancer. The polymorphism of this gene occurs by a substitution of a base in codon 72 and may increase the risk of cancer. AIM: To investigate the

  19. The role of the expression of bcl-2, p53 gene in tamoxifen-induced apoptosis of breast cancer cells and its relationship with hormone receptor status

    Energy Technology Data Exchange (ETDEWEB)

    Noh, Woo Chul; Ham, Yong Ho [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1998-01-01

    To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10`-`9M) and tamoxifen (10`-`5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs

  20. The role of the expression of bcl-2, p53 gene in tamoxifen-induced apoptosis of breast cancer cells and its relationship with hormone receptor status

    International Nuclear Information System (INIS)

    Noh, Woo Chul; Ham, Yong Ho

    1998-01-01

    To investigate the relationship of bcl-2, p53, ER and tamoxifen-induced apoptosis of breast cancer cells, MCF-7 (ER+/bcl-2+/p53-) and MB MDA 468 (ER-/bcl-2-/p53+) cell line were cultured in estrogen-free condition. E2(10'-'9M) and tamoxifen (10'-'5M) were added to the media. The changes of bcl-2 and mutant p53 protein were checked by Western blot and apoptosis were measured by flowcytometry. In MCF-7 cells, we found that treatment with tamoxifen resulted in a decrease in bcl-2 protein level, but produced no change in mutant p53. In MB MDA 468 cell however, there were no changes of bcl-2 and mutant p53 protein level when E2 or tamoxifen were added. Apoptotic cells increased with time-dependent pattern when tamoxifen was added to MCF-7 cells. According to these result, ER+/blc-2+/mutant p53- cells, when treated with tamoxifen, were converted into bcl-2/mutant p53- cells which were more prone to apoptosis than bcl-2-/mutant p53+ cells. The paradoxical correlation of bcl-2 and ER which had been observed in clinical studies might be explained with this results and bcl-2 protein seems to be one of important factors that can predict the effect of hormone therapy. (author). 26 refs., 5 figs

  1. P53 Gene Mutagenesis in Breast Cancer

    National Research Council Canada - National Science Library

    Sommer, Steve S

    2005-01-01

    .... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...

  2. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    International Nuclear Information System (INIS)

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama

    2015-01-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of

  3. Restriction of human herpesvirus 6B replication by p53

    DEFF Research Database (Denmark)

    Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina

    2008-01-01

    Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

  4. Cancerous hyper-mutagenesis in p53 genes is possibly associated with transcriptional bypass of DNA lesions

    International Nuclear Information System (INIS)

    Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.

    2002-01-01

    The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with

  5. Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.

    Science.gov (United States)

    Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C

    2017-12-01

    Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung cancer expressing mutant p53

    DEFF Research Database (Denmark)

    Zandi, Roza; Selivanova, Galina; Christensen, Camilla Laulund

    2011-01-01

    Small cell lung cancer (SCLC) is a highly malignant disease with poor prognosis, necessitating the need to develop new and efficient treatment modalities. PRIMA-1(Met) (p53-dependent reactivation of massive apoptosis), also known as APR-246, is a small molecule, which restores tumor suppressor...... function to mutant p53 and induces cancer cell death in various cancer types. Since p53 is mutated in more than 90% of SCLC, we investigated the ability of PRIMA-1(Met) to induce apoptosis and inhibit tumor growth in SCLC with different p53 mutations....

  7. Downregulation of B-myb promotes senescence via the ROS-mediated p53/p21 pathway, in vascular endothelial cells.

    Science.gov (United States)

    Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei

    2017-04-01

    To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.

  8. Chrysin protects against cisplatin-induced colon. toxicity via amelioration of oxidative stress and apoptosis: Probable role of p38MAPK and p53

    Energy Technology Data Exchange (ETDEWEB)

    Khan, Rehan; Khan, Abdul Quaiyoom; Qamar, Wajhul; Lateef, Abdul; Tahir, Mir; Rehman, Muneeb U; Ali, Farrah; Sultana, Sarwat, E-mail: sarwat786@rediffmail.com

    2012-02-01

    Cisplatin, an antineoplastic drug, is widely used as a foremost therapy against numerous forms of cancer but it has pronounced adverse effects viz., nephrotoxicity, ototoxicity etc. CDDP-induced emesis and diarrhea are also marked toxicities that may be due to intestinal injury. Chrysin (5,7-dihydroxyflavone), a natural flavone commonly found in many plants possesses multiple biological activities, such as antioxidant, anti-inflammatory and anti-cancer effects. In the present study, we investigated the protective effect of chrysin against CDDP-induced colon toxicity. The plausible mechanism of CDDP-induced colon toxicity and damage includes oxidative stress, activation of p38MAPK and p53, and colonic epithelial cell apoptosis via upregulating the expression of Bak and cleaved caspase-3. Chrysin was administered to Wistar rats once daily for 14 consecutive days at the doses of 25 and 50 mg/kg body weight orally in corn oil. On day 14, a single intraperitoneal injection of cisplatin was given at the dose of 7.5 mg/kg body weight and animals were euthanized after 24 h of cisplatin injection. Chrysin ameliorated CDDP-induced lipid peroxidation, xanthine oxidase activity, glutathione depletion, decrease in antioxidant (catalase, glutathione reductase, glutathione peroxidase and glucose-6 phosphate dehydrogenase) and phase-II detoxifying (glutathione-S-transferase and quinone reductase) enzyme activities. Chrysin also attenuated goblet cell disintegration, expression of phospho-p38MAPK and p53, and apoptotic tissue damage which were induced by CDDP. Histological findings further supported the protective effects of chrysin against CDDP-induced colonic damage. The results of the present study suggest that the protective effect of chrysin against CDDP-induced colon toxicity was related with attenuation of oxidative stress, activation of p38MAPK and p53, and apoptotic tissue damage. Highlights: ► Cisplatin-induced colon toxicity is associated with oxidative stress and

  9. Chrysin protects against cisplatin-induced colon. toxicity via amelioration of oxidative stress and apoptosis: Probable role of p38MAPK and p53

    International Nuclear Information System (INIS)

    Khan, Rehan; Khan, Abdul Quaiyoom; Qamar, Wajhul; Lateef, Abdul; Tahir, Mir; Rehman, Muneeb U; Ali, Farrah; Sultana, Sarwat

    2012-01-01

    Cisplatin, an antineoplastic drug, is widely used as a foremost therapy against numerous forms of cancer but it has pronounced adverse effects viz., nephrotoxicity, ototoxicity etc. CDDP-induced emesis and diarrhea are also marked toxicities that may be due to intestinal injury. Chrysin (5,7-dihydroxyflavone), a natural flavone commonly found in many plants possesses multiple biological activities, such as antioxidant, anti-inflammatory and anti-cancer effects. In the present study, we investigated the protective effect of chrysin against CDDP-induced colon toxicity. The plausible mechanism of CDDP-induced colon toxicity and damage includes oxidative stress, activation of p38MAPK and p53, and colonic epithelial cell apoptosis via upregulating the expression of Bak and cleaved caspase-3. Chrysin was administered to Wistar rats once daily for 14 consecutive days at the doses of 25 and 50 mg/kg body weight orally in corn oil. On day 14, a single intraperitoneal injection of cisplatin was given at the dose of 7.5 mg/kg body weight and animals were euthanized after 24 h of cisplatin injection. Chrysin ameliorated CDDP-induced lipid peroxidation, xanthine oxidase activity, glutathione depletion, decrease in antioxidant (catalase, glutathione reductase, glutathione peroxidase and glucose-6 phosphate dehydrogenase) and phase-II detoxifying (glutathione-S-transferase and quinone reductase) enzyme activities. Chrysin also attenuated goblet cell disintegration, expression of phospho-p38MAPK and p53, and apoptotic tissue damage which were induced by CDDP. Histological findings further supported the protective effects of chrysin against CDDP-induced colonic damage. The results of the present study suggest that the protective effect of chrysin against CDDP-induced colon toxicity was related with attenuation of oxidative stress, activation of p38MAPK and p53, and apoptotic tissue damage. Highlights: ► Cisplatin-induced colon toxicity is associated with oxidative stress and

  10. Caspase Activation and Aberrant Cell Growth in a p53+/+ Cell Line from a Li-Fraumeni Syndrome Family

    Directory of Open Access Journals (Sweden)

    Zaki A. Sherif

    2015-01-01

    Full Text Available Wild-type p53 is well known to induce cell cycle arrest and apoptosis to block aberrant cell growth. However, p53’s unique role in apoptosis and cell proliferation in Li-Fraumeni Syndrome (LFS has not been well elucidated. The aim of this study is to characterize the activity of wild-type p53 protein in LFS family dominated by a germline negative mutant p53. As expected, etoposide-treated wild-type p53-containing cell lines, LFS 2852 and control Jurkat, showed a greater rate of caspase- and annexin V-induced apoptotic cell death compared to the p53-mutant LFS 2673 cell line although mitochondrial and nuclear assays could not detect apoptosis in these organelles. The most intriguing part of the observation was the abnormal proliferation rate of the wild-type p53-containing cell line, which grew twice as fast as 2673 and Jurkat cells. This is important because apoptosis inducers acting through the mitochondrial death pathway are emerging as promising drugs against tumors where the role of p53 is not only to target gene regulation but also to block cell proliferation. This study casts a long shadow on the possible dysregulation of p53 mediators that enable cell proliferation. The deregulation of proliferation pathways represents an important anticancer therapeutic strategy for patients with the LFS phenotype.

  11. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  12. The presence of carbon nanostructures in bakery products induces metabolic stress in human mesenchymal stem cells through CYP1A and p53 gene expression.

    Science.gov (United States)

    Al-Hadi, Ahmed M; Periasamy, Vaiyapuri Subbarayan; Athinarayanan, Jegan; Alshatwi, Ali A

    2016-01-01

    Ingredients commonly present in processed foods are excellent substrates for chemical reactions during modern thermal cooking or processing, which could possibly result in deteriorative carbonization changes mediated by a variety of thermal reactions. Spontaneous self-assembling complexation or polymerization of partially combusted lipids, proteins, and other food macromolecules with synthetic food additives during high temperature food processing or baking (200-250 °C) would result in the formation of carbon nanostructures (CNs). These unknown nanostructures may produce adverse physiological effects or potential health risks. The present work aimed to identify and characterize the nanostructures from the crusts of bread. Furthermore, a toxicological risk assessment of these nanostructures was conducted using human mesenchymal stem cells (hMSCs) as a model for cellular uptake and metabolic oxidative stress, with special reference to induced adipogenesis. CNs isolated from bread crusts were characterized using transmission electron microscopy. The in vitro risk assessment of the CNs was carried out in hMSCs using an MTT assay, cell morphological assessment, a reactive oxygen species assay, a mitochondrial trans-membrane potential assay, cell cycle progression assessment and gene expression analysis. Our results revealed that bread crusts contain CNs, which may form during the bread-making process. The in vitro results indicate that carbon nanostructures have moderately toxic effects in the hMSCs at a high dose (400 μg/mL). The mitochondrial trans-membrane potentials and intracellular ROS levels of the hMSCs were altered at this dose. The levels of the mRNA transcripts of metabolic stress-responsive genes such as CAT, GSR, GSTA4, CYP1A and p53 were significantly altered in response to CNs. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma

    International Nuclear Information System (INIS)

    Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei

    1999-01-01

    Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53

  14. Overexpression of p53 activated by small activating RNA suppresses the growth of human prostate cancer cells

    Directory of Open Access Journals (Sweden)

    Ge Q

    2016-01-01

    Full Text Available Qiangqiang Ge,1,* Chenghe Wang,2,* Yajun Ruan,1,* Zhong Chen,1 Jihong Liu,1 Zhangqun Ye1 1Department of Urology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei, 2Department of Urology, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China *These authors contributed equally to this work Abstract: Previous research has reported that a particular double-stranded RNA, named dsP53-285, has the capacity to induce expression of the tumor suppressor gene TP53 in chimpanzee cells by targeting its promoter. Usually, it is the wild-type p53 protein, rather than mutants, which exhibits potent cancer-inhibiting effects. In addition, nonhuman primates, such as chimpanzees, share almost identical genome sequences with humans. This prompted us to speculate whether dsP53-285 can trigger wild-type p53 protein expression in human prostate cancer (PCa cells and consequently suppress cell growth. The human PCa cell lines LNCaP and DU145 were transfected with dsP53-285 for 72 hours. Compared with the dsControl and mock transfection groups, expression of both p53 messenger RNA and p53 protein was significantly enhanced after dsP53-285 transfection, and this enhancement was followed by upregulation of p21, which indirectly indicated that dsP53-285 induced wild-type p53 expression. Moreover, overexpression of wild-type p53 mediated by dsP53-285 downregulated the expression of Cyclin D1 and cyclin-dependent kinase 4/6, thereby inducing PCa cell cycle arrest in G0/G1 phase and then inhibiting cell proliferation and clonogenicity. More importantly, dsP53-285 suppressed PCa cells mainly by modulating wild-type p53 expression. In conclusion, our study provides evidence that dsP53-285 can significantly stimulate wild-type p53 expression in the human PCa cell lines LNCaP and DU145 and can exert potent antitumor effects. Keywords: p53, small activating RNA, prostate

  15. Metformin and Resveratrol Inhibited High Glucose-Induced Metabolic Memory of Endothelial Senescence through SIRT1/p300/p53/p21 Pathway.

    Science.gov (United States)

    Zhang, Erli; Guo, Qianyun; Gao, Haiyang; Xu, Ruixia; Teng, Siyong; Wu, Yongjian

    2015-01-01

    Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and how "metabolic memory" would affect endothelial senescence through SIRT1 signaling remains largely unknown. In this study, we investigated the involvement of SIRT1 axis as well as the protective effects of resveratrol (RSV) and metformin (MET), two potent SIRT1 activators, during the occurrence of "metabolic memory" of cellular senescence (senescent "memory"). Human umbilical vascular endothelial cells (HUVECs) were cultured in either normal glucose (NG)/high glucose (HG) media for 6 days, or 3 days of HG followed by 3 days of NG (HN), with or without RSV or MET treatment. It was shown that HN incubation triggered persistent downregulation of deacetylase SIRT1 and upregulation of acetyltransferase p300, leading to sustained hyperacetylation (at K382) and activation of p53, and subsequent p53/p21-mediated senescent "memory." In contrast, senescent "memory" was abrogated by overexpression of SIRT1 or knockdown of p300. Interestingly, we found that SIRT1 and p300 could regulate each other in response to HN stimulation, suggesting that a delicate balance between acetyltransferases and deacetylases may be particularly important for sustained acetylation and activation of non-histone proteins (such as p53), and eventually the occurrence of "metabolic memory." Furthermore, we found that RSV or MET treatment prevented senescent "memory" by modulating SIRT1/p300/p53/p21 pathway. Notably, early and continuous treatment of MET, but not RSV, was particularly important for preventing senescent "memory." In conclusion, short-term high glucose stimulation could induce sustained endothelial senescence via SIRT1/p300/p53/p21 pathway. RVS or MET

  16. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  17. Iron deprivation induces apoptosis independently of p53 in human and murine tumour cells

    Czech Academy of Sciences Publication Activity Database

    Truksa, Jaroslav; Kovář, Jan; Valenta, Tomáš; Ehrlichová, Marie; Polák, J.; Naumann, P. W.

    2003-01-01

    Roč. 36, č. 4 (2003), s. 199-213 ISSN 0960-7722 R&D Projects: GA ČR GA301/01/0041 Keywords : iron deprivation * p53 * apoptosis induction Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 1.529, year: 2003

  18. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  19. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  20. The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

    International Nuclear Information System (INIS)

    Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

    2000-01-01

    The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53δ, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53δ cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of undifferentiated

  1. The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

    Energy Technology Data Exchange (ETDEWEB)

    Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura [Kyoto Univ. (Japan). Radiation Biology Center; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

    2000-09-01

    The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53{delta}, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53{delta} cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of

  2. Amplification of the uvrA gene product of Escherichia coli to 7% of cellular protein by linkage to the p/sub L/ promoter of pKC30

    International Nuclear Information System (INIS)

    Yoakum, G.H.; Yeung, A.T.; Mattes, W.B.; Grossman, L.

    1982-01-01

    Researchers have constructed a hybrid pKC30-uvrA plasmid (pGHY5003) in which transcription of the uvrA gene can be induced under p/sub L/ control to amplify the uvrA gene product to 7% of cellular protein. To construct pGHY5003, researchers developed a genetic selection using the basal level of expression (30 0 C) from p/sub L/ in thermosensitive cI857 lysogens to isolate appropriately tailored repair genes inserted at the Hpa I site of pKC30 from recombinant DNA mixtures with a variety of products. In addition, a post-uv-irradiation radiolabeling method was adapted to screen inserts for temperature-inducible polypeptide synthesis directed by transcription under p/sub L/ control rapidly. This should prove generally useful for isolating genes inserted at the Hpa I site of plasmid pKC30 with the following characteristics: (1) genetically functional hybrid plasmids selected from a large population of exonucleolytically tailored fragments ligated into Hpa I of pKC30 and (2) production of high-level amplification for the gene product of interest by screening for post-uv-irradiation temperature inducibility of polypeptides synthesized from hybrid plasmids. The level of amplification obtained for the uvrA gene product from pGHY5003 is approximately 10,000-fold higher than estimates of the level of uvrA protein in logarithmic phase Escherichia coli

  3. High LET radiation enhances apoptosis in mutated p53 cancer cells through Caspase-9 activation

    International Nuclear Information System (INIS)

    Yamakawa, Nobuhiro; Takahashi, Akihisa; Mori, Eiichiro; Imai, Yuichiro; Ohnishi, Ken; Kirita, Tadaaki; Ohnishi, Takeo; Furusawa, Yoshiya

    2008-01-01

    Although mutations in the p53 gene can lead to resistance to radiotherapy, chemotherapy and thermotherapy, high linear energy transfer (LET) radiation induces apoptosis regardless of p53 gene status in cancer cells. The aim of this study was to clarify the mechanisms involved in high LET radiation-induced apoptosis. Human gingival cancer cells (Ca9-22 cells) containing a mutated p53 (mp53) gene were irradiated with X-rays, C-ion (13-100 KeV/μm), or Fe-ion beams (200 KeV/μm). Cellular sensitivities were determined using colony forming assays. Apoptosis was detected and quantified with Hoechst 33342 staining. The activity of Caspase-3 was analyzed with Western blotting and flow cytometry. Cells irradiated with high LET radiation showed a high sensitivity with a high frequency of apoptosis induction. The relative biological effectiveness (RBE) values for the surviving fraction and apoptosis induction increased in a LET-dependent manner. Both RBE curves reached a peak at 100 KeV/μm, and then decreased at values over 100 KeV/μm. When cells were irradiated with high LET radiation, Caspase-3 was cleaved and activated, leading to poly (ADP-ribose) polymerase (PARP) cleavage. In addition, Caspase-9 inhibitor suppressed Caspase-3 activation and apoptosis induction resulting from high LET radiation to a greater extent than Caspase-8 inhibitor. These results suggest that high LET radiation enhances apoptosis by activation of Caspase-3 through Caspase-9, even in the presence of mp53. (author)

  4. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    Science.gov (United States)

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  5. Alterations of tumor suppressor genes (Rb, p16, p27 and p53) and an increased FDG uptake in lung cancer

    International Nuclear Information System (INIS)

    Sasaki, Masayuki; Sugio, Kenji; Kuwabara, Yasuo

    2003-01-01

    The FDG uptake in lung cancer is considered to reflect the degree of malignancy, while alterations of some tumor suppressor genes are considered to be related to the malignant biological behavior of tumors. The aim of this study is to examine the relationship between FDG-PET and alterations in the tumor suppression genes of lung cancer. We examined 28 patients with primary lung cancer who underwent FDG-PET before surgery consisting of 17 patients with adenocarcinoma, 10 with squamous cell carcinoma and 1 with large cell carcinoma. The FDG-PET findings were evaluated based on the standardized uptake value (SUV). Alterations in the tumor suppressor genes, Rb, p16, p27 and p53, were evaluated immunohistochemically. The FDG uptake in lung cancer with alteration in each tumor suppressor gene tended to be higher than in those genes without alterations, although the differences were not significant. In 15 tumors with alterations in either tumor suppressor genes, the FDG uptake was 6.83±3.21. On the other hand, the mean FDG uptake was 1.95 in 2 tumors without alterations in any genes. The difference in the FDG uptake between the 2 groups was statistically significant (p<0.001). In conclusion, the presence of abnormalities in the tumor suppressor genes, which results in an accelerated cell proliferation, is thus considered to increase the FDG uptake in lung cancer. (author)

  6. Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

    Directory of Open Access Journals (Sweden)

    Monica M Horvath

    2007-07-01

    Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

  7. P53 suppresses expression of the 14-3-3gamma oncogene

    Directory of Open Access Journals (Sweden)

    Qi Wenqing

    2011-08-01

    Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.

  8. A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation

    Directory of Open Access Journals (Sweden)

    Kumar Sonia

    2011-02-01

    Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.

  9. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    Directory of Open Access Journals (Sweden)

    Liang Y

    2018-03-01

    Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood

  10. Cholesterol Perturbation in Mice Results in p53 Degradation and Axonal Pathology through p38 MAPK and Mdm2 Activation.

    Directory of Open Access Journals (Sweden)

    Qingyu Qin

    Full Text Available Perturbation of lipid metabolism, especially of cholesterol homeostasis, can be catastrophic to mammalian brain, as it has the highest level of cholesterol in the body. This notion is best illustrated by the severe progressive neurodegeneration in Niemann-Pick Type C (NPC disease, one of the lysosomal storage diseases, caused by mutations in the NPC1 or NPC2 gene. In this study, we found that growth cone collapse induced by genetic or pharmacological disruption of cholesterol egress from late endosomes/lysosomes was directly related to a decrease in axonal and growth cone levels of the phosphorylated form of the tumor suppressor factor p53. Cholesterol perturbation-induced growth cone collapse and decrease in phosphorylated p53 were reduced by inhibition of p38 mitogen-activated protein kinase (MAPK and murine double minute (Mdm2 E3 ligase. Growth cone collapse induced by genetic (npc1-/- or pharmacological modification of cholesterol metabolism was Rho kinase (ROCK-dependent and associated with increased RhoA protein synthesis; both processes were significantly reduced by P38 MAPK or Mdm2 inhibition. Finally, in vivo ROCK inhibition significantly increased phosphorylated p53 levels and neurofilaments in axons, and axonal bundle size in npc1-/- mice. These results indicate that NPC-related and cholesterol perturbation-induced axonal pathology is associated with an abnormal signaling pathway consisting in p38 MAPK activation leading to Mdm2-mediated p53 degradation, followed by ROCK activation. These results also suggest new targets for pharmacological treatment of NPC disease and other diseases associated with disruption of cholesterol metabolism.

  11. Involvement of p53 Mutation and Mismatch Repair Proteins Dysregulation in NNK-Induced Malignant Transformation of Human Bronchial Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Ying Shen

    2014-01-01

    Full Text Available Genome integrity is essential for normal cellular functions and cell survival. Its instability can cause genetic aberrations and is considered as a hallmark of most cancers. To investigate the carcinogenesis process induced by tobacco-specific carcinogen NNK, we studied the dynamic changes of two important protectors of genome integrity, p53 and MMR system, in malignant transformation of human bronchial epithelial cells after NNK exposure. Our results showed that the expression of MLH1, one of the important MMR proteins, was decreased early and maintained the downregulation during the transformation in a histone modification involved and DNA methylation-independent manner. Another MMR protein PMS2 also displayed a declined expression while being in a later stage of transformation. Moreover, we conducted p53 mutation analysis and revealed a mutation at codon 273 which led to the replacement of arginine by histidine. With the mutation, DNA damage-induced activation of p53 was significantly impaired. We further reintroduced the wild-type p53 into the transformed cells, and the malignant proliferation can be abrogated by inducing cell cycle arrest and apoptosis. These findings indicate that p53 and MMR system play an important role in the initiation and progression of NNK-induced transformation, and p53 could be a potential therapeutic target for tobacco-related cancers.

  12. Immunohistochemical study of p53 and proliferating cell nuclear antigen expression in odontogenic keratocyst and periapical cyst.

    Science.gov (United States)

    Sajeevan, Thara Purath; Saraswathi, Tillai Rajasekaran; Ranganathan, Kannan; Joshua, Elizabeth; Rao, Uma Devi K

    2014-07-01

    p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA) is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC) and periapical cyst (PA). A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%), whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1) OKC showed p53 expression in 6 cases (60%) whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2) The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.

  13. Reactivity of p53 protein in canine transmissible venereal tumor Reatividade da proteína P53 no tumor venéreo transmissível canino

    Directory of Open Access Journals (Sweden)

    J.V. Moro

    2010-04-01

    Full Text Available The expression of p53 protein was evaluated in canine transmissible venereal tumor (CTVT, as following: natural occurrence (n=8; resistant to chemotherapy (n=4; and allogeneic transplanted in progression (n=8, stable (n=8, and regression (n=8stages. The collected specimens were submitted to GM1 immunohistochemical reaction. Results showed a mean percentage of immunomarked cells around 18.6% in CTVT of natural occurrence, 23.8% in CTVT resistant to chemotherapy, 22.9% in allogeneic transplanted CTVT in both progression and stable stages, and 35.8% in transplanted CTVT in regression stage. The results suggest that there is a functional abnormality in p53 gene and its products in the studied tumors; although, it is not possible to correlate the percentage of cells marked by p53 and a prognosis.A expressão da proteína p53 foi avaliada em espécimes de tumor venéreo transmissível canino (TVT de ocorrência natural (n=8; resistente à quimioterapia (n=4 e transplantado em cão nas fases de progressão tumoral (n=8, de latência (n=8 e de regressão (n=8. Os espécimes foram submetidos à reação de imunoistoquímica. Os resultados mostraram porcentagem média de células imunomarcadas de 18,6% no TVT de ocorrência natural, de 23,8% no TVT refratário, 22,9% nos TVTs transplantados nas fases de progressão e latência e de 35,8% na fase de regressão. Os resultados sugerem que há uma anormalidade funcional no gene P53 e seus produtos nos tumores estudados, apesar de não ser possível correlacionar a porcentagem de células marcadas pelo p53 ao prognóstico.

  14. Transient p53 suppression increases reprogramming of human fibroblasts without affecting apoptosis and DNA damage

    DEFF Research Database (Denmark)

    Rasmussen, Mikkel Aabech; Holst, Bjørn; Tümer, Zeynep

    2014-01-01

    The discovery of human-induced pluripotent stem cells (iPSCs) has sparked great interest in the potential treatment of patients with their own in vitro differentiated cells. Recently, knockout of the Tumor Protein 53 (p53) gene was reported to facilitate reprogramming but unfortunately also led...... to genomic instability. Here, we report that transient suppression of p53 during nonintegrative reprogramming of human fibroblasts leads to a significant increase in expression of pluripotency markers and overall number of iPSC colonies, due to downstream suppression of p21, without affecting apoptosis...... and DNA damage. Stable iPSC lines generated with or without p53 suppression showed comparable expression of pluripotency markers and methylation patterns, displayed normal karyotypes, contained between 0 and 5 genomic copy number variations and produced functional neurons in vitro. In conclusion...

  15. The dependence receptor Ret induces apoptosis in somatotrophs through a Pit-1/p53 pathway, preventing tumor growth.

    Science.gov (United States)

    Cañibano, Carmen; Rodriguez, Noela L; Saez, Carmen; Tovar, Sulay; Garcia-Lavandeira, Montse; Borrello, Maria Grazia; Vidal, Anxo; Costantini, Frank; Japon, Miguel; Dieguez, Carlos; Alvarez, Clara V

    2007-04-18

    Somatotrophs are the only pituitary cells that express Ret, GFRalpha1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCdelta, JNK, c/EBPalpha and CREB induced by a complex of Ret, caspase 3 and PKCdelta. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas.

  16. Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.

    Science.gov (United States)

    Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D

    2017-08-01

    Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.

  17. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    Science.gov (United States)

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  18. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  19. p53 represses autophagy in a cell cycle-dependent fashion.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido

    2008-10-01

    Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.

  20. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  1. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

    2006-01-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  2. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  3. Nitrous oxide discretely up-regulates nNOS and p53 in neonatal rat brain.

    Science.gov (United States)

    Cattano, D; Valleggi, S; Abramo, A; Forfori, F; Maze, M; Giunta, F

    2010-06-01

    Animal studies suggest that neuronal cell death often results from anesthetic administration during synaptogenesis. Volatile anesthetics are strongly involved in triggering neuronal apoptosis, whereas other inhalational agents (xenon) demonstrate protective effects. Nitrous oxide (N2O) has modest pro-apoptotic effects on its own and potent, synergistic toxic effects when combined with volatile agents. Recent findings suggest that, during periods of rapid brain development, the enhanced neurodegeneration triggered by anesthetic drugs may be caused by a compensatory increase in intracellular free calcium, a potent activator of neuronal nitric oxide synthase (nNOS). Anesthesia-induced neuro-apoptosis is also activated via the intrinsic and the extrinsic apoptotic pathways because both pathways involve p53, a key regulatory gene. The molecular events related to neuronal cell apoptosis are not completely understood. To gain further insight into the events underlying neuro-apoptosis, we analyzed the transcriptional consequences of N2O exposure on nNOS, iNOS and p53 mRNA levels. The study used 2 groups of postnatal day seven Sprague/Dawley rats (N=6 each) that were exposed for 120 minutes to air (75% N2, 25% O2) or N2O (75% N2O, 25% O2; this N2O concentration is commonly used to induce anesthesia and has been demonstrated to trigger neurodegeneration in postnatal day seven rats). Total RNA was isolated from each brain and expression analyses on iNOS and nNOS transcripts were performed using relative Real-Time C-reactive protein PCR (using G3PDH as a housekeeping gene). A semi-quantitative RT-PCR analysis was performed on the p53 transcript (using Ciclophylin A as a housekeeping gene). Statistical analysis (REST 2005) revealed a significant, 11-fold up-regulation (P=0.026) of the nNOS transcript but no significant changes in iNOS transcription. The p53 mRNA was up-regulated almost 2-fold (P=0.0002; Student's t-Test; GraphPad Prism 4.00) in N2O-treated samples relative to

  4. RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Toshinori Ozaki

    2013-01-01

    Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.

  5. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    Science.gov (United States)

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  6. Phylogenetic analysis of human Tp53 gene using computational ...

    African Journals Online (AJOL)

    The TP53 gene encoding p53 protein is involved in regulating a series of pathways. New discoveries about the function and control of p53 are still in progress and it is hoped to develop better therapeutics and diagnostics by exploiting this system. Evolutionary studies are of prime importance in the field of biological ...

  7. B1-induced caspase-independent apoptosis in MCF-7 cells is mediated by down-regulation of Bcl-2 via p53 binding to P2 promoter TATA box

    International Nuclear Information System (INIS)

    Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong

    2011-01-01

    The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.

  8. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  9. Formation of diastereomeric benzo[a]pyrene diol epoxide-guanine adducts in p53 gene-derived DNA sequences.

    Science.gov (United States)

    Matter, Brock; Wang, Gang; Jones, Roger; Tretyakova, Natalia

    2004-06-01

    (-)-trans-N(2)-BPDE-dG, 2.1 and 8.5% for (-)-cis-N(2)-BPDE-dG, and 0.5 and 8.3% for (+)-cis-N(2)-BPDE-dG. The relative yields of the minor N(2)-BPDE-dG stereoisomers were elevated at the sites of inefficient adduction, while the major (+)-trans-BPDE lesion was even more dominant at the frequently adducted sites. The introduction of 5-methyl groups at adjacent cytosine bases increased the yields of N(2)-BPDE-dG diastereomers, probably a result of favorable hydrophobic interactions between BPDE and 5-methylcytosine. The targeted formation of N(2)-BPDE-dG at (Me)CG dinucleotides within the p53 gene is consistent with the high prevalence of G --> T transversions at these sites in smoking-induced lung cancer.

  10. Effect of the p53 gene status on the sensitivity of oral squamous cell carcinoma cells to boron neutron capture therapy

    International Nuclear Information System (INIS)

    Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.

    2006-01-01

    The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)

  11. Zingiber officinale, Piper retrofractum and Combination Induced Apoptosis and p53 Expression in Myeloma and WiDr Cell Lines

    Directory of Open Access Journals (Sweden)

    HENY EKOWATI

    2012-09-01

    Full Text Available In previous studies, Zingiber officinale, Piper retrofractum, and the combination showed cytotoxic activity, induced apoptosis, and p53 expression of HeLa, T47D, and MCF-7 cell lines. This study was conducted to investigate the cytotoxic and apoptotic activity of Zingiber officinale (ZO, Piper retrofractum (PR, and the combination as well as their effect to p53 expression on Myeloma and WiDr cells. The powder of ZO, PR, and ZO + PR combination (1:1 were macerated with 96% ethanol for 3 x 24 hours. MTT cytotoxic assay was performed on Myeloma and WiDr cell lines. Apoptotic cells were stained with ethidium bromide and acridine orange. Imunohistochemical expression of p53 was examined on Myeloma and WiDr cell lines. Doxorubicin was used as positive control in all assays. Results showed that ZO, PR, and ZO + PR combination had cytotoxic activity on Myeloma cells with IC50 of 28, 36, and 55 mg/ml respectively and WiDr cell lines with IC50 of 74, 158, and 64 mg/ml respectively, induced apoptotic activity, and increased p53 expression on Myeloma and WiDr cells. These results suggest that ZO, PR, and their combination induced Myeloma and WiDr cells in apoptosis through p53 expression.

  12. Immunohistochemical study of p53 and proliferating cell nuclear antigen expression in odontogenic keratocyst and periapical cyst

    Directory of Open Access Journals (Sweden)

    Thara Purath Sajeevan

    2014-01-01

    Full Text Available Introduction: p53 protein is a product of p53 gene, which is now classified as a tumor suppressor gene. The gene is a frequent target for mutation, being seen as a common step in the pathogenesis of many human cancers. Proliferating cell nuclear antigen (PCNA is an auxiliary protein of DNA polymerase delta and plays a critical role in initiation of cell proliferation. Aim: The aim of this study is to assess and compare the expression of p53 and PCNA in lining epithelium of odontogenic keratocyst (OKC and periapical cyst (PA. Materials and Methods: A total of 20 cases comprising 10 OKC and 10 PA were included in retrospective study. Three paraffin section of 4 μm were cut, one was used for routine hematoxylin and eosin stain, while the other two were used for immunohistochemistry. Statistical analysis was performed using Chi-square test. Results: The level of staining and intensity were assessed in all these cases. OKC showed PCNA expression in all cases (100%, whereas in perapical cyst only 60% of cases exhibited PCNA staining. (1 OKC showed p53 expression in 6 cases (60% whereas in PA only 10% of the cases exhibited p53 staining. Chi-square test showed PCNA staining intensity was more significant than p53 in OKC. (2 The staining intensity of PA using p53, PCNA revealed that PCNA stating intensity was more significant than p53. Conclusion: OKC shows significant proliferative activity than PA using PCNA and p53. PCNA staining was more intense when compared with p53 in both OKC and PA.

  13. Influence of X-ray on the P53 gene in human peripheral blood lymphocytes

    International Nuclear Information System (INIS)

    Jin Wenwei; Cai Ting

    2002-01-01

    Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation

  14. Increased p53 and decreased p21 accompany apoptosis induced by ultraviolet radiation in the nervous system of a crustacean

    International Nuclear Information System (INIS)

    Hollmann, Gabriela; Linden, Rafael; Giangrande, Angela; Allodi, Silvana

    2016-01-01

    Highlights: • The paper characterizes molecular pathways of cell responses to environmental doses of UV in brain tissue of a crab species. • The UV radiation changes levels of proteins which trigger apoptotic or cell cycle arrest pathways and also it changes neurotrophins which lead to apoptosis of neural cell in the central nervous system (CNS) of the crab Ucides cordatus. • The UVB wavelengths in the solar simulator damaged the DNA, either directly or indirectly, by increasing ROS, and induced the increase of p53 and AKT, which blocked p21 and increased the expression of activated caspase-3, triggering apoptosis. The signs of death increased the expression of neurotrophins (BDNF and GDNF), which continued to stimulate the apoptosis signaling mediated by caspase-3. • In the brain of the crab U. cordatus, p53/p21 relationship in response to UV radiation is different from that of most mammals. - Abstract: Ultraviolet (UV) radiation can produce biological damage, leading the cell to apoptosis by the p53 pathway. This study evaluated some molecular markers of the apoptosis pathway induced by UVA, UVB and UVA+ UVB (Solar Simulator, SIM) in environmental doses, during five consecutive days of exposure, in the brain of the crab Ucides cordatus. We evaluated the central nervous system (CNS) by immunoblotting the content of proteins p53, p21, phosphorylated AKT, BDNF, GDNF, activated caspase-3 (C3) and phosphohistone H3 (PH3); and by immunohistochemical tests of the cells labeled for PH3 and C3. After the fifth day of exposure, UVB radiation and SIM increased the protein content of p53, increasing the content of AKT and, somehow, blocking p21, increasing the content of activated caspase-3, which led the cells to apoptosis. The signs of death affected the increase in neurotrophins, such as BDNF and GDNF, stimulating the apoptotic cascade of events. Immunohistochemical assays and immunoblotting showed that apoptosis was present in the brains of all UV groups, while

  15. Increased p53 and decreased p21 accompany apoptosis induced by ultraviolet radiation in the nervous system of a crustacean

    Energy Technology Data Exchange (ETDEWEB)

    Hollmann, Gabriela, E-mail: gabrielahollmann@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil); Linden, Rafael, E-mail: rlinden@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil); Giangrande, Angela, E-mail: angela.giangrande@igbmc.fr [Institut de Génétique et de Biologie Moléculaire et Cellulaire-IGBMC, INSERM, Strasbourg (France); Allodi, Silvana, E-mail: sallodi@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil)

    2016-04-15

    Highlights: • The paper characterizes molecular pathways of cell responses to environmental doses of UV in brain tissue of a crab species. • The UV radiation changes levels of proteins which trigger apoptotic or cell cycle arrest pathways and also it changes neurotrophins which lead to apoptosis of neural cell in the central nervous system (CNS) of the crab Ucides cordatus. • The UVB wavelengths in the solar simulator damaged the DNA, either directly or indirectly, by increasing ROS, and induced the increase of p53 and AKT, which blocked p21 and increased the expression of activated caspase-3, triggering apoptosis. The signs of death increased the expression of neurotrophins (BDNF and GDNF), which continued to stimulate the apoptosis signaling mediated by caspase-3. • In the brain of the crab U. cordatus, p53/p21 relationship in response to UV radiation is different from that of most mammals. - Abstract: Ultraviolet (UV) radiation can produce biological damage, leading the cell to apoptosis by the p53 pathway. This study evaluated some molecular markers of the apoptosis pathway induced by UVA, UVB and UVA+ UVB (Solar Simulator, SIM) in environmental doses, during five consecutive days of exposure, in the brain of the crab Ucides cordatus. We evaluated the central nervous system (CNS) by immunoblotting the content of proteins p53, p21, phosphorylated AKT, BDNF, GDNF, activated caspase-3 (C3) and phosphohistone H3 (PH3); and by immunohistochemical tests of the cells labeled for PH3 and C3. After the fifth day of exposure, UVB radiation and SIM increased the protein content of p53, increasing the content of AKT and, somehow, blocking p21, increasing the content of activated caspase-3, which led the cells to apoptosis. The signs of death affected the increase in neurotrophins, such as BDNF and GDNF, stimulating the apoptotic cascade of events. Immunohistochemical assays and immunoblotting showed that apoptosis was present in the brains of all UV groups, while

  16. Taurine protects HK-2 cells from oxidized LDL-induced cytotoxicity via the ROS-mediated mitochondrial and p53-related apoptotic pathways

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Chun-Yu [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Shen, Chao-Yu [School of Medical Imaging and Radiological Sciences, Chung Shan Medical University, Taichung, Taiwan (China); Department of Medical Imaging, Chung Shan Medical University Hospital, Taichung, Taiwan (China); School of Medicine, Chung Shan Medical University, Taichung, Taiwan (China); Kang, Chao-Kai [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, (China); Sher, Yuh-Pyng [Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Center for Molecular Medicine, China Medical University Hospital, Taichung 404, Taiwan (China); Sheu, Wayne H.-H. [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Division of Endocrinology and Metabolism, Department of Internal Medicine, Taichung Veterans General Hospital, Taichung, Taiwan (China); School of Medicine, National Yang Ming University, Taipei, Taiwan (China); School of Medicine, National Defense Medical Center, Taipei, Taiwan (China); Chang, Chia-Che, E-mail: chia_che@dragon.nchu.edu.tw [Graduate Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (China); Lee, Tsung-Han, E-mail: thlee@email.nchu.edu.tw [Department of Life Sciences, National Chung Hsing University, Taichung, Taiwan, (China); Graduate Institute of Clinical Medical Science, China Medical University, Taichung, Taiwan (China); Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Taiwan (China); Department of Biological Science and Technology, China Medical University, Taichung, Taiwan (China)

    2014-09-15

    Oxidized LDL (oxLDL) induces a pro-oxidative environment and promotes apoptosis, causing the progression of renal diseases in humans. Taurine is a semi-essential amino acid in mammals and has been shown to be a potent endogenous antioxidant. The kidney plays a pivotal role in maintaining the balance of taurine. However, the mechanisms underlying the protective effects of taurine against oxLDL-induced injury in renal epithelial cells have not been clarified. In the present study, we investigated the anti-apoptotic effects of taurine on human proximal tubular epithelial (HK-2) cells exposed to oxLDL and explored the related mechanisms. We observed that oxLDL increased the contents of ROS and of malondialdehyde (MDA), which is a lipid peroxidation by-product that acts as an indicator of the cellular oxidation status. In addition, oxLDL induced cell death and apoptosis in HK-2 cells. Pretreatment with taurine at 100 μM significantly attenuated the oxLDL-induced cytotoxicity. We determined that oxLDL triggered the phosphorylation of ERK and, in turn, the activation of p53 and other apoptosis-related events, including calcium accumulation, destabilization of the mitochondrial permeability and disruption of the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins. The malfunctions induced by oxLDL were effectively blocked by taurine. Thus, our results suggested that taurine exhibits potential therapeutic activity by preventing oxLDL-induced nephrotoxicity. The inhibition of oxLDL-induced epithelial apoptosis by taurine was at least partially due to its anti-oxidant activity and its ability to modulate the ERK and p53 apoptotic pathways. - Highlights: • Oxidized LDL induced cytotoxicity and apoptosis in HK-2 cells. • Pretreatment with taurine attenuated oxLDL-induced nephrotoxicity. • Taurine protected against renal damages through inhibition of ROS generation. • Taurine prevented apoptosis through modulation of the p53 phosphorylation.

  17. Taurine protects HK-2 cells from oxidized LDL-induced cytotoxicity via the ROS-mediated mitochondrial and p53-related apoptotic pathways

    International Nuclear Information System (INIS)

    Chang, Chun-Yu; Shen, Chao-Yu; Kang, Chao-Kai; Sher, Yuh-Pyng; Sheu, Wayne H.-H.; Chang, Chia-Che; Lee, Tsung-Han

    2014-01-01

    Oxidized LDL (oxLDL) induces a pro-oxidative environment and promotes apoptosis, causing the progression of renal diseases in humans. Taurine is a semi-essential amino acid in mammals and has been shown to be a potent endogenous antioxidant. The kidney plays a pivotal role in maintaining the balance of taurine. However, the mechanisms underlying the protective effects of taurine against oxLDL-induced injury in renal epithelial cells have not been clarified. In the present study, we investigated the anti-apoptotic effects of taurine on human proximal tubular epithelial (HK-2) cells exposed to oxLDL and explored the related mechanisms. We observed that oxLDL increased the contents of ROS and of malondialdehyde (MDA), which is a lipid peroxidation by-product that acts as an indicator of the cellular oxidation status. In addition, oxLDL induced cell death and apoptosis in HK-2 cells. Pretreatment with taurine at 100 μM significantly attenuated the oxLDL-induced cytotoxicity. We determined that oxLDL triggered the phosphorylation of ERK and, in turn, the activation of p53 and other apoptosis-related events, including calcium accumulation, destabilization of the mitochondrial permeability and disruption of the balance between pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins. The malfunctions induced by oxLDL were effectively blocked by taurine. Thus, our results suggested that taurine exhibits potential therapeutic activity by preventing oxLDL-induced nephrotoxicity. The inhibition of oxLDL-induced epithelial apoptosis by taurine was at least partially due to its anti-oxidant activity and its ability to modulate the ERK and p53 apoptotic pathways. - Highlights: • Oxidized LDL induced cytotoxicity and apoptosis in HK-2 cells. • Pretreatment with taurine attenuated oxLDL-induced nephrotoxicity. • Taurine protected against renal damages through inhibition of ROS generation. • Taurine prevented apoptosis through modulation of the p53 phosphorylation

  18. Non-Canonical Cell Death Induced by p53

    Directory of Open Access Journals (Sweden)

    Atul Ranjan

    2016-12-01

    Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.

  19. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  20. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. The effects of combining ionizing radiation and adenovirus-mediated p53 gene transfer in human nasopharyngeal carcinoma cell lines

    International Nuclear Information System (INIS)

    Liu Feifei; Li Jianhua; Lax, Stuart; Klamut, Henry

    1997-01-01

    Purpose/Objective: We have previously demonstrated that the introduction of human recombinant wild-type p53 carried by the adenoviral vector (Ad5CMV-p53) into two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z) resulted in significant cytotoxicity. In the current work, we wanted to evaluate the results of this strategy when combined with ionizing radiation (XRT). Materials and Methods: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain KS1, were infected with iso-effective doses of 2, 6 and 6 pfu/cell of Ad5CMV-p53 respectively. XRT was administered 24 hours post-infection, to coincide with the time of maximal recombinant p53 expression. Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax and bcl-2. Cell viability was evaluated using both the MTT and clonogenic assays. Presence of apoptosis was determined by using DNA agarose gel electrophoresis. Results: We observed that the combination of Ad5CMV-p53 + XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The MTT assay indicated sparing of the KS1 cells when subjected to the identical treatments. XRT alone stimulated minimal p53 expression; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax and bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed earlier, at 2 Gy when combined with Ad5CMV-p53. Conclusion: Additional cytotoxicity was observed for the NPC cell lines when XRT was combined with Ad5CMV-p53 infection, with concurrent sparing of normal cells (KS1). This cytotoxicity also appeared to be mediated through the induction of the apoptotic pathway. These results support our previous observation of the potential application of this strategy in the

  2. Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.

    Science.gov (United States)

    Yeung, S J; Pan, J; Lee, M-H

    2008-12-01

    Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.

  3. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  4. Transcriptional regulation of the p73 gene, a member of the p53 family, by early growth response-1 (Egr-1)

    International Nuclear Information System (INIS)

    Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong

    2007-01-01

    To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression

  5. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  6. Pharmacological activation of tumor suppressor, wild-type p53 as a promising strategy to fight cancer

    Directory of Open Access Journals (Sweden)

    Alicja Sznarkowska

    2010-08-01

    Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.

  7. Involvement of phorbol-12-myristate-13-acetate-induced protein 1 in goniothalamin-induced TP53-dependent and -independent apoptosis in hepatocellular carcinoma-derived cells

    International Nuclear Information System (INIS)

    Kuo, Kung-Kai; Chen, Yi-Ling; Chen, Lih-Ren; Li, Chien-Feng; Lan, Yu-Hsuan; Chang, Fang-Rong; Wu, Yang-Chang; Shiue, Yow-Ling

    2011-01-01

    The objective was to investigate the upstream apoptotic mechanisms that were triggered by a styrylpyrone derivative, goniothalamin (GTN), in tumor protein p53 (TP53)-positive and -negative hepatocellular carcinoma (HCC)-derived cells. Effects of GTN were evaluated by the flow cytometry, alkaline comet assay, immunocytochemistry, small-hairpin RNA interference, mitochondria/cytosol fractionation, quantitative reverse transcription-polymerase chain reaction, immunoblotting analysis and caspase 3 activity assays in two HCC-derived cell lines. Results indicated that GTN triggered phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, also known as NOXA)-mediated apoptosis via TP53-dependent and -independent pathways. In TP53-positive SK-Hep1 cells, GTN furthermore induced TP53 transcription-dependent and -independent apoptosis. After GTN treatment, accumulation of reactive oxygen species, formation of DNA double-strand breaks, transactivation of TP53 and/or PMAIP1 gene, translocation of TP53 and/or PMAIP1 proteins to mitochondria, release of cytochrome c from mitochondria, cleavage of caspases and induction of apoptosis in both cell lines were sustained. GTN might represent a novel class of anticancer drug that induces apoptosis in HCC-derived cells through PMAIP1 transactivation regardless of the status of TP53 gene. - Highlights: → Goniothalamin (GTN) induced apoptosis in hepatocellular carcinomas-derived cells. → The apoptosis induced by GTN is PMAIP1-dependent, regardless of TP53 status. → The apoptosis induced by GTN might be TP53 transcription-dependent or -independent. → GTN-induced apoptosis is mitochondria- and caspases-mediated.

  8. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Rhee, Jae-Sung [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, Bo-Mi; Kim, Ryeo-Ok [Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Seo, Jung Soo [Pathology Team, National Fisheries Research and Development Institute, Busan 619-902 (Korea, Republic of); Kim, Il-Chan [Division of Life Sciences, Korea Polar Research Institute, Korea Institute of Ocean Science and Technology, Incheon 406-840 (Korea, Republic of); Lee, Young-Mi, E-mail: ymlee70@smu.ac.kr [Department of Green Life Science, College of Convergence, Sangmyung University, Seoul 110-743 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@hanyang.ac.kr [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of)

    2013-09-15

    Highlights: •Novel identification of DNA repair-related genes in fish. •Investigation of whole expression profiling of DNA repair genes upon gamma radiation. •Analysis of effects of gamma radiation on antioxidant system and cell stress proteins. •Usefulness of verification of pathway-based profiling for mechanistic understanding. -- Abstract: To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4 Gy of radiation, and biochemical and molecular damage became substantial from 8 Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6 Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae.

  9. A systematic review of p53 regulation of oxidative stress in skeletal muscle.

    Science.gov (United States)

    Beyfuss, Kaitlyn; Hood, David A

    2018-12-01

    transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p

  10. The Flavonoid Apigenin Ameliorates Cisplatin-Induced Nephrotoxicity through Reduction of p53 Activation and Promotion of PI3K/Akt Pathway in Human Renal Proximal Tubular Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Sung Min Ju

    2015-01-01

    Full Text Available Apigenin is a member of the flavone subclass of flavonoids present in fruits and vegetables. Apigenin has long been considered to have various biological activities, such as antioxidant, anti-inflammatory, and antitumorigenic properties, in various cell types. Cisplatin was known to exhibit cytotoxic effect to renal cells by inducing apoptosis through activation of p53. The present study investigated the antiapoptotic effects of apigenin on the cisplatin-treated human renal proximal tubular epithelial (HK-2 cells. HK-2 cells were pretreated with apigenin (5, 10, 20 μM for 1 h and then treated with 40 μM cisplatin for various times. Apigenin inhibited the cisplatin-induced apoptosis of HK-2 cells. Interestingly, apigenin itself exerted cytostatic activity because of its ability to induce cell cycle arrest. Apigenin inhibited caspase-3 activity and PARP cleavage in cisplatin-treated cells. Apigenin reduced cisplatin-induced phosphorylation and expression of p53, with no significant influence on production of ROS that is known to induce p53 activation. Furthermore, apigenin promoted cisplatin-induced Akt phosphorylation, suggesting that enhanced Akt activation may be involved in cytoprotection. Taken together, these results suggest that apigenin ameliorates cisplatin-induced apoptosis through reduction of p53 activation and promotion of PI3K/Akt pathway in HK-2 cells.

  11. Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

    Science.gov (United States)

    Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

    2017-08-01

    Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    Science.gov (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  13. MDM2 inhibitor nutlin-3a induces apoptosis and senescence in cutaneous T-cell lymphoma: Role of p53

    DEFF Research Database (Denmark)

    Manfé, Valentina; Biskup, Edyta Urszula; Johansen, Peter

    2012-01-01

    cell lines, P53 mutation analysis identified a homozygous nonsense mutation (R196Stop in Hut-78) and a homozygous missense mutation (G245S in SeAx). In MyLa2000, Mac1, and Mac2a carrying wild-type P53, nutlin-3a induced apoptosis and senescence demonstrated by permanent G0/G1 cell-cycle block...... with intact p53 but also in Hut-78, SeAx, and Sézary cells. Thus, targeting p53 by nutlin-3a may constitute a therapeutic approach in CTCL because of increased apoptosis and senescence of tumor cells....

  14. Targeting GRP75 improves HSP90 inhibitor efficacy by enhancing p53-mediated apoptosis in hepatocellular carcinoma.

    Directory of Open Access Journals (Sweden)

    Weiwei Guo

    Full Text Available Heat shock protein 90 (HSP90 inhibitors are potential drugs for cancer therapy. The inhibition of HSP90 on cancer cell growth largely through degrading client proteins, like Akt and p53, therefore, triggering cancer cell apoptosis. Here, we show that the HSP90 inhibitor 17-AAG can induce the expression of GRP75, a member of heat shock protein 70 (HSP70 family, which, in turn, attenuates the anti-growth effect of HSP90 inhibition on cancer cells. Additionally, 17-AAG enhanced binding of GRP75 and p53, resulting in the retention of p53 in the cytoplasm. Blocking GRP75 with its inhibitor MKT-077 potentiated the anti-tumor effects of 17-AAG by disrupting the formation of GRP75-p53 complexes, thereby facilitating translocation of p53 into the nuclei and leading to the induction of apoptosis-related genes. Finally, dual inhibition of HSP90 and GRP75 was found to significantly inhibit tumor growth in a liver cancer xenograft model. In conclusion, the GRP75 inhibitor MKT-077 enhances 17-AAG-induced apoptosis in HCCs and increases p53-mediated inhibition of tumor growth in vivo. Dual targeting of GRP75 and HSP90 may be a useful strategy for the treatment of HCCs.

  15. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

    2002-01-01

    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  16. Differential induction of p53-mediated apoptosis in medulloblastomas and gliomas correlates with their ability to induce bax

    International Nuclear Information System (INIS)

    Shu, H.-K.G.; Furman, Felix; Dee, Suzanne; Israel, Mark A.

    1997-01-01

    Purpose/Objective: Medulloblastoma cell lines readily undergo a p53-mediated apoptosis following exposure to ionizing radiation, while glioma cell lines do not undergo significant levels of apoptosis following irradiation. This study attempts to define some of the molecular events that characterize the differential ability medulloblastomas and gliomas to undergo radiation-induced apoptosis. Materials and Methods: The medulloblastoma cell lines D283 and D341 and the glioma cell lines U87, U343 and U563 were used in this study. All five cell lines were confirmed to have a wild type p53 by their ability to induce p21 protein levels and to undergo a cell-cycle arrest in G1 following treatment with ionizing radiation. Also, 3 clonal derivatives of D283 were used. Two of the clones were derived following transfection with an expression plasmid containing a dominant negative mutant p53 (Arg175 --> His) expressed from the CMV promoter (D283/53.6 and D283/53.7), while the remaining clone was derived following transfection with that same expression plasmid without mutant p53 (D283/vec). All irradiation experiments were performed on Phillips RT-250 X-ray unit using 250 Kvp X-rays. In each case, 5 Gy of ionizing radiation was given at a dose rate of 250 cGy/minute. Apoptosis was quantitated by staining fixed cells with propidium iodide and determining the percentage of cells with subdiploid DNA content by flow cytometry. Northern blot analysis was performed using standard methods. Results: The D283 and D341 cell lines exhibited a significant induction of apoptosis when assayed 2 days following treatment with radiation while the U87, U343 and U563 cell lines displayed only minimal induction of apoptosis when assayed following treatment at that time. RNA was prepared from the different cell lines that were unirradiated, 6 hours or 24 hours post-irradiation. Northern blots were made of the total RNAs and probed for bax, bcl-2 and bcl-x mRNA. This analysis detected no significant

  17. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    International Nuclear Information System (INIS)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook

    2009-01-01

    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference

  18. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-05-15

    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.

  19. Pomegranate protects against arsenic-induced p53-dependent ROS-mediated inflammation and apoptosis in liver cells.

    Science.gov (United States)

    Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya

    2016-12-01

    Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright

  20. Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

    Science.gov (United States)

    El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

    2016-08-01

    Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik

    2006-01-01

    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  2. Peran p53 Sebagai Jalur Kritis pada Mekanisme Kontrol Siklus Sel Sebagai Pencegah Terjadinya Kanker Mulut

    Directory of Open Access Journals (Sweden)

    Herlia Nur Istindiah

    2015-09-01

    Full Text Available In cell cycle control, p53 acts as an emergency brake, where its important checkpoint function is to maintain the genome integrity by preventing the formation and proliferation of mutant cells. P53 activity is increased by DNA damage occurs caused by agents (such as radioation, UV light or drugs or oncogenes. Mdm2 protein can inhibit the p53 activation, but oncogenes can inhibit Mdm2 or activate p53. If DNA damage occurs, then p53 prevents the cells from replicating their DNA by arresting the cell cycle, so that the cells can repair the damage. Alternatively, p53 instructs the cells to undergo apoptosis by inducing bax gene expression, so that irregular cell growth, and cancer can be avoided. Cancer, including oral cancer, oftenthuolved cells with altered p53. Exogenous factors, such as tobacco and alcohol, presumably plays a role in triggering p53 mutations. Several techniques, such as immunohistochemistry and PCR can be used to investigation their etiology and development of oral cancer. The results hopefully be applied clinically in early detection, prevention and prediction of cancer. This paper discusses the role on p53 in preventing the occurrence and proliferation of mutated cells that lead to cancer, including oral cancer.

  3. Inhibition of autophagy exerts anti-colon cancer effects via apoptosis induced by p53 activation and ER stress

    International Nuclear Information System (INIS)

    Sakitani, Kosuke; Hirata, Yoshihiro; Hikiba, Yohko; Hayakawa, Yoku; Ihara, Sozaburo; Suzuki, Hirobumi; Suzuki, Nobumi; Serizawa, Takako; Kinoshita, Hiroto; Sakamoto, Kei; Nakagawa, Hayato; Tateishi, Keisuke; Maeda, Shin; Ikenoue, Tsuneo; Kawazu, Shoji; Koike, Kazuhiko

    2015-01-01

    Although some molecularly targeted drugs for colorectal cancer are used clinically and contribute to a better prognosis, the current median survival of advanced colorectal cancer patients is not sufficient. Autophagy, a basic cell survival mechanism mediated by recycling of cellular amino acids, plays an important role in cancer. Recently, autophagy has been highlighted as a promising new molecular target. The unfolded protein response (UPR) reportedly act in complementary fashion with autophagy in intestinal homeostasis. However, the roles of UPR in colon cancer under autophagic inhibition remain to be elucidated. We aim to clarify the inhibitory effect of autophagy on colon cancer. We crossed K19 CreERT and Atg5 flox/flox mice to generate Atg5 flox/flox /K19 CreERT mice. Atg5 flox/flox /K19 CreERT mice were first treated with azoxymethane/dextran sodium sulfate and then injected with tamoxifen to inhibit autophagy in CK19-positive epithelial cells. To examine the anti-cancer mechanisms of autophagic inhibition, we used colon cancer cell lines harboring different p53 gene statuses, as well as small interfering RNAs (siRNAs) targeting Atg5 and immunoglobulin heavy-chain binding protein (BiP), a chaperone to aid folding of unfolded proteins. Colon tumors in Atg5 flox/flox /K19 CreERT mice showed loss of autophagic activity and decreased tumor size (the total tumor diameter was 28.1 mm in the control and 20.7 mm in Atg5 flox/flox /K19 CreERT mice, p = 0.036). We found that p53 and UPR/endoplasmic reticulum (ER) stress-related proteins, such as cleaved caspase 3, and CAAT/enhancer-binding protein homologous protein, are up-regulated in colon tumors of Atg5 flox/flox /K19 CreERT mice. Although Atg5 and BiP silencing, respectively, increased apoptosis in p53 wild type cells, Atg5 silencing alone did not show the same effect on apoptosis in p53 mutant cells. However, co-transfection of Atg5 and BiP siRNAs led to increased apoptosis in p53 mutant cells. Blocking autophagy

  4. Role for p53 in the Recovery of Transcription and Protection Against Apoptosis Induced by Ultraviolet Light

    Directory of Open Access Journals (Sweden)

    Bruce C. McKay

    1999-08-01

    Full Text Available We have previously suggested that the inhibition of RNA polymerase II-mediated transcription after exposure to UV light promotes the accumulation of p53 and the induction of apoptosis (Oncogene 13, 823–831. However, it was not clear whether p53 induction was contributing to apoptosis. Here we report that apoptosis is triggered at lower UV doses in p53-deficient Li-Fraumeni syndrome (LFS and human papillomavirus (HPV E6 expressing fibroblasts than in normal cells, suggesting that p53 can be protective against UVinduced apoptosis. There is no significant difference in the effect of UV-irradiation on the cell cycle distribution of normal and primary LFS fibroblasts. Importantly, the recovery of nascent mRNA synthesis in all p53-deficient fibroblasts is significantly impaired compared with control cells after exposure to relevant doses of UV light. Taken together, our results suggest that wild-type p53 can protect cells against UV-induced apoptosis by facilitating the recovery of transcription. Furthermore, we suggest that the capacity of cells to recover transcription after genotoxic damage is an important determinant of sensitivity to apoptosis.

  5. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    International Nuclear Information System (INIS)

    Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang

    2006-01-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties

  6. Correlation between p53 expression and clinical-pathological characteristics of gastric cancer

    Directory of Open Access Journals (Sweden)

    Radovanović Dragče

    2011-01-01

    Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.

  7. The nucleolus directly regulates p53 export and degradation.

    Science.gov (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  8. Ets-2 and p53 mediate cAMP-induced MMP-2 expression, activity and trophoblast invasion

    Directory of Open Access Journals (Sweden)

    Goldman Shlomit

    2009-11-01

    Full Text Available Abstract Background We have previously shown that Matrix metalloproteinase (MMP -2 is a key-enzyme in early trophoblast invasion and that Protein Kinase A (PKA increases MMP-2 expression and trophoblast invasion. The aim of this study was to examine MMP -2 regulation by PKA in invasive trophoblasts: JAR choriocarcinoma cell-line and 6-8 w first trimester trophoblasts. Methods The effect of Forskolin (PKA on MMP-2 expression was assessed by Northern Blot and RT-PCR. Possible transcription factors binding to consensus MMP-2 promoter sequences in response to Forskolin, were detected by EMSA binding assay and their expression assessed by western blot analysis. Antisense transfection of relevant transcription factors was performed and the inhibitory effect assessed on MMP-2 expression (RT-PCR, secretion (zymography and trophoblast invasiveness (transwell migration assay. Results We found that Forskolin increased MMP-2 mRNA in JAR cells within 24 hours, and induced binding to p53, Ets, C/EBP and AP-2. Transcription factors Ets-2, phospho- p53, C/EBP epsilon, C/EBP lambda and AP-2 alpha bound to their respective binding sequences in response to Forskolin and the expressions of these transcription factors were all elevated in Forskolin- treated cells. Inhibition of Ets-2 and p53 reduced MMP-2 expression, secretion and invasiveness of Forskolin treated cells. Conclusion MMP-2 is regulated by PKA through several binding sites and transcription factors including Ets-2, p53, C/EBP, C/EBP lambda and AP-2 alpha. Ets-2 and p53 mediate cAMP- induced trophoblast invasiveness, through regulation of MMP-2.

  9. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  10. Alterations of the TP53 Gene in Gastric and Esophageal Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Marilanda Ferreira Bellini

    2012-01-01

    Full Text Available TP53 genes is one of more important tumor suppressor gene, which acts as a potent transcription factor with fundamental role in the maintenance of genetic stability. The development of esophageal and gastric cancers is a multistep process resulting in successive accumulation of genetic alterations that culminates in the malignant transformation. Thus, this study highlights the participation of the main genetic alterations of the TP53 gene in esophageal and gastric carcinogenesis. Among these changes, high frequency of TP53 mutations, loss of heterozygosity (LOH, overexpression of the p53 protein, and consequently loss of p53 function, which would be early events in esophageal and gastric cancers, as well as an important biomarker of the prognosis and treatment response. Furthermore, Single Nucleotide Polymorphisms (SNPs of TP53 have been implicated in the development and prognosis of several cancers, mainly TP53 codon 72 polymorphism whose role has been extensively studied in relation to susceptibility for esophageal and gastric cancer development.

  11. Borax-induced apoptosis in HepG2 cells involves p53, Bcl-2, and Bax.

    Science.gov (United States)

    Wei, Y; Yuan, F J; Zhou, W B; Wu, L; Chen, L; Wang, J J; Zhang, Y S

    2016-06-21

    Borax, a boron compound and a salt of boric acid, is known to inhibit the growth of tumor cells. HepG2 cells have been shown to be clearly susceptible to the anti-proliferative effects of borax. However, the specific mechanisms regulating this effect are poorly understood. This study aimed to investigate the pathways underlying the growth inhibition induced by borax in HepG2 cells. The effects of borax on HepG2 cell viability were characterized using MTT. Apoptosis was also verified by annexin V/propidium iodide staining. JC-1 dye and western blotting techniques were used to measure mitochondrial membrane potential and p53, Bax, and Bcl-2 protein expression, respectively. Relevant mRNA levels were measured by qRT-PCR. Borax inhibited the proliferation of HepG2 cells in a time- and dose-dependent manner in vitro. The apoptotic process triggered by borax involved the upregulation of p53 and Bax and the downregulation of Bcl-2, which was confirmed by a change in the mitochondrial membrane potential. These results elucidate a borax-induced apoptotic pathway in HepG2 cells that involves the upregulation of p53 and Bax and the downregulation of Bcl-2.

  12. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  13. Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa.

    Science.gov (United States)

    Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O

    2011-08-01

    The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.

  14. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  15. p63 expression confers significantly better survival outcomes in high-risk diffuse large B-cell lymphoma and demonstrates p53-like and p53-independent tumor suppressor function

    DEFF Research Database (Denmark)

    Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin

    2016-01-01

    with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...

  16. Flavopiridol induces apoptosis in glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway.

    Science.gov (United States)

    Alonso, Michelle; Tamasdan, Cristina; Miller, Douglas C; Newcomb, Elizabeth W

    2003-02-01

    Flavopiridol is a synthetic flavone, which inhibits growth in vitro and in vivo of several solid malignancies such as renal, prostate, and colon cancers. It is a potent cyclin-dependent kinase inhibitor presently in clinical trials. In this study, we examined the effect of flavopiridol on a panel of glioma cell lines having different genetic profiles: five of six have codeletion of p16(INK4a) and p14(ARF); three of six have p53 mutations; and one of six shows overexpression of mouse double minute-2 (MDM2) protein. Independent of retinoblastoma and p53 tumor suppressor pathway alterations, flavopiridol induced apoptosis in all cell lines but through a caspase-independent mechanism. No cleavage products for caspase 3 or its substrate poly(ADP-ribose) polymerase or caspase 8 were detected. The pan-caspase inhibitor Z-VAD-fmk did not inhibit flavopiridol-induced apoptosis. Mitochondrial damage measured by cytochrome c release and transmission electron microscopy was not observed in drug-treated glioma cells. In contrast, flavopiridol treatment induced translocation of apoptosis-inducing factor from the mitochondria to the nucleus. The proteins cyclin D(1) and MDM2 involved in the regulation of retinoblastoma and p53 activity, respectively, were down-regulated early after flavopiridol treatment. Given that MDM2 protein can confer oncogenic properties under certain circumstances, loss of MDM2 expression in tumor cells could promote increased chemosensitivity. After drug treatment, a low Bcl-2/Bax ratio was observed, a condition that may favor apoptosis. Taken together, the data indicate that flavopiridol has activity against glioma cell lines in vitro and should be considered for clinical development in the treatment of glioblastoma multiforme.

  17. p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.

    Science.gov (United States)

    Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina

    2009-11-01

    Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.

  18. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  19. Flow cytometric characterization of phenotype, DNA indices and p53 gene expression in 55 cases of acute leukemia.

    Science.gov (United States)

    Powari, Manish; Varma, Neelam; Varma, Subhash; Marwaha, Ram Kumar; Sandhu, Harpreet; Ganguly, Nirmal Kumar

    2002-06-01

    To characterize the phenotype of acute leukemia cases using flow cytometry, to detect mixed lineage cases and to use DNA index determination, including S-phase fraction (SPF) and p53 detection, to find if there was any correlation of SPF and p53 expression with outcome. Fifty-five cases of acute leukemia were enrolled in this study. A complete hemogram and routine bone marrow examination, including cytochemistry, was done. Mycloperoxidase-negative cases were evaluated on a flow cytometer using monoclonal antibodies. DNA indices were determined by flow cytometry in all cases, and p53 was detected immunohistochemically using the alkaline phosphatase/antialkaline phosphatase technique. Acute myeloblastic leukemia (AML) was diagnosed in 32 cases; acute lymphoblastic leukemia (ALL) was diagnosed in 18 (14 B lineage and 4 T line age). Four cases showed mixed lineage leukemia, and undifferentiated acute leukemia was diagnosed in one case. The mean/range of SPF for these groups were 3.76/0.33-6.91, 6.25/0.15-21.4, 2.89/0.35-10.64, 2.60/0.72-6.94 and 7.34, respectively. Aneuploidy was detected in two cases of B-lineage ALL and tetraploidy in a case of AML-M7, while all others were diploid p53. Was detected in 6 of 55 cases (10.90%). Follow-up was available for 24 patients. Five patients relapsed, and four had B-cell type ALL and were diploid and expressed no p53 gene. SPF% did not show any correlation with outcome. These data suggest that within acute leukemia subtypes, there is a wide variation in SPF. SPF does not seem to correlate with outcome. Immunophenotyping is essential to determine the lineage in myeloperoxidase-negative cases. It is perhaps the only way to diagnose mixed lineage leukemia and aberrant expression of markers presently. The p53 gene was detected less frequently. However, more studies are required from different centers with longer follow-up to evaluate prognostic significance.

  20. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  1. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  2. Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines

    DEFF Research Database (Denmark)

    Liu, Ying; Bodmer, Walter F

    2006-01-01

    A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...

  3. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    Science.gov (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  4. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  5. Relationship between radiation induced activation of DNA repair genes and radiation induced apoptosis in human cell line A431

    International Nuclear Information System (INIS)

    Bom, Hee Seung; Min, Jung Jun; Kim, Kyung Keun; Choi, Keun Hee

    2000-01-01

    The purpose of this study was to evaluate the relationship between radiation-induced acivation of DNA repair genes and radiation induced apoptosis in A431 cell line. Five and 25 Gys of gamma radiation were given to A431 cells by a Cs-137 cell irradiator. Apoptosis was evaluated by flow cytometry using annexin V-fluorescein isothiocyanate and propidium iodide staining. The expression of DNA repair genes was evaluated by both Northern and Western blot analyses. The number of apoptotic cells increased with the increased radiation dose. It increased most significantly at 12 hours after irradiation. Expression of p53, p21, and ℎRAD50 reached the highest level at 12 hours after 5 Gy irradiation. In response to 25 Gy irradiation, ℎRAD50 and p21 were expressed maximally at 12 hours, but p53 and GADD45 genes showed the highest expression level after 12 hours. Induction of apoptosis and DNA repair by ionizing radiation were closely correlated. The peak time of inducing apoptosis and DNA repair was 12 hours in this study model. ℎRAD50, a recently discovered DNA repair gene, was also associated with radiation-induced apoptosis.=20

  6. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    Directory of Open Access Journals (Sweden)

    Bruno Pagano

    Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  7. Radiotherapy modulates expression of EGFR, ERCC1 and p53 in cervical cancer

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, V.H. de; Melo, A.C. de; Nogueira-Rodrigues, A.; Pimenta-Inada, H.K.; Alves, F.G.; Moralez, G.; Thiago, L.S.; Ferreira, C.G.; Sternberg, C., E-mail: diretoriaexecutiva@sboc.org.br [Instituto Nacional de Câncer (INCA), Rio de Janeiro, RJ (Brazil); Meira, D.D. [Universidade Federal do Espírito Santo (UFES), Vitória, ES (Brazil); Pires, A.C. [Fonte Medicina Diagnóstica, Niterói, RJ (Brazil)

    2018-02-01

    Cervical cancer is a public health problem and the molecular mechanisms underlying radioresistance are still poorly understood. Here, we evaluated the modulation of key molecules involved in cell proliferation, cell cycle and DNA repair in cervical cancer cell lines (CASKI and C33A) and in malignant tissues biopsied from 10 patients before and after radiotherapy. The expression patterns of epidermal growth factor receptor (EGFR), excision repair cross-complementation group 1 (ERCC1) and p53 were evaluated in cancer cell lines by quantitative PCR and western blotting, and in human malignant tissues by immunohistochemistry. The mutation status of TP53 gene was evaluated by direct sequencing. Among cell lines, absent or weak modulations of EGFR, ERCC1 and p53 were observed after exposure to 1.8 Gy. Conversely, increased expressions of p53 (5/10 patients; P=0.0239), ERCC1 (5/10 patients; P=0.0294) and EGFR (4/10 patients; P=0.1773) were observed in malignant tissues after radiotherapy with the same radiation dose. TP53 mutations were found only in one patient. Here we show that a single dose of radiotherapy induced EGFR, ERCC1 and p53 expression in malignant tissues from cervical cancer patients but not in cancer cell lines, highlighting the gap between in vitro and in vivo experimental models. Studies on larger patient cohorts are needed to allow an interpretation that an up regulation of p53, EGFR and ERCC1 may be part of a radioresistance mechanism. (author)

  8. Exploring a minimal two-component p53 model

    International Nuclear Information System (INIS)

    Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

    2010-01-01

    The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

  9. Isolation of the alkane inducible cytochrome P450 (P450alk) gene from the yeast Candida tropicalis

    Science.gov (United States)

    The gene for the alkane-inducible cytochrome P450, P450alk, has been isolated from the yeast Candida tropicalis by immunoscreening a λgt11 library. Isolation of the gene has been identified on the basis of its inducibility and partial DNA sequence. Transcripts of this gene were i...

  10. The ubiquitin peptidase UCHL1 induces G0/G1 cell cycle arrest and apoptosis through stabilizing p53 and is frequently silenced in breast cancer.

    Directory of Open Access Journals (Sweden)

    Tingxiu Xiang

    Full Text Available Breast cancer (BrCa is a complex disease driven by aberrant gene alterations and environmental factors. Recent studies reveal that abnormal epigenetic gene regulation also plays an important role in its pathogenesis. Ubiquitin carboxyl- terminal esterase L1 (UCHL1 is a tumor suppressor silenced by promoter methylation in multiple cancers, but its role and alterations in breast tumorigenesis remain unclear.We found that UCHL1 was frequently downregulated or silenced in breast cancer cell lines and tumor tissues, but readily expressed in normal breast tissues and mammary epithelial cells. Promoter methylation of UCHL1 was detected in 9 of 10 breast cancer cell lines (90% and 53 of 66 (80% primary tumors, but rarely in normal breast tissues, which was statistically correlated with advanced clinical stage and progesterone receptor status. Pharmacologic demethylation reactivated UCHL1 expression along with concomitant promoter demethylation. Ectopic expression of UCHL1 significantly suppressed the colony formation and proliferation of breast tumor cells, through inducing G0/G1 cell cycle arrest and apoptosis. Subcellular localization study showed that UCHL1 increased cytoplasmic abundance of p53. We further found that UCHL1 induced p53 accumulation and reduced MDM2 protein level, and subsequently upregulated the expression of p21, as well as cleavage of caspase3 and PARP, but not in catalytic mutant UCHL1 C90S-expressed cells.UCHL1 exerts its tumor suppressive functions by inducing G0/G1cell cycle arrest and apoptosis in breast tumorigenesis, requiring its deubiquitinase activity. Its frequent silencing by promoter CpG methylation may serve as a potential tumor marker for breast cancer.

  11. Detection of p53 Gene by Using Genomagnetic Assay Combined with Carbon Nanotube Modified Disposable Sensor Technology

    Czech Academy of Sciences Publication Activity Database

    Congur, G.; Plucnara, Medard; Erdem, A.; Fojta, Miroslav

    2015-01-01

    Roč. 27, č. 7 (2015), s. 1579-1586 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 Keywords : p53 Gene * Carbon nanotubes * Magnetic particles Subject RIV: BO - Biophysics Impact factor: 2.471, year: 2015

  12. Relationship between P53 and bystander effect induced by radiated hepatoma cells

    International Nuclear Information System (INIS)

    Zhao Meijia; Shen Bo; Yuan Dexiao; Cheng Honghong; Shao Chunlin

    2009-01-01

    The role of p53 in bystander responses on normal liver cells were investigated by co-culturing irradiated hepatoma cells with non-irradiated bystander Chang liver cells. It was found that radiosensitivity of the hepatoma cells was relative to p53. HepG2 cells with wtp53 had the highest radiosensitivity followed by PLC/PRF/5 cells with mtp53 and Hep3B cells with null-p53. The induction of bystander micronucleus(MN) was observed only in the Chang liver cells that had been co-cultured with HepG2 cells but not co-cultured with PLC/PRF/5 or Hep3B. Also, this bystander MN was relative to the irradiation dose and the cell co-culture rime. When the hepatoma cells were treated with pifithrin-α, a p53 inhibitor, their radiosensitivities were reduced, and the bystander effect was diminished. The results indicate that p53 could regulate not only the radiosensitivity but also the bystander response. (authors)

  13. p53 protects against genome instability following centriole duplication failure

    Science.gov (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  14. GRIM-19 disrupts E6/E6AP complex to rescue p53 and induce apoptosis in cervical cancers.

    Directory of Open Access Journals (Sweden)

    Ying Zhou

    Full Text Available BACKGROUND: Our previous studies showed a down-regulation of GRIM-19 in primary human cervical cancers, and restoration of GRIM-19 induced tumor regression. The induction of tumor suppressor protein p53 ubiquitination and degradation by E6 oncoportein of high risk-HPV through forming a stable complex with E6AP is considered as a critical mechanism for cervical tumor development. The aims of this study were to determine the potential role of GRIM-19 in rescuing p53 protein and inducing cervical cancer cell apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: The protein levels of GRIM-19 and p53 were detected in normal cervical tissues from 45 patients who underwent hysterectomy for reasons other than neoplasias of either the cervix or endometrium, and cervical cancer tissues from 60 patients with non-metastatic squamous epithelial carcinomas. Coimmunoprecipitation and GST pull-down assay were performed to examine the interaction of GRIM-19 with 18E6 and E6AP in vivo and in vitro respectively. The competition of 18E6 with E6AP in binding GRIM-19 by performing competition pull-down assays was designed to examine the disruption of E6/E6AP complex by GRIM-19. The augment of E6AP ubiquitination by GRIM-19 was detected in vivo and in vitro ubiquitination assay. The effects of GRIM-19-dependent p53 accumulation on cell proliferation, cell cycle, apoptosis were explored by MTT, flow cytometry and transmission electron microscopy respectively. The tumor suppression was detected by xenograft mouse model. CONCLUSION/SIGNIFICANCE: The levels of GRIM-19 and p53 were concurrently down regulated in cervical cancers. The restoration of GRIM-19 can induce ubiquitination and degradation of E6AP, and disrupt the E6/E6AP complex through the interaction of N-terminus of GRIM-19 with both E6 and E6AP, which protected p53 from degradation and promoted cell apoptosis. Tumor xenograft studies also revealed the suppression of p53 degradation in presence of GRIM-19. These data

  15. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    Science.gov (United States)

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  17. PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

    Science.gov (United States)

    Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

    2009-01-01

    Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

  18. Honokiol induces autophagic cell death in malignant glioma through reactive oxygen species-mediated regulation of the p53/PI3K/Akt/mTOR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Ju [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China); Chen, Ta-Liang [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Tseng, Yuan-Yun [Department of Neurosurgery, Shuang-Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Wu, Gong-Jhe [Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Hsieh, Ming-Hui [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Lin, Yung-Wei [Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Chen, Ruei-Ming, E-mail: rmchen@tmu.edu.tw [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China)

    2016-08-01

    Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- and time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates

  19. p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.

    Science.gov (United States)

    Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete

    2018-06-11

    CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.

  20. Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

    Directory of Open Access Journals (Sweden)

    Carlos Farkas

    Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

  1. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    International Nuclear Information System (INIS)

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen

    2015-01-01

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection

  2. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen, E-mail: dwtong@nwsuaf.edu.cn

    2015-01-09

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.

  3. Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

    Science.gov (United States)

    Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

    2008-07-01

    We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

  4. Radiation-induced hyperproliferation of intestinal crypts results in elevated genome instability with inactive p53-related genomic surveillance.

    Science.gov (United States)

    Zhou, Xin; Ma, Xiaofei; Wang, Zhenhua; Sun, Chao; Wang, Yupei; He, Yang; Zhang, Hong

    2015-12-15

    Radiation-induced hyperproliferation of intestinal crypts is well documented, but its potential tumorigenic effects remain elusive. Here we aim to determine the genomic surveillance process during crypt hyperproliferation, and its consequential outcome after ionizing radiation. Crypt regeneration in the intestine was induced by a single dose of 12Gy abdominal irradiation. γ-H2AX, 53BP1 and DNA-PKcs were used as DNA repair surrogates to investigate the inherent ability of intestinal crypt cells to recognize and repair double-strand breaks. Ki67 staining and the 5-bromo-2'-deoxyuridine incorporation assay were used to study patterns of cell proliferation in regenerating crypts. Staining for ATM, p53, Chk1 and Chk2 was performed to study checkpoint activation and release. Apoptosis was evaluated through H&E staining and terminal deoxynucleotidyl transferase (dUTP) nick-end labeling. The ATM-p53 pathway was immediately activated after irradiation. A second wave of DSBs in crypt cells was observed in regenerating crypts, accompanied with significantly increased chromosomal bridges. The p53-related genomic surveillance pathway was not active during the regeneration phase despite DSBs and chromosomal bridges in the cells of regenerating crypts. Non-homologous end joining (NHEJ) DSBs repair was involved in the DSBs repair process, as indicated by p-DNA-PKcs staining. Intestinal crypt cells retained hyperproliferation with inactive p53-related genomic surveillance system. NHEJ was involved in the resultant genomic instability during hyperproliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. p53 and ATF4 mediate distinct and additive pathways to skeletal muscle atrophy during limb immobilization

    Science.gov (United States)

    Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.

    2014-01-01

    Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282

  6. Harnessing the p53-PUMA Axis to Overcome DNA Damage Resistance in Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Xiaoguang Zhou

    2014-12-01

    Full Text Available Resistance to DNA damage–induced apoptosis is a hallmark of cancer and a major cause of treatment failure and lethal disease outcome. A tumor entity that is largely resistant to DNA-damaging therapies including chemo- or radiotherapy is renal cell carcinoma (RCC. This study was designed to explore the underlying molecular mechanisms of DNA damage resistance in RCC to develop strategies to resensitize tumor cells to DNA damage–induced apoptosis. Here, we show that apoptosis-resistant RCC cells have a disconnect between activation of p53 and upregulation of the downstream proapoptotic protein p53 upregulated modulator of apoptosis (PUMA. We demonstrate that this disconnect is not caused by gene-specific repression through CCCTC-binding factor (CTCF but instead by aberrant chromatin compaction. Treatment with an HDAC inhibitor was found to effectively reactivate PUMA expression on the mRNA and protein level and to revert resistance to DNA damage–induced cell death. Ectopic expression of PUMA was found to resensitize a panel of RCC cell lines to four different DNA-damaging agents tested. Remarkably, all RCC cell lines analyzed were wild-type for p53, and a knockdown was likewise able to sensitize RCC cells to acute genotoxic stress. Taken together, our results indicate that DNA damage resistance in RCC is reversible, involves the p53-PUMA axis, and is potentially targetable to improve the oncological outcomes of RCC patients.

  7. Agmatine Ameliorates High Glucose-Induced Neuronal Cell Senescence by Regulating the p21 and p53 Signaling.

    Science.gov (United States)

    Song, Juhyun; Lee, Byeori; Kang, Somang; Oh, Yumi; Kim, Eosu; Kim, Chul-Hoon; Song, Ho-Taek; Lee, Jong Eun

    2016-02-01

    Neuronal senescence caused by diabetic neuropathy is considered a common complication of diabetes mellitus. Neuronal senescence leads to the secretion of pro-inflammatory cytokines, the production of reactive oxygen species, and the alteration of cellular homeostasis. Agmatine, which is biosynthesized by arginine decarboxylation, has been reported in previous in vitro to exert a protective effect against various stresses. In present study, agmatine attenuated the cell death and the expression of pro-inflammatory cytokines such as IL-6, TNF-alpha and CCL2 in high glucose in vitro conditions. Moreover, the senescence associated-β-galatosidase's activity in high glucose exposed neuronal cells was reduced by agmatine. Increased p21 and reduced p53 in high glucose conditioned cells were changed by agmatine. Ultimately, agmatine inhibits the neuronal cell senescence through the activation of p53 and the inhibition of p21. Here, we propose that agmatine may ameliorate neuronal cell senescence in hyperglycemia.

  8. Basic molecular biology in radiation-induced carcinogenesis

    International Nuclear Information System (INIS)

    Rytoemaa, T.

    1992-01-01

    The tumour suppressor gene p53 is 'guardian of the genome'. If a DNA molecule (each chromosome has one DNA molecule) is damaged by an external factor, such as ionizing radiation, the protein product of the p53 gene stops the cell's proliferative activity until the damage is repaired. If the repair fails, the p53 gene product normally triggers programmed death of the cell. P53 gene itself is commonly damaged by radiation (or by another DNA-damaging factor). The altered gene product fails to control the integrity of the genome, and it also prevents the guardian action of the protein which is produced by the intact allele (each cell has two p53 genes). Under these circumstances any subsequent damage to DNA, induced e.g. by a chemical, is easily 'fixed'. Potentially critical sites for an additional DNA damage are the proto-oncogens (when damaged these genes are called oncogens), which commonly act as components of the regulatory network in a cell. Permanent malfunction of the signal network may then lead to uncontrolled cell growth, resulting in a malignant clone (=cancer). This simplified molecular model seems to be the common mechanism in many (or most) human cancers. (orig.)

  9. FATS is a transcriptional target of p53 and associated with antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhang Xifeng

    2010-09-01

    Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.

  10. Synergistic anti-tumor effects of nitroreductase mutants and p53

    Directory of Open Access Journals (Sweden)

    Mahboobeh Razmkhah

    2014-01-01

    Conclusion: Combination of T41L/F70A NTR with p53 may have more advantages for treatment of different types of cancers compared to the other NTRs and p53 alone. The present study results may open new windows for getting desired outcome in gene therapy of different types of cancer.

  11. Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

    Directory of Open Access Journals (Sweden)

    Lu Xin

    2009-06-01

    Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

  12. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, Akihisa

    2002-01-01

    We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)

  13. Simple mathematical method to quantify p53 mutations in occupational lung cancer

    International Nuclear Information System (INIS)

    Helal, N.L.

    2005-01-01

    Radon-222, a decay product of uranium-238 and a source of high linear energy transfer (LET) alpha -particles, has been implicated in the increase risk of lung cancer in uranium miners as well as non-miners. The p53 gene mutational spectrum reveals evidence for a direct causal effect of radon inhalation in lung cancer. This mutation has been proposed as a marker of radon exposure. The development of such markers may ultimately be of benefit in the reduction of occupational morbidity and mortality from occupational cancer. One of the tasks in risk assessment of genotoxic occupational radiation exposure is to devise a simple numerical method. This method may be used to quantify the relationship between radiation dose and the effect on the genetic sequences. The tumor suppressor gene (TSG) p53 is an ideal bio marker addressing questions of exposure and risk. These proteins may be suitable for the design of more effective or less invasive cancer therapies. The clinical outcome of lung cancer patients may correlate with the normal regulation of these patients and, therefore, their identification may be used as a guideline for future therapy modalities. To investigate the association between radon exposure and p53 mutations in lung tumors, we have implied a mathematical method. This method has been developed from a 2-D graphical representational technique that enables easy visualization of base distributions. This is of special relevance to libraries of single nucleotide polymorphic (SNP) genes

  14. p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.

    Directory of Open Access Journals (Sweden)

    Feng Yu

    Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.

  15. Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer

    Directory of Open Access Journals (Sweden)

    Wen-Cheng Chung

    2017-11-01

    Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.

  16. Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

    Science.gov (United States)

    Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

    2003-12-01

    p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

  17. Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

    Directory of Open Access Journals (Sweden)

    Seok-Hyung Kim

    2013-07-01

    Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.

  18. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.

    2003-01-01

    Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation

  19. Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.

    Science.gov (United States)

    Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko

    2017-11-30

    Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.

  20. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    OpenAIRE

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...