Pax3 stimulates p53 ubiquitination and degradation independent of transcription.
Directory of Open Access Journals (Sweden)
Xiao Dan Wang
Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.
Energy Technology Data Exchange (ETDEWEB)
Wan, Chunhua [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Ma, Xa; Shi, Shangshi [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Zhao, Jianya; Nie, Xiaoke [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Han, Jingling; Xiao, Jing; Wang, Xiaoke [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Shengyang [Department of Nutrition and Food Hygiene, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China); Jiang, Junkang, E-mail: Jiang_junkang@163.com [Department of Occupational Medicine and Environmental Toxicology, School of Public Health, Nantong University, Nantong 226019 Jiangsu (China); Jiangsu Province Key Laboratory for Inflammation and Molecular Drug Target, Nantong University, Nantong 226019 Jiangsu (China)
2014-12-15
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H{sub 2}O{sub 2} production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is
International Nuclear Information System (INIS)
Wan, Chunhua; Ma, Xa; Shi, Shangshi; Zhao, Jianya; Nie, Xiaoke; Han, Jingling; Xiao, Jing; Wang, Xiaoke; Jiang, Shengyang; Jiang, Junkang
2014-01-01
Chronic exposure to excessive manganese (Mn) has been known to lead to neuronal loss and a clinical syndrome resembling idiopathic Parkinson's disease (IPD). p53 plays an integral role in the development of various human diseases, including neurodegenerative disorders. However, the role of p53 in Mn-induced neuronal apoptosis and neurological deficits remains obscure. In the present study, we showed that p53 was critically involved in Mn-induced neuronal apoptosis in rat striatum through both transcription-dependent and -independent mechanisms. Western blot and immunohistochemistrical analyses revealed that p53 was remarkably upregulated in the striatum of rats following Mn exposure. Coincidentally, increased level of cleaved PARP, a hallmark of apoptosis, was observed. Furthermore, using nerve growth factor (NGF)-differentiated PC12 cells as a neuronal cell model, we showed that Mn exposure decreased cell viability and induced apparent apoptosis. Importantly, p53 was progressively upregulated, and accumulated in both the nucleus and the cytoplasm. The cytoplasmic p53 had a remarkable distribution in mitochondria, suggesting an involvement of p53 mitochondrial translocation in Mn-induced neuronal apoptosis. In addition, Mn-induced impairment of mitochondrial membrane potential (ΔΨm) could be partially rescued by pretreatment with inhibitors of p53 transcriptional activity and p53 mitochondrial translocation, Pifithrin-α (PFT-α) and Pifithrin-μ (PFT-μ), respectively. Moreover, blockage of p53 activities with PFT-α and PFT-μ significantly attenuated Mn-induced reactive oxidative stress (ROS) generation and mitochondrial H 2 O 2 production. Finally, we observed that pretreatment with PFT-α and PFT-μ ameliorated Mn-induced apoptosis in PC12 cells. Collectively, these findings implicate that p53 transcription-dependent and -independent pathways may play crucial roles in the regulation of Mn-induced neuronal death. - Highlights: • p53 is robustly
Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena
2016-11-02
Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude
2011-01-01
Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Matthew L Hirsch
Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication
Directory of Open Access Journals (Sweden)
Constance Qiao Xin Yeo
2016-04-01
Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Apaf-1 is a transcriptional target for E2F and p53
DEFF Research Database (Denmark)
Moroni, M C; Hickman, E S; Lazzerini Denchi, E
2001-01-01
between the deregulation of the pRB pathway and apoptosis. Furthermore, because the pRB pathway is functionally inactivated in most cancers, the identification of Apaf-1 as a transcriptional target for E2F might explain the increased sensitivity of tumour cells to chemotherapy. We also show that......, independently of the pRB pathway, Apaf-1 is a direct transcriptional target of p53, suggesting that p53 might sensitize cells to apoptosis by increasing Apaf-1 levels....
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
p53-Dependent and -Independent Epithelial Integrity: Beyond miRNAs and Metabolic Fluctuations
Directory of Open Access Journals (Sweden)
Tsukasa Oikawa
2018-05-01
Full Text Available In addition to its classical roles as a tumor suppressor, p53 has also been shown to act as a guardian of epithelial integrity by inducing the microRNAs that target transcriptional factors driving epithelial–mesenchymal transition. On the other hand, the ENCODE project demonstrated an enrichment of putative motifs for the binding of p53 in epithelial-specific enhancers, such as CDH1 (encoding E-cadherin enhancers although its biological significance remained unknown. Recently, we identified two novel modes of epithelial integrity (i.e., maintenance of CDH1 expression: one involves the binding of p53 to a CDH1 enhancer region and the other does not. In the former, the binding of p53 is necessary to maintain permissive histone modifications around the CDH1 transcription start site, whereas in the latter, p53 does not bind to this region nor affect histone modifications. Furthermore, these mechanisms likely coexisted within the same tissue. Thus, the mechanisms involved in epithelial integrity appear to be much more complex than previously thought. In this review, we describe our findings, which may instigate further experimental scrutiny towards understanding the whole picture of epithelial integrity as well as the related complex asymmetrical functions of p53. Such understanding will be important not only for cancer biology but also for the safety of regenerative medicine.
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
David G. Johnson
2012-10-01
Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.
International Nuclear Information System (INIS)
Turinetto, Valentina; Porcedda, Paola; Orlando, Luca; De Marchi, Mario; Amoroso, Antonio; Giachino, Claudia
2009-01-01
Current chemotherapy of human cancers focuses on the DNA damage pathway to induce a p53-mediated cellular response leading to either G1 arrest or apoptosis. However, genotoxic treatments may induce mutations and translocations that result in secondary malignancies or recurrent disease. In addition, about 50% of human cancers are associated with mutations in the p53 gene. Nongenotoxic activation of apoptosis by targeting specific molecular pathways thus provides an attractive therapeutic approach. Normal and leukemic cells were evaluated for their sensitivity to 5, 6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) through cell viability and caspase activation tests. The apoptotic pathway induced by DRB was analysed by immunfluorescence and immunoblot analysis. H2AX phosphorylation and cell cycle analysis were performed to study the dependance of apoptosis on DNA damage and DNA replication, respectively. To investigate the role of p53 in DRB-induced apoptosis, specific p53 inhibitors were used. Statistical analysis on cell survival was performed with the test of independence. Here we report that DRB, an inhibitor of the transcriptional cyclin-dependent kinases (CDKs) 7 and 9, triggers DNA replication-independent apoptosis in normal and leukemic human cells regardless of their p53 status and without inducing DNA damage. Our data indicate that (i) in p53-competent cells, apoptosis induced by DRB relies on a cytosolic accumulation of p53 and subsequent Bax activation, (ii) in the absence of p53, it may rely on p73, and (iii) it is independent of ATM and NBS1 proteins. Notably, even apoptosis-resistant leukemic cells such as Raji were sensitive to DRB. Our results indicate that DRB represents a potentially useful cancer chemotherapeutic strategy that employs both the p53-dependent and -independent apoptotic pathways without inducing genotoxic stress, thereby decreasing the risk of secondary malignancies
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
International Nuclear Information System (INIS)
Kuo, Kung-Kai; Chen, Yi-Ling; Chen, Lih-Ren; Li, Chien-Feng; Lan, Yu-Hsuan; Chang, Fang-Rong; Wu, Yang-Chang; Shiue, Yow-Ling
2011-01-01
The objective was to investigate the upstream apoptotic mechanisms that were triggered by a styrylpyrone derivative, goniothalamin (GTN), in tumor protein p53 (TP53)-positive and -negative hepatocellular carcinoma (HCC)-derived cells. Effects of GTN were evaluated by the flow cytometry, alkaline comet assay, immunocytochemistry, small-hairpin RNA interference, mitochondria/cytosol fractionation, quantitative reverse transcription-polymerase chain reaction, immunoblotting analysis and caspase 3 activity assays in two HCC-derived cell lines. Results indicated that GTN triggered phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1, also known as NOXA)-mediated apoptosis via TP53-dependent and -independent pathways. In TP53-positive SK-Hep1 cells, GTN furthermore induced TP53 transcription-dependent and -independent apoptosis. After GTN treatment, accumulation of reactive oxygen species, formation of DNA double-strand breaks, transactivation of TP53 and/or PMAIP1 gene, translocation of TP53 and/or PMAIP1 proteins to mitochondria, release of cytochrome c from mitochondria, cleavage of caspases and induction of apoptosis in both cell lines were sustained. GTN might represent a novel class of anticancer drug that induces apoptosis in HCC-derived cells through PMAIP1 transactivation regardless of the status of TP53 gene. - Highlights: → Goniothalamin (GTN) induced apoptosis in hepatocellular carcinomas-derived cells. → The apoptosis induced by GTN is PMAIP1-dependent, regardless of TP53 status. → The apoptosis induced by GTN might be TP53 transcription-dependent or -independent. → GTN-induced apoptosis is mitochondria- and caspases-mediated.
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
International Nuclear Information System (INIS)
Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.
2002-01-01
The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with
Directory of Open Access Journals (Sweden)
Danielle B Ulanet
2010-08-01
Full Text Available The Arf tumor suppressor acts as a sensor of oncogenic signals, countering aberrant proliferation in large part via activation of the p53 transcriptional program, though a number of p53-independent functions have been described. Mounting evidence suggests that, in addition to promoting tumorigenesis via disruptions in the homeostatic balance between cell proliferation and apoptosis of overt cancer cells, genetic alterations leading to tumor suppressor loss of function or oncogene gain of function can also incite tumor development via effects on the tumor microenvironment. In a transgenic mouse model of multi-stage pancreatic neuroendocrine carcinogenesis (PNET driven by inhibition of the canonical p53 and Rb tumor suppressors with SV40 large T-antigen (Tag, stochastic progression to tumors is limited in part by a requirement for initiation of an angiogenic switch. Despite inhibition of p53 by Tag in this mouse PNET model, concomitant disruption of Arf via genetic knockout resulted in a significantly accelerated pathway to tumor formation that was surprisingly not driven by alterations in tumor cell proliferation or apoptosis, but rather via earlier activation of the angiogenic switch. In the setting of a constitutional p53 gene knockout, loss of Arf also accelerated tumor development, albeit to a lesser degree. These findings demonstrate that Arf loss of function can promote tumorigenesis via facilitating angiogenesis, at least in part, through p53-independent mechanisms.
APAF1 is a key transcriptional target for p53 in the regulation of neuronal cell death
DEFF Research Database (Denmark)
Fortin, A; Cregan, S P; MacLaurin, J G
2001-01-01
p53 is a transcriptional activator which has been implicated as a key regulator of neuronal cell death after acute injury. We have shown previously that p53-mediated neuronal cell death involves a Bax-dependent activation of caspase 3; however, the transcriptional targets involved in the regulati...
E2F-1-Induced p53-independent apoptosis in transgenic mice
DEFF Research Database (Denmark)
Holmberg, Christian Henrik; Helin, K.; Sehested, M.
1998-01-01
The E2F transcription factors are key targets for the retinoblastoma protein, pRB. By inactivation of E2Fs, pRB prevents progression to the S phase. To test proliferative functions of E2F, we generated transgenic mice expressing human E2F-1 and/or human DP-1. When the hydroxymethyl glutaryl...... involving increased apoptosis in the germinal epithelium. This effect was potentiated by simultaneous overexpression of DP-1. Testicular atrophy as a result of overexpression of E2F-1 and DP-1 is independent of functional p53, since p53-nullizygous transgenic mice overexpressing E2F-1 and DP-1 also suffered...
Expression of p53/HGF/c-met/STAT3 signal in fetuses with neural tube defects.
Trovato, Maria; D'Armiento, Maria; Lavra, Luca; Ulivieri, Alessandra; Dominici, Roberto; Vitarelli, Enrica; Grosso, Maddalena; Vecchione, Raffaella; Barresi, Gaetano; Sciacchitano, Salvatore
2007-02-01
Neural tube defects (NTD) are morphogenetic alterations due to a defective closure of neural tube. Hepatocyte growth factor (HGF)/c-met system plays a role in morphogenesis of nervous system, lung, and kidney. HGF/c-met morphogenetic effects are mediated by signal transducers and activators of transcription (STAT)3 and both HGF and c-met genes are regulated from p53. The aim of our study was to analyze mRNA and protein expressions of p53, HGF, c-met, and STAT3 in fetuses with NTD. By reverse transcriptase-polymerase chain reaction and immunohistochemistry, we analyzed neural tissues from four NTD fetuses and the corresponding non-malformed lungs, kidneys and placentas. We found a reduced mRNA expression of HGF/c-met/STAT3 pathway, in the malformed nervous systems and placentas. The reduced expression of this pathway correlated with the absence of p53 in all these samples. On the contrary, detectable expression levels of p53, HGF, c-met, and STAT3 were observed in non-malformed lungs and kidneys obtained from the same fetuses. Comparable results were obtained by immunohistochemistry, with the exception of p53, which was undetected in all fetal tissues. In conclusion, in NTD fetuses, both the defective neural tube tissue and the placenta have a reduction in all components of the p53/HGF/c-met/STAT3 cascade. This raises the possibility of using the suppression of these genes for early diagnosis of NTD especially on chorionic villus sampling.
RITA enhances chemosensivity of pre-B ALL cells to doxorubicin by inducing p53-dependent apoptosis.
Kazemi, Ahmad; Safa, Majid; Shahbazi, Atefeh
2011-07-01
The use of low-molecular-weight, non-peptidic molecules that disrupt the interaction between the p53 tumor suppressor and its negative regulator MDM2 has provided a promising alternative for the treatment of different types of cancer. Here, we used small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) to sensitize leukemic NALM-6 cells to doxorubicin by upregulating p53 protein. RITA alone effectively inhibited NALM-6 cells viability in dose-dependent manner as measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay and induced apoptosis as evaluated by flow cytometry, whereas RITA in combination with doxorubicin enhanced NALM-6 cells to doxorubicin-sensitivity and promoted doxorubicin induced apoptosis. Levels of p53 protein and its proapoptotic target genes, quantified by western blot and real-time PCR respectively, showed that expression of p53 was significantly increased after RITA treatment. Using p53 inhibitors PFT-alpha and PFT-mu it was shown that p53-mediated apoptosis induced by RITA can be regulated by both p53-transcription-dependent and -independent pathways. Moreover, RITA-induced apoptosis was accompanied by the activation of caspase-3 and PARP cleavage. Therefore, exploiting synergistic effects between RITA and chemotherapeutics might be an effective clinical strategy for leukemia chemotherapy.
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.
Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A
2015-10-29
Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
Chromatin-Bound MDM2 Regulates Serine Metabolism and Redox Homeostasis Independently of p53.
Riscal, Romain; Schrepfer, Emilie; Arena, Giuseppe; Cissé, Madi Y; Bellvert, Floriant; Heuillet, Maud; Rambow, Florian; Bonneil, Eric; Sabourdy, Frédérique; Vincent, Charles; Ait-Arsa, Imade; Levade, Thierry; Thibaut, Pierre; Marine, Jean-Christophe; Portais, Jean-Charles; Sarry, Jean-Emmanuel; Le Cam, Laurent; Linares, Laetitia K
2016-06-16
The mouse double minute 2 (MDM2) oncoprotein is recognized as a major negative regulator of the p53 tumor suppressor, but growing evidence indicates that its oncogenic activities extend beyond p53. Here, we show that MDM2 is recruited to chromatin independently of p53 to regulate a transcriptional program implicated in amino acid metabolism and redox homeostasis. Identification of MDM2 target genes at the whole-genome level highlights an important role for ATF3/4 transcription factors in tethering MDM2 to chromatin. MDM2 recruitment to chromatin is a tightly regulated process that occurs during oxidative stress and serine/glycine deprivation and is modulated by the pyruvate kinase M2 (PKM2) metabolic enzyme. Depletion of endogenous MDM2 in p53-deficient cells impairs serine/glycine metabolism, the NAD(+)/NADH ratio, and glutathione (GSH) recycling, impacting their redox state and tumorigenic potential. Collectively, our data illustrate a previously unsuspected function of chromatin-bound MDM2 in cancer cell metabolism. Copyright © 2016 Elsevier Inc. All rights reserved.
Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten
2014-12-01
Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.
UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53Ser-15 phosphorylation
International Nuclear Information System (INIS)
Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader; Shahin, Allen; Patel, Mahendra; Galadari, Sehamuddin
2009-01-01
Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser 15 . Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not prevent Dubca cell apoptosis, suggesting that p53 Ser-15 phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
International Nuclear Information System (INIS)
Tommaso, Anne di; Hagen, Jussara; Tompkins, Van; Muniz, Viviane; Dudakovic, Amel; Kitzis, Alain; Ladeveze, Veronique; Quelle, Dawn E.
2009-01-01
The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala 14 and Thr 31 ) were found to destabilize the protein while two others (Val 24 and Ala 41 ) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significant biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val 24 was required for p53-independent growth suppression whereas multiple residues (Val 24 , Thr 31 , Ala 41 and His 60 ) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
Energy Technology Data Exchange (ETDEWEB)
Sun, Lin [West Biostatistics and Cost-effectiveness Research Center, Medical Insurance Office, West China Hospital of Sichuan University, 610041, Sichuan (China); Li, Yu [Department of Anesthesiology, West China Hospital, Sichuan University, 610041, Sichuan (China); Yang, Bangxiang, E-mail: b19933009@qq.coom [Department of Pain Management, West China Hospital of Sichuan University, 610041, Sichuan (China)
2016-09-09
Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition of proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
FATS is a transcriptional target of p53 and associated with antitumor activity
Zhang Xifeng; Zhang Qian; Zhang Jun; Qiu Li; Yan Shuang-shuang; Feng Juling; Sun Yan; Huang Xingxu; Lu Karen H; Li Zheng
2010-01-01
Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374) through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS....
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
International Nuclear Information System (INIS)
Hayashi, Yoko; Kondo, Takashi; Zhao Qingli; Ogawa Ryohei; Cui Zhengguo; Feril, Loreto B.; Teranishi, Hidetoyo; Kasuya, Minoru
2004-01-01
It has been reported that the hexavalent chromium compound (Cr(VI)) can induce both p53-dependent and p53-independent apoptosis. While a considerable amount of information is available on the p53-dependent pathway, only little is known about the p53-independent pathway. To elucidate the p53-independent mechanism, the roles of the Ca 2+ -calpain- and mitochondria-caspase-dependent pathways in apoptosis induced by Cr(VI) were investigated. When human lymphoma U937 cells, p53 mutated cells, were treated with 20 μM Cr(VI) for 24 h, nuclear morphological changes and DNA fragmentation were observed. Production of hydroxyl radicals revealed by electron paramagnetic resonance (EPR)-spin trapping, and increase of intracellular calcium ion concentration monitored by digital imaging were also observed in Cr(VI)-treated cells. An intracellular Ca 2+ chelator, BAPTA-AM, and calpain inhibitors suppressed the Cr(VI)-induced DNA fragmentation. The number of cells showing low mitochondrial membrane potential (MMP), high level of superoxide anion radicals (O 2 - ), and high activity of caspase-3, which are indicators of mitochondria-caspase-dependent pathway, increased significantly in Cr(VI)-treated cells. An antioxidant, N-acetyl-L-cysteine (NAC), decreased DNA fragmentation and inhibited the changes in MMP, O 2 - formation, and activation of caspase-3 induced by Cr(VI). No increase of the expressions of Fas and phosphorylated JNK was observed after Cr(VI) treatment. Cell cycle analysis revealed that the fraction of G2/M phase tended to increase after 24 h of treatment, suggesting that Cr(VI)-induced apoptosis is related to the G2 block. These results indicate that Ca 2+ -calpain- and mitochondria-caspase-dependent pathways play significant roles in the Cr(VI)-induced apoptosis via the G2 block, which are independent of JNK and Fas activation. The inhibition of apoptosis and all its signal transductions by NAC suggests that intracellular reactive oxygen species (ROS) are
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Directory of Open Access Journals (Sweden)
Qiong Jia
Full Text Available Diamond-Blackfan anemia (DBA is a rare inherited bone marrow failure syndrome that is characterized by pure red-cell aplasia and associated physical deformities. It has been proven that defects of ribosomal proteins can lead to this disease and that RPS19 is the most frequently mutated gene in DBA patients. Previous studies suggest that p53-dependent genes and pathways play important roles in RPS19-deficient embryos. However, whether there are other vital factors linked to DBA has not been fully clarified. In this study, we compared the whole genome RNA-Seq data of zebrafish embryos injected with RPS19 morpholino (RPS19 MO, RPS19 and p53 morpholino simultaneously (RPS19+p53 MO and control morpholino (control. We found that genes enriched in the functions of hematological systems, nervous system development and skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for future research on DBA, which is a systematic and complex hereditary disease.
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors
Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't
1999-01-01
Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this
Herr, D; Keck, C; Tempfer, C; Pietrowski, Detlef
2004-12-01
The ovarian corpus luteum plays a critical role in reproduction being the primary source of circulating progesterone. After ovulation the corpus luteum is build by avascular granulosa lutein cells through rapid vascularization regulated by gonadotropic hormones. The present study was performed to investigate whether this process might be influenced by the human chorionic gonadotropin (hCG)-dependent expression of different tumor suppressor genes and hypoxia dependent transcription factors. RNA was isolated from cultured granulosa lutein cells, transcribed into cDNA, and the transcript level of following genes were determined: RB-1, VHL, NF-1, NF-2, Wt-1, p53, APC, and hypoxia inducible factor-1 (HIF-1), -2, and -3alpha. Additionally, the influence of hCG on the expression of VHL, p53, and HIf2alpha were investigated. We demonstrate that in human granulosa lutein cells the tumor suppressor genes RB-1, VHL, NF-1, NF-2, Wt-1, p53, and APC and the hypoxia dependent transcription factors HIF-1alpha, -2alpha, and -3alpha are expressed. In addition, we showed that hCG regulates the expression of p53, VHL, and HIF-2alpha. Our results indicate that hCG may determine the growth and development of the corpus luteum by mediating hypoxic and apoptotic pathways in human granulosa lutein cells. Copyright 2004 Wiley-Liss, Inc.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation
Directory of Open Access Journals (Sweden)
Kumar Sonia
2011-02-01
Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Nardilysin controls intestinal tumorigenesis through HDAC1/p53-dependent transcriptional regulation.
Kanda, Keitaro; Sakamoto, Jiro; Matsumoto, Yoshihide; Ikuta, Kozo; Goto, Norihiro; Morita, Yusuke; Ohno, Mikiko; Nishi, Kiyoto; Eto, Koji; Kimura, Yuto; Nakanishi, Yuki; Ikegami, Kanako; Yoshikawa, Takaaki; Fukuda, Akihisa; Kawada, Kenji; Sakai, Yoshiharu; Ito, Akihiro; Yoshida, Minoru; Kimura, Takeshi; Chiba, Tsutomu; Nishi, Eiichiro; Seno, Hiroshi
2018-04-19
Colon cancer is a complex disease affected by a combination of genetic and epigenetic factors. Here we demonstrate that nardilysin (N-arginine dibasic convertase; NRDC), a metalloendopeptidase of the M16 family, regulates intestinal tumorigenesis via its nuclear functions. NRDC is highly expressed in human colorectal cancers. Deletion of the Nrdc gene in ApcMin mice crucially suppressed intestinal tumor development. In ApcMin mice, epithelial cell-specific deletion of Nrdc recapitulated the tumor suppression observed in Nrdc-null mice. Moreover, epithelial cell-specific overexpression of Nrdc significantly enhanced tumor formation in ApcMin mice. Notably, epithelial NRDC controlled cell apoptosis in a gene dosage-dependent manner. In human colon cancer cells, nuclear NRDC directly associated with HDAC1, and controlled both acetylation and stabilization of p53, with alterations of p53 target apoptotic factors. These findings demonstrate that NRDC is critically involved in intestinal tumorigenesis through its epigenetic regulatory function, and targeting NRDC may lead to a novel prevention or therapeutic strategy against colon cancer.
Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.
Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D
2017-08-01
Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.
Directory of Open Access Journals (Sweden)
Li Xie
Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.
Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage
Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.
2009-01-01
Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133
Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.
Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel
2012-02-01
Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
Directory of Open Access Journals (Sweden)
Yitao Wang
2017-03-01
Full Text Available We previously identified proline-rich protein 11 (PRR11 as a novel cancer-related gene that is implicated in the regulation of cell cycle and tumorigenesis. Our recent study demonstrated that PRR11 and its adjacent gene, kinetochore associated 2 (SKA2, constitute a classic head-to-head gene pair that is coordinately regulated by nuclear factor Y (NF-Y. In the present study, we further show that the PRR11-SKA2 bidirectional transcription unit is an indirect target of the tumor suppressor p53. A luciferase reporter assay revealed that overexpression of wild type p53, but not mutant p53, significantly represses the basal activity and NF-Y mediated transactivation of the PRR11-SKA2 bidirectional promoter. Deletion and mutation analysis of the PRR11-SKA2 promoter revealed that p53-mediated PRR11-SKA2 repression is dependent on the presence of functional NF-Y binding sites. Furthermore, a co-immunoprecipitation assay revealed that p53 associates with NF-Y in lung cancer cells, and a chromatin immunoprecipitation assay showed that p53 represses PRR11-SKA2 transcription by reducing the binding amount of NF-Y in the PRR11-SKA2 promoter region. Consistently, the ability of p53 to downregulate PRR11-SKA2 transcription was significantly attenuated upon siRNA-mediated depletion of nuclear factor Y subunit beta (NF-YB. Notably, lung cancer patients with lower expression of either PRR11 or SKA2 along with wild type p53 exhibited the best overall survival compared with others with p53 mutation and/or higher expression of either PRR11 or SKA2. Taken together, our results demonstrate that p53 negatively regulates the expression of the PRR11-SKA2 bidirectional transcription unit through NF-Y, suggesting that the inability to repress the PRR11-SKA2 bidirectional transcription unit after loss of p53 might contribute to tumorigenesis.
Non-Canonical Cell Death Induced by p53
Directory of Open Access Journals (Sweden)
Atul Ranjan
2016-12-01
Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.
Mitochondrial localization of the low level p53 protein in proliferative cells
Energy Technology Data Exchange (ETDEWEB)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)
2009-10-02
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Mitochondrial localization of the low level p53 protein in proliferative cells
International Nuclear Information System (INIS)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc
2009-01-01
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Perfettini, Jean-Luc; Roumier, Thomas; Castedo, Maria; Larochette, Nathanael; Boya, Patricia; Raynal, Brigitte; Lazar, Vladimir; Ciccosanti, Fabiola; Nardacci, Roberta; Penninger, Josef; Piacentini, Mauro; Kroemer, Guido
2004-03-01
The coculture of cells expressing the HIV-1 envelope glycoprotein complex (Env) with cells expressing CD4 results into cell fusion, deregulated mitosis, and subsequent cell death. Here, we show that NF-kappaB, p53, and AP1 are activated in Env-elicited apoptosis. The nuclear factor kappaB (NF-kappaB) super repressor had an antimitotic and antiapoptotic effect and prevented the Env-elicited phosphorylation of p53 on serine 15 and 46, as well as the activation of AP1. Transfection with dominant-negative p53 abolished apoptosis and AP1 activation. Signs of NF-kappaB and p53 activation were also detected in lymph node biopsies from HIV-1-infected individuals. Microarrays revealed that most (85%) of the transcriptional effects of HIV-1 Env were blocked by the p53 inhibitor pifithrin-alpha. Macroarrays led to the identification of several Env-elicited, p53-dependent proapoptotic transcripts, in particular Puma, a proapoptotic "BH3-only" protein from the Bcl-2 family known to activate Bax/Bak. Down modulation of Puma by antisense oligonucleotides, as well as RNA interference of Bax and Bak, prevented Env-induced apoptosis. HIV-1-infected primary lymphoblasts up-regulated Puma in vitro. Moreover, circulating CD4+ lymphocytes from untreated, HIV-1-infected donors contained enhanced amounts of Puma protein, and these elevated Puma levels dropped upon antiretroviral therapy. Altogether, these data indicate that NF-kappaB and p53 cooperate as the dominant proapoptotic transcription factors participating in HIV-1 infection.
Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea
2009-06-01
Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitut...
Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael
2016-02-16
The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
International Nuclear Information System (INIS)
Stubbert, Lawton J; Smith, Jennifer M; McKay, Bruce C
2010-01-01
One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. RNA interference (RNAi) was used to reduce the transcription-coupled nucleotide excision repair (TC-NER) capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B) transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic
Directory of Open Access Journals (Sweden)
Smith Jennifer M
2010-05-01
Full Text Available Abstract Background One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. Methods RNA interference (RNAi was used to reduce the transcription-coupled nucleotide excision repair (TC-NER capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. Results These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. Conclusion The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Directory of Open Access Journals (Sweden)
Bruce C. McKay
1999-08-01
Full Text Available We have previously suggested that the inhibition of RNA polymerase II-mediated transcription after exposure to UV light promotes the accumulation of p53 and the induction of apoptosis (Oncogene 13, 823–831. However, it was not clear whether p53 induction was contributing to apoptosis. Here we report that apoptosis is triggered at lower UV doses in p53-deficient Li-Fraumeni syndrome (LFS and human papillomavirus (HPV E6 expressing fibroblasts than in normal cells, suggesting that p53 can be protective against UVinduced apoptosis. There is no significant difference in the effect of UV-irradiation on the cell cycle distribution of normal and primary LFS fibroblasts. Importantly, the recovery of nascent mRNA synthesis in all p53-deficient fibroblasts is significantly impaired compared with control cells after exposure to relevant doses of UV light. Taken together, our results suggest that wild-type p53 can protect cells against UV-induced apoptosis by facilitating the recovery of transcription. Furthermore, we suggest that the capacity of cells to recover transcription after genotoxic damage is an important determinant of sensitivity to apoptosis.
International Nuclear Information System (INIS)
Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu
2014-01-01
Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-07-19
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
Transcription of five p53- and Stat-3-Inducible genes after ionizing radiation
Energy Technology Data Exchange (ETDEWEB)
Grace, M.B. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)], E-mail: grace@afrri.usuhs.mil; Blakely, W.F. [Uniformed Services University (USUHS), Armed Forces Radiobiology Research Institute, Building 42, RM 3321, 8901 Wisconsin Avenue, Bethesda, MD 20889-5603 (United States)
2007-07-15
Ionizing radiation (IR) produces temporal- and dose-dependent changes in multiple gene mRNA targets that are potential biomarkers of radiation dose. We confirmed IR-induced changes in expression of gadd45a, ddb-2, and cdkn1a downstream transcripts of p53 by quantitative reverse transcription-polymerase chain reaction (QRT-PCR) assay in total RNA samples from the whole blood of radiotherapy patients undergoing total-body irradiation [Amundson, S.A., Grace, M.B., McLeland, C.B., Epperly, M.W., Yeager, A., Zhan, Q., Greenberger, J.S., Fornace Jr., A.J., 2004. Human in vivo radiation-induced biomarkers: gene expression changes in radiotherapy patients. Cancer Res. 64, 6368-6371.]. We now confirm dose-dependent up-regulation of bax in addition to these p53-dependent transcripts, and bcl-2, a downstream transcript of Stat-3, in ex vivo irradiated blood samples from healthy unrelated volunteers. Together these biomarkers represent pathways involved in growth arrest, DNA damage, and apoptosis. The objectives of this study were to (1) investigate the relationship between baseline mRNA expression levels, and (2) define expression patterns in response to IR in a large cohort (n=20). Whole-blood samples were irradiated ex vivo to measure gene expression in samples from (i) three healthy donors over a broad dose range (0, 0.25, 0.50, 0.75, 1, 2, and 3 Gy), and (ii) 20 healthy donors at two doses, 0.25 and 2.5 Gy. Expression level variance ({sigma}{sub 2}) of baseline values (0 Gy) showed negligible inter-individual variation with all values {<=}1.0. {sigma}{sub 2}values=0.50bax, 0.25 bcl-2, 0.73 gadd45a, 0.66 cdkn1a, and 1.0 ddb-2. Meaningful IR dose-responses were observed for bax, gadd45a, and ddb-2 profiles and the ratio of bax:bcl-2 mRNA expression over a broad dose range. QRT-PCR studies were extended in the lower dose range (0, 0.1, 0.5, 0.75, and 1 Gy). Results showed that bax:bcl-2 ratio initially favors bax expression at doses of <1Gy, with IR-induced dose responses
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Regulation of p73 by Hck through kinase-dependent and independent mechanisms
Directory of Open Access Journals (Sweden)
Radha Vegesna
2007-05-01
Full Text Available Abstract Background p73, a p53 family member is a transcription factor that plays a role in cell cycle, differentiation and apoptosis. p73 is regulated through post translational modifications and protein interactions. c-Abl is the only known tyrosine kinase that phosphorylates and activates p73. Here we have analyzed the role of Src family kinases, which are involved in diverse signaling pathways, in regulating p73. Results Exogenously expressed as well as cellular Hck and p73 interact in vivo. In vitro binding assays show that SH3 domain of Hck interacts with p73. Co-expression of p73 with Hck or c-Src in mammalian cells resulted in tyrosine phosphorylation of p73. Using site directed mutational analysis, we determined that Tyr-28 was the major site of phosphorylation by Hck and c-Src, unlike c-Abl which phosphorylates Tyr-99. In a kinase dependent manner, Hck co-expression resulted in stabilization of p73 protein in the cytoplasm. Activation of Hck in HL-60 cells resulted in tyrosine phosphorylation of endogenous p73. Both exogenous and endogenous Hck localize to the nuclear as well as cytoplasmic compartment, just as does p73. Ectopically expressed Hck repressed the transcriptional activity of p73 as determined by promoter assays and semi-quantitative RT-PCR analysis of the p73 target, Ipaf and MDM2. SH3 domain- dependent function of Hck was required for its effect on p73 activity, which was also reflected in its ability to inhibit p73-mediated apoptosis. We also show that Hck interacts with Yes associated protein (YAP, a transcriptional co-activator of p73, and shRNA mediated knockdown of YAP protein reduces p73 induced Ipaf promoter activation. Conclusion We have identified p73 as a novel substrate and interacting partner of Hck and show that it regulates p73 through mechanisms that are dependent on either catalytic activity or protein interaction domains. Hck-SH3 domain-mediated interactions play an important role in the inhibition of p73
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-09-19
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent
International Nuclear Information System (INIS)
Dbaibo, G.; El-Assaad, W.
2000-01-01
Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status
International Nuclear Information System (INIS)
Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer
2011-01-01
The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21− combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21− carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status
International Nuclear Information System (INIS)
Kim, W.-J.; Beardsley, Dillon I.; Adamson, Aaron W.; Brown, Kevin D.
2005-01-01
One of the cellular responses to DNA damaging events is the activation of programmed cell death, also known as apoptosis. Apoptosis is an important process in limiting tumorigenesis by eliminating cells with damaged DNA. This view is reinforced by the finding that many genes with pro-apoptotic function are absent or altered in cancer cells. The tumor suppressor p53 performs a significant role in apoptotic signaling by controlling expression of a host of genes that have pro-apoptotic or pro-survival function. The S N 1 DNA alkylating agent N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) triggers apoptosis and the upregulation/phosphorylation of p53; however, the mechanism(s) governing MNNG-induced cell death remain unresolved. We observed that the human lymphoblastoid cell line WTK-1, which expresses mutant p53, shows far less sensitivity to the cytotoxic effects of MNNG than the closely related, p53-normal line TK-6. Exposure to 15 μM MNNG (LD50 at 24 h in TK-6) leads to a kinetically slower rate of apoptotic onset in WTK-1 cells compared to TK-6 as judged by viability assays and approaches that directly examine apoptotic onset. Similar results were obtained using an unrelated human lymphoblastoid line B310 expressing reduced levels of p53 due to E6 oncoprotein expression, indicating that MNNG activates both p53-dependent and -independent apoptotic mechanisms and that these two mechanisms are discernable by the rates which they trigger apoptotic onset. We document, during time points corresponding to peak apoptotic response in TK6, WTK-1, B310, and B310-E6, that these cell lines show marked decreases in mitochondrial transmembrane potential and increases in cytochrome c within the cytosolic fraction of MNNG-treated cells. Consistent with these events, we observed that both caspase-9 and -3 are activated in our panel of lymphoblastoid cells after MNNG exposure. We also found, using both broad spectrum and specific inhibitors, that blocking caspase activity in TK-6 and
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
HAMLET triggers apoptosis but tumor cell death is independent of caspases, Bcl-2 and p53.
Hallgren, O; Gustafsson, L; Irjala, H; Selivanova, G; Orrenius, S; Svanborg, C
2006-02-01
HAMLET (Human alpha-lactalbumin Made Lethal to Tumor cells) triggers selective tumor cell death in vitro and limits tumor progression in vivo. Dying cells show features of apoptosis but it is not clear if the apoptotic response explains tumor cell death. This study examined the contribution of apoptosis to cell death in response to HAMLET. Apoptotic changes like caspase activation, phosphatidyl serine externalization, chromatin condensation were detected in HAMLET-treated tumor cells, but caspase inhibition or Bcl-2 over-expression did not prolong cell survival and the caspase response was Bcl-2 independent. HAMLET translocates to the nuclei and binds directly to chromatin, but the death response was unrelated to the p53 status of the tumor cells. p53 deletions or gain of function mutations did not influence the HAMLET sensitivity of tumor cells. Chromatin condensation was partly caspase dependent, but apoptosis-like marginalization of chromatin was also observed. The results show that tumor cell death in response to HAMLET is independent of caspases, p53 and Bcl-2 even though HAMLET activates an apoptotic response. The use of other cell death pathways allows HAMLET to successfully circumvent fundamental anti-apoptotic strategies that are present in many tumor cells.
Directory of Open Access Journals (Sweden)
Ching-Hao Li
2010-02-01
Full Text Available p53, can regulate cell apoptosis in both transcription-dependent and -independent manners. The transcription-independent pathway was demonstrated by the translocation of p53 to mitochondria. Our study showed that p53 mitochondrial translocation was found in mitomycin C (MMC-treated HepG2. The p53 C-terminal domain is clustered with potential nuclear leading sequences and showed strong electrostatic ion-ion interactions with cardiolipin, phosphatidylglycerol and phosphatidic acid in vitro. Disruption of cardiolipin biosynthesis by phosphatidylglycero-phosphate synthase (PGS or CDP-diacylglycerol synthase 2 (CDS-2 short hairpin RNA (shRNA transfection eliminated the MMC-induced translocation of mitochondrial p53. The elimination of mitochondrial p53 translocation also reduced Bcl-xL and Bcl-2 mitochondrial distribution. In HEK 293T models with saturated p53 expression, the mitochondrial partition of p53, Bcl-xL, and Bcl-2 obviously decreased in their PGS shRNA- or CDS-2 shRNA-expressing stable clones. In p53-null H1299 models, both the mitochondrial partitions of Bcl-xL and Bcl-2 were strongly reduced in relation to the HEK 293T models. The Bcl-xL mitochondrial partition was elevated in H1299 models expressing pCEP4-p53wt suggesting the direct carrier role of p53 in transporting Bcl-xL to the mitochondria. We also found that the cytosolic pool of Bcl-xL and Bcl-2 remained unaffected in the low-dose MMC treatment but decreased in the high-dose MMC treatment. The cytosolic pool of Bcl-2 and Bcl-xL directly regulated their amounts in p53-dependent mitochondrial distribution. In the low-dose MMC treatment, the increased mitochondrial p53, Bcl-xL, and Bcl-2 could attenuate apoptosis. However, in the high-dose MMC treatment, only the p53 translocated to the mitochondria and resulted in apoptosis progression. On the basis of this study, we thought mitochondrial p53 might regulate apoptosis in a biphasic manner.
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
p53-dependent inhibition of TrxR1 contributes to the tumor-specific induction of apoptosis by RITA.
Hedström, Elisabeth; Eriksson, Sofi; Zawacka-Pankau, Joanna; Arnér, Elias S J; Selivanova, Galina
2009-11-01
Thioredoxin reductase 1 (TrxR1) is a key regulator in many redox-dependent cellular pathways, and is often overexpressed in cancer. Several studies have identified TrxR1 as a potentially important target for anticancer therapy. The low molecular weight compound RITA (NSC 652287) binds p53 and induces p53-dependent apoptosis. Here we found that RITA also targets TrxR1 by non-covalent binding, followed by inhibition of its activity in vitro and by inhibition of TrxR activity in cancer cells. Interestingly, a novel approximately 130 kDa form of TrxR1, presumably representing a stable covalently linked dimer, and an increased generation of reactive oxygen species (ROS) were induced by RITA in cancer cells in a p53-dependent manner. Similarly, the gold-based TrxR inhibitor auranofin induced apoptosis related to oxidative stress, but independently of p53 and without apparent induction of the approximately 130 kDa form of TrxR1. In contrast to the effects observed in cancer cells, RITA did not inhibit TrxR or ROS formation in normal fibroblasts (NHDF). The inhibition of TrxR1 can sensitize tumor cells to agents that induce oxidative stress and may directly trigger cell death. Thus, our results suggest that a unique p53-dependent effect of RITA on TrxR1 in cancer cells might synergize with p53-dependent induction of pro-apoptotic genes and oxidative stress, thereby leading to a robust induction of cancer cell death, without affecting non-transformed cells.
DEFF Research Database (Denmark)
Galanos, Panagiotis; Vougas, Konstantinos; Walter, David
2016-01-01
The cyclin-dependent kinase inhibitor p21(WAF1/CIP1) (p21) is a cell-cycle checkpoint effector and inducer of senescence, regulated by p53. Yet, evidence suggests that p21 could also be oncogenic, through a mechanism that has so far remained obscure. We report that a subset of atypical cancerous ...
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Zhang, Jing; Biggar, Kyle K; Storey, Kenneth B
2013-01-15
The red-eared slider turtle (Trachemys scripta elegans) exhibits well-developed natural anoxia tolerance that depends on multiple biochemical adaptations, including anoxia-induced hypometabolism. We hypothesized that signaling by the p53 protein could aid in establishing the hypometabolic state by arresting the cell cycle, protecting against DNA damage as well as altering pathways of energy metabolism. Immunoblotting was used to evaluate the regulation and post-transcriptional modifications of p53 in liver and skeletal muscle of red-eared slider turtles subjected to 5h or 20h of anoxic submergence. Tissue specific regulation of p53 was observed with the liver showing a more rapid activation of p53 in response to anoxia as well as differential expression of seven serine phosphorylation and two lysine acetylation sites when compared with skeletal muscle. Protein expression of MDM2, a major p53 inhibitor, was also examined but did not change during anoxia. Reverse-transcriptase PCR was used to assess transcript levels of selected p53 target genes (14-3-3σ, Gadd45α and Pgm) and one microRNA (miR-34a); results showed down-regulation of Pgm and up-regulation of the other three. These findings show an activation of p53 in response to anoxia exposure and suggest an important role for the p53 stress response pathway in regulating natural anoxia tolerance and hypometabolism in a vertebrate facultative anaerobe. Copyright © 2012 Elsevier B.V. All rights reserved.
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Seth, Rohit; Corniola, Rikki S.; Gower-Winter, Shannon D.; Morgan, Thomas J., Jr.; Bishop, Brian; Levenson, Cathy W.
2015-01-01
Previous studies have shown that zinc deficiency leads to apoptosis of neuronal precursor cells in vivo and in vitro. In addition to the role of p53 as a nuclear transcription factor in zinc deficient cultured human neuronal precursors (NT-2), we have now identified the translocation of phosphorylated p53 to the mitochondria and p53-dependent…
Jang, Sang-Min; Kang, Eun-Jin; Kim, Jung-Woong; Kim, Chul-Hong; An, Joo-Hee; Choi, Kyung-Hee
2013-08-23
PUMA is a crucial regulator of apoptotic cell death mediated by p53-dependent and p53-independent mechanisms. In many cancer cells, PUMA expression is induced in response to DNA-damaging reagent in a p53-dependent manner. However, few studies have investigated transcription factors that lead to the induction of PUMA expression via p53-independent apoptotic signaling. In this study, we found that the transcription factor Sox4 increased PUMA expression in response to trichostatin A (TSA), a histone deacetylase inhibitor in the p53-null human lung cancer cell line H1299. Ectopic expression of Sox4 led to the induction of PUMA expression at the mRNA and protein levels, and TSA-mediated up-regulation of PUMA transcription was repressed by the knockdown of Sox4. Using luciferase assays and chromatin immunoprecipitation, we also determined that Sox4 recruits p300 on the PUMA promoter region and increases PUMA gene expression in response to TSA treatment. Taken together, these results suggest that Sox4 is required for p53-independent apoptotic cell death mediated by PUMA induction via TSA treatment. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response
Directory of Open Access Journals (Sweden)
Toshinori Ozaki
2013-01-01
Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.
Cdk2 is required for p53-independent G2/M checkpoint control.
Directory of Open Access Journals (Sweden)
Jon H Chung
2010-02-01
Full Text Available The activation of phase-specific cyclin-dependent kinases (Cdks is associated with ordered cell cycle transitions. Among the mammalian Cdks, only Cdk1 is essential for somatic cell proliferation. Cdk1 can apparently substitute for Cdk2, Cdk4, and Cdk6, which are individually dispensable in mice. It is unclear if all functions of non-essential Cdks are fully redundant with Cdk1. Using a genetic approach, we show that Cdk2, the S-phase Cdk, uniquely controls the G(2/M checkpoint that prevents cells with damaged DNA from initiating mitosis. CDK2-nullizygous human cells exposed to ionizing radiation failed to exclude Cdk1 from the nucleus and exhibited a marked defect in G(2/M arrest that was unmasked by the disruption of P53. The DNA replication licensing protein Cdc6, which is normally stabilized by Cdk2, was physically associated with the checkpoint regulator ATR and was required for efficient ATR-Chk1-Cdc25A signaling. These findings demonstrate that Cdk2 maintains a balance of S-phase regulatory proteins and thereby coordinates subsequent p53-independent G(2/M checkpoint activation.
Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways
Directory of Open Access Journals (Sweden)
Lisa Wiesmüller
2001-01-01
Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.
ERK-dependent and -independent pathways trigger human neural progenitor cell migration
International Nuclear Information System (INIS)
Moors, Michaela; Cline, Jason E.; Abel, Josef; Fritsche, Ellen
2007-01-01
Besides differentiation and apoptosis, cell migration is a basic process in brain development in which neural cells migrate several centimeters within the developing brain before reaching their proper positions and forming the right connections. For identifying signaling events that control neural migration and are therefore potential targets of chemicals to disturb normal brain development, we developed a human neurosphere-based migration assay based on normal human neural progenitor (NHNP) cells, in which the distance is measured that cells wander over time. Applying this assay, we investigated the role of the extracellular signal-regulated kinases 1 and 2 (ERK1/2) in the regulation of NHNP cell migration. Exposure to model substances like ethanol or phorbol 12-myristate 13-acetate (PMA) revealed a correlation between ERK1/2 activation and cell migration. The participation of phospho-(P-) ERK1/2 was confirmed by exposure of the cells to the MEK inhibitor PD98059, which directly prohibits ERK1/2 phosphorylation and inhibited cell migration. We identified protein kinase C (PKC) and epidermal growth factor receptor (EGFR) as upstream signaling kinases governing ERK1/2 activation, thereby controlling NHNP cell migration. Additionally, treatments with src kinase inhibitors led to a diminished cell migration without affecting ERK1/2 phosphorylation. Based on these results, we postulate that migration of NHNP cells is controlled via ERK1/2-dependent and -independent pathways
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
Directory of Open Access Journals (Sweden)
Rouba Hage-Sleiman
Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Sun, Guoqiang; Yu, Ruth T; Evans, Ronald M; Shi, Yanhong
2007-09-25
TLX is a transcription factor that is essential for neural stem cell proliferation and self-renewal. However, the molecular mechanism of TLX-mediated neural stem cell proliferation and self-renewal is largely unknown. We show here that TLX recruits histone deacetylases (HDACs) to its downstream target genes to repress their transcription, which in turn regulates neural stem cell proliferation. TLX interacts with HDAC3 and HDAC5 in neural stem cells. The HDAC5-interaction domain was mapped to TLX residues 359-385, which contains a conserved nuclear receptor-coregulator interaction motif IXXLL. Both HDAC3 and HDAC5 have been shown to be recruited to the promoters of TLX target genes along with TLX in neural stem cells. Recruitment of HDACs led to transcriptional repression of TLX target genes, the cyclin-dependent kinase inhibitor, p21(CIP1/WAF1)(p21), and the tumor suppressor gene, pten. Either inhibition of HDAC activity or knockdown of HDAC expression led to marked induction of p21 and pten gene expression and dramatically reduced neural stem cell proliferation, suggesting that the TLX-interacting HDACs play an important role in neural stem cell proliferation. Moreover, expression of a TLX peptide containing the minimal HDAC5 interaction domain disrupted the TLX-HDAC5 interaction. Disruption of this interaction led to significant induction of p21 and pten gene expression and to dramatic inhibition of neural stem cell proliferation. Taken together, these findings demonstrate a mechanism for neural stem cell proliferation through transcriptional repression of p21 and pten gene expression by TLX-HDAC interactions.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Alonso, Michelle; Tamasdan, Cristina; Miller, Douglas C; Newcomb, Elizabeth W
2003-02-01
Flavopiridol is a synthetic flavone, which inhibits growth in vitro and in vivo of several solid malignancies such as renal, prostate, and colon cancers. It is a potent cyclin-dependent kinase inhibitor presently in clinical trials. In this study, we examined the effect of flavopiridol on a panel of glioma cell lines having different genetic profiles: five of six have codeletion of p16(INK4a) and p14(ARF); three of six have p53 mutations; and one of six shows overexpression of mouse double minute-2 (MDM2) protein. Independent of retinoblastoma and p53 tumor suppressor pathway alterations, flavopiridol induced apoptosis in all cell lines but through a caspase-independent mechanism. No cleavage products for caspase 3 or its substrate poly(ADP-ribose) polymerase or caspase 8 were detected. The pan-caspase inhibitor Z-VAD-fmk did not inhibit flavopiridol-induced apoptosis. Mitochondrial damage measured by cytochrome c release and transmission electron microscopy was not observed in drug-treated glioma cells. In contrast, flavopiridol treatment induced translocation of apoptosis-inducing factor from the mitochondria to the nucleus. The proteins cyclin D(1) and MDM2 involved in the regulation of retinoblastoma and p53 activity, respectively, were down-regulated early after flavopiridol treatment. Given that MDM2 protein can confer oncogenic properties under certain circumstances, loss of MDM2 expression in tumor cells could promote increased chemosensitivity. After drug treatment, a low Bcl-2/Bax ratio was observed, a condition that may favor apoptosis. Taken together, the data indicate that flavopiridol has activity against glioma cell lines in vitro and should be considered for clinical development in the treatment of glioblastoma multiforme.
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
International Nuclear Information System (INIS)
An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee
2011-01-01
Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.
p53-Independent thermosensitization by mitomycin C in human non-small cell lung carcinoma cells
International Nuclear Information System (INIS)
Jin, Z.-H.; Matsumoto, H.; Hayashi, S.; Shioura, H.; Kitai, R.; Kano, E.; Hatashita, M.
2003-01-01
The combined treatment with hyperthermia and chemotherapeutic drugs such as cisplatin (CDDP), doxorubicin (DOX) and mitomycin C (MMC) has been widely adopted as a strategy of interdisciplinary cancer therapy to obtain greater therapeutic benefits. However, the involved mechanisms of the interactive cytotoxic effects of hyperthermia and MMC remain unclear. To elucidate the relationship between p53 functions and the interactive effects of the combined treatment with mild-hyperthermia and MMC, we examined the potentiation of cytotoxic effects, the induction of apoptosis, the changes in cell cycles and the accumulation of Hsp72 after the combined treatment with hyperthermia at 42 degree C and MMC using human non-small cell lung carcinoma H1299 transfectants with either null, wild-type (wt) or mutant (m) p53 gene. H1299/null, H1299/wtp53 and H1299/mp53 cells showed similar sensitivities to either hyperthermia at 42 degree C alone or MMC alone. The combined treatment resulted in a synergistically enhanced cytotoxicity in H1299 transfectants in a p53-independent manner. The mechanisms involved an enhancement of heat-induced apoptosis and a modulation of the cell cycle distribution by the combined treatment. The accumulation of Hsp72 was not suppressed by the combined treatment, as is not the case of the combined treatment with hyperthermia and either CDDP (1) or bleomycin (2). Our findings demonstrate a p53-independent mechanism for a synergistically cytotoxic enhancement by the combined treatment with mild-hyperthermia and MMC
Cellular inactivation of nitric oxide induces p53-dependent ...
African Journals Online (AJOL)
Tropical Journal of Pharmaceutical Research August 2016; 15 (8): 1595-1603 ... Cellular inactivation of nitric oxide induces p53-dependent apoptosis in ... apoptosis induced by a selective iNOS inhibitor, N-[(3-aminomethyl) benzyl] acetamidine (1400W), .... and nitrate. ... Nitrite production was measured in culture media.
Expression of p53 and p21 in primary glioblastomas
International Nuclear Information System (INIS)
Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.
2005-01-01
Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures
Directory of Open Access Journals (Sweden)
Jennifer M. Smith
2007-12-01
Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
International Nuclear Information System (INIS)
Sheahan, Sharon; Bellamy, Christopher O; Harland, Stephen N; Harrison, David J; Prost, Sandrine
2008-01-01
TGFβ has pleiotropic effects that range from regulation of proliferation and apoptosis to morphological changes and epithelial-mesenchymal transition (EMT). Some evidence suggests that these effects may be interconnected. We have recently reported that P53, P21 Cip1 and pRB, three critical regulators of the G1/S transition are variably involved in TGFβ-induced cell cycle arrest in hepatocytes. As these proteins are also involved in the regulation of apoptosis in many circumstances, we investigated their contribution to other relevant TGFβ-induced effects, namely apoptosis and EMT, and examined how the various processes were interrelated. Primary mouse hepatocytes deficient in p53, p21 and/or Rb, singly or in combination were treated with TGFβ for 24 to 96 hours. Apoptosis was quantified according to morphology and by immunostaining for cleaved-capsase 3. Epithelial and mesenchymal marker expression was studied using immunocytochemistry and real time PCR. We found that TGFβ similarly induced morphological changes regardless of genotype and independently of proliferation index or sensitivity to inhibition of proliferation by TGFβ. Morphological changes were accompanied by decrease in E-cadherin and increased Snail expression but the mesenchymal markers (N-cadherin, SMAα and Vimentin) studied remained unchanged. TGFβ induced high levels of apoptosis in p53-/-, Rb-/-, p21 cip1 -/- and control hepatocytes although with slight differences in kinetics. This was unrelated to proliferation or changes in morphology and loss of cell-cell adhesion. However, hepatocytes deficient in both p53 and p21 cip1 were less sensitive to TGFβ-induced apoptosis. Although p53, p21 Cip1 and pRb are well known regulators of both proliferation and apoptosis in response to a multitude of stresses, we conclude that they are critical for TGFβ-driven inhibition of hepatocytes proliferation, but only slightly modulate TGFβ-induced apoptosis. This effect may depend on other parameters
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
Cyclin D1 represses p300 transactivation through a cyclin-dependent kinase-independent mechanism.
Fu, Maofu; Wang, Chenguang; Rao, Mahadev; Wu, Xiaofang; Bouras, Toula; Zhang, Xueping; Li, Zhiping; Jiao, Xuanmao; Yang, Jianguo; Li, Anping; Perkins, Neil D; Thimmapaya, Bayar; Kung, Andrew L; Munoz, Alberto; Giordano, Antonio; Lisanti, Michael P; Pestell, Richard G
2005-08-19
Cyclin D1 encodes a regulatory subunit, which with its cyclin-dependent kinase (Cdk)-binding partner forms a holoenzyme that phosphorylates and inactivates the retinoblastoma protein. In addition to its Cdk binding-dependent functions, cyclin D1 regulates cellular differentiation in part by modifying several transcription factors and nuclear receptors. The molecular mechanism through which cyclin D1 regulates the function of transcription factors involved in cellular differentiation remains to be clarified. The histone acetyltransferase protein p300 is a co-integrator required for regulation of multiple transcription factors. Here we show that cyclin D1 physically interacts with p300 and represses p300 transactivation. We demonstrated further that the interaction of the two proteins occurs at the peroxisome proliferator-activated receptor gamma-responsive element of the lipoprotein lipase promoter in the context of the local chromatin structure. We have mapped the domains in p300 and cyclin D1 involved in this interaction. The bromo domain and cysteine- and histidine-rich domains of p300 were required for repression by cyclin D1. Cyclin D1 repression of p300 was independent of the Cdk- and retinoblastoma protein-binding domains of cyclin D1. Cyclin D1 inhibits histone acetyltransferase activity of p300 in vitro. Microarray analysis identified a signature of genes repressed by cyclin D1 and induced by p300 that promotes cellular differentiation and induces cell cycle arrest. Together, our results suggest that cyclin D1 plays an important role in cellular proliferation and differentiation through regulation of p300.
International Nuclear Information System (INIS)
Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G
2013-01-01
Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches
DEFF Research Database (Denmark)
Møller, Michael Boe; Ino, Y; Gerdes, A M
1999-01-01
The two gene products of the CDKN2A gene, p16 and p19ARF, have recently been linked to each of two major tumour suppressor pathways in human carcinogenesis, the RB1 pathway and the p53 pathway. p16 inhibits the phosphorylation of the retinoblastoma gene product by cyclin D-dependent kinases...
Directory of Open Access Journals (Sweden)
Yen-An Tang
2014-06-01
Conclusions: This study provides cell and clinical evidence that p53 and RB pathways transcriptionally repress DNMT expression. Normal expression of DNMT3A, RB and MDM2 proteins can be a biomarker for good prognosis in lung cancer.
Directory of Open Access Journals (Sweden)
R Geetha Ramani
Full Text Available Prediction of secondary site mutations that reinstate mutated p53 to normalcy has been the focus of intense research in the recent past owing to the fact that p53 mutants have been implicated in more than half of all human cancers and restoration of p53 causes tumor regression. However laboratory investigations are more often laborious and resource intensive but computational techniques could well surmount these drawbacks. In view of this, we formulated a novel approach utilizing computational techniques to predict the transcriptional activity of multiple site (one-site to five-site p53 mutants. The optimal MCC obtained by the proposed approach on prediction of one-site, two-site, three-site, four-site and five-site mutants were 0.775,0.341,0.784,0.916 and 0.655 respectively, the highest reported thus far in literature. We have also demonstrated that 2D and 3D features generate higher prediction accuracy of p53 activity and our findings revealed the optimal results for prediction of p53 status, reported till date. We believe detection of the secondary site mutations that suppress tumor growth may facilitate better understanding of the relationship between p53 structure and function and further knowledge on the molecular mechanisms and biological activity of p53, a targeted source for cancer therapy. We expect that our prediction methods and reported results may provide useful insights on p53 functional mechanisms and generate more avenues for utilizing computational techniques in biological data analysis.
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.
2014-01-01
Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Post-translational regulation enables robust p53 regulation.
Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling
2013-08-30
The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro
2018-01-01
Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.
Bajbouj, K; Mawrin, C; Hartig, R; Schulze-Luehrmann, J; Wilisch-Neumann, A; Roessner, A; Schneider-Stock, R
2012-05-01
Glioblastomas are known to be highly chemoresistant, but HDAC inhibitors (HDACi) have been shown to be of therapeutic relevance for this aggressive tumor type. We treated U87 glioblastoma cells with trichostatin A (TSA) to define potential epigenetic targets for HDACi-mediated antitumor effects. Using a cDNA array analysis covering 96 cell cycle genes, cyclin-dependent kinase inhibitor p21(WAF1) was identified as the major player in TSA-induced cell cycle arrest. TSA slightly inhibited proliferation and viability of U87 cells, cumulating in a G1/S cell cycle arrest. This effect was accompanied by a significant up-regulation of p53 and its transcriptional target p21(WAF1) and by down-regulation of key G1/S regulators, such as cdk4, cdk6, and cyclin D1. Nevertheless, TSA did not induce apoptosis in U87 cells. As expected, TSA promoted the accumulation of total acetylated histones H3 and H4 and a decrease in endogenous HDAC activity. Characterizing the chromatin modulation around the p21(WAF1) promoter after TSA treatment using chromatin immunoprecipitation, we found (1) a release of HDAC1, (2) an increase of acetylated H4 binding, and (3) enhanced recruitment of p53. p53-depleted U87 cells showed an abrogation of the G1/S arrest and re-entered the cell cycle. Immunofluorescence staining revealed that TSA induced the nuclear translocation of p21(WAF1) verifying a cell cycle arrest. On the other hand, a significant portion of p21(WAF1) was present in the cytoplasmic compartment causing apoptosis resistance. Furthermore, TSA-treated p53-mutant cell line U138 failed to show an induction in p21(WAF1), showed a deficient G2/M checkpoint, and underwent mitotic catastrophe. We suggest that HDAC inhibition in combination with other clinically used drugs may be considered an effective strategy to overcome chemoresistance in glioblastoma cells.
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias
2016-01-07
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Harish Chander
Full Text Available We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established.We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured.These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.
Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent
Energy Technology Data Exchange (ETDEWEB)
Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.
1995-12-01
One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E
2014-07-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
TAF6delta controls apoptosis and gene expression in the absence of p53.
Directory of Open Access Journals (Sweden)
Emmanuelle Wilhelm
Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.
Abnormal mitosis triggers p53-dependent cell cycle arrest in human tetraploid cells.
Kuffer, Christian; Kuznetsova, Anastasia Yurievna; Storchová, Zuzana
2013-08-01
Erroneously arising tetraploid mammalian cells are chromosomally instable and may facilitate cell transformation. An increasing body of evidence shows that the propagation of mammalian tetraploid cells is limited by a p53-dependent arrest. The trigger of this arrest has not been identified so far. Here we show by live cell imaging of tetraploid cells generated by an induced cytokinesis failure that most tetraploids arrest and die in a p53-dependent manner after the first tetraploid mitosis. Furthermore, we found that the main trigger is a mitotic defect, in particular, chromosome missegregation during bipolar mitosis or spindle multipolarity. Both a transient multipolar spindle followed by efficient clustering in anaphase as well as a multipolar spindle followed by multipolar mitosis inhibited subsequent proliferation to a similar degree. We found that the tetraploid cells did not accumulate double-strand breaks that could cause the cell cycle arrest after tetraploid mitosis. In contrast, tetraploid cells showed increased levels of oxidative DNA damage coinciding with the p53 activation. To further elucidate the pathways involved in the proliferation control of tetraploid cells, we knocked down specific kinases that had been previously linked to the cell cycle arrest and p53 phosphorylation. Our results suggest that the checkpoint kinase ATM phosphorylates p53 in tetraploid cells after abnormal mitosis and thus contributes to proliferation control of human aberrantly arising tetraploids.
International Nuclear Information System (INIS)
Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang
2006-01-01
HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
Deben, Christophe; Wouters, An; de Beeck, Ken Op; van Den Bossche, Jolien; Jacobs, Julie; Zwaenepoel, Karen; Peeters, Marc; Van Meerbeeck, Jan; Lardon, Filip; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick
2015-01-01
The p53/MDM2 interaction has been a well-studied target for new drug design leading to the development of the small molecule inhibitor Nutlin-3. Our objectives were to combine Nutlin-3 with cisplatin (CDDP), a well-known activator of the p53 pathway, in a series of non-small cell lung cancer cell lines in order to increase the cytotoxic response to CDDP. We report that sequential treatment (CDDP followed by Nutlin-3), but not simultaneous treatment, resulted in strong synergism. Combination treatment induced p53's transcriptional activity, resulting in increased mRNA and protein levels of MDM2, p21, PUMA and BAX. In addition we report the induction of a strong p53 dependent apoptotic response and induction of G2/M cell cycle arrest. The strongest synergistic effect was observed at low doses of both CDDP and Nutlin-3, which could result in fewer (off-target) side effects while maintaining a strong cytotoxic effect. Our results indicate a promising preclinical potential, emphasizing the importance of the applied treatment scheme and the presence of wild type p53 for the combination of CDDP and Nutlin-3. PMID:26125230
HEXIM1, a New Player in the p53 Pathway
Energy Technology Data Exchange (ETDEWEB)
Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)
2013-07-04
Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.
Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73
Directory of Open Access Journals (Sweden)
Lu Xin
2009-06-01
Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.
Directory of Open Access Journals (Sweden)
Liang Y
2018-03-01
Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood
Rieber, Manuel; Strasberg-Rieber, Mary
2014-03-15
Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Harrison David J
2007-11-01
Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of
Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol
2016-01-01
The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulat...
Directory of Open Access Journals (Sweden)
Jonathan Krell
Full Text Available The growth arrest-specific transcript 5 gene (GAS5 encodes a long noncoding RNA (lncRNA and hosts a number of small nucleolar RNAs (snoRNAs that have recently been implicated in multiple cellular processes and cancer. Here, we investigate the relationship between DNA damage, p53, and the GAS5 snoRNAs to gain further insight into the potential role of this locus in cell survival and oncogenesis both in vivo and in vitro.We used quantitative techniques to analyse the effect of DNA damage on GAS5 snoRNA expression and to assess the relationship between p53 and the GAS5 snoRNAs in cancer cell lines and in normal, pre-malignant, and malignant human colorectal tissue and used biological techniques to suggest potential roles for these snoRNAs in the DNA damage response.GAS5-derived snoRNA expression was induced by DNA damage in a p53-dependent manner in colorectal cancer cell lines and their levels were not affected by DICER. Furthermore, p53 levels strongly correlated with GAS5-derived snoRNA expression in colorectal tissue.In aggregate, these data suggest that the GAS5-derived snoRNAs are under control of p53 and that they have an important role in mediating the p53 response to DNA damage, which may not relate to their function in the ribosome. We suggest that these snoRNAs are not processed by DICER to form smaller snoRNA-derived RNAs with microRNA (miRNA-like functions, but their precise role requires further evaluation. Furthermore, since GAS5 host snoRNAs are often used as endogenous controls in qPCR quantifications we show that their use as housekeeping genes in DNA damage experiments can lead to inaccurate results.
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dana Austin
Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.
Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina
2010-04-15
Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.
The nucleolus as a fundamental regulator of the p53 response and a new target for cancer therapy.
Woods, Simone J; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D
2015-07-01
Recent studies have highlighted the fundamental role that key oncogenes such as MYC, RAS and PI3K occupy in driving RNA Polymerase I transcription in the nucleolus. In addition to maintaining essential levels of protein synthesis, hyperactivated ribosome biogenesis and nucleolar function plays a central role in suppressing p53 activation in response to oncogenic stress. Consequently, disruption of ribosome biogenesis by agents such as the small molecule inhibitor of RNA Polymerase I transcription, CX-5461, has shown unexpected, potent, and selective effects in killing tumour cells via disruption of nucleolar function leading to activation of p53, independent of DNA damage. This review will explore the mechanism of DNA damage-independent activation of p53 via the nucleolar surveillance pathway and how this can be utilised to design novel cancer therapies. Non-genotoxic targeting of nucleolar function may provide a new paradigm for treatment of a broad range of oncogene-driven malignancies with improved therapeutic windows. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage
Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe
2001-01-01
The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603
Regulation of Mdmx and its role in the p53 pathway
Meulmeester, Erik
2006-01-01
The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to
Directory of Open Access Journals (Sweden)
Steven N Reuland
Full Text Available Metastatic melanoma has poor prognosis and is refractory to most conventional chemotherapies. The alkylating agent temozolomide (TMZ is commonly used in treating melanoma but has a disappointing response rate. Agents that can act cooperatively with TMZ and improve its efficacy are thus highly sought after. The BH3 mimetic ABT-737, which can induce apoptosis by targeting pro-survival Bcl-2 family members, has been found to enhance the efficacy of many conventional chemotherapeutic agents in multiple cancers. We found that combining TMZ and ABT-737 induced strong synergistic apoptosis in multiple human melanoma cell lines. When the drugs were used in combination in a mouse xenograft model, they drastically reduced tumor growth at concentrations where each individual drug had no significant effect. We found that TMZ treatment elevated p53 levels, and that the pro-apoptotic protein Noxa was elevated in TMZ/ABT-737 treated cells. Experiments with shRNA demonstrated that the synergistic effect of TMZ and ABT-737 was largely dependent on Noxa. Experiments with nutlin-3, a p53 inducer, demonstrated that p53 induction was sufficient for synergistic cell death with ABT-737 in a Noxa-dependent fashion. However, p53 was not necessary for TMZ/ABT-737 synergy as demonstrated by a p53-null line, indicating that TMZ and ABT-737 together induce Noxa in a p53-independent fashion. These results demonstrate that targeting anti-apoptotic Bcl-2 members is a promising method for treating metastatic melanoma, and that clinical trials with TMZ and Bcl-2 inhibitors are warranted.
Directory of Open Access Journals (Sweden)
Alicja Sznarkowska
2010-08-01
Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.
Gao, Li; Ji, Yue; Lu, Yan; Qiu, Ming; Shen, Yejiao; Wang, Yaqing; Kong, Xiangqing; Shao, Yongfeng; Sheng, Yanhui; Sun, Wei
2018-03-09
The most frequently used oral anti-coagulant warfarin has been implicated in inducing calcification of aortic valve interstitial cells (AVICs), whereas the mechanism is not fully understood. The low-level activation of p53 is found to be involved in osteogenic transdifferentiation and calcification of AVICs. Whether p53 participates in warfarin-induced AVIC calcification remains unknown. In this study, we investigated the role of low-level p53 overexpression in warfarin-induced porcine AVIC (pAVIC) calcification. Immunostaining, quantitative PCR, and Western blotting revealed that p53 was expressed in human and pAVICs and that p53 expression was slightly increased in calcific human aortic valves compared with non-calcific valves. Terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining indicated that apoptosis slightly increased in calcific aortic valves than in non-calcific valves. Warfarin treatment led to a low-level increase of p53 mRNA and protein in both pAVICs and mouse aortic valves. Low-level overexpression of p53 in pAVICs via an adenovirus vector did not affect pAVIC apoptosis but promoted warfarin-induced calcium deposition and expression of osteogenic markers. shRNA-mediated p53 knockdown attenuated the pAVIC calcium deposition and osteogenic marker expression. Moreover, ChIP and luciferase assays showed that p53 was recruited to the slug promoter and activated slug expression in calcific pAVICs. Of note, overexpression of Slug increased osteogenic marker Runx2 expression, but not pAVIC calcium deposition, and Slug knockdown attenuated pAVIC calcification and p53-mediated pAVIC calcium deposition and expression of osteogenic markers. In conclusion, we found that p53 plays an important role in warfarin induced pAVIC calcification, and increased slug transcription by p53 is required for p53-mediated pAVIC calcification. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano
2014-01-01
The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756
International Nuclear Information System (INIS)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing; Guo Chun; Zhu Faliang; Yang Qiaozi; Gao Guimin; Gong Yaoqin; Shao Changshun
2009-01-01
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis
Energy Technology Data Exchange (ETDEWEB)
Liu Zhaojian; Liu Qiao; Xu Bing; Wu Jingjing [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Guo Chun; Zhu Faliang [Institute of Immunology, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Yang Qiaozi [Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States); Gao Guimin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Gong Yaoqin [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China)], E-mail: yxg8@sdu.edu.cn; Shao Changshun [Key Laboratory of Experimental Teratology of Ministry of Education and Institute of Molecular Medicine and Genetics, Shandong University School of Medicine, Jinan, Shandong 250012 (China); Department of Genetics, Rutgers University, Piscataway, NJ 08854 (United States)], E-mail: shao@biology.rutgers.edu
2009-03-09
Alkaloid berberine is widely used for the treatment of diarrhea and other diseases. Many laboratory studies showed that it exhibits anti-proliferative activity against a wide spectrum of cancer cells in culture. In this report we studied the mechanisms underlying the inhibitory effects of berberine on human osteosarcoma cells and on normal osteoblasts. The inhibition was largely attributed to cell cycle arrest at G1 and G2/M, and to a less extent, to apoptosis. The G1 arrest was dependent on p53, as G1 arrest was abolished in p53-deficient osteosarcoma cells. The induction of G1 arrest and apoptosis was accompanied by a p53-dependent up-regulation of p21 and pro-apoptotic genes. However, the G2/M arrest could be induced by berberine regardless of the status of p53. Interestingly, DNA double-strand breaks, as measured by the phosphorylation of H2AX, were remarkably accumulated in berberine-treated cells in a dose-dependent manner. Thus, one major mechanism by which berberine exerts its growth-inhibitory effect is to inflict genomic lesions on cells, which in turn trigger the activation of p53 and the p53-dependent cellular responses including cell cycle arrest and apoptosis.
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei
2015-03-15
Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.
The p53 inhibitor, pifithrin-α, suppresses self-renewal of embryonic stem cells
International Nuclear Information System (INIS)
Abdelalim, Essam Mohamed; Tooyama, Ikuo
2012-01-01
Highlights: ► We determine the role of p53 in ES cells under unstressful conditions. ► PFT-α suppresses ES cell proliferation. ► PFT-α induces ES cell cycle arrest. ► PFT-α downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-α, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-α resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-α caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.
The p53 inhibitor, pifithrin-{alpha}, suppresses self-renewal of embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Abdelalim, Essam Mohamed, E-mail: essam_abdelalim@yahoo.com [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia 41522 (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)
2012-04-13
Highlights: Black-Right-Pointing-Pointer We determine the role of p53 in ES cells under unstressful conditions. Black-Right-Pointing-Pointer PFT-{alpha} suppresses ES cell proliferation. Black-Right-Pointing-Pointer PFT-{alpha} induces ES cell cycle arrest. Black-Right-Pointing-Pointer PFT-{alpha} downregulates Nanog and cyclin D1. -- Abstract: Recent studies have reported the role of p53 in suppressing the pluripotency of embryonic stem (ES) cells after DNA damage and blocking the reprogramming of somatic cells into induced pluripotent stem (iPS) cells. However, to date no evidence has been presented to support the function of p53 in unstressed ES cells. In this study, we investigated the effect of pifithrin (PFT)-{alpha}, an inhibitor of p53-dependent transcriptional activation, on self-renewal of ES cells. Our results revealed that treatment of ES cells with PFT-{alpha} resulted in the inhibition of ES cell propagation in a dose-dependent manner, as indicated by a marked reduction in the cell number and colony size. Also, PFT-{alpha} caused a cell cycle arrest and significant reduction in DNA synthesis. In addition, inhibition of p53 activity reduced the expression levels of cyclin D1 and Nanog. These findings indicate that p53 pathway in ES cells rather than acting as an inactive gene, is required for ES cell proliferation and self-renewal under unstressful conditions.
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.
Directory of Open Access Journals (Sweden)
Young me Yoon
2016-11-01
Full Text Available Our mechanistic understanding of Fanconi anemia (FA pathway function in hematopoietic stem and progenitor cells (HSPCs owes much to their role in experimentally induced DNA crosslink lesion repair. In bone marrow HSPCs, unresolved stress confers p53-dependent apoptosis and progressive cell attrition. The role of FA proteins during hematopoietic development, in the face of physiological replicative demand, remains elusive. Here, we reveal a fetal HSPC pool in Fancd2−/− mice with compromised clonogenicity and repopulation. Without experimental manipulation, fetal Fancd2−/− HSPCs spontaneously accumulate DNA strand breaks and RAD51 foci, associated with a broad transcriptional DNA-damage response, and constitutive activation of ATM as well as p38 stress kinase. Remarkably, the unresolved stress during rapid HSPC pool expansion does not trigger p53 activation and apoptosis; rather, it constrains proliferation. Collectively our studies point to a role for the FA pathway during hematopoietic development and provide a new model for studying the physiological function of FA proteins.
Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination
Directory of Open Access Journals (Sweden)
Zhou Y
2018-04-01
Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto
2010-01-01
Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012
Directory of Open Access Journals (Sweden)
Bianca M Sirbu
Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.
Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling
Directory of Open Access Journals (Sweden)
Joerg eReichrath
2014-06-01
Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
Directory of Open Access Journals (Sweden)
Liu Jun
2004-07-01
Full Text Available Abstract Background BAK (Bcl-2 homologous antagonist/killer is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Methods Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53 and MKN-28 (mutant-type p53. RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. Results BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G0/G1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45, or in p53 mutant-type (MKN-28 gastric cancer cells. Conclusions The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies.
BAK overexpression mediates p53-independent apoptosis inducing effects on human gastric cancer cells
International Nuclear Information System (INIS)
Tong, Qiang-Song; Zheng, Li-Duan; Wang, Liang; Liu, Jun; Qian, Wei
2004-01-01
BAK (Bcl-2 homologous antagonist/killer) is a novel pro-apoptotic gene of the Bcl-2 family. It has been reported that gastric tumors have reduced BAK levels when compared with the normal mucosa. Moreover, mutations of the BAK gene have been identified in human gastrointestinal cancers, suggesting that a perturbation of BAK-mediated apoptosis may contribute to the pathogenesis of gastric cancer. In this study, we explored the therapeutic effects of gene transfer mediated elevations in BAK expression on human gastric cancer cells in vitro. Eukaryotic expression vector for the BAK gene was constructed and transferred into gastric cancer cell lines, MKN-45 (wild-type p53) and MKN-28 (mutant-type p53). RT-PCR and Western Blotting detected cellular BAK gene expression. Cell growth activities were detected by MTT colorimetry and flow cytometry, while apoptosis was assayed by electronic microscopy and TUNEL. Western Blotting and colorimetry investigated cellular caspase-3 activities. BAK gene transfer could result in significant BAK overexpression, decreased in vitro growth, cell cycle G 0 /G 1 arrest, and induced apoptosis in gastric cancer cells. In transferred cells, inactive caspase-3 precursor was cleaved into the active subunits p20 and p17, during BAK overexpression-induced apoptosis. In addition, this process occurred equally well in p53 wild-type (MKN-45), or in p53 mutant-type (MKN-28) gastric cancer cells. The data presented suggests that overexpression of the BAK gene can lead to apoptosis of gastric cancer cells in vitro, which does not appear to be dependent on p53 status. The action mechanism of BAK mediated apoptosis correlates with activation of caspase-3. This could be served as a potential strategy for further development of gastric cancer therapies
Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun
2016-01-01
Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.
p53-dependent non-coding RNA networks in chronic lymphocytic leukemia
Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.
2015-01-01
Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We
Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio
2017-01-01
The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
DEFF Research Database (Denmark)
Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice
2016-01-01
The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...
Directory of Open Access Journals (Sweden)
Yingshi Ouyang
Full Text Available Accumulating evidence suggests that tumor-initiating stem cells or cancer stem cells (CSCs possibly originating from normal stem cells may be the root cause of certain malignancies. How stem cell homeostasis is impaired in tumor tissues is not well understood, although certain tumor suppressors have been implicated. In this study, we use the Drosophila neural stem cells (NSCs called neuroblasts as a model to study this process. Loss-of-function of Numb, a key cell fate determinant with well-conserved mammalian counterparts, leads to the formation of ectopic neuroblasts and a tumor phenotype in the larval brain. Overexpression of the Drosophila tumor suppressor p53 (dp53 was able to suppress ectopic neuroblast formation caused by numb loss-of-function. This occurred in a non-apoptotic manner and was independent of Dacapo, the fly counterpart of the well-characterized mammalian p53 target p21 involved in cellular senescence. The observation that dp53 affected Edu incorporation into neuroblasts led us to test the hypothesis that dp53 acts through regulation of factors involved in cell cycle progression. Our results show that the inhibitory effect of dp53 on ectopic neuroblast formation was mediated largely through its regulation of Cyclin E (Cyc E. Overexpression of Cyc E was able to abrogate dp53's ability to rescue numb loss-of-function phenotypes. Increasing Cyc E levels by attenuating Archipelago (Ago, a recently identified transcriptional target of dp53 and a negative regulator of Cyc E, had similar effects. Conversely, reducing Cyc E activity by overexpressing Ago blocked ectopic neuroblast formation in numb mutant. Our results reveal an intimate connection between cell cycle progression and NSC self-renewal vs. differentiation control, and indicate that p53-mediated regulation of ectopic NSC self-renewal through the Ago/Cyc E axis becomes particularly important when NSC homeostasis is perturbed as in numb loss-of-function condition. This has
Ling, Hong; Samarasinghe, Sandhya; Kulasiri, Don
2013-12-01
Understanding the control of cellular networks consisting of gene and protein interactions and their emergent properties is a central activity of Systems Biology research. For this, continuous, discrete, hybrid, and stochastic methods have been proposed. Currently, the most common approach to modelling accurate temporal dynamics of networks is ordinary differential equations (ODE). However, critical limitations of ODE models are difficulty in kinetic parameter estimation and numerical solution of a large number of equations, making them more suited to smaller systems. In this article, we introduce a novel recurrent artificial neural network (RNN) that addresses above limitations and produces a continuous model that easily estimates parameters from data, can handle a large number of molecular interactions and quantifies temporal dynamics and emergent systems properties. This RNN is based on a system of ODEs representing molecular interactions in a signalling network. Each neuron represents concentration change of one molecule represented by an ODE. Weights of the RNN correspond to kinetic parameters in the system and can be adjusted incrementally during network training. The method is applied to the p53-Mdm2 oscillation system - a crucial component of the DNA damage response pathways activated by a damage signal. Simulation results indicate that the proposed RNN can successfully represent the behaviour of the p53-Mdm2 oscillation system and solve the parameter estimation problem with high accuracy. Furthermore, we presented a modified form of the RNN that estimates parameters and captures systems dynamics from sparse data collected over relatively large time steps. We also investigate the robustness of the p53-Mdm2 system using the trained RNN under various levels of parameter perturbation to gain a greater understanding of the control of the p53-Mdm2 system. Its outcomes on robustness are consistent with the current biological knowledge of this system. As more
REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO
XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.
2015-01-01
The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells
Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua
2011-01-01
Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149
Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.
Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi
2016-04-01
P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.
Directory of Open Access Journals (Sweden)
Alejo Efeyan
Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.
Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino
2011-11-01
Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.
p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.
Directory of Open Access Journals (Sweden)
Feng Yu
Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.
Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C
2012-12-13
p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
Energy Technology Data Exchange (ETDEWEB)
Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing
2009-09-07
The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
Zhang, Qingyu; Liu, Jie; Liu, Bin; Xia, Juan; Chen, Nianping; Chen, Xiaofeng; Cao, Yi; Zhang, Chen; Lu, Caijie; Li, Mingyi; Zhu, Runzhi
2014-04-01
The development of antitumor chemotherapy drugs remains a key goal for oncologists, and natural products provide a vast resource for anti-cancer drug discovery. In the current study, we found that the flavonoid dihydromyricetin (DHM) exhibited antitumor activity against liver cancer cells, including primary cells obtained from hepatocellular carcinoma (HCC) patients. In contrast, DHM was not cytotoxic to immortalized normal liver cells. Furthermore, DHM treatment resulted in the growth inhibition and remission of xenotransplanted tumors in nude mice. Our results further demonstrated that this antitumor activity was caused by the activation of the p53-dependent apoptosis pathway via p53 phosphorylation at serine (15Ser). Moreover, our results showed that DHM plays a dual role in the induction of cell death when administered in combination with cisplatin, a common clinical drug that kills primary hepatoma cells but not normal liver cells.
Wang, H; Ma, L; Li, Y; Cho, C H
2000-04-01
Cigarette smoking is a major risk factor for gastric cancer and peptic ulcer. The aim of our study was to investigate the relationship between exposure to cigarette smoke and apoptosis in the rat gastric mucosa and the mechanism involved. Rats were exposed to different concentrations of cigarette smoke (0, 2, and 4%) once daily for a different number of 1 h periods (1, 3, 6, and 9 d). Apoptosis was identified by the terminal deoxy-transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) method and caspase-3 activity. The mucosal xanthine oxidase (XO) activity and p53 level were also measured. The results showed that exposure to cigarette smoke produced a time- and concentration-dependent increase in apoptosis in the rat gastric mucosa that was accompanied by an increase in XO activity. The increased apoptosis and XO activity could be detected after even a single exposure. In contrast, the level of p53 was elevated only in the later stage of cigarette smoke exposure. The apoptotic effect could be blocked by pretreatment with an XO inhibitor (allopurinol, 20 mg/kg intraperitoneally) or a hydroxyl free radical scavenger (DMSO, 0.2%, 1 ml/kg intravenously). However, neither of these treatments had any effect on the p53 level of the mucosa. In summary, we conclude that exposure to cigarette smoke can increase apoptosis in the rat gastric mucosa through a reactive oxygen species- (ROS) mediated and a p53-independent pathway.
Loss of Geminin induces rereplication in the presence of functional p53
DEFF Research Database (Denmark)
Melixetian, Marina; Ballabeni, Andrea; Masiero, Laura
2004-01-01
nuclear foci. Abrogation of the checkpoint leads to abortive mitosis and death of rereplicated cells. In addition, we demonstrate that the induction of rereplication is dependent on the replication initiation factors CDT1 and CDC6, and independent of the functional status of p53. These data show...
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
RNA content in the nucleolus alters p53 acetylation via MYBBP1A
Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn
2011-01-01
A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583
Recent progress of the study of p53 control mechanism by ionizing radiation
International Nuclear Information System (INIS)
Kawai, Hidehiko
2004-01-01
Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)
Zhao, Yi; Yao, Yun-hong; Li, Li; An, Wei-fang; Chen, Hong-zen; Sun, Li-ping; Kang, Hai-xian; Wang, Sen; Hu, Xin-rong
2014-12-01
Pokemon has been showed to directly suppress p14(ARF) expression and also to overexpress in multiple cancers. However, p14(ARF)-MDM2-p53 pathway is usually aberrant in colorectal cancer (CRC). The aim is to confirm whether Pokemon plays a role in CRC and explore whether Pokemon works through p14(ARF)-MDM2-p53 pathway in CRC. Immunohistochemistry for Pokemon, p14(ARF) and Mtp53 protein was applied to 45 colorectal epitheliums (CREs), 42 colorectal adenomas (CRAs) and 66 CRCs. Pokemon was knocked down with RNAi technique in CRC cell line Lovo to detect mRNA expression of p14(ARF) with qRT-PCR, cell proliferation with CCK8 assay, and cell cycle and apoptosis with flowcytometry analysis. The protein expression rates were significantly higher in CRC (75.8%) than in CRE (22.2 %) or CRA (38.1%) for Pokemon and higher in CRC (53.0%) than in CRE (0) or CRA (4.8%) for Mtp53, but not significantly different in CRC (86.4 %) versus CRE (93.3%) or CRA (90.5 %) for p14(ARF). Higher expression rate of Pokemon was associated with lymph node metastasis and higher Duke's stage. After knockdown of Pokemon in Lovo cells, the mRNA level of p14(ARF) was not significantly changed, the cell proliferation ability was decreased by 20.6%, cell cycle was arrested by 55.7% in G0/G1 phase, and apoptosis rate was increased by 19.0%. Pokemon enhanced the oncogenesis of CRC by promoting proliferation, cell cycle progression and anti-apoptosis activity of CRC cells independently of p14(ARF)-MDM2-p53 pathway. This finding provided a novel idea for understanding and further studying the molecular mechanism of Pokemon on carcinogenesis of CRC.
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
hSSB1 regulates both the stability and the transcriptional activity of p53
Xu, Shuangbing; Wu, Yuanzhong; Chen, Qiong; Cao, Jingying; Hu, Kaishun; Tang, Jianjun; Sang, Yi; Lai, Fenju; Wang, Li; Zhang, Ruhua; Li, Sheng-Ping; Zeng, Yi-Xin; Yin, Yuxin; Kang, Tiebang
2012-01-01
The tumor suppressor p53 is essential for several cellular processes that are involved in the response to diverse genotoxic stress, including cell cycle arrest, DNA repair, apoptosis and senescence. Studies of the regulation of p53 have mostly focused on its stability and transactivation; however, new regulatory molecules for p53 have also been frequently identified. Here, we report that human ssDNA binding protein SSB1 (hSSB1), a novel DNA damage-associated protein, can interact with p53 and...
Palazzo, E; Kellett, M; Cataisson, C; Gormley, A; Bible, P W; Pietroni, V; Radoja, N; Hwang, J; Blumenberg, M; Yuspa, S H; Morasso, M I
2016-06-16
Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinguished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis.
Combination of Heavy-ion radiotherapy and p53-gene therapy by radio-sensitizing promoter for glioma
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2005-01-01
In this study we have investigated the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing promoter-E9ns-2/CMV chimeric promoter (Scott et al:2003) in p53-gene therapy. First, EGFP reporter gene with E9ns-2/CMV chimeric promoter was transfected in C6 rat glioma cell-line and the transfected-cell bulk was irradiated at dose of 3, 5, 10 Gy respectively with charged carbon particle (290 MeV/nucleon). The light upregulation of EGFP was observed in 24 hours after 5 Gy irradiation. On the basis of this result, p53 gene with E9ns-2/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 5 Gy. There was, however, no obvious p53-upregulation at any time-point, so far. Further investigation is needed to clarify the appropriate experimental system. (author)
International Nuclear Information System (INIS)
Alphonse, Gersende; Maalouf, Mira; Battiston-Montagne, Priscillia; Ardail, Dominique; Beuve, Michaël; Rousson, Robert; Taucher-Scholz, Gisela; Fournier, Claudia; Rodriguez-Lafrasse, Claire
2013-01-01
To determine whether ceramide is responsible for the induction of p53-independent early or late apoptosis in response to high- and low-Linear-Energy-Transfer (LET) irradiation. Four cell lines displaying different radiosensitivities and p53-protein status were irradiated with photons or 33.4 or 184 keV/μm carbon ions. The kinetics of ceramide production was quantified by fluorescent microscopy or High-Performance-Liquid-Chromatogaphy and the sequence of events leading to apoptosis by flow cytometry. Regardless of the p53-status, both low and high-LET irradiation induced an early ceramide production in radiosensitive cells and late in the radioresistant. This production strongly correlated with the level of early apoptosis in radiosensitive cells and delayed apoptosis in the radioresistant ones, regardless of radiation quality, tumor type, radiosensitivity, or p53-status. Inhibition of caspase activity or ceramide production showed that, for both types of radiation, ceramide is essential for the initiation of early apoptosis in radiosensitive cells and late apoptosis following mitotic catastrophe in radioresistant cells. Ceramide is a determining factor in the onset of early and late apoptosis after low and high-LET irradiation and is the mediator of the p53-independent-apoptotic pathway. We propose that ceramide is the molecular bridge between mitotic catastrophe and the commitment phase of delayed apoptosis in response to irradiation
Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio
2013-01-01
Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976
Restriction of human herpesvirus 6B replication by p53
DEFF Research Database (Denmark)
Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina
2008-01-01
Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...
Directory of Open Access Journals (Sweden)
Vladimir O. Pustylnyak
2015-01-01
Full Text Available Gene expression plays an important role in the mechanisms of long-term potentiation (LTP, which is a widely accepted experimental model of synaptic plasticity. We have studied the expression of at least 50 genes that are transcriptionally regulated by p53, as well as other genes that are related to p53-dependent processes, in the early phase of LTP. Within 30 min after Schaffer collaterals (SC tetanization, increases in the mRNA and protein levels of Bax, which are upregulated by p53, and a decrease in the mRNA and protein levels of Bcl2, which are downregulated by p53, were observed. The inhibition of Mdm2 by nutlin-3 increased the basal p53 protein level and rescued its tetanization-induced depletion, which suggested the involvement of Mdm2 in the control over p53 during LTP. Furthermore, nutlin-3 caused an increase in the basal expression of Bax and a decrease in the basal expression of Bcl2, whereas tetanization-induced changes in their expression were occluded. These results support the hypothesis that p53 may be involved in transcriptional regulation during the early phase of LTP. We hope that the presented data may aid in the understanding of the contribution of p53 and related genes in the processes that are associated with synaptic plasticity.
Tichy, Elisia D; Stephan, Zachary A; Osterburg, Andrew; Noel, Greg; Stambrook, Peter J
2013-05-01
Embryonic stem cells (ESCs) are hypersensitive to many DNA damaging agents and can rapidly undergo cell death or cell differentiation following exposure. Treatment of mouse ESCs (mESCs) with etoposide (ETO), a topoisomerase II poison, followed by a recovery period resulted in massive cell death with characteristics of a programmed cell death pathway (PCD). While cell death was both caspase- and necroptosis-independent, it was partially dependent on the activity of lysosomal proteases. A role for autophagy in the cell death process was eliminated, suggesting that ETO induces a novel PCD pathway in mESCs. Inhibition of p53 either as a transcription factor by pifithrin α or in its mitochondrial role by pifithrin μ significantly reduced ESC death levels. Finally, EndoG was newly identified as a protease participating in the DNA fragmentation observed during ETO-induced PCD. We coined the term charontosis after Charon, the ferryman of the dead in Greek mythology, to refer to the PCD signaling events induced by ETO in mESCs. Copyright © 2013 Elsevier B.V. All rights reserved.
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Buglioni, S; D'Agnano, I; Cosimelli, M; Vasselli, S; D'Angelo, C; Tedesco, M; Zupi, G; Mottolese, M
1999-12-22
About 40% of patients with colorectal carcinoma will develop local or distant tumour recurrences. Integrated analyses of bio-pathological markers, predictive of tumour aggressiveness, may offer a more rational approach to planning adjuvant therapy. To this end, we analysed the correlation between p53 accumulation, Bcl-2 expression, DNA ploidy, cell proliferation and conventional clinico-pathological parameters by testing the prognostic significance of these variables in a series of 171 colorectal carcinoma patients with long-term follow-up. The relationships among the various bio-pathological parameters, analysed by multiple correspondence analysis, showed 2 different clinico-biological profiles. The first, characterised by p53 negativity, Bcl-2 positivity, diploidy, low percentage of cells in S-phase (%S-phase), a low Ki-67 score, is associated with Dukes' A-B stage, well differentiated tumours and lack of relapse. The second, defined by p53 positivity, Bcl-2 negativity, aneuploidy, high %S-phase and elevated Ki-67 score, correlates with Dukes' C-D stage, poorly differentiated tumours and presence of relapse. When these parameters were examined according to Kaplan-Meier's method, significantly shorter disease-free (DFS) and overall survival (OS) were also observed in patients bearing p53 positive and Bcl-2 negative tumours, in Dukes' B stage. In multivariate analysis, p53 accumulation and Bcl-2 expression emerged as independent predictors of a worse and better clinical outcome, respectively. Our results indicate that, in colorectal adenocarcinomas, a biological profile, based on the combined evaluation of p53 and Bcl-2, may be useful for identifying high risk patients to be enrolled in an adjuvant setting, mainly in an early stage of the disease. Int. J. Cancer (Pred. Oncol.) 84:545-552, 1999. Copyright 1999 Wiley-Liss, Inc.
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Implication of p53-dependent cellular senescence related gene, TARSH in tumor suppression
International Nuclear Information System (INIS)
Wakoh, Takeshi; Uekawa, Natsuko; Terauchi, Kunihiko; Sugimoto, Masataka; Ishigami, Akihito; Shimada, Jun-ichi; Maruyama, Mitsuo
2009-01-01
A novel target of NESH-SH3 (TARSH) was identified as a cellular senescence related gene in mouse embryonic fibroblasts (MEFs) replicative senescence, the expression of which has been suppressed in primary clinical lung cancer specimens. However, the molecular mechanism underlying the regulation of TARSH involved in pulmonary tumorigenesis remains unclear. Here we demonstrate that the reduction of TARSH gene expression by short hairpin RNA (shRNA) system robustly inhibited the MEFs proliferation with increase in senescence-associated β-galactosidase (SA-β-gal) activity. Using p53 -/- MEFs, we further suggest that this growth arrest by loss of TARSH is evoked by p53-dependent p21 Cip1 accumulation. Moreover, we also reveal that TARSH reduction induces multicentrosome in MEFs, which is linked in chromosome instability and tumor development. These results suggest that TARSH plays an important role in proliferation of replicative senescence and may serve as a trigger of tumor development.
Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage
Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.
2018-01-01
Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532
International Nuclear Information System (INIS)
Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.
2014-01-01
Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach
Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku
2016-01-01
Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981
Buglioni, S; D'Agnano, I; Vasselli, S; Perrone Donnorso, R; D'Angelo, C; Brenna, A; Benevolo, M; Cosimelli, M; Zupi, G; Mottolese, M
2001-09-01
To identify the prognostically highest risk patients, DNA content and p53 nuclear or cytoplasmic accumulation, evaluated by monoclonal antibody DO7 and polyclonal antibody CM1, were determined in 94 surgically resected stage II (Dukes B2) colorectal cancers, treated or not with adjuvant 5-fluorouracil-based chemotherapy. Sixty-one (65%) of the tumors were aneuploid, 16 (17%) of which had a multiploid DNA content; 50 (53%) displayed DO7 nuclear p53 accumulation, and 44 (47%) showed cytoplasmic CM1 positivity. In multivariate analysis, only multiploidy and p53 nuclear positivity emerged as independent prognostic indicators of a poorer outcome. Positivity for p53 was associated with shorter survival in 5-fluorouracil-treated and untreated patients. Therefore, in patients with Dukes B2 colorectal cancer, a biologic profile based on the combined evaluation of DNA multiploidy and p53 status can provide valuable prognostic information, identifying patients to be enrolled in alternative, more aggressive therapeutic trials.
p53-Dependent radiation-induced apoptosis in vivo: relationship to Bcl-2 and Bax expression
International Nuclear Information System (INIS)
Hasegawa, Masatoshi; Suzuki, Yoshiyuki; Furuta, Masaya; Yamakawa, Michitaka; Maebayashi, Katsuya; Hayakawa, Kayoko; Saito, Yoshihiro; Mitsuhashi, Norio; Niibe, Hideo
1997-01-01
Purpose: A close correlation between p53 protein expression and radiation-induced apoptosis has already been reported, however, Bcl-2 and Bax expression and the ratio of Bcl-2 to Bax have been also suggested to play an important role in the regulation of apoptotic cell death. In this study, we investigated the relationship between p53-dependent radiation-induced apoptosis and expression of Bcl-2 and Bax by using human tumors transplanted into nude mice. Materials and Methods: Three human tumors (an ependymoblastoma, a glioblastoma, and a small cell lung cancer) were subcutaneously transplanted into nude mice and irradiated with single doses of 1, 2, 5, or 10 Gy. The tumors were excised 1, 3, 6, 12, 24, and 48 hours after irradiation, fixed in 10% formalin for 24 hours, and embedded in paraffin. Slides were stained with hematoxylin and eosin for morphologic examination. Immunohistochemical studies were performed with mouse monoclonal antibodies to demonstrate p53, p21 (WAF-1), Bcl-2, and Bax expression. TdT-mediated dUTP-biotin nick-end labeling (TUNEL) and electron microscopic studies were performed to identify apoptosis, and PCR-SSCP analysis was used to evaluate p53 gene mutation. Results: All of the tumors showed only a few cells undergoing apoptosis before irradiation. Beginning several hours after irradiation, only the ependymoblastoma showed a large increase in the number of cells undergoing apoptosis, peaking at 6 hours after irradiation, and there was a clear dose-effect relationship. In contrast, the other tumors showed much less change following irradiation, and the dose-effect relationship was not as clear as in the ependymoblastoma. Immunohistochemically, the non-irradiated ependymoblastoma was negative for p53, p21, Bcl-2, and Bax. Following irradiation, however, many of the tumor cells became positive for p53 and p21, and a few cells became positive for bcl-2. In contrast, the glioblastoma and the small cell lung cancer were positive for p53 and Bcl-2
Mutant p53 drives cancer by subverting multiple tumour suppression pathways
Directory of Open Access Journals (Sweden)
Sue eHaupt
2016-01-01
Full Text Available The tumour suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counter-productively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins (including many transcription factors, which normally partner with its wild type, tumour-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism and corrupt them to become cancer promoting.
Human herpesvirus 6B inhibits cell proliferation by a p53-independent pathway
DEFF Research Database (Denmark)
Øster, Bodil; Kaspersen, M.D.; Kofod-Olsen, Emil
2006-01-01
BACKGROUND: Various forms of cellular stress can activate the tumour suppressor protein p53, an important regulator of cell cycle arrest, apoptosis, and cellular senescence. Cells infected by human herpesvirus 6B (HHV-6B) accumulate aberrant amounts of p53. OBJECTIVES: The aim of this study...
Neem oil limonoids induces p53-independent apoptosis and autophagy.
Srivastava, Pragya; Yadav, Neelu; Lella, Ravi; Schneider, Andrea; Jones, Anthony; Marlowe, Timothy; Lovett, Gabrielle; O'Loughlin, Kieran; Minderman, Hans; Gogada, Raghu; Chandra, Dhyan
2012-11-01
Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells.
Neem oil limonoids induces p53-independent apoptosis and autophagy
Chandra, Dhyan
2012-01-01
Azadirachta indica, commonly known as neem, has a wide range of medicinal properties. Neem extracts and its purified products have been examined for induction of apoptosis in multiple cancer cell types; however, its underlying mechanisms remain undefined. We show that neem oil (i.e., neem), which contains majority of neem limonoids including azadirachtin, induced apoptotic and autophagic cell death. Gene silencing demonstrated that caspase cascade was initiated by the activation of caspase-9, whereas caspase-8 was also activated late during neem-induced apoptosis. Pretreatment of cancer cells with pan caspase inhibitor, z-VAD inhibited activities of both initiator caspases (e.g., caspase-8 and -9) and executioner caspase-3. Neem induced the release of cytochrome c and apoptosis-inducing factor (AIF) from mitochondria, suggesting the involvement of both caspase-dependent and AIF-mediated apoptosis. p21 deficiency caused an increase in caspase activities at lower doses of neem, whereas p53 deficiency did not modulate neem-induced caspase activation. Additionally, neem treatment resulted in the accumulation of LC3-II in cancer cells, suggesting the involvement of autophagy in neem-induced cancer cell death. Low doses of autophagy inhibitors (i.e., 3-methyladenine and LY294002) did not prevent accumulation of neem-induced LC3-II in cancer cells. Silencing of ATG5 or Beclin-1 further enhanced neem-induced cell death. Phosphoinositide 3-kinase (PI3K) or autophagy inhibitors increased neem-induced caspase-3 activation and inhibition of caspases enhanced neem-induced autophagy. Together, for the first time, we demonstrate that neem induces caspase-dependent and AIF-mediated apoptosis, and autophagy in cancer cells. PMID:22915764
Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.
Stępiński, Dariusz
2016-08-01
Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.
Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription.
Directory of Open Access Journals (Sweden)
Goran Periz
2015-04-01
Full Text Available Protein quality control is essential for clearing misfolded and aggregated proteins from the cell, and its failure is associated with many neurodegenerative disorders. Here, we identify two genes, ufd-2 and spr-5, that when inactivated, synergistically and robustly suppress neurotoxicity associated with misfolded proteins in Caenorhabditis elegans. Loss of human orthologs ubiquitination factor E4 B (UBE4B and lysine-specific demethylase 1 (LSD1, respectively encoding a ubiquitin ligase and a lysine-specific demethylase, promotes the clearance of misfolded proteins in mammalian cells by activating both proteasomal and autophagic degradation machineries. An unbiased search in this pathway reveals a downstream effector as the transcription factor p53, a shared substrate of UBE4B and LSD1 that functions as a key regulator of protein quality control to protect against proteotoxicity. These studies identify a new protein quality control pathway via regulation of transcription factors and point to the augmentation of protein quality control as a wide-spectrum antiproteotoxicity strategy.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
International Nuclear Information System (INIS)
Oga, Masaru; Koshikawa, Nobuko; Takenaga, Keizo; Iwadate, Yasuo; Nojima, Kumie
2006-01-01
In this study we have started to investigate the anti-tumor effect of the combination of heavy-ion radiotherapy, inducing p53-independent apoptosis, and p53-gene therapy, inducing p53-dependent apoptosis for glioma. To enhance the p53-dependent apoptosis, we chose the strategy to utilize the heavy-ion irradiation itself as a ''trigger'' by using radio-sensitizing E 9ns-2 /cytomegalovirus (CMV) chimeric promoter (Scott et al: 2003) in p53-gene therapy. Our study in the first year, however, suggested the uselessness of E 9ns-2 /CMV chimeric promoter. Then we applied E 9ns-2 /Epo5/CMV-radio and hypoxia-sensitizing chimeric promoter to amplify p53 gene exopression. P53 gene with E 9ns2 /Epo5/CMV chimeric promoter was transfected in p53-mutant U373MG human glioma cell-line and the transfected-cell bulk was irradiated at dose of 1 Gy of high linear energy transfer (LET)-carbon ion beam or low-LET X-ray under various hypoxic conditions. The result suggested the possible role of 1 Gy of high LET-carbon ion beam as a ''useful trigger'' to enhance a selective anti-tumor effect toward glioma under hypoxic condition through amplification of p53 gene expression. (author)
Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function
International Nuclear Information System (INIS)
Lieber, Charles S.; Leo, Maria Anna; Wang, Xiaolei; DeCarli, Leonore M.
2008-01-01
Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-γ coactivator1α (PGC-1α). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (p = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1α hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
International Nuclear Information System (INIS)
Wang, Bing; Ohyama, Harumi; Nose, Masako; Yukawa, Osami; Yamada, Takeshi; Hayata, Isamu
2003-01-01
In the past 5 years, a series of study was done at our institute to investigate radiation effects on the embryogenesis in mice with an emphasis on mechanisms involved in the radiation-induced adaptive response and the role of radiation-induced apoptosis played in teratogenesis in the late period of organogenesis. Using the limb bud system, we first found that radiation-induced apoptosis is involved in malformations, namely, radiation-induced apoptosis in the predigital regions of embryonic limb buds is responsible for digital defects in ICR mice. Examination of embryonic C57BL/6J mice with different p53 status led to further finding that susceptibility to the radiation-induced apoptosis and digital defects depends on both the p53 status and the radiation dose. p53 wild-type mice appeared to be the most sensitive, while p53 knockout mice were the most resistant. These results indicate that p53-dependent apoptosis mediates radiation-induced digital defects. The existence of a radioadaptive response in fetuses, i.e., the priming dose significantly decreases the apoptosis induction, prenatal death, and digital defects in the living fetuses induced by the challenging dose, was found first in ICR strain mice and later confirmed again in C57BL/6J mice. p53 heterozygous embryos did not show the radioadaptive response, indicating the involvement of p53 in the radioadaptive response. (author)
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
International Nuclear Information System (INIS)
Verheyde, J.
2007-01-01
radiation exposure. The Trp53 null mutants at this stage exhibited a decreased expression profile for various Cyclins and Cyclin-dependent kinases, suggesting the induction of a Trp53 independent cell cycle arrest. The observed absence of high levels of apoptosis is in concordance with the described phenotype of Trp53 null mutant mice that show an increased risk for tumour formation. Next, we questioned if the developing brain is characterized by a regional dependent differences on radiation sensitivity. Therefore, additional transcriptional analyses of the different regions (hippocampus, pallidal neuroepithelium and cortex of control and irradiated brain embryos) of the ventral wild type brain at E15 were performed. In these three regions of the developing brain, the differential expression of Trp53inp1 and Ccng1 by in situ hybridization suggested that the ventral brain shows a specific regional dependent expression pattern. This was further evidenced by real time qPCR, by which it also became clear that the strongest radiation induced effect can be observed in the cerebral cortex. However, this experiment didn't allow making a distinction between neural cells in this experiment, and different cell types contribute to correct neural network formation. Detailed analysis of cultured and irradiated neural cell types indicated that the expression of the Trp53inp1/Hipk2 and Ccng1/Mdm2/P19Arf signalling pathways are activated in a cell-type dependent matter. From this data it appears that, depending on the cell type and the stage of differentiation, two possible mechanisms for the induction of apoptosis are activated. In one hand cell cycle arrest occurs via P21 (Cdkn1a) induction and to certain extends via P19ARF in the mitotic astrocytes, while in short-term neurons this mechanism seems to be preferentially induced by Cyclin G1. This arrest is then followed by the induction of the mitochondrial proapoptotic pathway. Interestingly, long term cultured neurons show also an
Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M
2014-01-01
Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714
The transcription factor Nerfin-1 prevents reversion of neurons into neural stem cells.
Froldi, Francesca; Szuperak, Milan; Weng, Chen-Fang; Shi, Wei; Papenfuss, Anthony T; Cheng, Louise Y
2015-01-15
Cellular dedifferentiation is the regression of a cell from a specialized state to a more multipotent state and is implicated in cancer. However, the transcriptional network that prevents differentiated cells from reacquiring stem cell fate is so far unclear. Neuroblasts (NBs), the Drosophila neural stem cells, are a model for the regulation of stem cell self-renewal and differentiation. Here we show that the Drosophila zinc finger transcription factor Nervous fingers 1 (Nerfin-1) locks neurons into differentiation, preventing their reversion into NBs. Following Prospero-dependent neuronal specification in the ganglion mother cell (GMC), a Nerfin-1-specific transcriptional program maintains differentiation in the post-mitotic neurons. The loss of Nerfin-1 causes reversion to multipotency and results in tumors in several neural lineages. Both the onset and rate of neuronal dedifferentiation in nerfin-1 mutant lineages are dependent on Myc- and target of rapamycin (Tor)-mediated cellular growth. In addition, Nerfin-1 is required for NB differentiation at the end of neurogenesis. RNA sequencing (RNA-seq) and chromatin immunoprecipitation (ChIP) analysis show that Nerfin-1 administers its function by repression of self-renewing-specific and activation of differentiation-specific genes. Our findings support the model of bidirectional interconvertibility between neural stem cells and their post-mitotic progeny and highlight the importance of the Nerfin-1-regulated transcriptional program in neuronal maintenance. © 2015 Froldi et al.; Published by Cold Spring Harbor Laboratory Press.
Directory of Open Access Journals (Sweden)
Ajay Kumar
Full Text Available Minnelide/Triptolide (TL has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC. However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS. Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2, along with diminished cellular glutathione (GSH content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC. TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y, restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.
Energy Technology Data Exchange (ETDEWEB)
Armesilla-Diaz, Alejandro, E-mail: aarmesilla@cib.csic.es [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain); Elvira, Gema; Silva, Augusto [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain)
2009-12-10
Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.
Directory of Open Access Journals (Sweden)
Kiran Hasygar
2014-11-01
Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.
Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals
Directory of Open Access Journals (Sweden)
Yasuhito Ohsaka
2010-01-01
Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
A systematic review of p53 regulation of oxidative stress in skeletal muscle.
Beyfuss, Kaitlyn; Hood, David A
2018-12-01
transcription factor 4; ATM: ATM serine/threonine kinase; Bax: BCL2 associated X, apoptosis regulator; Bcl-2: B cell Leukemia/Lymphoma 2 apoptosis regulator; Bhlhe40: basic helix-loop-helix family member e40; BH3: Borane; Bim: bcl-2 interacting mediator of cell death; Bok: Bcl-2 related ovarian killer; COX-IV: cytochrome c oxidase IV; cGMP: Cyclic guanosine monophosphate; c-myc: proto-oncogene protein; Cpt1b: carnitine palmitoyltransferase 1B; Dr5: death receptor 5; eNOS: endothelial nitric oxide synthase; ERK: extracellular regulated MAP kinase; Fas: Fas Cell surface death receptor; FDXR: Ferredoxin Reductase; FOXO3a: forkhead box O3; Gadd45a: growth arrest and DNA damage-inducible 45 alpha; GLS2: glutaminase 2; GLUT 1 and 4: glucose transporter 1(endothelial) and 4 (skeletal muscle); GSH: Glutathione; Hes1: hes family bHLH transcription factor 1; Hey1: hes related family bHLH transcription factor with YRPW motif 1; HIFI-α: hypoxia-inducible factor 1, α-subunit; HK2: Hexokinase 2; HSP70: Heat Shock Protein 70; H 2 O 2 : Hydrogen Peroxide; Id2: inhibitor of DNA-binding 2; IGF-1-BP3: Insulin-like growth factor binding protein 3; IL-1β: Interleukin 1 beta; iNOS: inducible nitric oxide synthase; IRS-1: Insulin receptor substrate 1; JNK: c-Jun N-terminal kinases; LY-83583: 6-anilino-5,8-quinolinedione; inhibitor of soluble guanylate cyclase and of cGMP production; Mdm 2/ 4: Mouse double minute 2 homolog (mouse) Mdm4 (humans); mtDNA: mitochondrial DNA; MURF1: Muscle RING-finger protein-1; MyoD: Myogenic differentiation 1; MyoG: myogenin; Nanog: Nanog homeobox; NF-kB: Nuclear factor-κB; NO: nitric oxide; NoxA: phorbol-12-myristate-13-acetate-induced protein 1 (Pmaip1); NRF-1: nuclear respiratory factor 1; Nrf2: Nuclear factor erythroid 2-related factor 2; P21: Cdkn1a cyclin-dependent kinase inhibitor 1A (P21); P38 MAPK: mitogen-activated protein kinases; p53R2: p53 inducible ribonucleotide reductase gene; P66Shc: src homology 2 domain-containing transforming protein C1; PERP: p
Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore
2017-01-01
Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426
ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.
Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya
2013-01-01
ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.
Kim, Jusik; Choi, Inseo; Lee, Youngsoo
2017-11-01
Maintenance of genomic integrity is one of the critical features for proper neurodevelopment and inhibition of neurological diseases. The signals from both ATM and ATR to TP53 are well-known mechanisms to remove neural cells with DNA damage during neurogenesis. Here we examined the involvement of Atm and Atr in genomic instability due to Terf2 inactivation during mouse brain development. Selective inactivation of Terf2 in neural progenitors induced apoptosis, resulting in a complete loss of the brain structure. This neural loss was rescued partially in both Atm and Trp53 deficiency, but not in an Atr-deficient background in the mouse. Atm inactivation resulted in incomplete brain structures, whereas p53 deficiency led to the formation of multinucleated giant neural cells and the disruption of the brain structure. These giant neural cells disappeared in Lig4 deficiency. These data demonstrate ATM and TP53 are important for the maintenance of telomere homeostasis and the surveillance of telomere dysfunction during neurogenesis.
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Fukushi, Saori; Yoshino, Hironori; Yoshizawa, Atsushi; Kashiwakura, Ikuo
2016-07-25
We recently demonstrated the cytotoxicity of liquid crystal precursors (hereafter referred to as "mesogenic compounds") in the human non-small cell lung cancer (NSCLC) cell line A549 which carry wild-type p53. p53 mutations are observed in 50 % of NSCLC and contribute to their resistance to chemotherapy. To develop more effective and cancer-specific agents, in this study, we investigated the structure-activity relationships of mesogenic compounds with cytotoxic effects against multiple NSCLC cells. The pharmacological effects of mesogenic compounds were examined in human NSCLC cells (A549, LU99, EBC-1, and H1299) and normal WI-38 human fibroblast. Analyses of the cell cycle, cell-death induction, and capsases expression were performed. The 3-ring compounds possessing terminal alkyl and hydroxyl groups (compounds C1-C5) showed cytotoxicity in NSCLC cells regardless of the p53 status. The compounds C1 and C3, which possess a pyrimidine at the center of the core, induced G2/M arrest, while the compounds without a pyrimidine (C2, C4, and C5) caused G1 arrest; all compounds produced caspase-mediated cell death. These events occurred in a p53-independent manner. Furthermore, it was suggested that compounds induced cell death through p53-independent DNA damage-signaling pathway. Compounds C2, C4, and C5 did not show strong cytotoxicity in WI-38 cells, whereas C1 and C3 did. However, the cytotoxicity of compound C1 against WI-38 cells was improved by modulating the terminal alkyl chain lengths of the compound. We showed the p53-indepdent structure-activity relationships of mesogenic compounds related to the cytotoxic effects. These structure-activity relationships will be helpful in the development of more effective and cancer-specific agents.
Directory of Open Access Journals (Sweden)
Yuen Ngan Fan
Full Text Available Chemotherapeutic drug resistance and relapse remains a major challenge for paediatric (medulloblastoma and adult (glioblastoma brain tumour treatment. Medulloblastoma tumours and cell lines with mutations in the p53 signalling pathway have been shown to be specifically insensitive to DNA damaging agents. The aim of this study was to investigate the potential of triggering cell death in p53 mutated medulloblastoma cells by a direct activation of pro-death signalling downstream of p53 activation. Since non-coding microRNAs (miRNAs have the ability to fine tune the expression of a variety of target genes, orchestrating multiple downstream effects, we hypothesised that triggering the expression of a p53 target miRNA could induce cell death in chemo-resistant cells. Treatment with etoposide, increased miR-34a levels in a p53-dependent fashion and the level of miR-34a transcription was correlated with the cell sensitivity to etoposide. miR-34a activity was validated by measuring the expression levels of one of its well described target: the NADH dependent sirtuin1 (SIRT1. Whilst drugs directly targeting SIRT1, were potent to trigger cell death at high concentrations only, introduction of synthetic miR-34a mimics was able to induce cell death in p53 mutated medulloblastoma and glioblastoma cell lines. Our results show that the need of a functional p53 signaling pathway can be bypassed by direct activation of miR-34a in brain tumour cells.
p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer
DEFF Research Database (Denmark)
Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F
2014-01-01
The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....
Serrano, M A; Li, Z; Dangeti, M; Musich, P R; Patrick, S; Roginskaya, M; Cartwright, B; Zou, Y
2013-05-09
Homologous recombination (HR) and nonhomologous end joining (NHEJ) are two distinct DNA double-stranded break (DSB) repair pathways. Here, we report that DNA-dependent protein kinase (DNA-PK), the core component of NHEJ, partnering with DNA-damage checkpoint kinases ataxia telangiectasia mutated (ATM) and ATM- and Rad3-related (ATR), regulates HR repair of DSBs. The regulation was accomplished through modulation of the p53 and replication protein A (RPA) interaction. We show that upon DNA damage, p53 and RPA were freed from a p53-RPA complex by simultaneous phosphorylations of RPA at the N-terminus of RPA32 subunit by DNA-PK and of p53 at Ser37 and Ser46 in a Chk1/Chk2-independent manner by ATR and ATM, respectively. Neither the phosphorylation of RPA nor of p53 alone could dissociate p53 and RPA. Furthermore, disruption of the release significantly compromised HR repair of DSBs. Our results reveal a mechanism for the crosstalk between HR repair and NHEJ through the co-regulation of p53-RPA interaction by DNA-PK, ATM and ATR.
He, Mingyuan; Dong, Chen; Konishi, Teruaki; Tu, Wenzhi; Liu, Weili; Shiomi, Naoko; Kobayashi, Alisa; Uchihori, Yukio; Furusawa, Yoshiya; Hei, Tom K.; Dang, Bingrong; Shao, Chunlin
2014-04-01
High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.
YAP/TAZ enhance mammalian embryonic neural stem cell characteristics in a Tead-dependent manner
Energy Technology Data Exchange (ETDEWEB)
Han, Dasol; Byun, Sung-Hyun; Park, Soojeong; Kim, Juwan; Kim, Inhee; Ha, Soobong; Kwon, Mookwang; Yoon, Keejung, E-mail: keejung@skku.edu
2015-02-27
Mammalian brain development is regulated by multiple signaling pathways controlling cell proliferation, migration and differentiation. Here we show that YAP/TAZ enhance embryonic neural stem cell characteristics in a cell autonomous fashion using diverse experimental approaches. Introduction of retroviral vectors expressing YAP or TAZ into the mouse embryonic brain induced cell localization in the ventricular zone (VZ), which is the embryonic neural stem cell niche. This change in cell distribution in the cortical layer is due to the increased stemness of infected cells; YAP-expressing cells were colabeled with Sox2, a neural stem cell marker, and YAP/TAZ increased the frequency and size of neurospheres, indicating enhanced self-renewal- and proliferative ability of neural stem cells. These effects appear to be TEA domain family transcription factor (Tead)–dependent; a Tead binding-defective YAP mutant lost the ability to promote neural stem cell characteristics. Consistently, in utero gene transfer of a constitutively active form of Tead2 (Tead2-VP16) recapitulated all the features of YAP/TAZ overexpression, and dominant negative Tead2-EnR resulted in marked cell exit from the VZ toward outer cortical layers. Taken together, these results indicate that the Tead-dependent YAP/TAZ signaling pathway plays important roles in neural stem cell maintenance by enhancing stemness of neural stem cells during mammalian brain development. - Highlights: • Roles of YAP and Tead in vivo during mammalian brain development are clarified. • Expression of YAP promotes embryonic neural stem cell characteristics in vivo in a cell autonomous fashion. • Enhancement of neural stem cell characteristics by YAP depends on Tead. • Transcriptionally active form of Tead alone can recapitulate the effects of YAP. • Transcriptionally repressive form of Tead severely reduces stem cell characteristics.
YAP/TAZ enhance mammalian embryonic neural stem cell characteristics in a Tead-dependent manner
International Nuclear Information System (INIS)
Han, Dasol; Byun, Sung-Hyun; Park, Soojeong; Kim, Juwan; Kim, Inhee; Ha, Soobong; Kwon, Mookwang; Yoon, Keejung
2015-01-01
Mammalian brain development is regulated by multiple signaling pathways controlling cell proliferation, migration and differentiation. Here we show that YAP/TAZ enhance embryonic neural stem cell characteristics in a cell autonomous fashion using diverse experimental approaches. Introduction of retroviral vectors expressing YAP or TAZ into the mouse embryonic brain induced cell localization in the ventricular zone (VZ), which is the embryonic neural stem cell niche. This change in cell distribution in the cortical layer is due to the increased stemness of infected cells; YAP-expressing cells were colabeled with Sox2, a neural stem cell marker, and YAP/TAZ increased the frequency and size of neurospheres, indicating enhanced self-renewal- and proliferative ability of neural stem cells. These effects appear to be TEA domain family transcription factor (Tead)–dependent; a Tead binding-defective YAP mutant lost the ability to promote neural stem cell characteristics. Consistently, in utero gene transfer of a constitutively active form of Tead2 (Tead2-VP16) recapitulated all the features of YAP/TAZ overexpression, and dominant negative Tead2-EnR resulted in marked cell exit from the VZ toward outer cortical layers. Taken together, these results indicate that the Tead-dependent YAP/TAZ signaling pathway plays important roles in neural stem cell maintenance by enhancing stemness of neural stem cells during mammalian brain development. - Highlights: • Roles of YAP and Tead in vivo during mammalian brain development are clarified. • Expression of YAP promotes embryonic neural stem cell characteristics in vivo in a cell autonomous fashion. • Enhancement of neural stem cell characteristics by YAP depends on Tead. • Transcriptionally active form of Tead alone can recapitulate the effects of YAP. • Transcriptionally repressive form of Tead severely reduces stem cell characteristics
Directory of Open Access Journals (Sweden)
Somayeh Khazaei
2017-01-01
Full Text Available Breast cancer is the second leading cause of cancer death among women and despite significant advances in therapy, it remains a critical health problem worldwide. Allium atroviolaceum is an herbaceous plant, with limited information about the therapeutic capability. We aimed to study the anticancer effect of flower extract and the mechanisms of action in MCF-7 and MDA-MB-231. The extract inhibits the proliferation of the cells in a time- and dose-dependent manner. The underlying mechanism involved the stimulation of S and G2/M phase arrest in MCF-7 and S phase arrest in MDA-MB-231 associated with decreased level of Cdk1, in a p53-independent pathway. Furthermore, the extract induces apoptosis in both cell lines, as indicated by the percentage of sub-G0 population, the morphological changes observed by phase contrast and fluorescent microscopy, and increase in Annexin-V-positive cells. The apoptosis induction was related to downregulation of Bcl-2 and also likely to be caspase-dependent. Moreover, the combination of the extract and tamoxifen exhibits synergistic effect, suggesting that it can complement current chemotherapy. LC-MS analysis displayed 17 major compounds in the extract which might be responsible for the observed effects. Overall, this study demonstrates the potential applications of Allium atroviolaceum extract as an anticancer drug for breast cancer treatment.
Directory of Open Access Journals (Sweden)
Peng Zhang
2014-03-01
Full Text Available Hypoxia-inducible factors (HIFs play key roles in the cellular response to hypoxia. It is widely accepted that whereas HIF-1 and HIF-2 function as transcriptional activators, HIF-3 inhibits HIF-1/2α action. Contrary to this idea, we show that zebrafish Hif-3α has strong transactivation activity. Hif-3α is degraded under normoxia. Mutation of P393, P493, and L503 inhibits this oxygen-dependent degradation. Transcriptomics and chromatin immunoprecipitation analyses identify genes that are regulated by Hif-3α, Hif-1α, or both. Under hypoxia or when overexpressed, Hif-3α binds to its target gene promoters and upregulates their expression. Dominant-negative inhibition and knockdown of Hif-3α abolish hypoxia-induced Hif-3α-promoter binding and gene expression. Hif-3α not only mediates hypoxia-induced growth and developmental retardation but also possesses hypoxia-independent activities. Importantly, transactivation activity is conserved and human HIF-3α upregulates similar genes in human cells. These findings suggest that Hif-3 is an oxygen-dependent transcription factor and activates a distinct transcriptional response to hypoxia.
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Distinct HIC1-SIRT1-p53 Loop Deregulation in Lung Squamous Carcinoma and Adenocarcinoma Patients
Directory of Open Access Journals (Sweden)
Ruo-Chia Tseng
2009-08-01
Full Text Available A HIC1-SIRT1-p53 circular loop in which hypermethylation in cancer 1 (HIC1 represses the transcription of SIRT1 that deacetylates and inactivates p53 thus leading to HIC1 inactivation has been identified in cell and animal models. However, the alteration and prognostic effects of HIC1-SIRT1-p53 circular loop have never been demonstrated in human cancer patients. We examine the HIC1-SIRT1-p53 alterations in 118 lung cancer patients to define their etiological roles in tumorigenesis. We found that patients with lung squamous cell carcinoma with low p53 acetylation and SIRT1 expression mostly showed low HIC1 expression, confirming deregulation of HIC1-SIRT1-p53 circular loop in the clinical model. Interestingly, the expression of deleted in breast cancer 1 (DBC1, which blocks the interaction between SIRT1 deacetylase and p53, led to acetylated p53 in patients with lung adenocarcinoma. However, epigenetic alteration of HIC1 promoter by posttranslational modifications of histones and promoter hypermethylation favoring the compacted chromatin production attenuated the transcriptional induction by acetylated p53. Importantly, lung cancer patients with altered HIC1-SIRT1-p53 circular regulation showed poor prognosis. Our data show the first valid clinical evidence of the deregulation of HIC1-SIRT1-p53 loop in lung tumorigenesis and prognosis. Distinct status of p53 acetylation/deacetylation and HIC1 alteration mechanism result from different SIRT1-DBC1 control and epigenetic alteration in lung squamous cell carcinoma and lung adenocarcinoma.
Radiosensitivity of cancer cells against carbon-ion beams in an aspect of the p53 gene status
International Nuclear Information System (INIS)
Takahashi, Akihisa; Ohnishi, Takeo; Matsumoto, Hideki
2004-01-01
We can easily understand that radiation sensitivities of cancer cells are dependent on the status of cancer-related genes. It is important to clarify which genes affect radiation sensitivity and reflect the effectiveness of radiation therapy for cancer cells. We have studied about the function of a tumor suppressor gene of p53, because p53 controls apoptosis, cell cycle and DNA repair from an aspect of important roles in cell fate. By analysis of function of p53 gene, therefore, we aim to predict the therapeutic effectiveness and to select the modalities of cancer therapies such as radiotherapy, chemotherapy and hyperthermia. As a final goal, we want to accept the most effective therapy, namely tailor-made cancer therapy, for each patient. Here, we introduce that carbon-beam therapy induced the expression of p53-independent apoptosis-related genes and NO radicals in mutated p53 cancer cells. (author)
Super p53 for Treatment of Ovarian Cancer
2017-09-01
position, policy or decision unless so designated by other documentation. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public...a lead construct. Technical skills gained in the proposal include cell culture , transfections, microscopy, apoptosis assays, transcriptional assays...experiments complete 100% (DOD) Specific Aim 2: Deliver super p53 DNA with advanced polymeric systems alone and in combination with CPTX first in vitro
Directory of Open Access Journals (Sweden)
Ben Stocks
2017-12-01
Full Text Available Tumour protein 53 (p53 has been implicated in the regulation of mitochondrial biogenesis in skeletal muscle, with whole-body p53 knockout mice displaying impairments in basal mitochondrial content, respiratory capacity, and enzyme activity. This study aimed to determine the effect of skeletal muscle-specific loss of p53 on mitochondrial content and enzyme activity. Mitochondrial protein content, enzyme activity and mRNA profiles were assessed in skeletal muscle of 8-week-old male muscle fibre-specific p53 knockout mice (p53 mKO and floxed littermate controls (WT under basal conditions. p53 mKO and WT mice displayed similar content of electron transport chain proteins I-V and citrate synthase enzyme activity in skeletal muscle. In addition, the content of proteins regulating mitochondrial morphology (MFN2, mitofillin, OPA1, DRP1, FIS1, fatty acid metabolism (β-HAD, ACADM, ACADL, ACADVL, carbohydrate metabolism (HKII, PDH, energy sensing (AMPKα2, AMPKβ2, and gene transcription (NRF1, PGC-1α, and TFAM were comparable in p53 mKO and WT mice (p > 0.05. Furthermore, p53 mKO mice exhibited normal mRNA profiles of targeted mitochondrial, metabolic and transcriptional proteins (p > 0.05. Thus, it appears that p53 expression in skeletal muscle fibres is not required to develop or maintain mitochondrial protein content or enzyme function in skeletal muscle under basal conditions.
Directory of Open Access Journals (Sweden)
Kazuho Nishimura
2015-03-01
Full Text Available The 5S ribonucleoprotein particle (RNP complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Ets-2 and p53 mediate cAMP-induced MMP-2 expression, activity and trophoblast invasion
Directory of Open Access Journals (Sweden)
Goldman Shlomit
2009-11-01
Full Text Available Abstract Background We have previously shown that Matrix metalloproteinase (MMP -2 is a key-enzyme in early trophoblast invasion and that Protein Kinase A (PKA increases MMP-2 expression and trophoblast invasion. The aim of this study was to examine MMP -2 regulation by PKA in invasive trophoblasts: JAR choriocarcinoma cell-line and 6-8 w first trimester trophoblasts. Methods The effect of Forskolin (PKA on MMP-2 expression was assessed by Northern Blot and RT-PCR. Possible transcription factors binding to consensus MMP-2 promoter sequences in response to Forskolin, were detected by EMSA binding assay and their expression assessed by western blot analysis. Antisense transfection of relevant transcription factors was performed and the inhibitory effect assessed on MMP-2 expression (RT-PCR, secretion (zymography and trophoblast invasiveness (transwell migration assay. Results We found that Forskolin increased MMP-2 mRNA in JAR cells within 24 hours, and induced binding to p53, Ets, C/EBP and AP-2. Transcription factors Ets-2, phospho- p53, C/EBP epsilon, C/EBP lambda and AP-2 alpha bound to their respective binding sequences in response to Forskolin and the expressions of these transcription factors were all elevated in Forskolin- treated cells. Inhibition of Ets-2 and p53 reduced MMP-2 expression, secretion and invasiveness of Forskolin treated cells. Conclusion MMP-2 is regulated by PKA through several binding sites and transcription factors including Ets-2, p53, C/EBP, C/EBP lambda and AP-2 alpha. Ets-2 and p53 mediate cAMP- induced trophoblast invasiveness, through regulation of MMP-2.
Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage.
Directory of Open Access Journals (Sweden)
Chengwan Zhang
Full Text Available UTX is known as a general factor that activates gene transcription during development. Here, we demonstrate an additional essential role of UTX in the DNA damage response, in which it upregulates the expression of ku80 in Drosophila, both in cultured cells and in third instar larvae. We further showed that UTX mediates the expression of ku80 by the demethylation of H3K27me3 at the ku80 promoter upon exposure to ionizing radiation (IR in a p53-dependent manner. UTX interacts physically with p53, and both UTX and p53 are recruited to the ku80 promoter following IR exposure in an interdependent manner. In contrast, the loss of utx has little impact on the expression of ku70, mre11, hid and reaper, suggesting the specific regulation of ku80 expression by UTX. Thus, our findings further elucidate the molecular function of UTX.
Directory of Open Access Journals (Sweden)
Kateřina Cetkovská
Full Text Available Williams-Beuren syndrome-associated transcription factor TFII-I plays a critical regulatory role in bone and neural tissue development and in immunity, in part by regulating cell proliferation in response to mitogens. Mdm2, a cellular oncogene responsible for the loss of p53 tumor suppressor activity in a significant proportion of human cancers, was identified in this study as a new binding partner for TFII-I and a negative regulator of TFII-I-mediated transcription. These findings suggest a new p53-independent mechanism by which increased Mdm2 levels found in human tumors could influence cancer cells. In addition to that, we present data indicating that TFII-I is an important cellular regulator of transcription from the immediate-early promoter of human cytomegalovirus, a promoter sequence frequently used in mammalian expression vectors, including vectors for gene therapy. Our observation that Mdm2 over-expression can decrease the ability of TFII-I to activate the CMV promoter might have implications for the efficiency of experimental gene therapy based on CMV promoter-derived vectors in cancers with Mdm2 gene amplification.
Directory of Open Access Journals (Sweden)
Raúl Esteban Ithuralde
Full Text Available Disordered regions and Intrinsically Disordered Proteins (IDPs are involved in critical cellular processes and may acquire a stable three-dimensional structure only upon binding to their partners. IDPs may follow a folding-after-binding process, known as induced folding, or a folding-before-binding process, known as conformational selection. The transcription factor p53 is involved in the regulation of cellular events that arise upon stress or DNA damage. The p53 domain structure is composed of an N-terminal transactivation domain (p53TAD, a DNA Binding Domain and a tetramerization domain. The activity of TAD is tightly regulated by interactions with cofactors, inhibitors and phosphorylation. To initiate transcription, p53TAD binds to the TAZ2 domain of CBP, a co-transcription factor, and undergoes a folding and binding process, as revealed by the recent NMR structure of the complex. The activity of p53 is regulated by phosphorylation at multiple sites on the TAD domain and recent studies have shown that modifications at three residues affect the binding towards TAZ2. However, we still do not know how these phosphorylations affect the structure of the bound state and, therefore, how they regulate the p53 function. In this work, we have used computational simulations to understand how phosphorylation affects the structure of the p53TAD:TAZ2 complex and regulates the recognition mechanism. Phosphorylation has been proposed to enhance binding by direct interaction with the folded protein or by changing the unbound conformation of IDPs, for example by pre-folding the protein favoring the recognition mechanism. Here, we show an interesting turn in the p53 case: phosphorylation mainly affects the bound structure of p53TAD, highlighting the complexity of IDP protein-protein interactions. Our results are in agreement with previous experimental studies, allowing a clear picture of how p53 is regulated by phosphorylation and giving new insights into how
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
Nitrous oxide discretely up-regulates nNOS and p53 in neonatal rat brain.
Cattano, D; Valleggi, S; Abramo, A; Forfori, F; Maze, M; Giunta, F
2010-06-01
Animal studies suggest that neuronal cell death often results from anesthetic administration during synaptogenesis. Volatile anesthetics are strongly involved in triggering neuronal apoptosis, whereas other inhalational agents (xenon) demonstrate protective effects. Nitrous oxide (N2O) has modest pro-apoptotic effects on its own and potent, synergistic toxic effects when combined with volatile agents. Recent findings suggest that, during periods of rapid brain development, the enhanced neurodegeneration triggered by anesthetic drugs may be caused by a compensatory increase in intracellular free calcium, a potent activator of neuronal nitric oxide synthase (nNOS). Anesthesia-induced neuro-apoptosis is also activated via the intrinsic and the extrinsic apoptotic pathways because both pathways involve p53, a key regulatory gene. The molecular events related to neuronal cell apoptosis are not completely understood. To gain further insight into the events underlying neuro-apoptosis, we analyzed the transcriptional consequences of N2O exposure on nNOS, iNOS and p53 mRNA levels. The study used 2 groups of postnatal day seven Sprague/Dawley rats (N=6 each) that were exposed for 120 minutes to air (75% N2, 25% O2) or N2O (75% N2O, 25% O2; this N2O concentration is commonly used to induce anesthesia and has been demonstrated to trigger neurodegeneration in postnatal day seven rats). Total RNA was isolated from each brain and expression analyses on iNOS and nNOS transcripts were performed using relative Real-Time C-reactive protein PCR (using G3PDH as a housekeeping gene). A semi-quantitative RT-PCR analysis was performed on the p53 transcript (using Ciclophylin A as a housekeeping gene). Statistical analysis (REST 2005) revealed a significant, 11-fold up-regulation (P=0.026) of the nNOS transcript but no significant changes in iNOS transcription. The p53 mRNA was up-regulated almost 2-fold (P=0.0002; Student's t-Test; GraphPad Prism 4.00) in N2O-treated samples relative to
COX-2 and p53 in human sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Cyr, Diane; Luce, Danièle
2008-01-01
The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...
A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine
International Nuclear Information System (INIS)
Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R
2008-01-01
p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy
Autonomous feedback loop of RUNX1-p53-CBFB in acute myeloid leukemia cells.
Morita, Ken; Noura, Mina; Tokushige, Chieko; Maeda, Shintaro; Kiyose, Hiroki; Kashiwazaki, Gengo; Taniguchi, Junichi; Bando, Toshikazu; Yoshida, Kenichi; Ozaki, Toshifumi; Matsuo, Hidemasa; Ogawa, Seishi; Liu, Pu Paul; Nakahata, Tatsutoshi; Sugiyama, Hiroshi; Adachi, Souichi; Kamikubo, Yasuhiko
2017-11-30
Although runt-related transcription factor 1 (RUNX1) and its associating core binding factor-β (CBFB) play pivotal roles in leukemogenesis, and inhibition of RUNX1 has now been widely recognized as a novel strategy for anti-leukemic therapies, it has been elusive how leukemic cells could acquire the serious resistance against RUNX1-inhibition therapies and also whether CBFB could participate in this process. Here, we show evidence that p53 (TP53) and CBFB are sequentially up-regulated in response to RUNX1 depletion, and their mutual interaction causes the physiological resistance against chemotherapy for acute myeloid leukemia (AML) cells. Mechanistically, p53 induced by RUNX1 gene silencing directly binds to CBFB promoter and stimulates its transcription as well as its translation, which in turn acts as a platform for the stabilization of RUNX1, thereby creating a compensative RUNX1-p53-CBFB feedback loop. Indeed, AML cells derived from relapsed cases exhibited higher CBFB expression levels compared to those from primary AML cells at diagnosis, and these CBFB expressions were positively correlated to those of p53. Our present results underscore the importance of RUNX1-p53-CBFB regulatory loop in the development and/or maintenance of AML cells, which could be targeted at any sides of this triangle in strategizing anti-leukemia therapies.
Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2
Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D
2002-01-01
A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296
Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji
2015-03-03
The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Orre, Lukas M.; Stenerloew, Bo; Dhar, Sumeer; Larsson, Rolf; Lewensohn, Rolf; Lehtioe, Janne
2006-01-01
We have investigated p53-related differences in cellular response to DNA damaging agents, focusing on p53s effects on RAD51 protein level and sub-cellular localization post exposure to ionizing radiation. In a human colon cancer cell line, HCT116 and its isogenic p53-/- subcell line we show here p53-independent RAD51 foci formation but interestingly the resolution of RAD51 foci showed clear p53 dependence. In p53 wt cells, but not in p53-/- cells, RAD51 protein level decreased 48 h post irradiation and fluorescence immunostaining showed resolution of RAD51 foci and relocalization of RAD51 to nucleoli at time points corresponding to the decrease in RAD51 protein level. Both cell lines rejoined DNA double strand breaks efficiently with similar kinetics and p53 status did not influence sensitivity to DNA damaging agents. We suggest that p53 has a role in RAD51 clearance post DSB repair and that nucleoli might be sites of RAD51 protein degradation
Heo, Jong-Ik; Cho, Jung Hee; Kim, Jae-Ryong
2013-08-01
Holliday junction recognition protein (HJURP), a centromere protein-A (CENP-A) histone chaperone, mediates centromere-specific assembly of CENP-A nucleosome, contributing to high-fidelity chromosome segregation during cell division. However, the role of HJURP in cellular senescence of human primary cells remains unclear. We found that the expression levels of HJURP decreased in human dermal fibroblasts and umbilical vein endothelial cells in replicative or premature senescence. Ectopic expression of HJURP in senescent cells partially overcame cell senescence. Conversely, downregulation of HJURP in young cells led to premature senescence. p53 knockdown, but not p16 knockdown, abolished senescence phenotypes caused by HJURP reduction. These data suggest that HJURP plays an important role in the regulation of cellular senescence through a p53-dependent pathway and might contribute to tissue or organismal aging and protection of cellular transformation.
Directory of Open Access Journals (Sweden)
Momoko Ishimine
2018-01-01
Full Text Available Irinotecan (CPT-11 is an anticancer prodrug that is activated by the carboxylesterase CES2 and has been approved for the treatment of many types of solid tumors, including colorectal cancer. Recent studies with cell lines show that CES2 expression is regulated by the tumor suppressor protein p53. However, clinical evidence for this regulatory mechanism in cancer is lacking. In this study, we examined the relationship between TP53 gene status and CES2 expression in human colorectal cancer. Most colorectal cancer specimens (70%; 26 of 37 showed lower CES2 mRNA levels (≥1.5-fold lower than the adjacent normal tissue, and only 30% (12 of 37 showed similar (<1.5-fold lower or higher CES2 mRNA levels. However, TP53 gene sequencing revealed no relationship between CES2 downregulation and TP53 mutational status. Moreover, while colorectal cancer cells expressing wild-type p53 exhibited p53-dependent upregulation of CES2, PRIMA-1MET, a drug that restores the transcriptional activity of mutant p53, failed to upregulate CES2 expression in cells with TP53 missense mutations. These results, taken together, suggest that CES2 mRNA expression is decreased in human colorectal cancer independently of p53.
Taylor, Lisa M; James, Alexander; Schuller, Christine E; Brce, Jesena; Lock, Richard B; Mackenzie, Karen L
2004-10-15
Recent investigations, including our own, have shown that specific strains of fibroblasts expressing telomerase reverse transcriptase (hTERT) have an extended lifespan, but are not immortal. We previously demonstrated that hTERT-transduced MRC5 fetal lung fibroblasts (MRC5hTERTs) bypassed senescence but eventually succumbed to a second mortality barrier (crisis). In the present study, 67 MRC5hTERT clones were established by limiting dilution of a mass culture. Whereas 39/67 clones had an extended lifespan, all 39 extended lifespan clones underwent crisis. 11 of 39 clones escaped crisis and were immortalized. There was no apparent relationship between the fate of clones at crisis and the level of telomerase activity. Telomeres were hyperextended in the majority of the clones analyzed. There was no difference in telomere length of pre-crisis compared with post-crisis and immortal clones, indicating that hyperextended telomeres were conducive for immortalization and confirming that crisis was independent of telomere length. Immortalization of MRC5hTERT cells was associated with repression of the cyclin-dependent kinase inhibitor p16INK4a and up-regulation of pRB. However, the regulation of pRB phosphorylation and the response of the p53/p21cip1/waf1 pathway were normal in immortal cells subject to genotoxic stress. Overexpression of oncogenic ras failed to de-repress p16INK4a in immortal cells. Furthermore, expression of ras enforced senescent-like growth arrest in p16INK4a-positive, but not p16INK4a-negative MRC5hTERT cells. Immortal cells expressing ras formed small, infrequent colonies in soft agarose, but were non-tumorigenic. Overall, these results implicate the inactivation of p16INK4a as a critical event for overcoming telomere-independent crisis, immortalizing MRC5 fibroblasts and overcoming ras-induced premature senescence.
Suberoyl bis-hydroxamic acid induces p53-dependent apoptosis of MCF-7 breast cancer cells
Institute of Scientific and Technical Information of China (English)
Zhi-gang ZHUANG; Fei FEI; Ying CHEN; Wei JIN
2008-01-01
Aim: To study the effects of suberoyl bis-hydroxamic acid (SBHA), an inhibitor of histone deacetylases, on the apoptosis of MCF-7 breast cancer cells. Meth-ods: Apoptosis in MCF-7 cells induced by SBHA was demonstrated by flow cytometric analysis, morphological observation, and DNA ladder. Mitochondrial membrane potential (△ψm) was measured using the fluorescent probe JC-1. The expressions of p53, p21, Bax, and PUMA were determined using RT-PCR or Western blotting analysis after the MCF-7 cells were treated with SBHA or p53 siRNA. Results: SBHA induced apoptosis in MCF-7 cells. The expressions of p53, p21, Bax, and PUMA were induced, and △ψm collapsed after treatment with SBHA. p53 siRNA abrogated the SBHA-induced apoptosis and the expressions of p53, p21, Bax, and PUMA. Conclusion: The activation of the p53 pathway is involved in SBHA-induced apoptosis in MCF-7 cells.
International Nuclear Information System (INIS)
Fujita, Y.; Kamida, A.; Kato, I.; Yura, Y.; Ono, K.; Suzuki, M.; Sakurai, Y.; Ohnishi, T.; Ohnishi, K.
2006-01-01
The role of the p53 gene in the sensitivity of oral squamous cell carcinoma (SCC) to boron neutron capture therapy (BNCT) had not been studied. We examined the effect of boronophenylalanine (BPA)-mediated BNCT on oral SCC cells showing either wild-type p53 (SAS/neo) or mutated-type p53 (SAS/mp53). Survival ratio of cells was determined by colony formation. Cell viability was measured by MTT assay. Apoptotic cells were evaluated by flow cytometric analysis and nuclear DNA staining. When SAS/neo and SAS/mp53 cells were subjected to BNCT, more suppressive effects on colony formation and cell viability were observed in SAS/neo cells as compared with SAS/mp53. The proportion of apoptotic cells with DNA fragmentation was also increased in the cells with functional p53. These results suggest that oral SCC cells with mutated p53 cells are more resistant to BNCT than those with wild-type p53. BNCT must inhibit oral SCC cells in p53-dependent and p53-independent mechanisms. (author)
Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.
Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido
2008-07-01
We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.
Bublik, Débora R.; Bursać, Slađana; Sheffer, Michal; Oršolić, Ines; Shalit, Tali; Tarcic, Ohad; Kotler, Eran; Mouhadeb, Odelia; Hoffman, Yonit; Fuchs, Gilad; Levin, Yishai; Volarević, Siniša; Oren, Moshe
2017-01-01
The microRNA miR-504 targets TP53 mRNA encoding the p53 tumor suppressor. miR-504 resides within the fibroblast growth factor 13 (FGF13) gene, which is overexpressed in various cancers. We report that the FGF13 locus, comprising FGF13 and miR-504, is transcriptionally repressed by p53, defining an additional negative feedback loop in the p53 network. Furthermore, we show that FGF13 1A is a nucleolar protein that represses ribosomal RNA transcription and attenuates protein synthesis. Importantly, in cancer cells expressing high levels of FGF13, the depletion of FGF13 elicits increased proteostasis stress, associated with the accumulation of reactive oxygen species and apoptosis. Notably, stepwise neoplastic transformation is accompanied by a gradual increase in FGF13 expression and increased dependence on FGF13 for survival (“nononcogene addiction”). Moreover, FGF13 overexpression enables cells to cope more effectively with the stress elicited by oncogenic Ras protein. We propose that, in cells in which activated oncogenes drive excessive protein synthesis, FGF13 may favor survival by maintaining translation rates at a level compatible with the protein quality-control capacity of the cell. Thus, FGF13 may serve as an enabler, allowing cancer cells to evade proteostasis stress triggered by oncogene activation. PMID:27994142
Directory of Open Access Journals (Sweden)
Yue Teng
2017-07-01
Full Text Available Zika virus (ZIKV infection is an emerging global threat that is suspected to be associated with fetal microcephaly. However, the molecular mechanisms underlying ZIKV disease pathogenesis in humans remain elusive. Here, we investigated the human protein interaction network associated with ZIKV infection using a systemic virology approach, and reconstructed the transcriptional regulatory network to analyze the mechanisms underlying ZIKV-elicited microcephaly pathogenesis. The bioinformatics findings in this study show that P53 is the hub of the genetic regulatory network for ZIKV-related and microcephaly-associated proteins. Importantly, these results imply that the ZIKV capsid protein interacts with mouse double-minute-2 homolog (MDM2, which is involved in the P53-mediated apoptosis pathway, activating the death of infected neural cells. We also found that synthetic mimics of the ZIKV capsid protein induced cell death in vitro and in vivo. This study provides important insight into the relationship between ZIKV infection and brain diseases.
Deben, Christophe; Deschoolmeester, Vanessa; De Waele, Jorrit; Jacobs, Julie; Van den Bossche, Jolien; Wouters, An; Peeters, Marc; Rolfo, Christian; Smits, Evelien; Lardon, Filip; Pauwels, Patrick
2018-04-21
The compound APR-246 (PRIMA-1 MET ) is a known reactivator of (mutant) p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α) and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC) cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228 Q331 * cell line, and not in the wild type A549 and mutant NCI-H1975 R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228 Q331 * cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228 Q331 * cells in a synergistic manner without affecting mutant p53 Q331 * transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53 Q331 * and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.
Directory of Open Access Journals (Sweden)
Christophe Deben
2018-04-01
Full Text Available The compound APR-246 (PRIMA-1MET is a known reactivator of (mutant p53 and inducer of oxidative stress which can sensitize cancer cells to platinum-based chemotherapeutics. However, the effect of a hypoxic tumor environment has been largely overlooked in this interaction. This study focusses on the role of hypoxia-inducible factor-1α (HIF-1α and the p53 tumor suppressor protein in hypoxia-induced cisplatin resistance in non-small cell lung cancer (NSCLC cells and the potential of APR-246 to overcome this resistance. We observed that hypoxia-induced cisplatin resistance only occurred in the p53 mutant NCI-H2228Q331* cell line, and not in the wild type A549 and mutant NCI-H1975R273H cell lines. Cisplatin reduced HIF-1α protein levels in NCI-H2228Q331* cells, leading to a shift in expression from HIF-1α-dependent to p53-dependent transcription targets under hypoxia. APR-246 was able to overcome hypoxia-induced cisplatin resistance in NCI-H2228Q331* cells in a synergistic manner without affecting mutant p53Q331* transcriptional activity, but significantly depleting total glutathione levels more efficiently under hypoxic conditions. Synergism was dependent on the presence of mutant p53Q331* and the induction of reactive oxygen species, with depletion of one or the other leading to loss of synergism. Our data further support the rationale of combining APR-246 with cisplatin in NSCLC, since their synergistic interaction is retained or enforced under hypoxic conditions in the presence of mutant p53.
The role of p53 in the response to mitotic spindle damage
International Nuclear Information System (INIS)
Meek, D.W.
2000-01-01
The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)
International Nuclear Information System (INIS)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook
2009-01-01
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference
Energy Technology Data Exchange (ETDEWEB)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2009-05-15
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.
Analysis of p53- immunoreactivity in astrocytic brain tumors
Directory of Open Access Journals (Sweden)
Shinkarenko T.V.
2016-12-01
Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.
A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK
International Nuclear Information System (INIS)
Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi
2006-01-01
PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK
Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC
2013-01-01
CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078
Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich
2015-07-10
The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.
Directory of Open Access Journals (Sweden)
Fuqiang Xing
Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.
Directory of Open Access Journals (Sweden)
Ariel M Wilson
Full Text Available The transcription factor p53 mediates the apoptosis of post-mitotic neurons exposed to a wide range of stress stimuli. The apoptotic activity of p53 is tightly regulated by the apoptosis-stimulating proteins of p53 (ASPP family members: ASPP1, ASPP2 and iASPP. We previously showed that the pro-apoptotic members ASPP1 and ASPP2 contribute to p53-dependent death of retinal ganglion cells (RGCs. However, the role of the p53 inhibitor iASPP in the central nervous system (CNS remains to be elucidated. To address this, we asked whether iASPP contributes to the survival of RGCs in an in vivo model of acute optic nerve damage. We demonstrate that iASPP is expressed by injured RGCs and that iASPP phosphorylation at serine residues, which increase iASPP affinity towards p53, is significantly reduced following axotomy. We show that short interference RNA (siRNA-induced iASPP knockdown exacerbates RGC death, whereas adeno-associated virus (AAV-mediated iASPP expression promotes RGC survival. Importantly, our data also demonstrate that increasing iASPP expression in RGCs downregulates p53 activity and blocks the expression of pro-apoptotic targets PUMA and Fas/CD95. This study demonstrates a novel role for iASPP in the survival of RGCs, and provides further evidence of the importance of the ASPP family in the regulation of neuronal loss after axonal injury.
Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.
Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald
2013-04-17
The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.
Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna
2016-03-08
p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.
2003-01-01
Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation
Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner
International Nuclear Information System (INIS)
Panta, Sushil; Yamakuchi, Munekazu; Shimizu, Toshiaki; Takenouchi, Kazunori; Oyama, Yoko; Koriyama, Toyoyasu; Kojo, Tsuyoshi; Hashiguchi, Teruto
2017-01-01
In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclear localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β 3 -integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β 3 -integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β 3 -integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β 3 -integrin pathway in endothelial cells.
Kalveram, Birte; Lihoradova, Olga; Indran, Sabarish V; Lokugamage, Nandadeva; Head, Jennifer A; Ikegami, Tetsuro
2013-01-20
Rift Valley fever virus (RVFV) encodes one major virulence factor, the NSs protein. NSs suppresses host general transcription, including interferon (IFN)-β mRNA synthesis, and promotes degradation of the dsRNA-dependent protein kinase (PKR). We generated a novel RVFV mutant (rMP12-NSsR173A) specifically lacking the function to promote PKR degradation. rMP12-NSsR173A infection induces early phosphorylation of eIF2α through PKR activation, while retaining the function to inhibit host general transcription including IFN-β gene inhibition. MP-12 NSs but not R173A NSs binds to wt PKR. R173A NSs formed filamentous structure in nucleus in a mosaic pattern, which was distinct from MP-12 NSs filament pattern. Due to early phosphorylation of eIF2α, rMP12-NSsR173A could not efficiently accumulate viral proteins. Our results suggest that NSs-mediated host general transcription suppression occurs independently of PKR degradation, while the PKR degradation is important to inhibit the phosphorylation of eIF2α in infected cells undergoing host general transcription suppression. Copyright © 2012 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Alvarez, S.
2003-12-01
After a detailed discussion of the relationship between cancer and genetic instability, of the structure, activation mechanisms, activity and biological functions of the p53 protein, a presentation of p53 mutants, and a recall of the effects of ionizing radiations, the author reports a biology research during which he investigated a cell model established from rat embryo lungs treated with Benzo[a]pyrene and made of tumoral lines muted by the p53 gene. He tried to identify markers which could report differences of tumorigenicity and radio-sensitivity observed in these different lines. He also tried to characterize radio-sensitivity molecular markers dependent on the p53 gene in a context of normal cells
Directory of Open Access Journals (Sweden)
Marialaura ePetroni
2012-10-01
Full Text Available The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14ARF, significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment.In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2-p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR, it stabilizes p53 and its proapoptotic kinase HIPK2. Through the regulation of the HIPK2-p53 inhibitor HMGA1 and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and anti-apoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2-p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong
2012-01-01
The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK
Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.
Directory of Open Access Journals (Sweden)
Manujendra N Saha
Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with
Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R
2017-08-01
Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
G9a stimulates CRC growth by inducing p53 Lys373 dimethylation-dependent activation of Plk1.
Zhang, Jie; Wang, Yafang; Shen, Yanyan; He, Pengxing; Ding, Jian; Chen, Yi
2018-01-01
Rationale: G9a is genetically deregulated in various tumor types and is important for cell proliferation; however, the mechanism underlying G9a-induced carcinogenesis, especially in colorectal cancer (CRC), is unclear. Here, we investigated if G9a exerts oncogenic effects in CRC by increasing polo-like kinase 1 (Plk1) expression. Thus, we further characterized the detailed molecular mechanisms. Methods: The role of Plk1 in G9a aberrant CRC was determined by performing different in vitro and in vivo assays, including assessment of cell growth by performing cell viability assay and assessment of signaling transduction profiles by performing immunoblotting, in the cases of pharmacological inhibition or short RNA interference-mediated suppression of G9a. Detailed molecular mechanisms underlying the effect of G9a on Plk1 expression were determined by performing point mutation analysis, chromatin immunoprecipitation analysis, and luciferase reporter assay. Correlation between G9a and Plk1 expression was determined by analyzing clinical samples of patients with CRC by performing immunohistochemistry. Results: Our study is the first to report a significant positive correlation between G9a and Plk1 levels in 89 clinical samples of patients with CRC. Moreover, G9a depletion decreased Plk1 expression and suppressed CRC cell growth both in vitro and in vivo , thus confirming the significant correlation between G9a and Plk1 levels. Further, we observed that G9a-induced Plk1 regulation depended on p53 inhibition. G9a dimethylated p53 at lysine 373, which in turn increased Plk1 expression and promoted CRC cell growth. Conclusions: These results indicate that G9a-induced and p53-dependent epigenetic programing stimulates the growth of colon cancer, which also suggests that G9a inhibitors that restore p53 activity are promising therapeutic agents for treating colon cancer, especially for CRC expressing wild-type p53.
DEFF Research Database (Denmark)
Øster, Bodil; Bundgaard, B; Hupp, T R
2008-01-01
Here, we demonstrate that human herpesvirus 6B (HHV-6B) infection upregulates the tumour suppressor p53 and induces phosphorylation of p53 at Ser392. Interestingly, phosphorylation at the equivalent site has previously been shown to correlate with p53 tumour suppression in murine models. Although...
SoxB1-driven transcriptional network underlies neural-specific interpretation of morphogen signals.
Oosterveen, Tony; Kurdija, Sanja; Ensterö, Mats; Uhde, Christopher W; Bergsland, Maria; Sandberg, Magnus; Sandberg, Rickard; Muhr, Jonas; Ericson, Johan
2013-04-30
The reiterative deployment of a small cadre of morphogen signals underlies patterning and growth of most tissues during embyogenesis, but how such inductive events result in tissue-specific responses remains poorly understood. By characterizing cis-regulatory modules (CRMs) associated with genes regulated by Sonic hedgehog (Shh), retinoids, or bone morphogenetic proteins in the CNS, we provide evidence that the neural-specific interpretation of morphogen signaling reflects a direct integration of these pathways with SoxB1 proteins at the CRM level. Moreover, expression of SoxB1 proteins in the limb bud confers on mesodermal cells the potential to activate neural-specific target genes upon Shh, retinoid, or bone morphogenetic protein signaling, and the collocation of binding sites for SoxB1 and morphogen-mediatory transcription factors in CRMs faithfully predicts neural-specific gene activity. Thus, an unexpectedly simple transcriptional paradigm appears to conceptually explain the neural-specific interpretation of pleiotropic signaling during vertebrate development. Importantly, genes induced in a SoxB1-dependent manner appear to constitute repressive gene regulatory networks that are directly interlinked at the CRM level to constrain the regional expression of patterning genes. Accordingly, not only does the topology of SoxB1-driven gene regulatory networks provide a tissue-specific mode of gene activation, but it also determines the spatial expression pattern of target genes within the developing neural tube.
Czech Academy of Sciences Publication Activity Database
Paprskářová, Martina; Kryštof, Vladimír; Jorda, Radek; Džubák, P.; Hajdúch, M.; Wesierska-Gadek, J.; Strnad, Miroslav
2009-01-01
Roč. 107, č. 3 (2009), s. 428-437 ISSN 0730-2312 R&D Projects: GA ČR GA204/08/0511 Institutional research plan: CEZ:AV0Z50380511 Keywords : APOPTOSIS * CYCLIN-DEPENDENT KINASE * OLOMOUCINE II * p53 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.935, year: 2009
Energy Technology Data Exchange (ETDEWEB)
Mohan, Vijay [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Agarwal, Rajesh [Department of Pharmaceutical Sciences, School of Pharmacy, University of Colorado Denver, Aurora, CO (United States); Singh, Rana P., E-mail: ranaps@hotmail.com [School of Life Sciences, Central University of Gujarat, Gandhinagar, Gujarat (India); Cancer Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi (India)
2016-09-02
Lung cancer is the most frequently diagnosed malignancy that contributes to high proportion of deaths globally among patients who die due to cancer. Chemotherapy remains the common mode of treatment for lung cancer patients though with limited success. We assessed the biological effects and associated molecular changes of evodiamine, a plant alkaloid, on human lung cancer A549 and H1299 cells along with other epithelial cancer and normal lung SAEC cells. Our data showed that 20–40 μM evodiamine treatment for 24–48 h strongly (up to 73%, P < 0.001) reduced the growth and survival of these cancer cells. However, it also moderately inhibited growth and survival of SAEC cells. A strong inhibition (P < 0.001) was observed on clonogenicity of A549 cells. Further, evodiamine increased (4-fold) mitochondrial membrane depolarization with 6-fold increase in apoptosis and a slight increase in Bax/Bcl-2 ratio. It increased the cytochrome-c release from mitochondria into the cytosol as well as nucleus. Cytosolic cytochrome-c activated cascade of caspase-9 and caspase-3 intrinsic pathway, however, DR5 and caspase-8 extrinsic pathway was also activated which could be due to nuclear cytochrome-c. Pan-caspase inhibitor (z-VAD.fmk) partially reversed evodiamine induced apoptosis. An increase in p53 as well as its serine 15 phosphorylation was also observed. Pifithrin-α, a p53 inhibitor, slightly inhibited growth of A549 cells and under p53 inhibitory condition evodiamine-induced apoptosis could not be reversed. Together these findings suggest that evodiamine is a strong inducer of apoptosis in lung epithelial cancer cells independent of their p53 status and that could involve both intrinsic as well as extrinsic pathway of apoptosis. Thus evodiamine could be a potential anticancer agent against lung cancer. - Highlights: • Evodiamine, a novel plant alkaloid, relatively selectively inhibited growth and survival of human lung cancer cells. • Increased cancer cell
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
Energy Technology Data Exchange (ETDEWEB)
Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)
2013-02-15
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
International Nuclear Information System (INIS)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer
2013-01-01
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status
Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4
Directory of Open Access Journals (Sweden)
Ravshan Burikhanov
2014-01-01
Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.
Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells
Energy Technology Data Exchange (ETDEWEB)
Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)
2015-11-01
Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.
Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells
International Nuclear Information System (INIS)
Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.
2015-01-01
Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
Directory of Open Access Journals (Sweden)
Pathi Satya
2011-08-01
Full Text Available Abstract Background Betulinic acid (BA inhibits growth of several cancer cell lines and tumors and the effects of BA have been attributed to its mitochondriotoxicity and inhibition of multiple pro-oncogenic factors. Previous studies show that BA induces proteasome-dependent degradation of specificity protein (Sp transcription factors Sp1, Sp3 and Sp4 in prostate cancer cells and this study focused on the mechanism of action of BA in colon cancer cells. Methods The effects of BA on colon cancer cell proliferation and apoptosis and tumor growth in vivo were determined using standardized assays. The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a and ZBTB10 mRNA expression. Results BA inhibited growth and induced apoptosis in RKO and SW480 colon cancer cells and inhibited tumor growth in athymic nude mice bearing RKO cells as xenograft. BA also decreased expression of Sp1, Sp3 and Sp4 transcription factors which are overexpressed in colon cancer cells and decreased levels of several Sp-regulated genes including survivin, vascular endothelial growth factor, p65 sub-unit of NFκB, epidermal growth factor receptor, cyclin D1, and pituitary tumor transforming gene-1. The mechanism of action of BA was dependent on cell context, since BA induced proteasome-dependent and proteasome-independent downregulation of Sp1, Sp3 and Sp4 in SW480 and RKO cells, respectively. In RKO cells, the mechanism of BA-induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS, ROS-mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. Conclusions These results suggest that the anticancer activity of BA in colon cancer cells is due, in part, to downregulation of Sp1, Sp3 and Sp4 transcription factors; however, the mechanism of this response is cell context-dependent.
International Nuclear Information System (INIS)
Chintharlapalli, Sudhakar; Papineni, Sabitha; Lei, Ping; Pathi, Satya; Safe, Stephen
2011-01-01
Betulinic acid (BA) inhibits growth of several cancer cell lines and tumors and the effects of BA have been attributed to its mitochondriotoxicity and inhibition of multiple pro-oncogenic factors. Previous studies show that BA induces proteasome-dependent degradation of specificity protein (Sp) transcription factors Sp1, Sp3 and Sp4 in prostate cancer cells and this study focused on the mechanism of action of BA in colon cancer cells. The effects of BA on colon cancer cell proliferation and apoptosis and tumor growth in vivo were determined using standardized assays. The effects of BA on Sp proteins and Sp-regulated gene products were analyzed by western blots, and real time PCR was used to determine microRNA-27a (miR-27a) and ZBTB10 mRNA expression. BA inhibited growth and induced apoptosis in RKO and SW480 colon cancer cells and inhibited tumor growth in athymic nude mice bearing RKO cells as xenograft. BA also decreased expression of Sp1, Sp3 and Sp4 transcription factors which are overexpressed in colon cancer cells and decreased levels of several Sp-regulated genes including survivin, vascular endothelial growth factor, p65 sub-unit of NFκB, epidermal growth factor receptor, cyclin D1, and pituitary tumor transforming gene-1. The mechanism of action of BA was dependent on cell context, since BA induced proteasome-dependent and proteasome-independent downregulation of Sp1, Sp3 and Sp4 in SW480 and RKO cells, respectively. In RKO cells, the mechanism of BA-induced repression of Sp1, Sp3 and Sp4 was due to induction of reactive oxygen species (ROS), ROS-mediated repression of microRNA-27a, and induction of the Sp repressor gene ZBTB10. These results suggest that the anticancer activity of BA in colon cancer cells is due, in part, to downregulation of Sp1, Sp3 and Sp4 transcription factors; however, the mechanism of this response is cell context-dependent
International Nuclear Information System (INIS)
Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong
2007-01-01
To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Koster, R.; Timmer-Bosscha, H.; Bischoff, R.; Gietema, J. A.; de Jong, S.
Wild-type p53 has a major role in the response and execution of apoptosis after chemotherapy in many cancers. Although high levels of wild-type p53 and hardly any TP53 mutations are found in testicular cancer (TC), chemotherapy resistance is still observed in a significant subgroup of TC patients.
Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression
Directory of Open Access Journals (Sweden)
Shang-Jui Wang
2016-10-01
Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.
Contribution to the investigation of the p53 in vivo and in vitro trans-activation activity
International Nuclear Information System (INIS)
Meiller, A.
2004-03-01
Among the body's defence mechanisms, the programmed cellular death or apoptosis is an important safeguard way which allows the body to get rid of the injured cells before they acquire steady genetic modifications leading to an anarchistic multiplication. As p53 tumor suppressor gene plays a predominant role within this process, this research report first presents the p53 protein, its structure, its activities as a transcription factor, its modifications and the implications on its functional activities, its biological activities, and describes the p53 intracellular rate regulation and the use of this protein in radiology, particularly in 'in vivo' investigations on irradiated mice. It also presents the p53 family. Then, the author reports experimental investigations on possible other genes which could be trans-activated by p53. A gene is identified as a new target gene. She also demonstrates a new p53 activation path induced by another member of the p53 family, the p73 alpha protein
An adaptive molecular timer in p53-meidated cell fate decision
Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei
The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).
Role of DNA mismatch repair and p53 in signaling induction of apoptosis by alkylating agents.
Hickman, M J; Samson, L D
1999-09-14
All cells are unavoidably exposed to chemicals that can alkylate DNA to form genotoxic damage. Among the various DNA lesions formed, O(6)-alkylguanine lesions can be highly cytotoxic, and we recently demonstrated that O(6)-methylguanine (O(6)MeG) and O(6)-chloroethylguanine (O(6)CEG) specifically initiate apoptosis in hamster cells. Here we show, in both hamster and human cells, that the MutSalpha branch of the DNA mismatch repair pathway (but not the MutSbeta branch) is absolutely required for signaling the initiation of apoptosis in response to O(6)MeGs and is partially required for signaling apoptosis in response to O(6)CEGs. Further, O(6)MeG lesions signal the stabilization of the p53 tumor suppressor, and such signaling is also MutSalpha-dependent. Despite this, MutSalpha-dependent apoptosis can be executed in a p53-independent manner. DNA mismatch repair status did not influence the response of cells to other inducers of p53 and apoptosis. Thus, it appears that mismatch repair status, rather than p53 status, is a strong indicator of the susceptibility of cells to alkylation-induced apoptosis. This experimental system will allow dissection of the signal transduction events that couple a specific type of DNA base lesion with the final outcome of apoptotic cell death.
The role of p53 in lung macrophages following exposure to a panel of manufactured nanomaterials
DEFF Research Database (Denmark)
Belade, Esther; Chrusciel, Sandra; Armand, Lucie
2015-01-01
is a key transcription factor implicated in cellular defence and reparative responses to various stress factors. Additionally, p53 has been implicated in cellular responses following exposure to some MNMs. Here, the role of the MNM mediated p53 induction and activation and its downstream effects following...... exposure to five well-characterised materials [namely two types of TiO2, two carbon black (CB), and one single-walled carbon nanotube (SWCNT)] were investigated. MNM internalisation, cellular viability, p53 protein induction and activation, oxidative stress, inflammation and apoptosis were measured...... in murine cell line and primary pulmonary macrophage models. It was observed that p53 was implicated in the biological responses to MNMs, with oxidative stress associated with p53 activation (only following exposure to the SWCNT). We demonstrate that p53 acted as an antioxidant and anti...
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
=0.01). Sixty of the 70 tumors showed positive immunohistologic staining for p53 protein (transformed p53=tp53), and 10/70 were negative (wild-type p53=wtp53); p53 expression had no significant impact on survival (50% for tp53 vs. 79% for wtp53, p=0.11). FIGO stage and anemia had no impact on p53 expression. Forty-nine of 70 tumors were hypoxic (HF5+), and 21 showed no hypoxia (HF5-). Hypoxic carcinomas were more frequently positive for p53 as compared to nonhypoxic tumors (27% vs. 13%, p=0.011) and showed a trend toward a lower survival (48% vs. 70%, p = 0.07). In a further multivariate analysis, the impact of a combination of p53 expression and hypoxia on survival was examined. After adjusting for FIGO stage and pretreatment anemia, patients with wtp53 tumors had the best prognosis (3-year survival 79%) followed by tp53-HF5(-) patients (57%), and the most unfavorable prognosis was observed for tp53-HF5(+) patients (47%). The DNA index was higher in tp53 carcinomas compared to wtp53 tumors, 1.97±0.4 vs. 1.67±0.1, p=0.05. The highest DNA index was found in hypoxic tumors with transformed p53 (2.2±3.1). Conclusions: Advanced stage and pretreatment hemoglobin level are independent prognostic factors in cervical carcinomas. The immunohistologic detection of (a functionally inactive) p53 and the presence of hypoxia had no prognostic impact, if analyzed as single parameters. However, the combination of both parameters was able to discriminate different prognostic subgroups. Moreover, hypoxic cancers were more often immunohistologically positive for tp53 protein and had a higher DNA index with the highest DNA index in tumors with both hypoxia and tp53 protein expression. These findings in summary support the theory that the tumor's microenvironment may influence the biologic behavior via hypoxia
Multipolar mitosis of tetraploid cells: inhibition by p53 and dependency on Mos.
Vitale, Ilio; Senovilla, Laura; Jemaà, Mohamed; Michaud, Mickaël; Galluzzi, Lorenzo; Kepp, Oliver; Nanty, Lisa; Criollo, Alfredo; Rello-Varona, Santiago; Manic, Gwenola; Métivier, Didier; Vivet, Sonia; Tajeddine, Nicolas; Joza, Nicholas; Valent, Alexander; Castedo, Maria; Kroemer, Guido
2010-04-07
Tetraploidy can constitute a metastable intermediate between normal diploidy and oncogenic aneuploidy. Here, we show that the absence of p53 is not only permissive for the survival but also for multipolar asymmetric divisions of tetraploid cells, which lead to the generation of aneuploid cells with a near-to-diploid chromosome content. Multipolar mitoses (which reduce the tetraploid genome to a sub-tetraploid state) are more frequent when p53 is downregulated and the product of the Mos oncogene is upregulated. Mos inhibits the coalescence of supernumerary centrosomes that allow for normal bipolar mitoses of tetraploid cells. In the absence of p53, Mos knockdown prevents multipolar mitoses and exerts genome-stabilizing effects. These results elucidate the mechanisms through which asymmetric cell division drives chromosomal instability in tetraploid cells.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence
Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.
2009-01-01
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...
International Nuclear Information System (INIS)
Suzuki, Katsura; Inageda, Kiyoshi; Nishitai, Gen; Matsuoka, Masato
2007-01-01
When A549 cells were exposed to sodium metavanadate (NaVO 3 ), the pentavalent species of vanadium (vanadate), phosphorylation of p53 protein at Ser15 was found in a time (8-48 h)- and dose (10-200 μM)-dependent manner. After the incubation with 50 or 100 μM NaVO 3 for 48 h, accumulation of p53 protein was accompanied with Ser15 phosphorylation. Among serines in p53 protein immunoprecipitated from A549 cells treated with 100 μM NaVO 3 for 48 h, only Ser15 was markedly phosphorylated. Treatment with other vanadate compounds, sodium orthovanadate (Na 3 VO 4 ) and ammonium metavanadate (NH 4 VO 3 ), also induced Ser15 phosphorylation and accumulation of p53 protein. While phosphorylation of extracellular signal-regulated protein kinase (ERK) was found in cells treated with NaVO 3 , treatment with U0126 did not suppress Ser15 phosphorylation. On the other hand, treatment with wortmannin or caffeine, the inhibitors to phosphatidylinositol 3-kinase related kinases (PIKKs), suppressed both NaVO 3 -induced Ser15 phosphorylation and accumulation of p53 protein. The silencing of ataxia telangiectasia mutated (ATM) expression using short-interference RNA resulted in the marked suppression of Ser15 phosphorylation in A549 cells exposed to NaVO 3 . However, treatment with antioxidants such as catalase and N-acetylcysteine did not suppress NaVO 3 -induced Ser15 phosphorylation. Transcriptional activation of p53 and DNA fragmentation in A549 cells treated with NaVO 3 were suppressed only slightly by S15A mutation, suggesting that Ser15 phosphorylation is not essential for these responses. The present results showed that vanadate induces the phosphorylation of p53 at Ser15 depending on ATM, one of the members of PIKK family, in this human pulmonary epithelial cell line
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
International Nuclear Information System (INIS)
Didelot, C.; Mirjolet, J.F.; Barberi-Heyob, M.; Ramacci, C.; Merlin, J.L.
2002-01-01
The effect of chemoresistance induction in radio sensitivity and cellular behavior after irradiation remains misunderstood. This study was designed to understand the relationship between radiation-induced cell cycle arrest, apoptosis, and radiosensitivity in KB cell line and KB3 subline selected after 5-fluorouracil (5FU) exposure. Exposure of KB cells to 5FU led to an increase in radiosensitivity. G 2 /M cell cycle arrest was observed in the two cell lines after irradiation. The radioresistant KB cell line reached the maximum arrest two hours before KB3. The cellular exit from this arrest was found to be related to the wild type p53 protein expression induction. After irradiation, only KB3 cell line underwent apoptosis. This apoptosis induction seemed to be independent of G 2 /M arrest exit, which was carried out later. The difference in radiosensitivity between KB and KB3 subline may result therefore from both a difference in apoptosis induction and a difference in G 2 /M arrest maximum duration. Moreover, 5FU exposure has led to an increase in constitutive p53 protein expression, which may be associated with an increase in basal apoptosis cell fraction. Given the existing correlation between radiosensitivity and the percentage of basal apoptosis. the constitutive p53 protein expression may be related to intrinsic radiosensitivity in our cellular model. (author)
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Directory of Open Access Journals (Sweden)
Katsuhiko Nosho
2009-01-01
Full Text Available JC virus has a transforming gene encoding JC virus T-antigen (JCVT. JCVT may inactivate wild-type p53, cause chromosomal instability (CIN, and stabilize β-catenin. A link between JCVT and CpG island methylator phenotype (CIMP has been suggested. However, no large-scale study has examined the relations of JCVT with molecular alterations, clinical outcome, or prognosis in colon cancer. We detected JCVT expression (by immunohistochemistry in 271 (35% of 766 colorectal cancers. We quantified DNA methylation in eight CIMP-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1 and eight other loci (CHFR, HIC1, IGFBP3, MGMT, MINT1, MINT31, p14, WRN by MethyLight. We examined loss of heterozygosity in 2p, 5q, 17q, and 18q. JCVT was significantly associated with p53 expression (P < .0001, p21 loss (P < .0001, CIN (≥2 chromosomal segments with LOH; P < .0001, nuclear β-catenin (P = .006, LINE-1 hypomethylation (P = .002, and inversely with CIMP-high (P = .0005 and microsatellite instability (MSI (P < .0001, but not with PIK3CA mutation. In multivariate logistic regression analysis, the associations of JCVT with p53 [adjusted odds ratio (OR, 8.45; P < .0001], CIN (adjusted OR, 2.53; P = .003, cyclin D1 (adjusted OR, 1.57; P = .02, LINE-1 hypomethylation (adjusted OR, 1.97 for a 30% decline as a unit; P = .03, BRAF mutation (adjusted OR, 2.20; P = .04, and family history of colorectal cancer (adjusted OR, 0.64; P = .04 remained statistically significant. However, JCVT was no longer significantly associated with CIMP, MSI, β-catenin, or cyclooxygenase-2 expression in multivariate analysis. JCVT was unrelated with patient survival. In conclusion, JCVT expression in colorectal cancer is independently associated with p53 expression and CIN, which may lead to uncontrolled cell proliferation.
Mutant p53 - heat shock response oncogenic cooperation: a new mechanism of cancer cell survival
Directory of Open Access Journals (Sweden)
Evguenia eAlexandrova
2015-04-01
Full Text Available The main tumor suppressor function of p53 as a ‘guardian of the genome’ is to respond to cellular stress by transcriptional activation of apoptosis, growth arrest or senescence in damaged cells. Not surprisingly, mutations in the p53 gene are the most frequent genetic alteration in human cancers. Importantly, mutant p53 (mutp53 proteins not only lose their wild-type tumor suppressor activity, but also can actively promote tumor development. Two main mechanisms accounting for mutp53 proto-oncogenic activity are inhibition of the wild-type p53 in a dominant-negative fashion and gain of additional oncogenic activities known as gain-of-function (GOF. Here we discuss a novel mechanism of mutp53 GOF, which relies on its oncogenic cooperation with the heat shock machinery. This coordinated adaptive mechanism renders cancer cells more resistant to proteotoxic stress and provides both, a strong survival advantage to cancer cells and a promising means for therapeutic intervention.
International Nuclear Information System (INIS)
Bodis, Stephan; Pruschy, Martin; Wirbelauer, Christiane; Glanzmann, Christoph; Krek, Wilhelm
1997-01-01
Purpose: Correct advance of cells through the S-phase of the mammalian cell cycle depends on the timely controlled activity of the E2F-1 transcription factor by cyclin A-cdk2. We are studying the reproductive integrity and radiosensitation of isogenic mouse fibrosarcoma cells, differing only in their p53 status, after expression of E2F-1 wildtype (wt) and specific E2F-1 mutants (mt) lacking the cyclin-A-binding domain. In this tumor model system only p53 wild-type expressing tumor cells are sensitive to ionizing radiation in vitro and in vivo. Material and Methods: Either wild-type p53 or genetically engineered p53 'null' mouse embryo fibroblasts were transfected with the oncogenes E1A and ras. These otherwise isogenic fibrosarcoma cells, with a malignant phenotype and tumorigenic in nude mice, were transfected with retroviruses containing either E2F-1 wild-type or specific E2F-1 mutants lacking the cyclin-A binding domain. Reproductive integrity after E2F-1 transfection with or without ionizing radiation (RT) was tested using the clonogenic assay. Tumor cell morphology of treated cells is analyzed for cell death mechanism. Results: E2F-1 wild-type expression in fibrosarcoma cells induced a clear p53 dependent cell death. While clonogenic survival of p53 'null' tumor cells was only slightly reduced with the expression of E2F-1 wild type (survival fraction of 0.5), the clonogenic survival of p53 wild-type fibrosarcoma tumor cells was reduced by at least one logarithm (survival fraction of 0.05). However, expression of the specific E2F-1 mutant lacking the cyclin-A binding domain reduced clonogenic survival in both the p53 'null' and the p53 wild-type fibrosarcoma cells by at least 2 logarithms (survival fraction 0.01 for p53 'null' and 0.002 for p53 wild-type). The mean values of the survival fractions after 2 and 5 Gy radiation alone in p53 'null' fibrosarcoma cells (SF 2 and SF 5) were SF 2 0.7, SF 5 = 0.15, respectively. The combination of ionizing RT in the p53
Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle
DEFF Research Database (Denmark)
Skouv, J.; Jensen, P O; Forchhammer, J
1994-01-01
Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...
Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins
International Nuclear Information System (INIS)
Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg
2006-01-01
Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2002-07-01
The p53 tumor suppressor is a tetrameric transcription factor that is post-translational modified at {approx}18 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review the posttranslational modifications to p53 and the pathways that produce them in response to both genotoxic and non-genotoxic stresses.
Directory of Open Access Journals (Sweden)
Wei-Ru Huang
Full Text Available Avian reovirus (ARV protein p17 has been shown to regulate cell cycle and autophagy by activation of p53/PTEN pathway; nevertheless, it is still unclear how p53 and PTEN are activated by p17. Here, we report for the first time that p17 functions as a nucleoporin Tpr suppressor that leads to p53 nuclear accumulation and consequently activates p53, p21, and PTEN. The nuclear localization signal (119IAAKRGRQLD128 of p17 has been identified for Tpr binding. This study has shown that Tpr suppression occurs by p17 interacting with Tpr and by reducing the transcription level of Tpr, which together inhibit Tpr function. In addition to upregulation of PTEN by activation of p53 pathway, this study also suggests that ARV protein p17 acts as a positive regulator of PTEN. ARV p17 stabilizes PTEN by stimulating phosphorylation of cytoplasmic PTEN and by elevating Rak-PTEN association to prevent it from E3 ligase NEDD4-1 targeting. To activate PTEN, p17 is able to promote β-arrestin-mediated PTEN translocation from the cytoplasm to the plasma membrane via a Rock-1-dependent manner. The accumulation of p53 in the nucleus induces the PTEN- and p21-mediated downregulation of cyclin D1 and CDK4. Furthermore, Tpr and CDK4 knockdown increased virus production in contrast to depletion of p53, PTEN, and LC3 reducing virus yield. Taken together, our data suggest that p17-mediated Tpr suppression positively regulates p53, PTEN, and p21 and negatively regulates PI3K/AKT/mTOR and ERK signaling pathways, both of which are beneficial for virus replication.
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Clinical significance of altered nm23-H1, EGFR, RB and p53 expression in bilharzial bladder cancer
International Nuclear Information System (INIS)
Khaled, Hussein M; Bahnassy, Abeer A; Raafat, Amira A; Zekri, Abdel-Rahman N; Madboul, Maha S; Mokhtar, Nadia M
2009-01-01
Clinical characterization of bladder carcinomas is still inadequate using the standard clinico-pathological prognostic markers. We assessed the correlation between nm23-H1, Rb, EGFR and p53 in relation to the clinical outcome of patients with muscle invasive bilharzial bladder cancer (MI-BBC). nm23-H1, Rb, EGFR and p53 expression was assessed in 59 MI-BBC patients using immunohistochemistry and reverse transcription (RT-PCR) and was correlated to the standard clinico-pathological prognostic factors, patient's outcome and the overall survival (OS) rate. Overexpression of EGFR and p53 proteins was detected in 66.1% and 35.6%; respectively. Loss of nm23-H1and Rb proteins was detected in 42.4% and 57.6%; respectively. Increased EGFR and loss of nm23-H1 RNA were detected in 61.5% and 36.5%; respectively. There was a statistically significant correlation between p53 and EGFR overexpression (p < 0.0001), nm23 loss (protein and RNA), lymph node status (p < 0.0001); between the incidence of local recurrence and EGFR RNA overexpression (p= 0.003) as well as between the incidence of metastasis and altered Rb expression (p = 0.026), p53 overexpression (p < 0.0001) and mutation (p = 0.04). Advanced disease stage correlated significantly with increased EGFR (protein and RNA) (p = 0.003 & 0.01), reduced nm23-H1 RNA (p = 0.02), altered Rb (p = 0.023), and p53 overexpression (p = 0.004). OS rates correlated significantly, in univariate analysis, with p53 overexpression (p = 0.011), increased EGFR (protein and RNA, p = 0.034&0.031), nm23-H1 RNA loss (p = 0.021) and aberrations of ≥ 2 genes. However, multivariate analysis showed that only high EGFR overexpression, metastatic recurrence, high tumor grade and the combination of ≥ 2 affected markers were independent prognostic factors. nm23-H1, EGFR and p53 could be used as prognostic biomarkers in MI-BBC patients. In addition to the standard pathological prognostic factors, a combination of these markers (≥ 2) has
GROENEWEG, JOLIJN W.; WHITE, YVONNE A.R.; KOKEL, DAVID; PETERSON, RANDALL T.; ZUKERBERG, LAWRENCE R.; BERIN, INNA; RUEDA, BO R.; WOOD, ANTONY W.
2014-01-01
SUMMARY In vitro studies have suggested that the Cables1 gene regulates epithelial cell proliferation, whereas other studies suggest a role in promoting neural differentiation. In efforts to clarify the functions of Cables1 in vivo, we conducted gain- and loss-of-function studies targeting its ortholog (cables1) in the zebrafish embryo. Similar to rodents, zebrafish cables1 mRNA expression is detected most robustly in embryonic neural tissues. Antisense knockdown of cables1 leads to increased numbers of apoptotic cells, particularly in brain tissue, in addition to a distinct behavioral phenotype, characterized by hyperactivity in response to stimulation. Apoptosis and the behavioral abnormality could be rescued by co-expression of a morpholino-resistant cables1 construct. Suppression of p53 expression in cables1 morphants partially rescued both apoptosis and the behavioral phenotype, suggesting that the phenotype of cables1 morphants is due in part to p53-dependent apoptosis. Alterations in the expression patterns of several neural transcription factors were observed in cables1 morphants during early neurulation, suggesting that cables1 is required for early neural differentiation. Ectopic overexpression of cables1 strongly disrupted embryonic morphogenesis, while overexpression of a cables1 mutant lacking the C-terminal cyclin box had little effect, suggesting functional importance of the cyclin box. Lastly, marked reductions in p35, but not Cdk5, were observed in cables1 morphants. Collectively, these data suggest that cables1 is important for neural differentiation during embryogenesis, in a mechanism that likely involves interactions with the Cdk5/p35 kinase pathway. PMID:21268180
Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C
2012-06-01
Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J
2006-08-01
Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.
Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E
1996-09-01
Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.
Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph
2017-04-01
Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event
Directory of Open Access Journals (Sweden)
Alnawaz Rehemtulla
2004-01-01
Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.
International Nuclear Information System (INIS)
Petroni, Marialaura; Veschi, Veronica; Gulino, Alberto; Giannini, Giuseppe
2012-01-01
The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14 ARF , significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment. In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2–p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR), it stabilizes p53 and its proapoptotic kinase Homeodomain Interacting Protein Kinase 2 (HIPK2). Through the regulation of the HIPK2-p53 inhibitor High Mobility Group protein A1 (HMGA1) and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and antiapoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2–p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.
Energy Technology Data Exchange (ETDEWEB)
Petroni, Marialaura; Veschi, Veronica; Gulino, Alberto; Giannini, Giuseppe, E-mail: giuseppe.giannini@uniroma1.it [Department of Molecular Medicine, University “La Sapienza”, Rome (Italy)
2012-10-12
The p53 oncosuppressor is very seldom mutated in neuroblastoma, but several mechanisms cooperate to its functional inactivation in this tumor. Increased MDM2 levels, due to genetic amplification or constitutive inhibition of p14{sup ARF}, significantly contribute to this event highlighting p53 reactivation as an attractive perspective for neuroblastoma treatment. In addition to its role in tumorigenesis, MYCN sensitizes untransformed and cancer cells to apoptosis. This is associated to a fine modulation of the MDM2–p53 pathway. Indeed MYCN induces p53 and MDM2 transcription, and, by evoking a DNA damage response (DDR), it stabilizes p53 and its proapoptotic kinase Homeodomain Interacting Protein Kinase 2 (HIPK2). Through the regulation of the HIPK2-p53 inhibitor High Mobility Group protein A1 (HMGA1) and the homeobox proteins BMI-1 and TWIST-1, MYCN establishes a delicate balance between pro- and antiapoptotic molecules that might be easily perturbed by a variety of insults, leading to cell death. MDM2–p53 antagonists, such as Nutlin-3, are strikingly prone to inducing death in MYCN-amplified neuroblastoma, by further pushing on HIPK2 accumulation. Here we discuss implications and caveats of exploiting this pathway and its connections to MYCN-induced DDR for a tailored therapy of MYCN-amplified neuroblastoma.
Marx, Christian; Marx-Blümel, Lisa; Lindig, Nora; Thierbach, René; Hoelzer, Doerte; Becker, Sabine; Wittig, Susan; Lehmann, Roland; Slevogt, Hortense; Heinzel, Thorsten; Wang, Zhao-Qi; Beck, James F; Sonnemann, Jürgen
2018-06-01
The sirtuin 1/2 inhibitor tenovin-1 activates p53 and may have potential in the management of cancer. Here, we investigated the responsiveness of Ewing's sarcoma cells to tenovin-1. We examined its effects in two Ewing's sarcoma cell lines with different p53 status, i.e. in p53 wild-type and p53 null cells. Effects were assessed by flow cytometric analyses of cell death, mitochondrial membrane depolarization and reactive oxygen species (ROS) generation, by caspase 3/7 activity measurement, by mRNA expression profiling and by immunoblotting. Tenovin-1 elicited caspase-mediated cell death in p53 wild-type cells, but caspase-independent cell death in p53 null cells. Remarkably, it induced a nonlinear concentration response in the latter: low concentrations of tenovin-1 were much more effective than were higher concentrations. Tenovin-1's effects in p53 null cells involved gene expression changes of Bcl-2 family members, mitochondrial membrane depolarization, nuclear translocation of apoptosis-inducing factor, ROS formation and DNA damage; all these effects followed a bell-shaped pattern. In conclusion, our results provide new insights into tenovin-1's mode of action by demonstrating that it can induce different pathways of cell death.
International Nuclear Information System (INIS)
Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo
2000-01-01
The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53δ, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53δ cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of undifferentiated
Energy Technology Data Exchange (ETDEWEB)
Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura [Kyoto Univ. (Japan). Radiation Biology Center; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo
2000-09-01
The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53{delta}, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53{delta} cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of
p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells
International Nuclear Information System (INIS)
Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd; Groesch, Sabine
2008-01-01
S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53 wt ) or being p(HCT-116 p53 -/- ), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53 -/- xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53 wt cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53 wt cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75 NTR , p53 and Bax
p53-Mediated Molecular Control of Autophagy in Tumor Cells
Directory of Open Access Journals (Sweden)
Maria Mrakovcic
2018-03-01
Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.
Energy Technology Data Exchange (ETDEWEB)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J.; Fortunato, Elizabeth A., E-mail: lfort@uidaho.edu
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.
Directory of Open Access Journals (Sweden)
Limor Raz
Full Text Available Recent studies demonstrate that acetylation of the transcription factor, p53 on lysine(373 leads to its enhanced stabilization/activity and increased susceptibility of cells to stress. However, it is not known whether acetylation of p53 is altered in the hippocampus following global cerebral ischemia (GCI or is regulated by the hormone, 17β-estradiol (17β-E(2, and thus, this study examined these issues.The study revealed that Acetyl p53-Lysine(373 levels were markedly increased in the hippocampal CA1 region after GCI at 3 h, 6 h and 24 h after reperfusion, an effect strongly attenuated by 17β-E(2. 17β-E(2 also enhanced interaction of p53 with the ubiquitin ligase, Mdm2, increased ubiquitination of p53, and induced its down-regulation, as well as attenuated elevation of the p53 transcriptional target, Puma. We also observed enhanced acetylation of p53 at a different lysine (Lys(382 at 3 h after reperfusion, and 17β-E(2 also markedly attenuated this effect. Furthermore, administration of an inhibitor of CBP/p300 acetyltransferase, which acetylates p53, was strongly neuroprotective of the CA1 region following GCI. In long-term estrogen deprived (LTED animals, the ability of 17β-E(2 to attenuate p53 acetylation was lost, and intriguingly, Acetyl p53-Lysine(373 levels were markedly elevated in sham (non-ischemic LTED animals. Finally, intracerebroventricular injections of Gp91ds-Tat, a specific NADPH oxidase (NOX2 inhibitor, but not the scrambled tat peptide control (Sc-Tat, attenuated acetylation of p53 and reduced levels of Puma following GCI.The studies demonstrate that p53 undergoes enhanced acetylation in the hippocampal CA1 region following global cerebral ischemia, and that the neuroprotective agent, 17β-E(2, markedly attenuates the ischemia-induced p53 acetylation. Furthermore, following LTED, the suppressive effect of 17β-E(2 on p53 acetylation is lost, and p53 acetylation increases in the hippocampus, which may explain previous
International Nuclear Information System (INIS)
Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi
2006-01-01
Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer
Directory of Open Access Journals (Sweden)
Nishizaki Takashi
2006-07-01
Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
Energy Technology Data Exchange (ETDEWEB)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish, E-mail: ashish.lal@nih.gov [Genetics Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States)
2013-12-04
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways.
Long Non-Coding RNAs Embedded in the Rb and p53 Pathways
International Nuclear Information System (INIS)
Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish
2013-01-01
In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways
Regulation of GAD65 expression by SMAR1 and p53 upon Streptozotocin treatment
Directory of Open Access Journals (Sweden)
Singh Sandeep
2012-09-01
Full Text Available Abstract Background GAD65 (Glutamic acid decarboxylase 65 KDa isoform is one of the most important auto-antigens involved in Type 1 diabetes induction. Although it serves as one of the first injury markers of β-islets, the mechanisms governing GAD65 expression remain poorly understood. Since the regulation of GAD65 is crucial for the proper functioning of insulin secreting cells, we investigated the stress induced regulation of GAD65 transcription. Results The present study shows that SMAR1 regulates GAD65 expression at the transcription level. Using a novel protein-DNA pull-down assay, we show that SMAR1 binding is very specific to GAD65 promoter but not to the other isoform, GAD67. We show that Streptozotocin (STZ mediated DNA damage leads to upregulation of SMAR1 and p53 expression, resulting in elevated levels of GAD65, in both cell lines as well as mouse β-islets. SMAR1 and p53 act synergistically to up-regulate GAD65 expression upon STZ treatment. Conclusion We propose a novel mechanism of GAD65 regulation by synergistic activities of SMAR1 and p53.
Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.
Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi
2018-05-18
The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.
Directory of Open Access Journals (Sweden)
Xiao-Su Zhao
Full Text Available Cyclin-dependent kinase 5 (Cdk5 is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC-interacting factor 1 (NIF-1, is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.
Zhao, Xiao-Su; Fu, Wing-Yu; Chien, Winnie W Y; Li, Zhen; Fu, Amy K Y; Ip, Nancy Y
2014-01-01
Cyclin-dependent kinase 5 (Cdk5) is a proline-directed serine/threonine kinase, which plays critical roles in a wide spectrum of neuronal functions including neuronal survival, neurite outgrowth, and synapse development and plasticity. Cdk5 activity is controlled by its specific activators: p35 or p39. While knockout studies reveal that Cdk5/p35 is critical for neuronal migration during early brain development, functions of Cdk5/p35 have been unraveled through the identification of the interacting proteins of p35, most of which are Cdk5/p35 substrates. However, it remains unclear whether p35 can regulate neuronal functions independent of Cdk5 activity. Here, we report that a nuclear protein, nuclear hormone receptor coregulator (NRC)-interacting factor 1 (NIF-1), is a new interacting partner of p35. Interestingly, p35 regulates the functions of NIF-1 independent of Cdk5 activity. NIF-1 was initially discovered as a transcriptional regulator that enhances the transcriptional activity of nuclear hormone receptors. Our results show that p35 interacts with NIF-1 and regulates its nucleocytoplasmic trafficking via the nuclear export pathway. Furthermore, we identified a nuclear export signal on p35; mutation of this site or blockade of the CRM1/exportin-dependent nuclear export pathway resulted in the nuclear accumulation of p35. Intriguingly, blocking the nuclear export of p35 attenuated the nuclear accumulation of NIF-1. These findings reveal a new p35-dependent mechanism in transcriptional regulation that involves the nucleocytoplasmic shuttling of transcription regulators.
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
International Nuclear Information System (INIS)
Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip
2011-01-01
Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.
International Nuclear Information System (INIS)
Fischer, Barbara
2004-01-01
The general objective of this thesis was to identify the cellular mechanisms that govern the induction of apoptosis by ionizing radiations with high linear energy transfer (LET), particularly fast neutrons and carbon ions. It was also attempted to determine the role in these mechanisms of the p53 tumor suppressor protein. For this, lymphoblastoid lines differing by their p53 status have been used: TK6 (p53 + / +), WTK1 (p53 mute) and NH32 (p53 - / -). At first, the study concerned the induction of apoptosis by fast neutrons, and the effects of these radiations have been compared with those of X-rays on cell lines. Results show that for the same irradiation dose, fast neutrons are more efficient than X-rays in terms of inducing apoptosis. This induction of apoptosis also varies according to the p53 status of the cells. These data suggest that fast neutrons activate apoptosis in two distinct ways: a p53-dependent pathway that occurs in the first hours after irradiation, and an independent pathway of p53, which is slower, but also involves caspases. The author then tried to characterize the two active apoptotic signaling pathways in lymphoblastoid lines by fast neutrons, in order to identify the different mechanisms involved in triggering the apoptotic process as a function of p53. Results show that the p53 status not only affects the kinetics of induction of apoptosis but also the nature of active caspases. The p53-dependent apoptosis is associated with the activation of caspases-3, 7, 8 and 9, the cleavage of BID by caspase-8, the fall of Δψm and the release of cytochrome c from mitochondria to cytoplasm. On the other hand, caspase-7 seems to be activated by an independent p53 signaling pathway. In the following experiments, the mechanisms leading to the initiation of apoptotic pathways induced by fast neutrons were explored, and more particularly the activation of caspase-8 in p53-dependent apoptosis. The involvement of the Fas necrosis receptor in the activation
Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer
International Nuclear Information System (INIS)
Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van
2013-01-01
p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
Energy Technology Data Exchange (ETDEWEB)
Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.
2011-12-15
We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.
Kutejova, Eva; Sasai, Noriaki; Shah, Ankita; Gouti, Mina; Briscoe, James
2016-03-21
In the vertebrate neural tube, a morphogen-induced transcriptional network produces multiple molecularly distinct progenitor domains, each generating different neuronal subtypes. Using an in vitro differentiation system, we defined gene expression signatures of distinct progenitor populations and identified direct gene-regulatory inputs corresponding to locations of specific transcription factor binding. Combined with targeted perturbations of the network, this revealed a mechanism in which a progenitor identity is installed by active repression of the entire transcriptional programs of other neural progenitor fates. In the ventral neural tube, sonic hedgehog (Shh) signaling, together with broadly expressed transcriptional activators, concurrently activates the gene expression programs of several domains. The specific outcome is selected by repressive input provided by Shh-induced transcription factors that act as the key nodes in the network, enabling progenitors to adopt a single definitive identity from several initially permitted options. Together, the data suggest design principles relevant to many developing tissues. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong
2010-11-01
Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.
Directory of Open Access Journals (Sweden)
Nishal S Patel
Full Text Available Changes in higher order chromatin organisation have been linked to transcriptional regulation; however, little is known about how such organisation alters during embryonic development or how it is regulated by extrinsic signals. Here we analyse changes in chromatin organisation as neural differentiation progresses, exploiting the clear spatial separation of the temporal events of differentiation along the elongating body axis of the mouse embryo. Combining fluorescence in situ hybridisation with super-resolution structured illumination microscopy, we show that chromatin around key differentiation gene loci Pax6 and Irx3 undergoes both decompaction and displacement towards the nuclear centre coincident with transcriptional onset. Conversely, down-regulation of Fgf8 as neural differentiation commences correlates with a more peripheral nuclear position of this locus. During normal neural differentiation, fibroblast growth factor (FGF signalling is repressed by retinoic acid, and this vitamin A derivative is further required for transcription of neural genes. We show here that exposure to retinoic acid or inhibition of FGF signalling promotes precocious decompaction and central nuclear positioning of differentiation gene loci. Using the Raldh2 mutant as a model for retinoid deficiency, we further find that such changes in higher order chromatin organisation are dependent on retinoid signalling. In this retinoid deficient condition, FGF signalling persists ectopically in the elongating body, and importantly, we find that inhibiting FGF receptor (FGFR signalling in Raldh2-/- embryos does not rescue differentiation gene transcription, but does elicit both chromatin decompaction and nuclear position change. These findings demonstrate that regulation of higher order chromatin organisation during differentiation in the embryo can be uncoupled from the machinery that promotes transcription and, for the first time, identify FGF as an extrinsic signal that
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Glucocorticoid control of gene transcription in neural tissue
Morsink, Maarten Christian
2007-01-01
Glucocorticoid hormones exert modulatory effects on neural function in a delayed genomic fashion. The two receptor types that can bind glucocorticoids, the mineralocorticoid receptor (MR) and the glucocorticoid receptor (GR), are ligand-inducible transcription factors. Therefore, changes in gene
Directory of Open Access Journals (Sweden)
Armin Wiegering
2017-04-01
Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number
Directory of Open Access Journals (Sweden)
Luciano de Souza Santos
2017-01-01
Full Text Available Xylopine is an aporphine alkaloid that has cytotoxic activity to cancer cells. In this study, the underlying mechanism of xylopine cytotoxicity was assessed in human colon carcinoma HCT116 cells. Xylopine displayed potent cytotoxicity in different cancer cell lines in monolayer cultures and in a 3D model of cancer multicellular spheroids formed from HCT116 cells. Typical morphology of apoptosis, cell cycle arrest in the G2/M phase, increased internucleosomal DNA fragmentation, loss of the mitochondrial transmembrane potential, and increased phosphatidylserine externalization and caspase-3 activation were observed in xylopine-treated HCT116 cells. Moreover, pretreatment with a caspase-3 inhibitor (Z-DEVD-FMK, but not with a p53 inhibitor (cyclic pifithrin-α, reduced xylopine-induced apoptosis, indicating induction of caspase-mediated apoptosis by the p53-independent pathway. Treatment with xylopine also caused an increase in the production of reactive oxygen/nitrogen species (ROS/RNS, including hydrogen peroxide and nitric oxide, but not superoxide anion, and reduced glutathione levels were decreased in xylopine-treated HCT116 cells. Application of the antioxidant N-acetylcysteine reduced the ROS levels and xylopine-induced apoptosis, indicating activation of ROS-mediated apoptosis pathway. In conclusion, xylopine has potent cytotoxicity to different cancer cell lines and is able to induce oxidative stress and G2/M phase arrest, triggering caspase-mediated apoptosis by the p53-independent pathway in HCT116 cells.
Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.
Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei
2016-11-01
Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.
Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V
2014-11-01
Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in
DEFF Research Database (Denmark)
Danielsen, B; Sørensen, I J; Nybo, Mads
1997-01-01
precursor protein beta2M was observed. This binding was also enhanced at slightly acid pH, most pronounced at pH 5.0. The results of this study indicate that SAP can exhibit both Ca2(+)-dependent and -independent binding to ligands involved in amyloid fibril formation and that the binding is enhanced under...... and beta2M) by ELISA. An increase in the dose-dependent binding of SAP to heparan sulfate, AA-protein and beta2M was observed as the pH decreased from 8.0 to 5.0. Furthermore, a lower, but significant Ca2(+)-independent binding of SAP to heparan sulfate, dermatan sulfate, AA protein and the amyloid...
Zhou, Tian; Dong, Qinglei; Shen, Yang; Wu, Wei; Wu, Haide; Luo, Xianglin; Liao, Xiaoling; Wang, Guixue
Micro/nanoparticles could cause adverse effects on cardiovascular system and increase the risk for cardiovascular disease-related events. Nanoparticles prepared from poly(ethylene glycol) (PEG)- b -poly( ε -caprolactone) (PCL), namely PEG- b -PCL, a widely studied biodegradable copolymer, are promising carriers for the drug delivery systems. However, it is unknown whether polymeric PEG- b -PCL nano-micelles give rise to potential complications of the cardiovascular system. Zebrafish were used as an in vivo model to evaluate the effects of PEG- b -PCL nano-micelle on cardiovascular development. The results showed that PEG- b -PCL nano-micelle caused embryo mortality as well as embryonic and larval malformations in a dose-dependent manner. To determine PEG- b -PCL nano-micelle effects on embryonic angiogenesis, a critical process in zebrafish cardiovascular development, growth of intersegmental vessels (ISVs) and caudal vessels (CVs) in flk1-GFP transgenic zebrafish embryos using fluorescent stereomicroscopy were examined. The expression of fetal liver kinase 1 (flk1), an angiogenic factor, by real-time quantitative polymerase chain reaction (qPCR) and in situ whole-mount hybridization were also analyzed. PEG- b -PCL nano-micelle decreased growth of ISVs and CVs, as well as reduced flk1 expression in a concentration-dependent manner. Parallel to the inhibitory effects on angiogenesis, PEG- b -PCL nano-micelle exposure upregulated p53 pro-apoptotic pathway and induced cellular apoptosis in angiogenic regions by qPCR and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) apoptosis assay. This study further showed that inhibiting p53 activity, either by pharmacological inhibitor or RNA interference, could abrogate the apoptosis and angiogenic defects caused by PEG- b -PCL nano-micelles, indicating that PEG- b -PCL nano-micelle inhibits angiogenesis by activating p53-mediated apoptosis. This study indicates that polymeric PEG- b -PCL nano-micelle could
Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA
DEFF Research Database (Denmark)
Glahder, Jacob-Andreas Harald; Norrild, Bodil
2011-01-01
Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...
Immunohistochemical study of p53, pRb, p16 in esophageal cancer
International Nuclear Information System (INIS)
Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee
1998-01-01
To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs
ARF and ATM/ATR cooperate in p53-mediated apoptosis upon oncogenic stress
International Nuclear Information System (INIS)
Pauklin, Siim; Kristjuhan, Arnold; Maimets, Toivo; Jaks, Viljar
2005-01-01
Induction of apoptosis is pivotal for eliminating cells with damaged DNA or deregulated proliferation. We show that tumor suppressor ARF and ATM/ATR kinase pathways cooperate in the induction of apoptosis in response to elevated expression of c-myc, β-catenin or human papilloma virus E7 oncogenes. Overexpression of oncogenes leads to the formation of phosphorylated H2AX foci, induction of Rad51 protein levels and ATM/ATR-dependent phosphorylation of p53. Inhibition of ATM/ATR kinases abolishes both induction of Rad51 and phosphorylation of p53, and remarkably reduces the level of apoptosis induced by co-expression of oncogenes and ARF. However, the induction of apoptosis is downregulated in p53-/- cells and does not depend on activities of ATM/ATR kinases, indicating that efficient induction of apoptosis by oncogene activation depends on coordinated action of ARF and ATM/ATR pathways in the regulation of p53
Directory of Open Access Journals (Sweden)
Mona Meyer
Full Text Available Acute myeloid leukemia (AML is a clonal disease originating from myeloid progenitor cells with a heterogeneous genetic background. High-dose cytarabine is used as the standard consolidation chemotherapy. Oncogenic RAS mutations are frequently observed in AML, and are associated with beneficial response to cytarabine. Why AML-patients with oncogenic RAS benefit most from high-dose cytarabine post-remission therapy is not well understood. Here we used bone marrow cells expressing a conditional MLL-ENL-ER oncogene to investigate the interaction of oncogenic RAS and chemotherapeutic agents. We show that oncogenic RAS synergizes with cytotoxic agents such as cytarabine in activation of DNA damage checkpoints, resulting in a p53-dependent genetic program that reduces clonogenicity and increases myeloid differentiation. Our data can explain the beneficial effects observed for AML patients with oncogenic RAS treated with higher dosages of cytarabine and suggest that induction of p53-dependent differentiation, e.g. by interfering with Mdm2-mediated degradation, may be a rational approach to increase cure rate in response to chemotherapy. The data also support the notion that the therapeutic success of cytotoxic drugs may depend on their ability to promote the differentiation of tumor-initiating cells.
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, Akihisa
2002-01-01
We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)
Survivin inhibits anti-growth effect of p53 activated by aurora B
International Nuclear Information System (INIS)
Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee
2005-01-01
Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Directory of Open Access Journals (Sweden)
Callihan Phillip
2008-12-01
Full Text Available Abstract Background Lysophospholipids regulate the morphology and growth of neurons, neural cell lines, and neural progenitors. A stable human neural progenitor cell line is not currently available in which to study the role of lysophospholipids in human neural development. We recently established a stable, adherent human embryonic stem cell-derived neuroepithelial (hES-NEP cell line which recapitulates morphological and phenotypic features of neural progenitor cells isolated from fetal tissue. The goal of this study was to determine if hES-NEP cells express functional lysophospholipid receptors, and if activation of these receptors mediates cellular responses critical for neural development. Results Our results demonstrate that Lysophosphatidic Acid (LPA and Sphingosine-1-phosphate (S1P receptors are functionally expressed in hES-NEP cells and are coupled to multiple cellular signaling pathways. We have shown that transcript levels for S1P1 receptor increased significantly in the transition from embryonic stem cell to hES-NEP. hES-NEP cells express LPA and S1P receptors coupled to Gi/o G-proteins that inhibit adenylyl cyclase and to Gq-like phospholipase C activity. LPA and S1P also induce p44/42 ERK MAP kinase phosphorylation in these cells and stimulate cell proliferation via Gi/o coupled receptors in an Epidermal Growth Factor Receptor (EGFR- and ERK-dependent pathway. In contrast, LPA and S1P stimulate transient cell rounding and aggregation that is independent of EGFR and ERK, but dependent on the Rho effector p160 ROCK. Conclusion Thus, lysophospholipids regulate neural progenitor growth and morphology through distinct mechanisms. These findings establish human ES cell-derived NEP cells as a model system for studying the role of lysophospholipids in neural progenitors.
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M
1996-12-20
In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
Energy Technology Data Exchange (ETDEWEB)
Shukla, Shatrunajay [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), Hamdard Nagar, New Delhi ‐110062 (India); Sharma, Ankita [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Pandey, Vivek Kumar [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Academy of Scientific and Innovative Research (India); Raisuddin, Sheikh [Department of Medical Elementology and Toxicology, Jamia Hamdard (Hamdard University), Hamdard Nagar, New Delhi ‐110062 (India); Kakkar, Poonam, E-mail: kakkarp59@gmail.com [Herbal Research Section, CSIR — Indian Institute of Toxicology Research, Post Box No. 80, Mahatma Gandhi Marg, Lucknow‐226001 (India); Academy of Scientific and Innovative Research (India)
2016-01-15
Post-translational modifications i.e. phosphorylation and acetylation are pivotal requirements for proper functioning of eukaryotic proteins. The current study aimed to decode the impact of acetylation/deacetylation of non-histone targets i.e. FoxO1/3a and p53 of sirtuins (NAD{sup +} dependent enzymes with lysine deacetylase activity) in berberine treated human hepatoma cells. Berberine (100 μM) inhibited sirtuins significantly (P < 0.05) at transcriptional level as well as at translational level. Combination of nicotinamide (sirtuin inhibitor) with berberine potentiated sirtuins inhibition and increased the expression of FoxO1/3a and phosphorylation of p53 tumor suppressor protein. As sirtuins deacetylate non-histone targets including FoxO1/3a and p53, berberine increased the acetylation load of FoxO1/3a and p53 proteins. Acetylated FoxO and p53 proteins transcriptionally activate BH3-only proteins Bim and PUMA (3.89 and 3.87 fold respectively, P<0.001), which are known as direct activator of pro-apoptotic Bcl-2 family protein Bax that culminated into mitochondria mediated activation of apoptotic cascade. Bim/PUMA knock-down showed no changes in sirtuins' expression while cytotoxicity induced by berberine and nicotinamide was curtailed up to 28.3% (P < 0.001) and it restored pro/anti apoptotic protein ratio in HepG2 cells. Sirtuins inhibition was accompanied by decline in NAD{sup +}/NADH ratio, ATP generation, enhanced ROS production and decreased mitochondrial membrane potential. TEM analysis confirmed mitochondrial deterioration and cell damage. SRT-1720 (1–10 μM), a SIRT-1 activator, when pre-treated with berberine (25 μM), reversed sirtuins expression comparable to control and significantly restored the cell viability (P < 0.05). Thus, our findings suggest that berberine mediated sirtuins inhibition resulting into FoxO1/3a and p53 acetylation followed by BH3-only protein Bim/PUMA activation may in part be responsible for mitochondria
Directory of Open Access Journals (Sweden)
Paramita Banerjee Sawant
Full Text Available Hypoxia is a global phenomenon affecting recruitment as well as the embryonic development of aquatic fauna. The present study depicts hypoxia induced disruption of the intrinsic pathway of programmed cell death (PCD, leading to embryonic malformation in the goldfish, Carrasius auratus. Constant hypoxia induced the early expression of pro-apoptotic/tumor suppressor p53 and concomitant expression of the cell death molecule, caspase-3, leading to high level of DNA damage and cell death in hypoxic embryos, as compared to normoxic ones. As a result, the former showed delayed 4 and 64 celled stages and a delay in appearance of epiboly stage. Expression of p53 efficiently switched off expression of the anti-apoptotic Bcl-2 during the initial 12 hours post fertilization (hpf and caused embryonic cell death. However, after 12 hours, simultaneous downregulation of p53 and Caspase-3 and exponential increase of Bcl-2, caused uncontrolled cell proliferation and prevented essential programmed cell death (PCD, ultimately resulting in significant (p<0.05 embryonic malformation up to 144 hpf. Evidences suggest that uncontrolled cell proliferation after 12 hpf may have been due to downregulation of p53 abundance, which in turn has an influence on upregulation of anti-apoptotic Bcl-2. Therefore, we have been able to show for the first time and propose that hypoxia induced downregulation of p53 beyond 12 hpf, disrupts PCD and leads to failure in normal differentiation, causing malformation in gold fish embryos.
p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*
Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping
2011-01-01
The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasm...
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression
Directory of Open Access Journals (Sweden)
Takahiro Ebata
2017-01-01
Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.
Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.
Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J
2006-04-01
p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.
International Nuclear Information System (INIS)
Willers, H.; Powell, S.N.; Dahm-Daphi, J.
2003-01-01
Full text: p53 is known to suppress spontaneous homologous recombination (HR), while its role in non-homologous recombination (NHR) remains to be clarified. Here, we sought to determine the influence of p53 on the repair of chromosomal double-strand breaks (DSBs) by HR or NHR using specially designed recombination substrates that integrate into the genome. Isogenic mouse fibroblast pairs with or without expression of exogenous p53 protein were utilized. A reporter plasmid carrying a mutated XGPRT gene was chromosomally integrated and DSBs were generated within the plasmid by the I-SceI endonuclease. Subsequent homology-mediated repair from an episomal donor resulted in XGPRT reconstitution and cellular resistance to a selection antibiotic. Analogously, the repair of chromosomal I-SceI breaks by NHR using another novel reporter plasmid restored XGPRT translation. For p53-null cells, the mean frequency of I-SceI break repair via HR was 5.5 x 10 -4 . The p53-Val135 mutant, which previously has been shown to suppress spontaneous HR by 14-fold employing the same cell system and reporter gene, only caused a 2- to 3-fold suppression of break-induced HR. In contrast, a dramatic effect of p53 on repair via NHR was found. Preliminary sequence analysis indicated that there was at least a 1000-fold reduction of illegitimate repair events resulting in loss of sequence at the break sites. The observed effects were mediated by p53 mutants defective in regulation of the cell-cycle and apoptosis. The main findings were: (1) p53 virtually blocked illegitimate rejoining of chromosomal ends. (2) The suppression of homologous DSB repair was less pronounced than the inhibition of spontaneous HR. We hypothesize that p53 allows to a certain extent error-free homology-dependent repair to proceed, while blocking error-prone NHR. The data support and extent a previous model, in which p53 maintains genomic stability by regulating recombination independently of its transactivation function
Lee, Soonduck; Kim, Jinsun; Jung, Samil; Li, Chengping; Yang, Young; Kim, Keun Il; Lim, Jong-Seok; Kim, Yonghwan; Cheon, Choong-Il; Lee, Myeong-Sok
2015-03-01
Vitamin C is considered as an important anticancer therapeutic agent although this view is debatable. In this study, we introduce a physiological mechanism demonstrating how vitamin C exerts anticancer activity that induces cell cycle arrest and apoptosis. Our previous and current data reveal that p53 tumor suppressor is the prerequisite factor for stronger anticancer effects of vitamin C. In addition, vitamin C-mediated cancer cell cytotoxicity appears to be achieved at least partly through the downregulation of the p34SEI-1 oncoprotein. Our previous study showed that p34SEI-1 increases the survival of various types of cancer cells by inhibiting their apoptosis. Present data suggest that vitamin C treatment decreases the p34SEI-1 expression at the protein level and therefore alleviates its anti-apoptotic activity. Of note, SIAH1, E3 ubiquitin ligase, appears to be responsible for the p34SEI-1 polyubiquitination and its subsequent degradation, which is dependent on p53. In summary, vitamin C increases cancer cell death by inducing SIAH1-mediated polyubiquitination/degradation of the p34SEI-1 oncoprotein in a p53-dependent manner.
Iron deprivation induces apoptosis independently of p53 in human and murine tumour cells
Czech Academy of Sciences Publication Activity Database
Truksa, Jaroslav; Kovář, Jan; Valenta, Tomáš; Ehrlichová, Marie; Polák, J.; Naumann, P. W.
2003-01-01
Roč. 36, č. 4 (2003), s. 199-213 ISSN 0960-7722 R&D Projects: GA ČR GA301/01/0041 Keywords : iron deprivation * p53 * apoptosis induction Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 1.529, year: 2003
Synergistic induction of profibrotic PAI-1 by TGF-β and radiation depends on p53
International Nuclear Information System (INIS)
Niemantsverdriet, Maarten; Jong, Edwin de; Langendijk, Johannes A.; Kampinga, Harm H.; Coppes, Robert P.
2010-01-01
Radiation-induced fibrosis is a severe side effect of radiotherapy. TGF-β and radiation synergistically induce expression of the profibrotic PAI-1 gene and this cooperation potentially involves p53. Here, we demonstrate that p53 is both indispensable and sufficient for the radiation effect inducing synergistic activation of PAI-1 by radiation and TGF-β.
2016-09-01
in this progress report: p53 triple-negative breast cancer subtypes gene expression somatic cell genetics CRISPR / Cas 3. ACCOMPLISHMENTS Major...report, we described the creation of an isogenic p53 mutant TNBC cell line panel using CRISPR / Cas -mediated genome editing8 and the resultant...LOF null state. To validate that mutant p53 is directly responsible for this altered transcription, we will use the same CRISPR -mediated genome
Sun, Pei; Wu, Haoyang; Huang, Jiali; Xu, Ying; Yang, Feng; Zhang, Qi; Xu, Xingang
2018-05-22
Porcine epidemic diarrhea virus (PEDV), an enteropathogenic Alphacoronavirus, has caused enormous economic losses in the swine industry. p53 protein exists in a wide variety of animal cells, which is involved in cell cycle regulation, apoptosis, cell differentiation and other biological functions. In this study, we investigated the effects of PEDV infection on the cell cycle of Vero cells and p53 activation. The results demonstrated that PEDV infection induces cell cycle arrest at G0/G1 phase in Vero cells, while UV-inactivated PEDV does not cause cell cycle arrest. PEDV infection up-regulates the levels of p21, cdc2, cdk2, cdk4, Cyclin A protein and down-regulates Cyclin E protein. Further research results showed that inhibition of p53 signaling pathway can reverse the cell cycle arrest in G0/G1 phase induced by PEDV infection and cancel out the up-regulation of p21 and corresponding Cyclin/cdk mentioned above. In addition, PEDV infection of the cells synchronized in various stages of cell cycle showed that viral subgenomic RNA and virus titer were higher in the cells released from G0/G1 phase synchronized cells than that in the cells released from the G1/S phase and G2/M phase synchronized or asynchronous cells after 18 h p.i.. This is the first report to demonstrate that the p53-dependent pathway plays an important role in PEDV induced cell cycle arrest and beneficially contributes to viral infection. Copyright © 2018 Elsevier B.V. All rights reserved.
The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.
Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang
2017-05-01
This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.
International Nuclear Information System (INIS)
Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir
2016-01-01
The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice
Rani, Reena; Li, Jie; Pang, Qishen
2008-01-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147
Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.
Rani, Reena; Li, Jie; Pang, Qishen
2008-12-01
Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence.
Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J
2009-06-19
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.
The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.
Directory of Open Access Journals (Sweden)
Peiyuan Jia
Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
International Nuclear Information System (INIS)
Yasuda, Takako; Nagata, Kento; Igarashi, Kento; Watanabe-Asaka, Tomomi; Oda, Shoji; Mitani, Hiroshi; Kimori, Yoshitaka
2016-01-01
The tumor suppressor protein, p53, plays pivotal roles in regulating apoptosis and proliferation in the embryonic and adult central nervous system (CNS) following neuronal injuries such as those induced by ionizing radiation. There is increasing evidence that p53 negatively regulates the self-renewal of neural stem cells in the adult murine brain; however, it is still unknown whether p53 is essential for self-renewal in the injured developing CNS. Previously, we demonstrated that the numbers of apoptotic cells in medaka (Oryzias latipes) embryos decreased in the absence of p53 at 12-24 h after irradiation with 10-Gy gamma rays. Here, we used histology to examine the later morphological development of the irradiated medaka brain. In p53-deficient larvae, the embryonic brain possessed similar vacuoles in the brain and retina, although the vacuoles were much smaller and fewer than those found in wild-type embryos. At the time of hatching (6 days after irradiation), no brain abnormality was observed. In contrast, severe disorganized neuronal arrangements were still present in the brain of irradiated wild-type embryos. Our present results demonstrated that self-renewal of the brain tissue completed faster in the absence of p53 than wild type at the time of hatching because p53 reduces the acute severe neural apoptosis induced by irradiation, suggesting that p53 is not essential for tissue self-renewal in developing brain. (author)
Choi, Hyun Kyung; Ryu, Hwani; Son, A-Rang; Seo, Bitna; Hwang, Sang-Gu; Song, Jie-Young; Ahn, Jiyeon
2016-04-01
To identify novel small molecules that induce selective cancer cell death, we screened a chemical library containing 1040 compounds in HT29 colon cancer and CCD18-Co normal colon cells, using a phenotypic cell-based viability assay system with the Cell Counting Kit-8 (CCK-8). We discovered a novel anthraquinone derivative, N-(4-[{(9,10-dioxo-9,10-dihydro-1-anthracenyl)sulfonyl}amino]phenyl)-N-methylacetamide (IMP1338), which was cytotoxic against the human colon cancer cells tested. The MTT cell viability assay showed that treatment with IMP1338 selectively inhibited HCT116, HCT116 p53(-/-), HT29, and A549 cancer cell proliferation compared to that of Beas2B normal epithelial cells. To elucidate the cellular mechanism underlying the cytotoxicity of IMP1338, we examined the effect of IMP1338 on the cell cycle distribution and death of cancer cells. IMP1338 treatment significantly arrested the cell cycle at S and G2/M phases by DNA damage and led to apoptotic cell death, which was determined using FACS analysis with Annexin V/PI double staining. Furthermore, IMP1338 increased caspase-3 cleavage in wild-type p53, p53 knockout HCT116, and HT29 cells as determined using immunoblotting. In addition, IMP1338 markedly induced the phosphorylation of histone H2AX and Chk1 in both cell lines while the combination of 5-fluorouracil (5-FU) and radiation inhibited the viability of HCT116, HCT116 p53(-/-), and HT29 cells compared to 5-FU or radiation alone. Our findings indicated that IMP1338 induced p53-independent cell death through S and G2/M phase arrest as well as DNA damage. These results provide a basis for future investigations assessing the promising anticancer properties of IMP1338. Copyright © 2016. Published by Elsevier Masson SAS.
Directory of Open Access Journals (Sweden)
Mandar Dave
2017-12-01
Full Text Available The differential expression of two closelyassociated cyclooxygenase isozymes, COX-1 and COX-2, exhibited functions beyond eicosanoid metabolism. We hypothesized that COX-1 or COX-2 knockout lung fibroblasts may display altered protein profiles which may allow us to further differentiate the functional roles of these isozymes at the molecular level. Proteomic analysis shows constitutive production of macrophage migration inhibitory factor (MIF in lung fibroblasts derived from COX-2−/− but not wild-type (WT or COX-1−/− mice. MIF was spontaneously released in high levels into the extracellular milieu of COX2−/− fibroblasts seemingly from the preformed intracellular stores, with no change in the basal gene expression of MIF. The secretion and regulation of MIF in COX-2−/− was “prostaglandin-independent.” GO analysis showed that concurrent with upregulation of MIF, there is a significant surge in expression of genes related to fibroblast growth, FK506 binding proteins, and isomerase activity in COX-2−/− cells. Furthermore, COX-2−/− fibroblasts also exhibit a significant increase in transcriptional activity of various regulators, antagonists, and co-modulators of p53, as well as in the expression of oncogenes and related transcripts. Integrative Oncogenomics Cancer Browser (IntroGen analysis shows downregulation of COX-2 and amplification of MIF and/or p53 activity during development of glioblastomas, ependymoma, and colon adenomas. These data indicate the functional role of the MIF-COX-p53 axis in inflammation and cancer at the genomic and proteomic levels in COX-2-ablated cells. This systematic analysis not only shows the proinflammatory state but also unveils a molecular signature of a pro-oncogenic state of COX-1 in COX-2 ablated cells.
Sun, GuoQiang; Yu, Ruth T.; Evans, Ronald M.; Shi, Yanhong
2007-01-01
TLX is a transcription factor that is essential for neural stem cell proliferation and self-renewal. However, the molecular mechanism of TLX-mediated neural stem cell proliferation and self-renewal is largely unknown. We show here that TLX recruits histone deacetylases (HDACs) to its downstream target genes to repress their transcription, which in turn regulates neural stem cell proliferation. TLX interacts with HDAC3 and HDAC5 in neural stem cells. The HDAC5-interaction domain was mapped to ...
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
Flamini, Valentina; Ghadiali, Rachel S; Antczak, Philipp; Rothwell, Amy; Turnbull, Jeremy E; Pisconti, Addolorata
2018-03-13
Satellite cells are adult muscle stem cells residing in a specialized niche that regulates their homeostasis. How niche-generated signals integrate to regulate gene expression in satellite cell-derived myoblasts is poorly understood. We undertook an unbiased approach to study the effect of the satellite cell niche on satellite cell-derived myoblast transcriptional regulation and identified the tumor suppressor p53 as a key player in the regulation of myoblast quiescence. After activation and proliferation, a subpopulation of myoblasts cultured in the presence of the niche upregulates p53 and fails to differentiate. When satellite cell self-renewal is modeled ex vivo in a reserve cell assay, myoblasts treated with Nutlin-3, which increases p53 levels in the cell, fail to differentiate and instead become quiescent. Since both these Nutlin-3 effects are rescued by small interfering RNA-mediated p53 knockdown, we conclude that a tight control of p53 levels in myoblasts regulates the balance between differentiation and return to quiescence. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna
2015-01-01
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
Energy Technology Data Exchange (ETDEWEB)
Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)
2015-08-15
Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at
The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Andrew Fesler
2016-04-01
Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Mikael S Lindström
Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit
2017-01-01
Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454
Choudhury, Sreetama; Ghosh, Sayan; Mukherjee, Sudeshna; Gupta, Payal; Bhattacharya, Saurav; Adhikary, Arghya; Chattopadhyay, Sreya
2016-12-01
Molecular mechanisms involved in arsenic-induced toxicity are complex and elusive. Liver is one of the most favored organs for arsenic toxicity as methylation of arsenic occurs mostly in the liver. In this study, we have selected a range of environmentally relevant doses of arsenic to examine the basis of arsenic toxicity and the role of pomegranate fruit extract (PFE) in combating it. Male Swiss albino mice exposed to different doses of arsenic presented marked hepatic injury as evident from histological and electron microscopic studies. Increased activities of enzymes alanine aminotransferase, aspartate aminotransferase, lactate dehydrogenase and alkaline phosphatase corroborated extensive liver damage. It was further noted that arsenic exposure initiated reactive oxygen species (ROS)-dependent apoptosis in the hepatocytes involving loss of mitochondrial membrane potential. Arsenic significantly increased nuclear translocation of nuclear factor erythroid 2-related factor 2 (Nrf2) and nuclear factor-κB (NF-κB), coupled with increase in phosphorylated Iκ-B, possibly as adaptive cellular survival strategies. Arsenic-induced oxidative DNA damage to liver cells culminated in p53 activation and increased expression of p53 targets like miR-34a and Bax. Pomegranate polyphenols are known to possess remarkable antioxidant properties and are capable of protecting normal cells from various stimuli-induced oxidative stress and toxicities. We explored the protective role of PFE in ameliorating arsenic-induced hepatic damage. PFE was shown to reduce ROS generation in hepatocytes, thereby reducing arsenic-induced Nrf2 activation. PFE also inhibited arsenic-induced NF-κB-inflammatory pathway. Data revealed that PFE reversed arsenic-induced hepatotoxicity and apoptosis by modulating the ROS/Nrf2/p53-miR-34a axis. For the first time, we have mapped the possible signaling pathways associated with arsenic-induced hepatotoxicity and its rescue by pomegranate polyphenols. Copyright
Kim, Jong-Sik; Baek, Seung Joon; Bottone, Frank G; Sali, Tina; Eling, Thomas E
2005-09-01
To investigate the function of 15-lipoxygenase-1 (15-LOX-1) in human colorectal cancer, we overexpressed 15-LOX-1 in HCT-116 human colorectal cancer cells. Clones expressing the highest levels of 15-LOX-1 displayed reduced viability compared with the HCT-116-Vector control cells. Further, by cell cycle gene array analyses, the cyclin-dependent kinase inhibitor p21WAF1/CIP1 and MDM2 genes were up-regulated in 15-LOX-1-overexpressing cells. The induction of p21(WAF1/CIP1) and MDM2 were linked to activation of p53 by 15-LOX-1, as there was a dramatic induction of phosphorylated p53 (Ser15) in 15-LOX-1-overesxpressing cells. However, the 15-LOX-1 metabolites 13(S)-hydroxyoctadecadienoic acid and 15(S)-hydroxyeicosatetraenoic acid failed to induce phosphorylation of p53 at Ser15, and the 15-LOX-1 inhibitor PD146176 did not inhibit the phosphorylation of p53 at Ser15 in 15-LOX-1-overexpressing cells. Nonetheless, the growth-inhibitory effects of 15-LOX-1 were p53 dependent, as 15-LOX-1 overexpression had no effect on cell growth in p53 (-/-) HCT-116 cells. Finally, treatment of HCT-116-15-LOX-1 cells with different kinase inhibitors suggested that the effects of 15-LOX-1 on p53 phosphorylation and activation were due to effects on DNA-dependent protein kinase. Collectively, these findings suggest a new mechanism to explain the biological activity of 15-LOX-1, where 15-LOX plays a stoichiometric role in activating a DNA-dependent protein kinase-dependent pathway that leads to p53-dependent growth arrest.
Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.
2008-01-01
Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the
DREAM Controls the On/Off Switch of Specific Activity-Dependent Transcription Pathways
Mellström, Britt; Sahún, Ignasi; Ruiz-Nuño, Ana; Murtra, Patricia; Gomez-Villafuertes, Rosa; Savignac, Magali; Oliveros, Juan C.; Gonzalez, Paz; Kastanauskaite, Asta; Knafo, Shira; Zhuo, Min; Higuera-Matas, Alejandro; Errington, Michael L.; Maldonado, Rafael; DeFelipe, Javier; Jefferys, John G. R.; Bliss, Tim V. P.; Dierssen, Mara
2014-01-01
Changes in nuclear Ca2+ homeostasis activate specific gene expression programs and are central to the acquisition and storage of information in the brain. DREAM (downstream regulatory element antagonist modulator), also known as calsenilin/KChIP-3 (K+ channel interacting protein 3), is a Ca2+-binding protein that binds DNA and represses transcription in a Ca2+-dependent manner. To study the function of DREAM in the brain, we used transgenic mice expressing a Ca2+-insensitive/CREB-independent dominant active mutant DREAM (daDREAM). Using genome-wide analysis, we show that DREAM regulates the expression of specific activity-dependent transcription factors in the hippocampus, including Npas4, Nr4a1, Mef2c, JunB, and c-Fos. Furthermore, DREAM regulates its own expression, establishing an autoinhibitory feedback loop to terminate activity-dependent transcription. Ablation of DREAM does not modify activity-dependent transcription because of gene compensation by the other KChIP family members. The expression of daDREAM in the forebrain resulted in a complex phenotype characterized by loss of recurrent inhibition and enhanced long-term potentiation (LTP) in the dentate gyrus and impaired learning and memory. Our results indicate that DREAM is a major master switch transcription factor that regulates the on/off status of specific activity-dependent gene expression programs that control synaptic plasticity, learning, and memory. PMID:24366545
Directory of Open Access Journals (Sweden)
Xiaoli Li
2018-02-01
Full Text Available Summary: Overactive p53 has been proposed as an important pathophysiological factor for bone marrow failure syndromes, including Fanconi anemia (FA. Here, we report a p53-dependent effect on hematopoietic stem and progenitor cell (HSPC proliferation in mice deficient for the FA gene Fanca. Deletion of p53 in Fanca−/− mice leads to replicative exhaustion of the hematopoietic stem cell (HSC in transplant recipients. Using Fanca−/− HSCs expressing the separation-of-function mutant p53515C transgene, which selectively impairs the p53 function in apoptosis but keeps its cell-cycle checkpoint activities intact, we show that the p53 cell-cycle function is specifically required for the regulation of Fanca−/− HSC proliferation. Our results demonstrate that p53 plays a compensatory role in preventing FA HSCs from replicative exhaustion and suggest a cautious approach to manipulating p53 signaling as a therapeutic utility in FA. : In this article, Pang and colleagues demonstrate a p53-dependent HSPC proliferation regulation in mice deficient for the Fanca gene in the Fanconi anemia (FA pathway. They show that the p53 cell-cycle function is specifically required for the regulation of FA HSC proliferation. These results suggest that overactive p53 may represent a compensatory checkpoint mechanism for FA HSC proliferation. Keywords: p53, bone marrow failure, Fanconi anemia, hematopoietic stem and progenitor cells, apoptosis, cell cycle, proliferation
A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.
Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping
2018-05-23
PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.
Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah
2017-10-01
In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile
The contribution of p53 and Y chromosome long arm genes to regulation of apoptosis in mouse testis.
Lech, Tomasz; Styrna, Józefa; Kotarska, Katarzyna
2018-03-01
Apoptosis of excessive or defective germ cells is a natural process occurring in mammalian testes. Tumour suppressor protein p53 is involved in this process both in developing and adult male gonads. Its contribution to testicular physiology is known to be modified by genetic background. The aim of this study was to evaluate the combined influence of the p53 and Y chromosome long arm genes on male germ cell apoptosis. Knockout of the transformation related protein 53 (Trp53) gene was introduced into congenic strains: B10.BR (intact Y chromosome) and B10.BR-Ydel (Y chromosome with a deletion in the long arm). The level of apoptosis in the testes of 19-day-old and 3-month-old male mice was determined using the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate in situ nick-end labelling (TUNEL) method. The study revealed that although p53 is involved in germ cell apoptosis in peripubertal testes, this process can also be mediated by p53-independent mechanisms. However, activation of p53-independent apoptotic pathways in the absence of the p53 protein requires engagement of the multicopy Yq genes and was not observed in gonads of B10.BR-Ydel-p53-/- males. The role of Yq genes in the regulation of testicular apoptosis seems to be restricted to the initial wave of spermatogenesis and is not evident in adult gonads. The study confirmed, instead, that p53 does participate in spontaneous apoptosis in mature testes.
Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A
2009-05-01
Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.
An N-terminal Region of Mot-2 Binds to p53 In Vitro
Directory of Open Access Journals (Sweden)
Sunil C. Kaul
2001-01-01
Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.
Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,
Apoptosis in spermatogonia irradiated P53 null mice
International Nuclear Information System (INIS)
Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.
2007-01-01
Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after
Growth of the Developing Cerebral Cortex Is Controlled by MicroRNA-7 through the p53 Pathway
Directory of Open Access Journals (Sweden)
Andrew Pollock
2014-05-01
Full Text Available Proper growth of the mammalian cerebral cortex is crucial for normal brain functions and is controlled by precise gene-expression regulation. Here, we show that microRNA-7 (miR-7 is highly expressed in cortical neural progenitors and describe miR-7 sponge transgenic mice in which miR-7-silencing activity is specifically knocked down in the embryonic cortex. Blocking miR-7 function causes microcephaly-like brain defects due to reduced intermediate progenitor (IP production and apoptosis. Upregulation of miR-7 target genes, including those implicated in the p53 pathway, such as Ak1 and Cdkn1a (p21, is responsible for abnormalities in neural progenitors. Furthermore, ectopic expression of Ak1 or p21 and specific blockade of miR-7 binding sites in target genes using protectors in vivo induce similarly reduced IP production. Using conditional miRNA sponge transgenic approaches, we uncovered an unexpected role for miR-7 in cortical growth through its interactions with genes in the p53 pathway.
Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest
Directory of Open Access Journals (Sweden)
Clarke Alan R
2002-11-01
Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.
Badal, Brateil; Solovyov, Alexander; Di Cecilia, Serena; Chan, Joseph Minhow; Chang, Li-Wei; Iqbal, Ramiz; Aydin, Iraz T.; Rajan, Geena S.; Chen, Chen; Abbate, Franco; Arora, Kshitij S.; Tanne, Antoine; Gruber, Stephen B.; Johnson, Timothy M.; Fullen, Douglas R.; Phelps, Robert; Bhardwaj, Nina; Bernstein, Emily; Ting, David T.; Brunner, Georg; Schadt, Eric E.; Greenbaum, Benjamin D.; Celebi, Julide Tok
2017-01-01
BACKGROUND. Melanoma is a heterogeneous malignancy. We set out to identify the molecular underpinnings of high-risk melanomas, those that are likely to progress rapidly, metastasize, and result in poor outcomes. METHODS. We examined transcriptome changes from benign states to early-, intermediate-, and late-stage tumors using a set of 78 treatment-naive melanocytic tumors consisting of primary melanomas of the skin and benign melanocytic lesions. We utilized a next-generation sequencing platform that enabled a comprehensive analysis of protein-coding and -noncoding RNA transcripts. RESULTS. Gene expression changes unequivocally discriminated between benign and malignant states, and a dual epigenetic and immune signature emerged defining this transition. To our knowledge, we discovered previously unrecognized melanoma subtypes. A high-risk primary melanoma subset was distinguished by a 122-epigenetic gene signature (“epigenetic” cluster) and TP53 family gene deregulation (TP53, TP63, and TP73). This subtype associated with poor overall survival and showed enrichment of cell cycle genes. Noncoding repetitive element transcripts (LINEs, SINEs, and ERVs) that can result in immunostimulatory signals recapitulating a state of “viral mimicry” were significantly repressed. The high-risk subtype and its poor predictive characteristics were validated in several independent cohorts. Additionally, primary melanomas distinguished by specific immune signatures (“immune” clusters) were identified. CONCLUSION. The TP53 family of genes and genes regulating the epigenetic machinery demonstrate strong prognostic and biological relevance during progression of early disease. Gene expression profiling of protein-coding and -noncoding RNA transcripts may be a better predictor for disease course in melanoma. This study outlines the transcriptional interplay of the cancer cell’s epigenome with the immune milieu with potential for future therapeutic targeting. FUNDING
Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation
International Nuclear Information System (INIS)
Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki
2001-01-01
We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)
Directory of Open Access Journals (Sweden)
Eugene B. Chang
2013-01-01
Full Text Available Compound K (20-O-beta-D-glucopyranosyl-20(S-protopanaxadiol, CK, an intestinal bacterial metabolite of ginseng protopanaxadiol saponins, has been shown to inhibit cell growth in a variety of cancers. However, the mechanisms are not completely understood, especially in colorectal cancer (CRC. A xenograft tumor model was used first to examine the anti-CRC effect of CK in vivo. Then, multiple in vitro assays were applied to investigate the anticancer effects of CK including antiproliferation, apoptosis and cell cycle distribution. In addition, a qPCR array and western blot analysis were executed to screen and validate the molecules and pathways involved. We observed that CK significantly inhibited the growth of HCT-116 tumors in an athymic nude mouse xenograft model. CK significantly inhibited the proliferation of human CRC cell lines HCT-116, SW-480, and HT-29 in a dose- and time-dependent manner. We also observed that CK induced cell apoptosis and arrested the cell cycle in the G1 phase in HCT-116 cells. The processes were related to the upregulation of p53/p21, FoxO3a-p27/p15 and Smad3, and downregulation of cdc25A, CDK4/6 and cyclin D1/3. The major regulated targets of CK were cyclin dependent inhibitors, including p21, p27, and p15. These results indicate that CK inhibits transcriptional activation of multiple tumor-promoting pathways in CRC, suggesting that CK could be an active compound in the prevention or treatment of CRC.
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D
2014-01-01
TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Role of p53 status in radiation sensitivity and cell cycle progression
International Nuclear Information System (INIS)
Zellars, Richard C.; Loney, Tania; Schott, Ann F.; Davis, Mary A.; Maybaum, Jonathan; Clarke, Michael F.; Lawrence, Theodore S.
1995-01-01
Purpose: Although p53 function plays a major role in G1 arrest after radiation, the influence of p53 status on progress through other phases of the cell cycle and on radiation sensitivity of human tumors is less clear. We investigated these issues using cells with a conditional expression system for wild type p53. Methods: A temperature sensitive murine wild type p53 plasmid was used (Ginsberg D, et al: Mol. Cell.Biol . 11:582, 1991). At the permissive temperature (32 deg. C), this plasmid produces a protein which assumes a conformation that exhibits wild type p53 function. However, when cells are cultured at 38 deg. C, this protein assumes an inactive conformation. HT29 human colon cancer cells (which are p53 mutant) were transduced with this plasmid (designated PEP A and PEP G cells) or a control vector (designated CCH1 cells) using electroporation and Geneticin selection. The presence of murine p53 transcript in the PEP cells was confirmed by Northern analysis. Results: Cells were cultured under 3 conditions: 1) 38 deg. C at all times; 2) 32 deg. C for 24 hours prior to irradiation and 3) 32 deg. C for 24 hours after irradiation. We found that culturing under permissive temperatures produced a small decrease in surviving fraction in the PEP clones (0.61 ± 0.10 and 0.64 ± 0.07, for PEP A and G, respectively) but not the CCH1 controls (1.14 ± 0.15). PEP cells tended to be more radiosensitive than CCH1 cells (even under non-permissive conditions) and demonstrated a trend towards increased radiosensitivity under both Conditions 2 and 3. In addition, flow cytometry revealed that a 24 hour exposure to permissive conditions increased the fraction of cells in G1 slightly and in G2/M substantially. S phase was almost absent. Conclusion: Restoration of p53 function in HT29 human colon cancer cells using this temperature sensitive system produced increased cytotoxicity and radiation sensitivity as well as cell cycle redistribution. It will be important to assess the
Directory of Open Access Journals (Sweden)
L.M. Massoni Neto
2007-08-01
Full Text Available Malignancy of pulmonary large cell carcinomas (LCC increases from classic LCC through LCC with neuroendocrine morphology (LCCNM to large cell neuroendocrine carcinomas (LCNEC. However, the histological classification has sometimes proved to be difficult. Because the malignancy of LCC is highly dependent on proteins with functions in the cell cycle, DNA repair, and apoptosis, p53 has been targeted as a potentially useful biological marker. p53 mutations in lung cancers have been shown to result in expression and protein expression also occurs in the absence of mutations. To validate the importance of both p53 protein expression (by immunostaining and p53 gene mutations in lung LCC (by PCR-single strand conformational polymorphism analysis of exons 5, 6, 7, and 8 and to study their relationships with clinical factors and sub-classification we investigated the correlation of p53 abnormalities in 15 patients with LCC (5 classic LCC, 5 LCNEC, and 5 LCCNM who had undergone resection with curative intent. Of these patients, 5/15 expressed p53 and none had mutant p53 sequences. There was a negative survival correlation with positive p53 immunostaining (P = 0.05. After adjustment for stage, age, gender, chemotherapy, radiotherapy, and histological subtypes by multivariate analysis, p53 expression had an independent impact on survival. The present study indicates that p53 assessment may provide an objective marker for the prognosis of LCC irrespective of morphological variants and suggests that p53 expression is important for outcome prediction in patients with the early stages of LCC. The results reported here should be considered to be initial results because tumors from only 15 patients were studied: 5 each from LCC, LCNEC and LCCNM. This was due to the rarity of these specific diseases.
G2-block after irradiation of cells with different p53 status
International Nuclear Information System (INIS)
Zoelzer, Friedo; Jagetia, Ganesh; Streffer, Christian
2014-01-01
Although it is clear that functional p53 is not required for radiation-induced G 2 block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G 2 compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G 2 phase itself. We observed the movement of BrdU-labeled cells through G 2 and M into G 1 . From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G 2 and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G 2 and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G 2 compartment alone is misleading when differences in the G 2 block are investigated and that the G 2 block itself is indeed independent of functional p53. (orig.) [de
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.
Directory of Open Access Journals (Sweden)
Mariell Pettersson
Full Text Available The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2 via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.
Energy Technology Data Exchange (ETDEWEB)
Saquib, Quaiser [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Attia, Sabry M. [Department of Pharmacology, College of Pharmacy, King Saud University, Riyadh (Saudi Arabia); Siddiqui, Maqsood A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Aboul-Soud, Mourad A.M. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Biochemistry Department, Faculty of Agriculture, Cairo University, 12613 Giza (Egypt); Al-Khedhairy, Abdulaziz A. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Giesy, John P. [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Biomedical and Veterinary Biosciences and Toxicology Centre, University of Saskatchewan, Saskatoon, Canada S7N 5B3 (Canada); Zoology Department and Center for Integrative Toxicology, Michigan State University, East Lansing 48824 (United States); Musarrat, Javed, E-mail: musarratj1@yahoo.com [Department of Zoology, College of Science, King Saud University, Riyadh (Saudi Arabia); Department of Microbiology, Faculty of Agricultural Sciences, AMU, Aligarh (India)
2012-02-15
Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G{sub 2}/M arrest and appearance of a distinctive SubG{sub 1} peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced
International Nuclear Information System (INIS)
Saquib, Quaiser; Attia, Sabry M.; Siddiqui, Maqsood A.; Aboul-Soud, Mourad A.M.; Al-Khedhairy, Abdulaziz A.; Giesy, John P.; Musarrat, Javed
2012-01-01
Male Wistar rats exposed to a systemic organophosphorus insecticide, phorate [O,O-diethyl S-[(ethylthio) methyl] phosphorothioate] at varying oral doses of 0.046, 0.092 or 0.184 mg phorate/kg bw for 14 days, exhibited substantial oxidative stress, cellular DNA damage and activation of apoptosis-related p53, caspase 3 and 9 genes. The histopathological changes including the pyknotic nuclei, inflammatory leukocyte infiltrations, renal necrosis, and cardiac myofiber degeneration were observed in the liver, kidney and heart tissues. Biochemical analysis of catalase and glutathione revealed significantly lesser activities of antioxidative enzymes and lipid peroxidation in tissues of phorate exposed rats. Furthermore, generation of intracellular reactive oxygen species and reduced mitochondrial membrane potential in bone marrow cells confirmed phorate-induced oxidative stress. Significant DNA damage was measured through comet assay in terms of the Olive tail moment in bone marrow cells of treated animals as compared to control. Cell cycle analysis also demonstrated the G 2 /M arrest and appearance of a distinctive SubG 1 peak, which signified induction of apoptosis. Up-regulation of tumor suppressor p53 and caspase 3 and 9 genes, determined by quantitative real-time PCR and enzyme-linked immunosorbent assay, elucidated the activation of intrinsic apoptotic pathways in response to cellular stress. Overall, the results suggest that phorate induces genetic alterations and cellular toxicity, which can adversely affect the normal cellular functioning in rats. -- Highlights: ► This is the first report on molecular toxicity of phorate in an in vivo test system. ► Phorate induces biochemical and histological changes in liver, kidney and heart. ► Rats treated with phorate exhibited DNA damage in bone marrow cells. ► Phorate induces apoptosis, oxidative stress and alters mitochondrial fluorescence. ► Phorate induces transcriptional changes and enhanced activities of
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
International Nuclear Information System (INIS)
Blanchard, Pierre; Quero, Laurent; Pacault, Vincent; Schlageter, Marie-Helene; Baruch-Hennequin, Valerie; Hennequin, Christophe
2012-01-01
P53 mutations are an adverse prognostic factor in esophageal cancer. P53 and KRas mutations are involved in chemo-radioresistance. Circulating anti-p53 or anti-KRas antibodies are associated with gene mutations. We studied whether anti-p53 or anti-KRas auto-antibodies were prognostic factors for response to chemoradiotherapy (CRT) or survival in esophageal carcinoma. Serum p53 and KRas antibodies (abs) were measured using an ELISA method in 97 consecutive patients treated at Saint Louis University Hospital between 1999 and 2002 with CRT for esophageal carcinoma (squamous cell carcinoma (SCCE) 57 patients, adenocarcinoma (ACE) 27 patients). Patient and tumor characteristics, response to treatment and the follow-up status of 84 patients were retrospectively collected. The association between antibodies and patient characteristics was studied. Univariate and multivariate survival analyses were conducted. Twenty-four patients (28%) had anti-p53 abs. Abs were found predominantly in SCCE (p = 0.003). Anti-p53 abs were associated with a shorter overall survival in the univariate analysis (HR 1.8 [1.03-2.9], p = 0.04). In the multivariate analysis, independent prognostic factors for overall and progression-free survival were an objective response to CRT, the CRT strategy (alone or combined with surgery [preoperative]) and anti-p53 abs. None of the long-term survivors had p53 abs. KRas abs were found in 19 patients (23%, no difference according to the histological type). There was no significant association between anti-KRas abs and survival neither in the univariate nor in the multivariate analysis. Neither anti-p53 nor anti-KRas abs were associated with response to CRT. Anti-p53 abs are an independent prognostic factor for esophageal cancer patients treated with CRT. Individualized therapeutic approaches should be evaluated in this population
Blanchard, Pierre; Quero, Laurent; Pacault, Vincent; Schlageter, Marie-Helene; Baruch-Hennequin, Valerie; Hennequin, Christophe
2012-03-26
P53 mutations are an adverse prognostic factor in esophageal cancer. P53 and KRas mutations are involved in chemo-radioresistance. Circulating anti-p53 or anti-KRas antibodies are associated with gene mutations. We studied whether anti-p53 or anti-KRas auto-antibodies were prognostic factors for response to chemoradiotherapy (CRT) or survival in esophageal carcinoma. Serum p53 and KRas antibodies (abs) were measured using an ELISA method in 97 consecutive patients treated at Saint Louis University Hospital between 1999 and 2002 with CRT for esophageal carcinoma (squamous cell carcinoma (SCCE) 57 patients, adenocarcinoma (ACE) 27 patients). Patient and tumor characteristics, response to treatment and the follow-up status of 84 patients were retrospectively collected. The association between antibodies and patient characteristics was studied. Univariate and multivariate survival analyses were conducted. Twenty-four patients (28%) had anti-p53 abs. Abs were found predominantly in SCCE (p = 0.003). Anti-p53 abs were associated with a shorter overall survival in the univariate analysis (HR 1.8 [1.03-2.9], p = 0.04). In the multivariate analysis, independent prognostic factors for overall and progression-free survival were an objective response to CRT, the CRT strategy (alone or combined with surgery [preoperative]) and anti-p53 abs. None of the long-term survivors had p53 abs. KRas abs were found in 19 patients (23%, no difference according to the histological type). There was no significant association between anti-KRas abs and survival neither in the univariate nor in the multivariate analysis. Neither anti-p53 nor anti-KRas abs were associated with response to CRT. Anti-p53 abs are an independent prognostic factor for esophageal cancer patients treated with CRT. Individualized therapeutic approaches should be evaluated in this population.
Directory of Open Access Journals (Sweden)
Blanchard Pierre
2012-03-01
Full Text Available Abstract Background P53 mutations are an adverse prognostic factor in esophageal cancer. P53 and KRas mutations are involved in chemo-radioresistance. Circulating anti-p53 or anti-KRas antibodies are associated with gene mutations. We studied whether anti-p53 or anti-KRas auto-antibodies were prognostic factors for response to chemoradiotherapy (CRT or survival in esophageal carcinoma. Methods Serum p53 and KRas antibodies (abs were measured using an ELISA method in 97 consecutive patients treated at Saint Louis University Hospital between 1999 and 2002 with CRT for esophageal carcinoma (squamous cell carcinoma (SCCE 57 patients, adenocarcinoma (ACE 27 patients. Patient and tumor characteristics, response to treatment and the follow-up status of 84 patients were retrospectively collected. The association between antibodies and patient characteristics was studied. Univariate and multivariate survival analyses were conducted. Results Twenty-four patients (28% had anti-p53 abs. Abs were found predominantly in SCCE (p = 0.003. Anti-p53 abs were associated with a shorter overall survival in the univariate analysis (HR 1.8 [1.03-2.9], p = 0.04. In the multivariate analysis, independent prognostic factors for overall and progression-free survival were an objective response to CRT, the CRT strategy (alone or combined with surgery [preoperative] and anti-p53 abs. None of the long-term survivors had p53 abs. KRas abs were found in 19 patients (23%, no difference according to the histological type. There was no significant association between anti-KRas abs and survival neither in the univariate nor in the multivariate analysis. Neither anti-p53 nor anti-KRas abs were associated with response to CRT. Conclusions Anti-p53 abs are an independent prognostic factor for esophageal cancer patients treated with CRT. Individualized therapeutic approaches should be evaluated in this population.
Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.
Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei
2013-07-01
Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.
Rambhatla, Lakshmi; Ram-Mohan, Sumati; Cheng, Jennifer J; Sherley, James L
2005-04-15
Because they are long-lived and cycle continuously, adult stem cells (ASCs) are predicted as the most common precursor for cancers in adult mammalian tissues. Two unique attributes have been proposed to restrict the carcinogenic potential of ASCs. These are asymmetric self-renewal that limits their number and immortal DNA strand cosegregation that limits their accumulation of mutations due to DNA replication errors. Until recently, the molecular basis and regulation of these important ASC-specific functions were unknown. We developed engineered cultured cells that exhibit asymmetric self-renewal and immortal DNA strand cosegregation. These model cells were used to show that both ASC-specific functions are regulated by the p53 cancer gene. Previously, we proposed that IMP dehydrogenase (IMPDH) was an essential factor for p53-dependent asymmetric self-renewal. We now confirm this proposal and provide quantitative evidence that asymmetric self-renewal is acutely sensitive to even modest changes in IMPDH expression. These analyses reveal that immortal DNA strand cosegregation is also regulated by IMPDH and confirm the original implicit precept that immortal DNA strand cosegregation is specific to cells undergoing asymmetric self-renewal (i.e., ASCs). With IMPDH being the rate-determining enzyme for guanine ribonucleotide (rGNP) biosynthesis, its requirement implicates rGNPs as important regulators of ASC asymmetric self-renewal and immortal DNA strand cosegregation. An in silico analysis of global gene expression data from human cancer cell lines underscored the importance of p53-IMPDH-rGNP regulation for normal tissue cell kinetics, providing further support for the concept that ASCs are key targets for adult tissue carcinogenesis.
Effect of UV C irradiation on P53 in FADD+/+ and FADD-/- cells
International Nuclear Information System (INIS)
Matic, Igor; Radnic, Maja; Marijanovic, Inga; Furcic, Ivana; Nagy, Biserka
2008-01-01
The dominant paradigm of tumor biology is that evasion from apoptosis is one of the crucial features of malignant diseases and that the efficiency of cancer therapy depends on P53-dependent apoptosis. Because of the importance of apoptotic pathways in protecting cells against malignant transformation, disruption of apoptosis is extremely common in cancer cells, and is frequently due to mutations in the P53 tumor suppressor gene. Fas-associated death domain (FADD) is an adapter protein that is required for apoptosis induced by all known death receptors. FADD is implicated in death receptor-independent apoptotic response, such as DNA damage. We used embryonic fibroblasts derived from FADD knockout mice and their genetic counterparts. We predicted that UV exposure induces a loss of FADD function and leads to mutations in P53. Loss of FADD expression causes deregulation of apoptosis and expansion of mutated cells and initiation of cancer. We predicted that FADD dysfunction may be potentially advantageous for tumor growth and that FADD can act as a tumor suppressor. Cells were irradiated with UV C light (254 nm) using a germicidal lamp (Upland, CA). The culture media was drained before the irradiation and fresh media was added after. In the first experiment we irradiated cells with a dose of 25 J/m 2 and after 5 days we isolated genomic DNA but part of the cells were irradiated again with the same dose. After 5 days DNA were isolated so the cumulative irradiation dose was 50 J/m 2 . In the second experiment cells were irradiated ones with the dose of 40 J/m 2 and DNA was isolated after 18 days. Lethal dosage for each cell line is 50 J/m 2 . Genomic DNA was analyzed by allele-specific polymerase chain reaction (AS-PCR) for CC to TT mutation at codons 154-155 and 175-176 in exon 5 and for C to T mutations at codons 270 and 275 in exon 8 of the P53 gene. The mutant-specific forward primer was used for each mutation. The reverse primers for amplification of mutations were
p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*
Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping
2011-01-01
The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B
2016-01-01
Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.
International Nuclear Information System (INIS)
Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.
1996-01-01
Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
Directory of Open Access Journals (Sweden)
Xiang Ling
Full Text Available Drug/radiation resistance to treatment and tumor relapse are major obstacles in identifying a cure for cancer. Development of novel agents that address these challenges would therefore be of the upmost importance in the fight against cancer. In this regard, studies show that the antiapoptotic protein survivin is a central molecule involved in both hurdles. Using cancer cell-based survivin-reporter systems (US 7,569,221 B2 via high throughput screening (HTS of compound libraries, followed by in vitro and in vivo analyses of HTS-derived hit-lead compounds, we identified a novel anticancer compound (designated FL118. FL118 shows structural similarity to irinotecan. However, while the inhibition of DNA topoisomerase 1 activity by FL118 was no better than the active form of irinotecan, SN-38 at 1 µM, FL118 effectively inhibited cancer cell growth at less than nM levels in a p53 status-independent manner. Moreover, FL118 selectively inhibited survivin promoter activity and gene expression also in a p53 status-independent manner. Although the survivin promoter-reporter system was used for the identification of FL118, our studies revealed that FL118 not only inhibits survivin expression but also selectively and independently inhibits three additional cancer-associated survival genes (Mcl-1, XIAP and cIAP2 in a p53 status-independent manner, while showing no inhibitory effects on control genes. Genetic silencing or overexpression of FL118 targets demonstrated a role for these targets in FL118's effects. Follow-up in vivo studies revealed that FL118 exhibits superior antitumor efficacy in human tumor xenograft models in comparison with irinotecan, topotecan, doxorubicin, 5-FU, gemcitabine, docetaxel, oxaliplatin, cytoxan and cisplatin, and a majority of mice treated with FL118 showed tumor regression with a weekly × 4 schedule. FL118 induced favorable body-weight-loss profiles (temporary and reversible and was able to eliminate large tumors. Together
International Nuclear Information System (INIS)
Vilasova, Z.; Vavrova, J.; Sinkorova, Z.; Tichy, A.; Oesterreicher, J.; Rezacova, M.; Zoelzer, F.
2008-01-01
The aim of this study was to compare reaction of quiescent and proliferating PHA (mitogenic lectin phytohemagglutinin)-stimulated human peripheral blood mononuclear cells (PBMCs) to γ-irradiation and analyze changes of proteins related to repair if DNA damage and apoptosis, such as γH2A.X, p53 and its phosphorylations on serine 15 and 392, and p21. Protein changes induced by radiation are different in quiescent and stimulated PBMCs. W e analyzed changes in proteins related to DNA damage repair and apoptosis using the western blot method in quiescent and stimulated PBMCs. Western blot technique can detect γH2A.X increase only at later times, when the phosphorylation of H2A.X is related to the onset of apoptosis (24-72 h after irradiation by the dose of 4 Gy). The level of H2A.X phosphorylation increased after stimulation of PBMC by PHA (72 h, 10 μg/ml) and as shown here it was detectable by western blot analysis. The increase in γH2A.X that we detected by western blot 4 h after irradiation of stimulated lymphocytes was dose dependent. It can be concluded that measurement of γH2A.X during the first hours after the irradiation is a good marker of the received dose of radiation. We compared the dynamics of p53 induction after irradiation by IR in both quiescent and stimulated lymphocytes. p53 increase was observed only in stimulated lymphocytes, as was p53 phosphorylation at serines-392 and -15. The increase in the amount of p53 was not dose-dependent 4 h after the irradiation. On the other hand, phosphorylation of p53 at serine-15 analyzed 4 h after the irradiation is dose-dependent over the studied dose range. Despite the fact that p53 was not detected in quiescent lymphocytes and a reaction to irradiation was not observed either, p21 levels increased after irradiation in both quiescent and stimulated lymphocytes in a dose-dependent manner. IR induces phosphorylation of p53 at both serines-15 and -392 in PHA stimulated human lymphocytes. However
A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53
International Nuclear Information System (INIS)
Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.
2011-01-01
eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)
The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.
Directory of Open Access Journals (Sweden)
Hui-Ching Chuang
Full Text Available TP53 is the most commonly mutated gene in head and neck cancer (HNSCC, with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis, a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1 inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.
Molecular analysis of p53 and K-ras in lung carcinomas of coal miners
Energy Technology Data Exchange (ETDEWEB)
Sarkar, F.H.; Li, Y.W.; Vallyathan, V. [Wayne State University, Detroit, MI (United States). School of Medicine, Dept. of Pathology
2001-10-01
Thirty-three cases of non-small cell lung cancers (NSCLC) from the archives of National Coal Workers' Autopsy Study were studied for mutational alterations in p53 and K-ras using PCR-SSCP, DNA sequencing and PCR-oligonucleotide probe hybridization techniques. Mutations of the p53 were observed in 4 smokers (19%) and one in a never smoker (8%). Two polymorphisms in smokers were detected at codon 213, a common site for sequence variation. Among the smokers the p53 mutations were in the heavy smokers. In never smokers there was only a single p53 mutation and two K-ras mutations. In never smokers the frequency of K-ras mutations was similar (17%) in smokers, but one never smoker had two K-ras mutations. Mutations of p53 were more frequent in adenocarcinomas (27%) and they were AT-GC transitions. There were two large cell undifferentiated carcinomas with p53 mutation and one with a K-ras mutation. Two of the 16 squamous cell carcinomas were positive for p53 mutation, while no K-ras mutations were found in this group. The results of these preliminary studies indicate a moderately different mutational spectrum of p53 and K-ras in coal miners independent of cigarette smoking. The mutational spectrum observed in this study of coal miners with heavy cigarette smoking history suggest a protective effect of coal mine dust in preventing abnormal mutations induced by chemical carcinogens in cigarette smoke or reactive oxygen species.
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Ozaki, Toshinori; Nakamura, Mizuyo; Ogata, Takehiro; Sang, Meijie; Yoda, Hiroyuki; Hiraoka, Kiriko; Sang, Meixiang; Shimozato, Osamu
2016-11-01
Recently, we have described that siRNA-mediated silencing of runt-related transcription factor 2 (RUNX2) improves anti-cancer drug gemcitabine (GEM) sensitivity of p53-deficient human pancreatic cancer AsPC-1 cells through the augmentation of p53 family TAp63-dependent cell death pathway. In this manuscript, we have extended our study to p53-mutated human pancreatic cancer Panc-1 cells. According to our present results, knockdown of mutant p53 alone had a marginal effect on GEM-mediated cell death of Panc-1 cells. We then sought to deplete RUNX2 using siRNA in Panc-1 cells and examined its effect on GEM sensitivity. Under our experimental conditions, RUNX2 knockdown caused a significant enhancement of GEM sensitivity of Panc-1 cells. Notably, GEM-mediated induction of TAp63 but not of TAp73 was further stimulated in RUNX2-depleted Panc-1 cells, indicating that, like AsPC-1 cells, TAp63 might play a pivotal role in the regulation of GEM sensitivity of Panc-1 cells. Consistent with this notion, forced expression of TAp63α in Panc-1 cells promoted cell cycle arrest and/or cell death, and massively increased luciferase activities driven by TAp63-target gene promoters such as p21WAF1 and NOXA. In addition, immunoprecipitation experiments indicated that RUNX2 forms a complex with TAp63 in Panc-1 cells. Taken together, our current observations strongly suggest that depletion of RUNX2 enhances the cytotoxic effect of GEM on p53-mutated Panc-1 cells through the stimulation of TAp63-dependent cell death pathway even in the presence of a large amount of pro-oncogenic mutant p53, and might provide an attractive strategy to treat pancreatic cancer patients with p53 mutations.
Interaction between the Cockayne syndrome B and p53 proteins: implications for aging.
Frontini, Mattia; Proietti-De-Santis, Luca
2012-02-01
The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53’s levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis.
Wang, Dongfang; Qin, Jingkai; Jia, Jirong; Yan, Peipei; Li, Wensheng
2017-01-29
This study aims to determine the post-transcriptional regulation mechanism of the transcription factor pou1f1 (pou class 1 homeobox 1), which is the key gene for pituitary development, somatic growth in vertebrates, and transcription of several hormone genes in teleost fish. MicroRNA miR-223-3p was identified as a bona fide target of pou1f; overexpression of miR-223-3p in primary pituitary cells led to the down-regulation of pou1f1 and downstream genes, and inhibition of miR-223-3p led to the up-regulation of pou1f1 in Nile tilapia dispersed primary pituitary cells. An adenylate-uridylate-rich element (AU-Rich element) was found in the 3'UTR of pou1f1 mRNA, and deletion of the AU-Rich element led to slower mRNA decay and therefore more protein output. A potential mutual relationship between miR-223-3p and the AU-rich element was also investigated, and the results demonstrated that with or without the AU-Rich element, miR-223-3p induced the up-regulation of a reporter system under serum starvation conditions, indicating that miR-223-3p and the AU-Rich element function independent of each other. This study is the first to investigate the post-transcriptional mechanism of pou1f1, which revealed that miR-223-3p down-regulated pou1f1 and downstream gene expressions, and the AU-Rich element led to rapid decay of pou1f1 mRNA. MicroRNA miR-223-3p and the AU-Rich element co-regulated the post-transcriptional expression of pou1f1 independently in Nile tilapia, demonstrating that pou1f1 is under the control of a dual post-transcription regulation mechanism. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Wang MS
2017-10-01
Full Text Available Ming-Shan Wang,1 Liang Chen,2 Ya-Qiong Xiong,2 Jing Xu,2 Ji-Peng Wang,2 Zi-Li Meng2 1Department of Oncology, Huaiyin Hospital of Huai’an City, Huai’an, China; 2Department of Respiration, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an, China Abstract: Actein (AT is a triterpene glycoside isolated from the rhizomes of Cimicifuga foetida that has been investigated for its antitumor effects. AT treatment leads to apoptosis in various cell types, including breast cancer cells, by regulating different signaling pathways. Iron oxide (Fe3O4 magnetic nanoparticles (MNPs are nanomaterials with biocompatible activity and low toxicity. In the present study, the possible benefits of AT in combination with MNPs on non-small-cell lung cancer (NSCLC were explored in in vitro and in vivo studies. AT-MNP treatment contributed to apoptosis in NSCLC cells, as evidenced by activation of the caspase 3-signaling pathway, which was accompanied by downregulation of the antiapoptotic proteins Bcl2 and BclXL, and upregulation of the proapoptotic signals Bax and Bad. The death receptors of TRAIL were also elevated following AT-MNP treatment in a p53-dependent manner. Furthermore, a mouse xenograft model in vivo revealed that AT-MNP treatment exhibited no toxicity and suppressed NSCLC growth compared to either AT or MNP monotherapies. In conclusion, this study suggests a novel therapy to induce apoptosis in suppressing NSCLC growth in a p53-dependent manner by combining AT with Fe3O4 MNPs. Keywords: actein, Fe3O4 magnetic nanoparticles, NSCLC, apoptosis, p53
p53 specific (auto)immunity in mice
Lauwen, Marjolein Monique
2008-01-01
Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T