Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.
Directory of Open Access Journals (Sweden)
Kristina Kirschner
2015-03-01
Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.
Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T
2016-01-01
p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.
Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq
2017-10-01
In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.
International Nuclear Information System (INIS)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook
2009-01-01
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference
Energy Technology Data Exchange (ETDEWEB)
Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)
2009-05-15
The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.
De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic
2017-05-01
Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great
Fragment-based screening in tandem with phenotypic screening provides novel antiparasitic hits.
Blaazer, Antoni R; Orrling, Kristina M; Shanmugham, Anitha; Jansen, Chimed; Maes, Louis; Edink, Ewald; Sterk, Geert Jan; Siderius, Marco; England, Paul; Bailey, David; de Esch, Iwan J P; Leurs, Rob
2015-01-01
Methods to discover biologically active small molecules include target-based and phenotypic screening approaches. One of the main difficulties in drug discovery is elucidating and exploiting the relationship between drug activity at the protein target and disease modification, a phenotypic endpoint. Fragment-based drug discovery is a target-based approach that typically involves the screening of a relatively small number of fragment-like (molecular weight <300) molecules that efficiently cover chemical space. Here, we report a fragment screening on TbrPDEB1, an essential cyclic nucleotide phosphodiesterase (PDE) from Trypanosoma brucei, and human PDE4D, an off-target, in a workflow in which fragment hits and a series of close analogs are subsequently screened for antiparasitic activity in a phenotypic panel. The phenotypic panel contained T. brucei, Trypanosoma cruzi, Leishmania infantum, and Plasmodium falciparum, the causative agents of human African trypanosomiasis (sleeping sickness), Chagas disease, leishmaniasis, and malaria, respectively, as well as MRC-5 human lung cells. This hybrid screening workflow has resulted in the discovery of various benzhydryl ethers with antiprotozoal activity and low toxicity, representing interesting starting points for further antiparasitic optimization. © 2014 Society for Laboratory Automation and Screening.
A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine
International Nuclear Information System (INIS)
Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R
2008-01-01
p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.
Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom
2012-01-01
The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.
System-based strategies for p53 recovery.
Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I
2018-06-01
The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.
Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J
2012-04-05
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.
Directory of Open Access Journals (Sweden)
Takako Kawasaki
2007-12-01
Full Text Available Insulin-like growth factor binding protein 3 (IGFBP3, which is induced by wild-type p53, regulates IGF and interacts with the TGF-β pathway. IGFBP3 promoter methylation may occur in colorectal cancer with or without the CpG island methylator phenotype (CIMP, which is associated with microsatellite instability (MSI and TGFBR2 mutation. We examined the relationship between IGFBP3 methylation, p53 expression, CIMP and MSI in 902 population-based colorectal cancers. Utilizing real-time PCR (MethyLight, we quantified promoter methylation in IGFBP3 and eight other CIMP-high-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1. IGFBP3 methylation was far more frequent in non-MSI-high CIMP-high tumors (85% = 35/41 than in MSI-high CIMPhigh (49% = 44/90, P < .0001, MSI-high non-CIMP-high (17% = 6/36, P < .0001, non-MSI-high non-CIMP-high tumors (22% = 152/680, P < .0001. Among CIMPhigh tumors, the inverse relationship between MSI and IGFBP3 methylation persisted in p53-negative tumors (P < .0001, but not in p53-positive tumors. IGFBP3 methylation was associated inversely with TGFBR2 mutation in MSI-high non-CIMP-high tumors (P = .02. In conclusion, IGFBP3 methylation is inversely associated with MSI in CIMP-high colorectal cancers, this relationship is limited to p53-negative tumors. Our data suggest complex relationship between global genomic/epigenomic phenomena (such as MSI/ CIMP, single molecular events (e.g., IGFBP3 methylation, TP53 mutation, TGFBR2 mutation, the related pathways.
Directory of Open Access Journals (Sweden)
Li Xie
Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.
Analysis of P53 mutations and their expression in 56 colorectal cancer cell lines
DEFF Research Database (Denmark)
Liu, Ying; Bodmer, Walter F
2006-01-01
A comprehensive analysis of the TP53 gene and its protein status was carried out on a panel of 56 colorectal cancer cell lines. This analysis was based on a combination of denaturing HPLC mutation screening of all exons of the p53 gene, sequencing the cDNA, and assessing the function of the p53 p...
Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R
2017-08-01
Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Breza, Marianthi; Koutsis, Georgios; Karadima, Georgia; Potagas, Constantin; Kartanou, Chrisoula; Papageorgiou, Sokratis G; Paraskevas, George P; Kapaki, Elisabeth; Stefanis, Leonidas; Panas, Marios
2018-04-13
The p. A53T mutation in the alpha-synuclein (SNCA) gene is a rare cause of autosomal dominant Parkinson's disease (PD). Although generally rare, it is particularly common in the Greek population due to a founder effect. A53T-positive PD patients often develop dementia during disease course and may very rarely present with dementia. We screened for the p. A53T SNCA mutation a total of 347 cases of Greek origin with parkinsonism and/or dementia, collected over 15 years at the Neurogenetics Unit, Eginition Hospital, University of Athens. Cases were classified into: "pure parkinsonism", "pure dementia" and "parkinsonism plus dementia". In total, 4 p. A53T SNCA mutation carriers were identified. All had autosomal dominant family history and early onset. Screening of the "pure parkinsonism" category revealed 2 cases with typical PD. The other two mutation carriers were identified in the "parkinsonism plus dementia" category. One had a diagnosis of PD dementia and the other of behavioral variant frontotemporal dementia. Screening of patients with "pure dementia" failed to identify any further A53T-positive cases. Our results confirm that the p. A53T SNCA mutation is relatively common in Greek patients with PD or PD plus dementia, particularly in cases with early onset and/or autosomal dominant family history. Copyright © 2017 Elsevier B.V. All rights reserved.
A Morpholino-based screen to identify novel genes involved in craniofacial morphogenesis
Melvin, Vida Senkus; Feng, Weiguo; Hernandez-Lagunas, Laura; Artinger, Kristin Bruk; Williams, Trevor
2014-01-01
BACKGROUND The regulatory mechanisms underpinning facial development are conserved between diverse species. Therefore, results from model systems provide insight into the genetic causes of human craniofacial defects. Previously, we generated a comprehensive dataset examining gene expression during development and fusion of the mouse facial prominences. Here, we used this resource to identify genes that have dynamic expression patterns in the facial prominences, but for which only limited information exists concerning developmental function. RESULTS This set of ~80 genes was used for a high throughput functional analysis in the zebrafish system using Morpholino gene knockdown technology. This screen revealed three classes of cranial cartilage phenotypes depending upon whether knockdown of the gene affected the neurocranium, viscerocranium, or both. The targeted genes that produced consistent phenotypes encoded proteins linked to transcription (meis1, meis2a, tshz2, vgll4l), signaling (pkdcc, vlk, macc1, wu:fb16h09), and extracellular matrix function (smoc2). The majority of these phenotypes were not altered by reduction of p53 levels, demonstrating that both p53 dependent and independent mechanisms were involved in the craniofacial abnormalities. CONCLUSIONS This Morpholino-based screen highlights new genes involved in development of the zebrafish craniofacial skeleton with wider relevance to formation of the face in other species, particularly mouse and human. PMID:23559552
The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy
International Nuclear Information System (INIS)
Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.
1996-01-01
Background and purpose: Experimental studies have implicated the normal or 'wild type' p53 protein (i.e. WTp53) in the cellular response to ionizing radiation and other DNA damaging agents. Whether altered WTp53 protein function can lead to changes in cellular radiosensitivity and/or clinical radiocurability remains an area of ongoing study. In this review, we describe the potential implications of altered WTp53 protein function in normal and tumour cells as it relates to clinical radiotherapy, and describe novel treatment strategies designed to re-institute WTp53 protein function as a means of sensitizing cells to ionizing radiation. Methods and Materials: A number of experimental and clinical studies are critically reviewed with respect to the role of the p53 protein as a determinant of cellular oncogenesis, genomic stability, apoptosis, DNA repair and radioresponse in normal and transformed mammalian cells. Results: In normal fibroblasts, exposure to ionizing radiation leads to a G1 cell cycle delay (i.e. a 'G1 checkpoint') as a result of WTp53-mediated inhibition of G1-cyclin-kinase and retinoblastoma (pRb) protein function. The G1 checkpoint response is absent in tumour cells which express a mutant form of the p53 protein (i.e. MTp53), leading to acquired radioresistance in vitro. Depending on the cell type studied, this increase in cellular radiation survival can be mediated through decreased radiation-induced apoptosis, or altered kinetics of the radiation-induced G1 checkpoint. Recent biochemical studies support an indirect role for the p53 protein in both nucleotide excision and recombinational DNA repair pathways. However, based on clinicopathologic data, it remains unclear as to whether WTp53 protein function can predict for human tumour radiocurability and normal tissue radioresponse. Conclusions: Alterations in cell cycle control secondary to aberrant WTp53 protein function may be clinically significant if they lead to the acquisition of mutant
Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio
2013-01-01
Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976
Directory of Open Access Journals (Sweden)
Yamaguchi Toshikazu
2005-01-01
Full Text Available Abstract Background Although the gastric well-differentiated adenocarcinoma in the distal stomach has been thought to develop via a intestinal metaplasia-carcinoma sequence, there are some disproofs from new mucin examinations for minute-size lesions in same type carcinoma. The current study was performed and pointed out the new findings for the solution to the problem according to the point described above. Methods 12 super-minute lesions (less than 1 mm in maximum diameter of well-differentiated adenocarcinoma in distal stomach (SMCa, which were detected from the pathological examinations of 210 surgically resected stomach specimens, and the mucosa adjacent to these carcinoma lesions, were examined by immunohistochemical mucin stainings (MUC2 and CD-10: intestinal phenotype, 45M1 and MUC6: gastric phenotype and p53-overexpression. And the analyses of the replication error of the microsatellites in chromosome 17 related p53 gene (TP53 and D17S786 (RER-p53MS were performed in SMCa lesions, adjacent mucosa to each lesion and other gastric mucosa with intestinal metaplasia, because all SMCa lesions showed p53-overexpression immunohistochemically, decribed below. Results 1. The carcinoma cells in all SMCa lesions were positive for 45M1 and p53. On the other hand, no positive carcinoma cells for MUC6 were seen although the pyloric glands and the remnant pyloric gland in the SMCa lesions in the same slides were positive for MUC6. Ten lesions (83% had intestinal phenotypic mucin (10 lesions: MUC2 (+, 4 lesions: CD10 (+. Two lesions (17% were positive for only 45M1 (gastric phenotypic mucin. 2. All of the mucosa adjacent to SMCa showed intestinal metaplasia (complete type: 7 regions, incomplete type: 5 regions. 3. RER-p53MS was confirmed in 42% (5/12 regions of SMCa, in 42% (5/12 regions of the mucosa adjacent to SMCa and 14% (6/42 regions of the other intestinal metaplasia mucosa. Conclusion Most of the super-minute well-differentiated adenocarcinoma
Powari, Manish; Varma, Neelam; Varma, Subhash; Marwaha, Ram Kumar; Sandhu, Harpreet; Ganguly, Nirmal Kumar
2002-06-01
To characterize the phenotype of acute leukemia cases using flow cytometry, to detect mixed lineage cases and to use DNA index determination, including S-phase fraction (SPF) and p53 detection, to find if there was any correlation of SPF and p53 expression with outcome. Fifty-five cases of acute leukemia were enrolled in this study. A complete hemogram and routine bone marrow examination, including cytochemistry, was done. Mycloperoxidase-negative cases were evaluated on a flow cytometer using monoclonal antibodies. DNA indices were determined by flow cytometry in all cases, and p53 was detected immunohistochemically using the alkaline phosphatase/antialkaline phosphatase technique. Acute myeloblastic leukemia (AML) was diagnosed in 32 cases; acute lymphoblastic leukemia (ALL) was diagnosed in 18 (14 B lineage and 4 T line age). Four cases showed mixed lineage leukemia, and undifferentiated acute leukemia was diagnosed in one case. The mean/range of SPF for these groups were 3.76/0.33-6.91, 6.25/0.15-21.4, 2.89/0.35-10.64, 2.60/0.72-6.94 and 7.34, respectively. Aneuploidy was detected in two cases of B-lineage ALL and tetraploidy in a case of AML-M7, while all others were diploid p53. Was detected in 6 of 55 cases (10.90%). Follow-up was available for 24 patients. Five patients relapsed, and four had B-cell type ALL and were diploid and expressed no p53 gene. SPF% did not show any correlation with outcome. These data suggest that within acute leukemia subtypes, there is a wide variation in SPF. SPF does not seem to correlate with outcome. Immunophenotyping is essential to determine the lineage in myeloperoxidase-negative cases. It is perhaps the only way to diagnose mixed lineage leukemia and aberrant expression of markers presently. The p53 gene was detected less frequently. However, more studies are required from different centers with longer follow-up to evaluate prognostic significance.
Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan
2016-07-02
Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.
Energy Technology Data Exchange (ETDEWEB)
Chen, Aiqiong; Bao, Yuanwu; Ge, Xiaoxiao; Shin, Yongsoon; Du, Dan; Lin, Yuehe
2012-11-20
Phosphorylated p53 at serin 15 (phospho-p53-15) is a potential biomarker of Gamma-radiation exposure. In this paper, we described a new magnetic particles (MPs)-based electrochemical immunoassay of human phospho-p53-15 using carbon nanospheres (CNS) and protein-cage templated lead phosphate nanoparticles for signal amplification. Greatly enhanced sensitivity was achieved by three aspects: 1) The protein-cage nanoparticle (PCN) and p53-15 signal antibody (p53-15 Ab2) are linked to CNS (PCNof each apoferritin; 3) MPs capture a large amount of primary antibodies. Using apoferritin templated metallic phosphate instead of enzyme as label has the advantage of eliminating the addition of mediator or immunoreagents and thus makes the immunoassay system simpler. The subsequent stripping voltammetric analysis of the released lead ions were detected on a disposable screen printed electrode. The response current was proportional to the phospho-p53-15 concentration in the range of 0.02 to 20 ng mL-1 with detection limit of 0.01 ng mL-1. This method shows a good stability, reproducibility and recovery.
Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki
2012-01-20
The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Copp& #233; , Jean-Philippe; Patil, Christopher; Rodier, Francis; Sun, Yu; Munoz, Denise; Goldstein, Joshua; Nelson, Peter; Desprez, Pierre-Yves; Campisi, Judith
2008-10-24
Cellular senescence suppresses cancer by arresting cell proliferation, essentially permanently, in response to oncogenic stimuli, including genotoxic stress. We modified the use of antibody arrays to provide a quantitative assessment of factors secreted by senescent cells. We show that human cells induced to senesce by genotoxic stress secrete myriad factors associated with inflammation and malignancy. This senescence-associated secretory phenotype (SASP) developed slowly over several days and only after DNA damage of sufficient magnitude to induce senescence. Remarkably similar SASPs developed in normal fibroblasts, normal epithelial cells, and epithelial tumor cells after genotoxic stress in culture, and in epithelial tumor cells in vivo after treatment of prostate cancer patients with DNA-damaging chemotherapy. In cultured premalignant epithelial cells, SASPs induced an epithelial-mesenchyme transition and invasiveness, hallmarks of malignancy, by a paracrine mechanism that depended largely on the SASP factors interleukin (IL)-6 and IL-8. Strikingly, two manipulations markedly amplified, and accelerated development of, the SASPs: oncogenic RAS expression, which causes genotoxic stress and senescence in normal cells, and functional loss of the p53 tumor suppressor protein. Both loss of p53 and gain of oncogenic RAS also exacerbated the promalignant paracrine activities of the SASPs. Our findings define a central feature of genotoxic stress-induced senescence. Moreover, they suggest a cell-nonautonomous mechanism by which p53 can restrain, and oncogenic RAS can promote, the development of age-related cancer by altering the tissue microenvironment.
OTUD5 regulates p53 stability by deubiquitinating p53.
Directory of Open Access Journals (Sweden)
Judong Luo
Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.
Xue, Xin; Wei, Jin-Lian; Xu, Li-Li; Xi, Mei-Yang; Xu, Xiao-Li; Liu, Fang; Guo, Xiao-Ke; Wang, Lei; Zhang, Xiao-Jin; Zhang, Ming-Ye; Lu, Meng-Chen; Sun, Hao-Peng; You, Qi-Dong
2013-10-28
Protein-protein interactions (PPIs) play a crucial role in cellular function and form the backbone of almost all biochemical processes. In recent years, protein-protein interaction inhibitors (PPIIs) have represented a treasure trove of potential new drug targets. Unfortunately, there are few successful drugs of PPIIs on the market. Structure-based pharmacophore (SBP) combined with docking has been demonstrated as a useful Virtual Screening (VS) strategy in drug development projects. However, the combination of target complexity and poor binding affinity prediction has thwarted the application of this strategy in the discovery of PPIIs. Here we report an effective VS strategy on p53-MDM2 PPI. First, we built a SBP model based on p53-MDM2 complex cocrystal structures. The model was then simplified by using a Receptor-Ligand complex-based pharmacophore model considering the critical binding features between MDM2 and its small molecular inhibitors. Cascade docking was subsequently applied to improve the hit rate. Based on this strategy, we performed VS on NCI and SPECS databases and successfully discovered 6 novel compounds from 15 hits with the best, compound 1 (NSC 5359), K(i) = 180 ± 50 nM. These compounds can serve as lead compounds for further optimization.
Phenotype-Based Screening of Small Molecules to Modify Plant Cell Walls Using BY-2 Cells.
Okubo-Kurihara, Emiko; Matsui, Minami
2018-01-01
The plant cell wall is an important and abundant biomass with great potential for use as a modern recyclable resource. For effective utilization of this cellulosic biomass, its ability to degrade efficiently is key point. With the aim of modifying the cell wall to allow easy decomposition, we used chemical biological technology to alter its structure. As a first step toward evaluating the chemicals in the cell wall we employed a phenotype-based approach using high-throughput screening. As the plant cell wall is essential in determining cell morphology, phenotype-based screening is particularly effective in identifying compounds that bring about alterations in the cell wall. For rapid and reproducible screening, tobacco BY-2 cell is an excellent system in which to observe cell morphology. In this chapter, we provide a detailed chemical biological methodology for studying cell morphology using tobacco BY-2 cells.
International Nuclear Information System (INIS)
Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G
2013-01-01
Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches
Directory of Open Access Journals (Sweden)
Shuji Ogino
2006-06-01
Full Text Available Cyclooxygenase-2 (COX-2 overexpression and mutations of p53 (a known COX-2 regulator are inversely associated with microsatellite instability—high (MSI-H and CpG island methylator phenotype (CIMP, characterized by extensive promoter methylation, is associated with MSI-H. However, no studies have comprehensively examined interrelations between COX-2, p53, MSI, and CIMP. Using MethyLight, we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A, CRABP1, MLH1, and NEUROG1] in relatively unbiased samples of 751 colorectal cancer cases obtained from two large prospective cohorts; 115 (15% tumors were CIMP-high (≥ 4 of 5 methylated promoters, 251 (33% were CIMP-low (1 to 3 methylated promoters, and the remaining 385 (51% were CIMP-0 (no methylated promoters. CIMP-high tumors were much less frequent in COX-2+/p53+ tumors (4.6% than in COX-2+/p53- tumors (19%; P < .0001, COX-2-/p53+ tumors (17%; P = .04, and COX-2-/p53- tumors (28%; P < .0001. In addition, COX-2+/p53+ tumors were significantly less common in MSI-H CIMP-high tumors (9.7% than in non-MSI-H CIMP-low/CIMP-0 tumors (44–47%; P < .0001. In conclusion, COX-2 and p53 alterations were synergistically inversely correlated with both MSI-H and CIMP-high. Our data suggest that a combined analysis of COX-2 and p53 may be more useful for the molecular classification of colorectal cancer than either COX-2 or p53 analysis alone.
How Phenotypic Screening Influenced Drug Discovery: Lessons from Five Years of Practice.
Haasen, Dorothea; Schopfer, Ulrich; Antczak, Christophe; Guy, Chantale; Fuchs, Florian; Selzer, Paul
Since 2011, phenotypic screening has been a trend in the pharmaceutical industry as well as in academia. This renaissance was triggered by analyses that suggested that phenotypic screening is a superior strategy to discover first-in-class drugs. Despite these promises and considerable investments, pharmaceutical research organizations have encountered considerable challenges with the approach. Few success stories have emerged in the past 5 years and companies are questioning their investment in this area. In this contribution, we outline what we have learned about success factors and challenges of phenotypic screening. We then describe how our efforts in phenotypic screening have influenced our approach to drug discovery in general. We predict that concepts from phenotypic screening will be incorporated into target-based approaches and will thus remain influential beyond the current trend.
Noda, Takeshi
2011-12-01
I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.
CLCA2 as a p53-Inducible Senescence Mediator
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2012-02-01
Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.
EMPReSS: European mouse phenotyping resource for standardized screens.
Green, Eain C J; Gkoutos, Georgios V; Lad, Heena V; Blake, Andrew; Weekes, Joseph; Hancock, John M
2005-06-15
Standardized phenotyping protocols are essential for the characterization of phenotypes so that results are comparable between different laboratories and phenotypic data can be related to ontological descriptions in an automated manner. We describe a web-based resource for the visualization, searching and downloading of standard operating procedures and other documents, the European Mouse Phenotyping Resource for Standardized Screens-EMPReSS. Direct access: http://www.empress.har.mrc.ac.uk e.green@har.mrc.ac.uk.
p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.
Directory of Open Access Journals (Sweden)
Karolyn J Forget
Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.
Shaikh, Faraz; Sanehi, Parvish; Rawal, Rakesh
2012-01-01
Cervical cancer is malignant neoplasm of the cervix uteri or cervical area. Human Papillomaviruses (HPVs) which are heterogeneous groups of small double stranded DNA viruses are considered as the primary cause of cervical cancer, involved in 90% of all Cervical Cancers. Two early HPV genes, E6 and E7, are known to play crucial role in tumor formation. E6 binds with p53 and prevents its translocation and thereby inhibit the ability of p53 to activate or repress target genes. E7 binds to hypophosphorylated Rb and thereby induces cells to enter into premature S-phase by disrupting Rb-E2F complexes. The strategy of the research work was to target the site of interaction of Rb1 -E7 & p53-E6. A total of 88 compounds were selected for molecular screening, based on comprehensive literature survey for natural compounds with anti-cancer activity. Molecular docking analysis was carried out with Molegro Virtual Docker, to screen the 88 chosen compounds and rank them according to their binding affinity towards the site of interaction of the viral oncoproteins and human tumor suppressor proteins. The docking result revealed that Nicandrenone a member of Withanolides family of chemical compounds as the most likely molecule that can be used as a candidate drug against HPV induced cervical cancer. Abbreviations HPV - Human Papiloma Virus, HTSP - Human Tumor Suppressor Proteins, VOP - Viral oncoproteins. PMID:22829740
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Directory of Open Access Journals (Sweden)
Iva Simeonova
2013-06-01
Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.
INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.
2003-01-01
Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy
DEFF Research Database (Denmark)
Møller, Michael Boe; Gerdes, A M; Skjødt, K
1999-01-01
screening for p53 gene mutations as a prognostic marker in a population-based group of B- and T-cell non-Hodgkin's lymphomas (NHLs). On the basis of p53 gene mutation status and immunohistochemically detected p53 and p21Waf1 expression in 34 lymphomas, we established an immunophenotype (delta p53......) correlating with p53 gene mutation. The immunohistochemical analysis was extended to encompass 199 lymphomas from a population-based registry and was correlated with clinical parameters. Delta p53 showed 100% concordance with p53 gene mutation and was detected in 42 cases (21%). Multivariate analysis...... of advanced stage lymphomas showed that delta p53 was independently associated with treatment failure (relative risk, 3.8; P = 0.001). Delta p53 predicted poor survival when analyzing all patients (P = 0.0001), as well as B-cell (P = 0.04) and T-cell NHL (P = 0.000002). In multivariate analysis, delta p53...
Active Learning Strategies for Phenotypic Profiling of High-Content Screens.
Smith, Kevin; Horvath, Peter
2014-06-01
High-content screening is a powerful method to discover new drugs and carry out basic biological research. Increasingly, high-content screens have come to rely on supervised machine learning (SML) to perform automatic phenotypic classification as an essential step of the analysis. However, this comes at a cost, namely, the labeled examples required to train the predictive model. Classification performance increases with the number of labeled examples, and because labeling examples demands time from an expert, the training process represents a significant time investment. Active learning strategies attempt to overcome this bottleneck by presenting the most relevant examples to the annotator, thereby achieving high accuracy while minimizing the cost of obtaining labeled data. In this article, we investigate the impact of active learning on single-cell-based phenotype recognition, using data from three large-scale RNA interference high-content screens representing diverse phenotypic profiling problems. We consider several combinations of active learning strategies and popular SML methods. Our results show that active learning significantly reduces the time cost and can be used to reveal the same phenotypic targets identified using SML. We also identify combinations of active learning strategies and SML methods which perform better than others on the phenotypic profiling problems we studied. © 2014 Society for Laboratory Automation and Screening.
CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.
He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu
2016-01-01
The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.
Directory of Open Access Journals (Sweden)
Katsuhiko Nosho
2009-01-01
Full Text Available JC virus has a transforming gene encoding JC virus T-antigen (JCVT. JCVT may inactivate wild-type p53, cause chromosomal instability (CIN, and stabilize β-catenin. A link between JCVT and CpG island methylator phenotype (CIMP has been suggested. However, no large-scale study has examined the relations of JCVT with molecular alterations, clinical outcome, or prognosis in colon cancer. We detected JCVT expression (by immunohistochemistry in 271 (35% of 766 colorectal cancers. We quantified DNA methylation in eight CIMP-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1 and eight other loci (CHFR, HIC1, IGFBP3, MGMT, MINT1, MINT31, p14, WRN by MethyLight. We examined loss of heterozygosity in 2p, 5q, 17q, and 18q. JCVT was significantly associated with p53 expression (P < .0001, p21 loss (P < .0001, CIN (≥2 chromosomal segments with LOH; P < .0001, nuclear β-catenin (P = .006, LINE-1 hypomethylation (P = .002, and inversely with CIMP-high (P = .0005 and microsatellite instability (MSI (P < .0001, but not with PIK3CA mutation. In multivariate logistic regression analysis, the associations of JCVT with p53 [adjusted odds ratio (OR, 8.45; P < .0001], CIN (adjusted OR, 2.53; P = .003, cyclin D1 (adjusted OR, 1.57; P = .02, LINE-1 hypomethylation (adjusted OR, 1.97 for a 30% decline as a unit; P = .03, BRAF mutation (adjusted OR, 2.20; P = .04, and family history of colorectal cancer (adjusted OR, 0.64; P = .04 remained statistically significant. However, JCVT was no longer significantly associated with CIMP, MSI, β-catenin, or cyclooxygenase-2 expression in multivariate analysis. JCVT was unrelated with patient survival. In conclusion, JCVT expression in colorectal cancer is independently associated with p53 expression and CIN, which may lead to uncontrolled cell proliferation.
Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.
Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D
2017-08-01
Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.
Directory of Open Access Journals (Sweden)
Özlem Demir
2011-10-01
Full Text Available The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain ("cancer mutants". Activity can be restored by second-site suppressor mutations ("rescue mutants". This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD, without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC metric was strongly correlated (r(2 = 0.77 with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i p53 cancer mutants were more flexible than wild-type protein, (ii second-site rescue mutations decreased the flexibility of cancer mutants, and (iii negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants.
Directory of Open Access Journals (Sweden)
Ivan Raimondi
Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.
Novel small molecule induces p53-dependent apoptosis in human colon cancer cells
International Nuclear Information System (INIS)
Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil
2007-01-01
Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent
A method for double-labeling sputum cells for p53 and cytokeratin
Energy Technology Data Exchange (ETDEWEB)
Neft, R.E.; Tierney, L.A.; Belinsky, S.A. [and others
1995-12-01
Molecular and immunological techniques may enhance the usefulness of sputum cytology as a screening tool for lung cancer. These techniques may also be useful in detecting and following the early progression of disease from metaplasia to dysplasia, carcinoma in situ, and finally to invasive carcinoma. Longitudinal information on the evolution of these malignant changes in the respiratory epithelium can be gained by prospective study of populations at high risk for lung cancer. This work is significant because double-labeling of cells in sputum with p53 and cytokeratin antibodies facilitates rapid screening of p53 positive neoplastic and preneoplastic lung cells by brightfield and fluorescence microscopy.
A method for double-labeling sputum cells for p53 and cytokeratin
International Nuclear Information System (INIS)
Neft, R.E.; Tierney, L.A.; Belinsky, S.A.
1995-01-01
Molecular and immunological techniques may enhance the usefulness of sputum cytology as a screening tool for lung cancer. These techniques may also be useful in detecting and following the early progression of disease from metaplasia to dysplasia, carcinoma in situ, and finally to invasive carcinoma. Longitudinal information on the evolution of these malignant changes in the respiratory epithelium can be gained by prospective study of populations at high risk for lung cancer. This work is significant because double-labeling of cells in sputum with p53 and cytokeratin antibodies facilitates rapid screening of p53 positive neoplastic and preneoplastic lung cells by brightfield and fluorescence microscopy
Image-based phenotyping for non-destructive screening of different salinity tolerance traits in rice
Hairmansis, Aris
2014-08-14
Background Soil salinity is an abiotic stress wide spread in rice producing areas, limiting both plant growth and yield. The development of salt-tolerant rice requires efficient and high-throughput screening techniques to identify promising lines for salt affected areas. Advances made in image-based phenotyping techniques provide an opportunity to use non-destructive imaging to screen for salinity tolerance traits in a wide range of germplasm in a reliable, quantitative and efficient way. However, the application of image-based phenotyping in the development of salt-tolerant rice remains limited. Results A non-destructive image-based phenotyping protocol to assess salinity tolerance traits of two rice cultivars (IR64 and Fatmawati) has been established in this study. The response of rice to different levels of salt stress was quantified over time based on total shoot area and senescent shoot area, calculated from visible red-green-blue (RGB) and fluorescence images. The response of rice to salt stress (50, 75 and 100 mM NaCl) could be clearly distinguished from the control as indicated by the reduced increase of shoot area. The salt concentrations used had only a small effect on the growth of rice during the initial phase of stress, the shoot Na+ accumulation independent phase termed the ‘osmotic stress’ phase. However, after 20 d of treatment, the shoot area of salt stressed plants was reduced compared with non-stressed plants. This was accompanied by a significant increase in the concentration of Na+ in the shoot. Variation in the senescent area of the cultivars IR64 and Fatmawati in response to a high concentration of Na+ in the shoot indicates variation in tissue tolerance mechanisms between the cultivars. Conclusions Image analysis has the potential to be used for high-throughput screening procedures in the development of salt-tolerant rice. The ability of image analysis to discriminate between the different aspects of salt stress (shoot ion
P53 autoantibodies in 1006 patients followed up for breast cancer
International Nuclear Information System (INIS)
Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A
2000-01-01
Serial plasma samples from 1006 patients with breast cancer revealed: (i) no correlation of p53 autoantibody status with disease status at the time of sample collection, or with menopausal status at time of primary diagnosis of breast cancer; (ii) 155 out of 1006 (15%) of patients were positive for p53 autoantibodies, and these patients tended to have a persistent autoantibody status throughout follow up, irrespective of disease behaviour; and (iii) where a negative autoantibody status was found at primary diagnosis of breast cancer, this negative status persisted throughout follow up, irrespective of later disease behaviour. We conclude that screening for p53 autoantibody status is not informative on residual tumour activity nor on therapeutic responsiveness. Dysfunction of the tumour-suppressor protein, p53, may be due to either mutational or epigenetic factors, each of which may lead to accumulation of cytoplasmic p53. Abnormal accumulation of p53 in breast cancer tissue is predictive of poor prognosis [1,2]. Humoral studies [3,4] have shown that cancer patients may develop immunity to abnormally expressed p53, as revealed by p53 autoantibodies in the blood. Again, prognostic correlates have been noted, with presence of circulating p53 autoantibodies at diagnosis of breast cancer being associated with reduced overall survival [5,6] and with poor prognostic factors such as high histological grade and the absence of hormone receptors [5,7,8]. Little is known of the potential value of p53 autoantibody in follow up of cancer. In lung cancer there is evidence that autoantibodies to p53 may provide a useful tool to monitor response to therapy [9,10], whereas serial measurements of autoantibodies to p53 in 40 patients with advanced ovarian cancer were not found to be clinically useful [11]. In breast cancer some 30% of node-negative patients will relapse within 5 years, but there is no current means to predict those who are at risk. We performed the present study to
Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer
International Nuclear Information System (INIS)
Irshad, S.; Nawaz, T.
2008-01-01
Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)
p53 inhibits CRISPR-Cas9 engineering in human pluripotent stem cells.
Ihry, Robert J; Worringer, Kathleen A; Salick, Max R; Frias, Elizabeth; Ho, Daniel; Theriault, Kraig; Kommineni, Sravya; Chen, Julie; Sondey, Marie; Ye, Chaoyang; Randhawa, Ranjit; Kulkarni, Tripti; Yang, Zinger; McAllister, Gregory; Russ, Carsten; Reece-Hoyes, John; Forrester, William; Hoffman, Gregory R; Dolmetsch, Ricardo; Kaykas, Ajamete
2018-06-11
CRISPR/Cas9 has revolutionized our ability to engineer genomes and conduct genome-wide screens in human cells 1-3 . Whereas some cell types are amenable to genome engineering, genomes of human pluripotent stem cells (hPSCs) have been difficult to engineer, with reduced efficiencies relative to tumour cell lines or mouse embryonic stem cells 3-13 . Here, using hPSC lines with stable integration of Cas9 or transient delivery of Cas9-ribonucleoproteins (RNPs), we achieved an average insertion or deletion (indel) efficiency greater than 80%. This high efficiency of indel generation revealed that double-strand breaks (DSBs) induced by Cas9 are toxic and kill most hPSCs. In previous studies, the toxicity of Cas9 in hPSCs was less apparent because of low transfection efficiency and subsequently low DSB induction 3 . The toxic response to DSBs was P53/TP53-dependent, such that the efficiency of precise genome engineering in hPSCs with a wild-type P53 gene was severely reduced. Our results indicate that Cas9 toxicity creates an obstacle to the high-throughput use of CRISPR/Cas9 for genome engineering and screening in hPSCs. Moreover, as hPSCs can acquire P53 mutations 14 , cell replacement therapies using CRISPR/Cas9-enginereed hPSCs should proceed with caution, and such engineered hPSCs should be monitored for P53 function.
Exploring a minimal two-component p53 model
International Nuclear Information System (INIS)
Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei
2010-01-01
The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks
FATS is a transcriptional target of p53 and associated with antitumor activity
Directory of Open Access Journals (Sweden)
Zhang Xifeng
2010-09-01
Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.
Gao, Yi-ning; Wang, Dan-ying; Pan, Zong-fu; Mei, Yu-qin; Wang, Zhi-qiang; Zhu, Dan-yan; Lou, Yi-jia
2012-07-01
To set up a platform for phenotype-based primary screening of drug candidates promoting neuronal subtype differentiation in embryonic stem cells (ES) with light microscope. Hanging drop culture 4-/4+ method was employed to harvest the cells around embryoid body (EB) at differentiation endpoint. Morphological evaluation for neuron-like cells was performed with light microscope. Axons for more than three times of the length of the cell body were considered as neuron-like cells. The compound(s) that promote neuron-like cells was further evaluated. Icariin (ICA, 10(-6)mol/L) and Isobavachin (IBA, 10(-7)mol/L) were selected to screen the differentiation-promoting activity on ES cells. Immunofluorescence staining with specific antibodies (ChAT, GABA) was used to evaluate the neuron subtypes. The cells treated with IBA showed neuron-like phenotype, but the cells treated with ICA did not exhibit the morphological changes. ES cells treated with IBA was further confirmed to be cholinergic and GABAergic neurons. Phenotypic screening with light microscope for molecules promoting neuronal differentiation is an effective method with advantages of less labor and material consuming and time saving, and false-positive results derived from immunofluorescence can be avoided. The method confirms that IBA is able to facilitate ES cells differentiating into neuronal cells, including cholinergic neurons and GABAergic neurons.
Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53
International Nuclear Information System (INIS)
Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi
2001-01-01
Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)
p53 Acetylation: Regulation and Consequences
International Nuclear Information System (INIS)
Reed, Sara M.; Quelle, Dawn E.
2014-01-01
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer
p53 Acetylation: Regulation and Consequences
Energy Technology Data Exchange (ETDEWEB)
Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)
2014-12-23
Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents
Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib
2017-01-01
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.
Synthesis and evaluation of modified chalcone based p53 stabilizing agents
Iftikhar, Sunniya
2017-07-15
Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.
GenomeRNAi: a database for cell-based RNAi phenotypes.
Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael
2007-01-01
RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at http://rnai.dkfz.de.
Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer
Directory of Open Access Journals (Sweden)
Villiard Éric
2007-09-01
Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However
Energy Technology Data Exchange (ETDEWEB)
Deocaris, Custer C
2000-04-01
The p53 tumor suppressor is by far the most widely mutated gene in human cancers. p53 encodes a 53-kDa phosphoprotein, transcription-activator whose targets include genes and gene products that orchestrate genomic stability, cellular response to DNA damage, cell cycle progression apoptosis and aging (senescence). Analysis of the p53 gene profile has previously resulted in identifying several cancer-causative factors in the human setting, as well as, in creating a unique molecular profile of a tumor useful in the design of tailored-therapies for individual cancer patients. Our results in screening for p53 abnormalities in 140 Filipino patients with primary breast lesions confined from 1997-1998 in 5 major hospitals in Manila reveal that p53 plays an important role in the development and progression of breast cancer in at least 48% of all cases. Two methods of p53 analysis are employed, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction-temporal temperature gradient electrophoresis (PCR-TTGE). Inter-comparisons of method exhibit 63.3% concordance in 21 fresh breast carcinoma samples, with ELISA demonstrating 14% false-positives and 10% false-negatives. Only mutations in exon 7 (p=0.063) in the tumor samples how significant correlation with abnormal cellular elevation of p53. PCR-TTGE screening in a large series of 140 patients show that most genetic lesions are localized in exons 5 (41% of the total cases) and 6 (27% of the total cases). No mutations are, however, detected in the transactivation (exons 2-4) and oligomerization (exons 10-11) domains. Invasive carcinomas (stages II and III) are characterized with more frequent and diverse genetic alterations compared with benign tumors, most significantly at exon 5B (p=0.066) and at independently multiple sites (p=0.066). Earlier-onset cases (age of diagnosis < 50 yrs), known to be more clinico-pathologically aggressive, are diagnosed harboring more frequent p53 mutations centered at exon 7 (p=0
International Nuclear Information System (INIS)
Deocaris, Custer C.
2000-04-01
The p53 tumor suppressor is by far the most widely mutated gene in human cancers. p53 encodes a 53-kDa phosphoprotein, transcription-activator whose targets include genes and gene products that orchestrate genomic stability, cellular response to DNA damage, cell cycle progression apoptosis and aging (senescence). Analysis of the p53 gene profile has previously resulted in identifying several cancer-causative factors in the human setting, as well as, in creating a unique molecular profile of a tumor useful in the design of tailored-therapies for individual cancer patients. Our results in screening for p53 abnormalities in 140 Filipino patients with primary breast lesions confined from 1997-1998 in 5 major hospitals in Manila reveal that p53 plays an important role in the development and progression of breast cancer in at least 48% of all cases. Two methods of p53 analysis are employed, enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction-temporal temperature gradient electrophoresis (PCR-TTGE). Inter-comparisons of method exhibit 63.3% concordance in 21 fresh breast carcinoma samples, with ELISA demonstrating 14% false-positives and 10% false-negatives. Only mutations in exon 7 (p=0.063) in the tumor samples how significant correlation with abnormal cellular elevation of p53. PCR-TTGE screening in a large series of 140 patients show that most genetic lesions are localized in exons 5 (41% of the total cases) and 6 (27% of the total cases). No mutations are, however, detected in the transactivation (exons 2-4) and oligomerization (exons 10-11) domains. Invasive carcinomas (stages II and III) are characterized with more frequent and diverse genetic alterations compared with benign tumors, most significantly at exon 5B (p=0.066) and at independently multiple sites (p=0.066). Earlier-onset cases (age of diagnosis < 50 yrs), known to be more clinico-pathologically aggressive, are diagnosed harboring more frequent p53 mutations centered at exon 7 (p=0
Clinical utility of anti-p53 auto-antibody: systematic review and focus on colorectal cancer.
Suppiah, Aravind; Greenman, John
2013-08-07
Mutation of the p53 gene is a key event in the carcinogenesis of many different types of tumours. These can occur throughout the length of the p53 gene. Anti-p53 auto-antibodies are commonly produced in response to these p53 mutations. This review firstly describes the various mechanisms of p53 dysfunction and their association with subsequent carcinogenesis. Following this, the mechanisms of induction of anti-p53 auto-antibody production are shown, with various hypotheses for the discrepancies between the presence of p53 mutation and the presence/absence of anti-p53 auto-antibodies. A systematic review was performed with a descriptive summary of key findings of each anti-p53 auto-antibody study in all cancers published in the last 30 years. Using this, the cumulative frequency of anti-p53 auto-antibody in each cancer type is calculated and then compared with the incidence of p53 mutation in each cancer to provide the largest sample calculation and correlation between mutation and anti-p53 auto-antibody published to date. Finally, the review focuses on the data of anti-p53 auto-antibody in colorectal cancer studies, and discusses future strategies including the potentially promising role using anti-p53 auto-antibody presence in screening and surveillance.
Energy Technology Data Exchange (ETDEWEB)
Armesilla-Diaz, Alejandro, E-mail: aarmesilla@cib.csic.es [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain); Elvira, Gema; Silva, Augusto [Department of Cellular and Molecular Physiopathology, Centro de Investigaciones Biologicas, CSIC, Ramiro de Maeztu, 9, 28040 Madrid (Spain)
2009-12-10
Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.
The nucleolus directly regulates p53 export and degradation.
Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P
2011-09-05
The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.
Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine
2014-06-14
The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.
He, Mingyuan; Dong, Chen; Konishi, Teruaki; Tu, Wenzhi; Liu, Weili; Shiomi, Naoko; Kobayashi, Alisa; Uchihori, Yukio; Furusawa, Yoshiya; Hei, Tom K.; Dang, Bingrong; Shao, Chunlin
2014-04-01
High LET particle irradiation has several potential advantages over γ-rays such as p53-independent response. The purpose of this work is to disclose the effect of p53 on the bystander effect induced by different LET irradiations and underlying mechanism. Lymphocyte cells of TK6 (wild type p53) and HMy2.CIR (mutated p53) were exposed to either low or high LET irradiation, then their mitochondrial dysfunction and ROS generation were detected. The micronuclei (MN) induction in HL-7702 hepatocytes co-cultured with irradiated lymphocytes was also measured. It was found that the mitochondrial dysfunction, p66Shc activation, and intracellular ROS were enhanced in TK6 but not in HMy2.CIR cells after γ-ray irradiation, but all of them were increased in both cell lines after carbon and iron irradiation. Consistently, the bystander effect of MN formation in HL-7702 cells was only triggered by γ-irradiated TK6 cells but not by γ-irradiated HMy2.CIR cells. But this bystander effect was induced by both lymphocyte cell lines after heavy ion irradiation. PFT-μ, an inhibitor of p53, only partly inhibited ROS generation and bystander effect induced by 30 keV/μm carbon-irradiated TK6 cells but failed to suppress the bystander effect induced by the TK6 cells irradiated with either 70 keV/μm carbon or 180 keV/μm iron. The mitochondrial inhibitors of rotenone and oligomycin eliminated heavy ion induced ROS generation in TK6 and HMy2.CIR cells and hence diminished the bystander effect on HL-7702 cells. These results clearly demonstrate that the bystander effect is p53-dependent for low LET irradiation, but it is p53-independent for high LET irradiation which may be because of p53-independent ROS generation due to mitochondrial dysfunction.
FATS is a transcriptional target of p53 and associated with antitumor activity
Zhang Xifeng; Zhang Qian; Zhang Jun; Qiu Li; Yan Shuang-shuang; Feng Juling; Sun Yan; Huang Xingxu; Lu Karen H; Li Zheng
2010-01-01
Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374) through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS....
Energy Technology Data Exchange (ETDEWEB)
Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J.; Fortunato, Elizabeth A., E-mail: lfort@uidaho.edu
2016-10-15
Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.
The p53-dependent radioadaptive response
Ohnishi, Takeo
We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.
Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.
Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi
2003-04-01
Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.
Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73
Directory of Open Access Journals (Sweden)
Lu Xin
2009-06-01
Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.
Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H
2014-07-10
Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.
Choi, Hyun Kyung; Ryu, Hwani; Son, A-Rang; Seo, Bitna; Hwang, Sang-Gu; Song, Jie-Young; Ahn, Jiyeon
2016-04-01
To identify novel small molecules that induce selective cancer cell death, we screened a chemical library containing 1040 compounds in HT29 colon cancer and CCD18-Co normal colon cells, using a phenotypic cell-based viability assay system with the Cell Counting Kit-8 (CCK-8). We discovered a novel anthraquinone derivative, N-(4-[{(9,10-dioxo-9,10-dihydro-1-anthracenyl)sulfonyl}amino]phenyl)-N-methylacetamide (IMP1338), which was cytotoxic against the human colon cancer cells tested. The MTT cell viability assay showed that treatment with IMP1338 selectively inhibited HCT116, HCT116 p53(-/-), HT29, and A549 cancer cell proliferation compared to that of Beas2B normal epithelial cells. To elucidate the cellular mechanism underlying the cytotoxicity of IMP1338, we examined the effect of IMP1338 on the cell cycle distribution and death of cancer cells. IMP1338 treatment significantly arrested the cell cycle at S and G2/M phases by DNA damage and led to apoptotic cell death, which was determined using FACS analysis with Annexin V/PI double staining. Furthermore, IMP1338 increased caspase-3 cleavage in wild-type p53, p53 knockout HCT116, and HT29 cells as determined using immunoblotting. In addition, IMP1338 markedly induced the phosphorylation of histone H2AX and Chk1 in both cell lines while the combination of 5-fluorouracil (5-FU) and radiation inhibited the viability of HCT116, HCT116 p53(-/-), and HT29 cells compared to 5-FU or radiation alone. Our findings indicated that IMP1338 induced p53-independent cell death through S and G2/M phase arrest as well as DNA damage. These results provide a basis for future investigations assessing the promising anticancer properties of IMP1338. Copyright © 2016. Published by Elsevier Masson SAS.
Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S
2017-11-01
Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
S100A4 interacts with p53 in the nucleus and promotes p53 degradation.
Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J
2013-12-05
S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.
Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2012-08-01
Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.
p53 inactivation in chewing tobacco-induced oral cancers and leukoplakias from India.
Saranath, D; Tandle, A T; Teni, T R; Dedhia, P M; Borges, A M; Parikh, D; Sanghavi, V; Mehta, A R
1999-05-01
The inactivation of p53 tumour suppressor gene vis-á-vis point mutation, overexpression and degradation due to Human Papilloma virus (HPV) 16/18 infection, was examined in chewing tobacco-associated oral cancers and oral leukoplakias from India. The analysis of mutations was assessed by polymerase chain reaction (PCR) with single strand conformation polymorphism (PCR-SSCP) of exons 5-9 on DNA from 83 oral cancer cases, and the mutations confirmed by direct nucleotide sequencing of the PCR products. p53 protein expression was evaluated by immunohistochemical analysis on paraffin-embedded sections of 62 representative oral cancer biopsies and 22 leukoplakias, using p53-specific monoclonal antibody DO-7. The presence of HPV16/18 was detected in the 83 oral cancer cases by PCR analysis using HPV L1 consensus sequences, followed by Southern hybridization with type-specific oligonucleotide probes. Forty-six per cent (38/83) of oral cancer tumours showed p53 alterations, with 17% (14/83) showing point mutations, 37% (23/62) with overexpression and 25% (21/83) with presence of HPV16 wherein the E6 HPV16 protein degrades p53. HPV18 was not detected in any of the samples. Ninety-two per cent concordance was observed between missense point mutations and overexpression of p53 protein. A significant correlation was not observed between p53 alterations in oral cancer and clinico-pathological profile of the patients. Twenty-seven per cent (6/22) of oral leukoplakias showed p53 overexpression. The overall p53 alterations in oral cancer tissues and oral lesions are comparable to data from the oral cancers reported in the Western countries with smoking and alcohol-associated oral cancers, and suggest a critical role for p53 gene in a significant proportion of oral cancers from India. The overexpression of p53 protein in leukoplakias may serve as a valuable biomarker for identifying individuals at high risk of transformation to malignant phenotype.
Expression of p53 and p21 in primary glioblastomas
International Nuclear Information System (INIS)
Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.
2005-01-01
Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures
Immunohistochemical study of p53, pRb, p16 in esophageal cancer
International Nuclear Information System (INIS)
Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee
1998-01-01
To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs
Directory of Open Access Journals (Sweden)
Jeyran eShahbazi
2013-05-01
Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.
p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors
Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't
1999-01-01
Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this
2014-01-01
Introduction Interval cancers are tumors arising after a negative screening episode and before the next screening invitation. They can be classified into true interval cancers, false-negatives, minimal-sign cancers, and occult tumors based on mammographic findings in screening and diagnostic mammograms. This study aimed to describe tumor-related characteristics and the association of breast density and tumor phenotype within four interval cancer categories. Methods We included 2,245 invasive tumors (1,297 screening-detected and 948 interval cancers) diagnosed from 2000 to 2009 among 645,764 women aged 45 to 69 who underwent biennial screening in Spain. Interval cancers were classified by a semi-informed retrospective review into true interval cancers (n = 455), false-negatives (n = 224), minimal-sign (n = 166), and occult tumors (n = 103). Breast density was evaluated using Boyd’s scale and was conflated into: 75%. Tumor-related information was obtained from cancer registries and clinical records. Tumor phenotype was defined as follows: luminal A: ER+/HER2- or PR+/HER2-; luminal B: ER+/HER2+ or PR+/HER2+; HER2: ER-/PR-/HER2+; triple-negative: ER-/PR-/HER2-. The association of tumor phenotype and breast density was assessed using a multinomial logistic regression model. Adjusted odds ratios (OR) and 95% confidence intervals (95% CI) were calculated. All statistical tests were two-sided. Results Forty-eight percent of interval cancers were true interval cancers and 23.6% false-negatives. True interval cancers were associated with HER2 and triple-negative phenotypes (OR = 1.91 (95% CI:1.22-2.96), OR = 2.07 (95% CI:1.42-3.01), respectively) and extremely dense breasts (>75%) (OR = 1.67 (95% CI:1.08-2.56)). However, among true interval cancers a higher proportion of triple-negative tumors was observed in predominantly fatty breasts (breasts (28.7%, 21.4%, 11.3% and 14.3%, respectively; screening-detected cancers, extreme breast density
Domingo, Laia; Salas, Dolores; Zubizarreta, Raquel; Baré, Marisa; Sarriugarte, Garbiñe; Barata, Teresa; Ibáñez, Josefa; Blanch, Jordi; Puig-Vives, Montserrat; Fernández, Ana; Castells, Xavier; Sala, Maria
2014-01-10
Interval cancers are tumors arising after a negative screening episode and before the next screening invitation. They can be classified into true interval cancers, false-negatives, minimal-sign cancers, and occult tumors based on mammographic findings in screening and diagnostic mammograms. This study aimed to describe tumor-related characteristics and the association of breast density and tumor phenotype within four interval cancer categories. We included 2,245 invasive tumors (1,297 screening-detected and 948 interval cancers) diagnosed from 2000 to 2009 among 645,764 women aged 45 to 69 who underwent biennial screening in Spain. Interval cancers were classified by a semi-informed retrospective review into true interval cancers (n = 455), false-negatives (n = 224), minimal-sign (n = 166), and occult tumors (n = 103). Breast density was evaluated using Boyd's scale and was conflated into: 75%. Tumor-related information was obtained from cancer registries and clinical records. Tumor phenotype was defined as follows: luminal A: ER+/HER2- or PR+/HER2-; luminal B: ER+/HER2+ or PR+/HER2+; HER2: ER-/PR-/HER2+; triple-negative: ER-/PR-/HER2-. The association of tumor phenotype and breast density was assessed using a multinomial logistic regression model. Adjusted odds ratios (OR) and 95% confidence intervals (95% CI) were calculated. All statistical tests were two-sided. Forty-eight percent of interval cancers were true interval cancers and 23.6% false-negatives. True interval cancers were associated with HER2 and triple-negative phenotypes (OR = 1.91 (95% CI:1.22-2.96), OR = 2.07 (95% CI:1.42-3.01), respectively) and extremely dense breasts (>75%) (OR = 1.67 (95% CI:1.08-2.56)). However, among true interval cancers a higher proportion of triple-negative tumors was observed in predominantly fatty breasts (breasts (28.7%, 21.4%, 11.3% and 14.3%, respectively; cancers, extreme breast density being strongly associated with occult tumors (OR
p53 oncogene mutations in head and neck cancer based on the ...
African Journals Online (AJOL)
Yomi
2012-01-26
Jan 26, 2012 ... In order to study the p53 mutations in head and neck cancer, we explored the relationship between the different positions of the bases and the amino acids' physical and chemical properties. In this paper, the Euclidean distance (d) was defined. Furthermore, by using improved variation coefficient method,.
Regulation of autophagy by cytoplasmic p53.
Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido
2008-06-01
Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.
SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53
International Nuclear Information System (INIS)
Milner, J.; Gamble, J.
1985-01-01
The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T
Gene expression patterns associated with p53 status in breast cancer
International Nuclear Information System (INIS)
Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M
2006-01-01
Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes
Directory of Open Access Journals (Sweden)
Leiping Fu
2010-09-01
Full Text Available Human Papillomavirus (HPV E6 induced p53 degradation is thought to be an essential activity by which high-risk human Alphapapillomaviruses (alpha-HPVs contribute to cervical cancer development. However, most of our understanding is derived from the comparison of HPV16 and HPV11. These two viruses are relatively distinct viruses, making the extrapolation of these results difficult. In the present study, we expand the tested strains (types to include members of all known HPV species groups within the Alphapapillomavirus genus.We report the biochemical activity of E6 proteins from 27 HPV types representing all alpha-HPV species groups to degrade p53 in human cells. Expression of E6 from all HPV types epidemiologically classified as group 1 carcinogens significantly reduced p53 levels. However, several types not associated with cancer (e.g., HPV53, HPV70 and HPV71 were equally active in degrading p53. HPV types within species groups alpha 5, 6, 7, 9 and 11 share a most recent common ancestor (MRCA and all contain E6 ORFs that degrade p53. A unique exception, HPV71 E6 ORF that degraded p53 was outside this clade and is one of the most prevalent HPV types infecting the cervix in a population-based study of 10,000 women. Alignment of E6 ORFs identified an amino acid site that was highly correlated with the biochemical ability to degrade p53. Alteration of this amino acid in HPV71 E6 abrogated its ability to degrade p53, while alteration of this site in HPV71-related HPV90 and HPV106 E6s enhanced their capacity to degrade p53.These data suggest that the alpha-HPV E6 proteins' ability to degrade p53 is an evolved phenotype inherited from a most recent common ancestor of the high-risk species that does not always segregate with carcinogenicity. In addition, we identified an amino-acid residue strongly correlated with viral p53 degrading potential.
Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer
Directory of Open Access Journals (Sweden)
Wen-Cheng Chung
2017-11-01
Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.
Directory of Open Access Journals (Sweden)
Richard Moore
2015-12-01
Full Text Available The p53 tumor suppressor protein plays a critical role in cellular stress and cancer prevention. A number of post-transcriptional regulators, termed microRNAs, are closely connected with the p53-mediated cellular networks. While the molecular interactions among p53 and microRNAs have emerged, a systems-level understanding of the regulatory mechanism and the role of microRNAs-forming feedback loops with the p53 core remains elusive. Here we have identified from literature that there exist three classes of microRNA-mediated feedback loops revolving around p53, all with the nature of positive feedback coincidentally. To explore the relationship between the cellular performance of p53 with the microRNA feedback pathways, we developed a mathematical model of the core p53-MDM2 module coupled with three microRNA-mediated positive feedback loops involving miR-192, miR-34a, and miR-29a. Simulations and bifurcation analysis in relationship to extrinsic noise reproduce the oscillatory behavior of p53 under DNA damage in single cells, and notably show that specific microRNA abrogation can disrupt the wild-type cellular phenotype when the ubiquitous cell-to-cell variability is taken into account. To assess these in silico results we conducted microRNA-perturbation experiments in MCF7 breast cancer cells. Time-lapse microscopy of cell-population behavior in response to DNA double-strand breaks, together with image classification of single-cell phenotypes across a population, confirmed that the cellular p53 oscillations are compromised after miR-192 perturbations, matching well with the model predictions. Our study via modeling in combination with quantitative experiments provides new evidence on the role of microRNA-mediated positive feedback loops in conferring robustness to the system performance of stress-induced response of p53.
Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B
2017-01-01
PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I
International Nuclear Information System (INIS)
Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.
2003-01-01
The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future
Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.
2009-01-01
Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229
p53 expression in biopsies from children with Langerhans cell histiocytosis
DEFF Research Database (Denmark)
Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik
2002-01-01
based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....
Egan, Crystelle; Marakovitz, Susan; O’Rourke, Julia; Osiecki, Lisa; Illmann, Cornelia; Barton, Lauren; McLaughlin, Elizabeth; Proujansky, Rachel; Royal, Justin; Cowley, Heather; Rangel-Lugo, Martha; Pauls, David; Scharf, Jeremiah M.; Mathews, Carol A.
2014-01-01
Genome-wide association studies (GWAS) and other emerging technologies offer great promise for the identification of genetic risk factors for complex psychiatric disorders, yet such studies are constrained by the need for large sample sizes. Web-based collection offers a relatively untapped resource for increasing participant recruitment. Therefore, we developed and implemented a novel web-based screening and phenotyping protocol for genetic studies of Tourette Syndrome (TS), a childhood-onset neuropsychiatric disorder characterized by motor and vocal tics. Participants were recruited over a 13 month period through the membership of the Tourette Syndrome Association (TSA) (n=28,878). Of the TSA members contacted, 4.3% (1,242) initiated the questionnaire, and 79.5% (987) of these were enrollment eligible. 63.9% (631) of enrolled participants completed the study by submitting phenotypic data and blood specimens. Age was the only variable that predicted study completion; children and young adults were significantly less likely to be study completers than adults 26 and older. Compared to a clinic-based study conducted over the same time period, the web-based method yielded a 60% larger sample. Web-based participants were older and more often female; otherwise, the sample characteristics did not differ significantly. TS diagnoses based on the web-screen demonstrated 100% accuracy compared to those derived from in-depth clinical interviews. Our results suggest that a web-based approach is effective for increasing the sample size for genetic studies of a relatively rare disorder and that our web-based screen is valid for diagnosing TS. Findings from this study should aid in the development of web-based protocols for other disorders. PMID:23090870
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra
2017-09-29
p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo
2014-04-01
p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.
The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.
Directory of Open Access Journals (Sweden)
Peiyuan Jia
Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.
p53 mutations promote proteasomal activity.
Oren, Moshe; Kotler, Eran
2016-07-27
p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.
Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*
Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long
2013-01-01
Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668
Therapeutic targeting of the p53 pathway in cancer stem cells
Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.
2013-01-01
Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602
Targeting the p53 Pathway in Ewing Sarcoma
Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.
2011-01-01
The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471
Directory of Open Access Journals (Sweden)
Timothy C. Haire
2018-03-01
Full Text Available Chlamydomonas reinhardtii (Cr, a unicellular alga, is routinely utilized to study photosynthetic biochemistry, ciliary motility, and cellular reproduction. Its minimal culture requirements, unicellular morphology, and ease of transformation have made it a popular model system. Despite its relatively slow doubling time, compared with many bacteria, it is an ideal eukaryotic system for microplate-based studies utilizing either, or both, absorbance as well as fluorescence assays. Such microplate assays are powerful tools for researchers in the areas of toxicology, pharmacology, chemical genetics, biotechnology, and more. However, while microplate-based assays are valuable tools for screening biological systems, these methodologies can significantly alter the conditions in which the organisms are cultured and their subsequent physiology or morphology. Herein we describe a novel method for the microplate culture and in vivo phenotypic analysis of growth, viability, and photosynthetic pigments of C. reinhardtii. We evaluated the utility of our assay by screening silver nanoparticles for their effects on growth and viability. These methods are amenable to a wide assortment of studies and present a significant advancement in the methodologies available for research involving this model organism.
International Nuclear Information System (INIS)
Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming
2008-01-01
Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)
The expanding universe of p53 targets.
Menendez, Daniel; Inga, Alberto; Resnick, Michael A
2009-10-01
The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.
Energy Technology Data Exchange (ETDEWEB)
Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)
2015-11-13
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
International Nuclear Information System (INIS)
Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.
2015-01-01
Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.
Directory of Open Access Journals (Sweden)
Sun Youxian
2008-06-01
Full Text Available Abstract Background The recent emergence of high-throughput automated image acquisition technologies has forever changed how cell biologists collect and analyze data. Historically, the interpretation of cellular phenotypes in different experimental conditions has been dependent upon the expert opinions of well-trained biologists. Such qualitative analysis is particularly effective in detecting subtle, but important, deviations in phenotypes. However, while the rapid and continuing development of automated microscope-based technologies now facilitates the acquisition of trillions of cells in thousands of diverse experimental conditions, such as in the context of RNA interference (RNAi or small-molecule screens, the massive size of these datasets precludes human analysis. Thus, the development of automated methods which aim to identify novel and biological relevant phenotypes online is one of the major challenges in high-throughput image-based screening. Ideally, phenotype discovery methods should be designed to utilize prior/existing information and tackle three challenging tasks, i.e. restoring pre-defined biological meaningful phenotypes, differentiating novel phenotypes from known ones and clarifying novel phenotypes from each other. Arbitrarily extracted information causes biased analysis, while combining the complete existing datasets with each new image is intractable in high-throughput screens. Results Here we present the design and implementation of a novel and robust online phenotype discovery method with broad applicability that can be used in diverse experimental contexts, especially high-throughput RNAi screens. This method features phenotype modelling and iterative cluster merging using improved gap statistics. A Gaussian Mixture Model (GMM is employed to estimate the distribution of each existing phenotype, and then used as reference distribution in gap statistics. This method is broadly applicable to a number of different types of
Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit
2017-01-01
Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454
Ewing, SJ; Zhu, S; Zhu, F; House, JS; Smart, RC
2013-01-01
CCAAT/enhancer-binding protein-β (C/EBPβ) is a mediator of cell survival and tumorigenesis. When C/EBPβ−/− mice are treated with carcinogens that produce oncogenic Ras mutations in keratinocytes, they respond with abnormally elevated keratinocyte apoptosis and a block in skin tumorigenesis. Although this aberrant carcinogen-induced apoptosis results from abnormal upregulation of p53, it is not known whether upregulated p53 results from oncogenic Ras and its ability to induce p19Arf and/or activate DNA-damage response pathways or from direct carcinogen-induced DNA damage. We report that p19Arf is dramatically elevated in C/EBPβ−/− epidermis and that C/EBPβ represses a p19Arf promoter reporter. To determine whether p19Arf is responsible for the proapoptotic phenotype in C/EBPβ−/− mice, C/EBPβ−/−;p19Arf−/− mice were generated. C/EBPβ−/−;p19Arf−/− mice responded to carcinogen treatment with increased p53 and apoptosis, indicating p19Arf is not essential. To ascertain whether oncogenic Ras activation induces aberrant p53 and apoptosis in C/EBPβ−/− epidermis, we generated K14-ER:Ras; C/EBPβ−/− mice. Oncogenic Ras activation induced by 4-hydroxytamoxifen did not produce increased p53 or apoptosis. Finally, when C/EBPβ−/− mice were treated with differing types of DNA-damaging agents, including alkylating chemotherapeutic agents, they displayed aberrant levels of p53 and apoptosis. These results indicate that C/EBPβ represses p53 to promote cell survival downstream of DNA damage and suggest that inhibition of C/EBPβ may be a target for cancer cotherapy to increase the efficacy of alkylating chemotherapeutic agents. PMID:18636078
Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.
Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,
Directory of Open Access Journals (Sweden)
Arindam Datta
2016-06-01
Full Text Available Mutation in TP53 is a common genetic alteration in human cancers. Certain tumor associated p53 missense mutants acquire gain-of-function (GOF properties and confer oncogenic phenotypes including enhanced chemoresistance. The colorectal cancers (CRC harboring mutant p53 are generally aggressive in nature and difficult to treat. To identify a potential gene expression signature of GOF mutant p53-driven acquired chemoresistance in CRC, we performed transcriptome profiling of floxuridine (FUdR treated SW480 cells expressing mutant p53R273H (GEO#: GSE77533. We obtained several genes differentially regulated between FUdR treated and untreated cells. Further, functional characterization and pathway analysis revealed significant enrichment of crucial biological processes and pathways upon FUdR treatment in SW480 cells. Our data suggest that in response to chemotherapeutics treatment, cancer cells with GOF mutant p53 can modulate key cellular pathways to withstand the cytotoxic effect of the drugs. The genes and pathways identified in the present study can be further validated and targeted for better chemotherapy response in colorectal cancer patients harboring mutant p53.
Caspase Activation and Aberrant Cell Growth in a p53+/+ Cell Line from a Li-Fraumeni Syndrome Family
Directory of Open Access Journals (Sweden)
Zaki A. Sherif
2015-01-01
Full Text Available Wild-type p53 is well known to induce cell cycle arrest and apoptosis to block aberrant cell growth. However, p53’s unique role in apoptosis and cell proliferation in Li-Fraumeni Syndrome (LFS has not been well elucidated. The aim of this study is to characterize the activity of wild-type p53 protein in LFS family dominated by a germline negative mutant p53. As expected, etoposide-treated wild-type p53-containing cell lines, LFS 2852 and control Jurkat, showed a greater rate of caspase- and annexin V-induced apoptotic cell death compared to the p53-mutant LFS 2673 cell line although mitochondrial and nuclear assays could not detect apoptosis in these organelles. The most intriguing part of the observation was the abnormal proliferation rate of the wild-type p53-containing cell line, which grew twice as fast as 2673 and Jurkat cells. This is important because apoptosis inducers acting through the mitochondrial death pathway are emerging as promising drugs against tumors where the role of p53 is not only to target gene regulation but also to block cell proliferation. This study casts a long shadow on the possible dysregulation of p53 mediators that enable cell proliferation. The deregulation of proliferation pathways represents an important anticancer therapeutic strategy for patients with the LFS phenotype.
Menin and p53 have non-synergistic effects on tumorigenesis in mice
International Nuclear Information System (INIS)
Loffler, Kelly A; Mould, Arne W; Waring, Paul M; Hayward, Nicholas K; Kay, Graham F
2012-01-01
While it is now more than a decade since the first description of the gene mutation underlying the tumour predisposition syndrome multiple endocrine neoplasia type 1 (MEN1), the mechanism by which its protein product menin acts to prevent development of tumours is still poorly understood. We undertook a genetic experiment to assess whether menin synergises with p53. Mice carrying various combinations of Men1 and Trp53 mutations were generated then survival and pathology assessed. While homozygous loss of Trp53 in mice resulted in early onset, aggressive tumours and profoundly reduced lifespan, heterozygous loss of either Trp53 or Men1 caused later onset disease, with a spectrum of tumours characteristic of each tumour suppressor gene. Loss of one copy of Men1 in animals also lacking both alleles of Trp53 did not exacerbate phenotype, based on survival, animal weight or sites of pathology, compared to Trp53 deletion alone. Dual heterozygous deletion of Men1 and Trp53 resulted in a small reduction in lifespan compared to the individual mutations, without new tumour sites. In the adrenal, we observed development of cortical tumours in dual heterozygous animals, as we have previously seen in Men1 +/− animals, and there was loss of heterozygosity at the Men1 allele in these tumours. Median number of pathology observations per animal was increased in dual heterozygous animals compared with heterozygous loss of Trp53 alone. Simultaneous heterozygous deletion of Men1 in animals with either heterozygous or homozygous deletion of Trp53 did not result in formation of tumours at any new sites, implying additive rather than synergistic effects of these pathways. Mice that were Men1 +/− in addition to Trp53 +/− had tumours in endocrine as well as other sites, implying that increase in total tumour burden, at sites typically associated with either Men1 or Trp53 loss, contributed to the slight decrease in survival in Men1 +/− : Trp53 +/− animals in comparison with their
P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors
International Nuclear Information System (INIS)
Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.
1999-01-01
Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy
Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.
Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei
2013-07-01
Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Julnar Usta
Full Text Available Genotype phenotype correlations in Wilson disease (WD are best established in homozygous patients or in compound heterozygous patients carrying the same set of mutations. We determined the clinical phenotype of patients with WD carrying the c.2298_2299insC in Exon 8 (c.2299insC or the p. Ala1003Thr missense substitution in Exon 13 mutations in the homozygous or compound heterozygous state. We investigated 76 members of a single large Lebanese family. Their genotypes were determined, and clinical assessments were carried out for affected subjects. We also performed a literature search retrieving the phenotypes of patients carrying the same mutations of our patients in the homozygous or compound heterozygous state. There were 7 consanguineous marriages in this family and the prevalence of WD was 8.9% and of carriers of ATP7B mutation 44.7%. WD was confirmed in 9 out of 76 subjects. All 9 had the c.2299insC mutation, 5 homozygous and 4-compound heterozygous with p. Ala1003Thr. Six of our patients had hepatic, 2 had neurologic and 1 had asymptomatic phenotype. Based on our data and a literature review, clear phenotypes were reported for 38 patients worldwide carrying the c.2299insC mutation. About 53% of those have hepatic and 29% have neurologic phenotype. Furthermore, there were 10 compound heterozygous patients carrying the p. Ala1003Thr mutation. Among those, 80% having c.2299insC as the second mutation had hepatic phenotype, and all others had neurologic phenotype. We hereby report an association between the c.2299insC mutation and hepatic phenotype and between the p. Ala1003Thr mutation and neurologic phenotype.
TRIM65 negatively regulates p53 through ubiquitination
Energy Technology Data Exchange (ETDEWEB)
Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)
2016-04-22
Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.
Chemical Variations on the p53 Reactivation Theme
Directory of Open Access Journals (Sweden)
Carlos J. A. Ribeiro
2016-05-01
Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.
A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53
International Nuclear Information System (INIS)
Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.
2011-01-01
eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)
International Nuclear Information System (INIS)
Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei
2009-01-01
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
Energy Technology Data Exchange (ETDEWEB)
Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)
2009-09-04
CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.
CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.
Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon
2017-09-19
Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.
p53 specific (auto)immunity in mice
Lauwen, Marjolein Monique
2008-01-01
Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T
International Nuclear Information System (INIS)
Giacomazzi, Juliana; Hainaut, Pierre; Ashton-Prolla, Patricia; Selistre, Simone; Duarte, Juliana; Ribeiro, Jorge Pinto; Vieira, Paulo JC; Souza Macedo, Gabriel de; Rossi, Cristina; Czepielewski, Mauro; Netto, Cristina Brinkmann Oliveira
2013-01-01
Adrenocortical carcinomas (ACCs) are among the most common childhood cancers occurring in infants affected with the Li-Fraumeni and Li- Fraumeni-like (LFS/LFL) syndromes, which are caused by dominant germline mutations in the TP53 gene. In Brazil, a particular mutation, occurring in the tetramerisation domain of the gene, p.R337H, is exceedingly common due to a founder effect and is strongly associated with ACC. In this report, we describe the phenotype and long-term clinical follow-up of a female child diagnosed with ACC and homozygous for the TP53 p.R337H founder mutation. At age 11 months, the patient was diagnosed with a virilising anaplastic adrenal cortical tumour, which was completely excised without disturbing the adrenal capsule. Family history was consistent with an LFL tumour pattern, and genotyping identified the TP53 p.R337H mutation in both alleles in genomic DNA from lymphocytes and fibroblasts. Haplotype analysis confirmed the occurrence of the mutation in the same founder haplotype previously described in other Brazilian patients. No other germline or somatic TP53 mutations or rearrangements were identified. At age 9 years, the child was asymptomatic and had no evidence of endocrine derangements. Full body and brain magnetic resonance imaging (MRI) failed to detect any suspicious proliferative lesions, and cardiopulmonary exercise testing results were within the normal reference for the child’s age, ruling out a major exercise capacity deficiency. This is the first clinical and aerobic functional capacity documentation of a patient who carries two mutant TP53 alleles and no wild-type allele. Our results support the hypothesis that TP53 p.R337H, the most common TP53 mutation ever described in any population, is a conditional mutant. Furthermore, our observations over a long period of clinical follow-up suggest that TP53 p.R337H homozygotes do not have a more severe disease phenotype than do heterozygote carriers of the same mutation. Patients with
The Transcriptional Landscape of p53 Signalling Pathway
Directory of Open Access Journals (Sweden)
Chizu Tanikawa
2017-06-01
Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.
Expression of p53 in oligodendrogliomas
J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)
1993-01-01
textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and
Expression of p53 in oligodendrogliomas
Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.
1993-01-01
The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.
p53 in differentiation of thyroid cancer
International Nuclear Information System (INIS)
Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.
1993-01-01
P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)
Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R
2002-08-15
Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.
Joslin, John; Gilligan, James; Anderson, Paul; Garcia, Catherine; Sharif, Orzala; Hampton, Janice; Cohen, Steven; King, Miranda; Zhou, Bin; Jiang, Shumei; Trussell, Christopher; Dunn, Robert; Fathman, John W; Snead, Jennifer L; Boitano, Anthony E; Nguyen, Tommy; Conner, Michael; Cooke, Mike; Harris, Jennifer; Ainscow, Ed; Zhou, Yingyao; Shaw, Chris; Sipes, Dan; Mainquist, James; Lesley, Scott
2018-05-01
The goal of high-throughput screening is to enable screening of compound libraries in an automated manner to identify quality starting points for optimization. This often involves screening a large diversity of compounds in an assay that preserves a connection to the disease pathology. Phenotypic screening is a powerful tool for drug identification, in that assays can be run without prior understanding of the target and with primary cells that closely mimic the therapeutic setting. Advanced automation and high-content imaging have enabled many complex assays, but these are still relatively slow and low throughput. To address this limitation, we have developed an automated workflow that is dedicated to processing complex phenotypic assays for flow cytometry. The system can achieve a throughput of 50,000 wells per day, resulting in a fully automated platform that enables robust phenotypic drug discovery. Over the past 5 years, this screening system has been used for a variety of drug discovery programs, across many disease areas, with many molecules advancing quickly into preclinical development and into the clinic. This report will highlight a diversity of approaches that automated flow cytometry has enabled for phenotypic drug discovery.
International Nuclear Information System (INIS)
Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang
2007-01-01
Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is
p53 and the pathogenesis of skin cancer
International Nuclear Information System (INIS)
Benjamin, Cara L.; Ananthaswamy, Honnavara N.
2007-01-01
The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients
Charoenkwan, Phasit; Hwang, Eric; Cutler, Robert W; Lee, Hua-Chin; Ko, Li-Wei; Huang, Hui-Ling; Ho, Shinn-Ying
2013-01-01
High-content screening (HCS) has become a powerful tool for drug discovery. However, the discovery of drugs targeting neurons is still hampered by the inability to accurately identify and quantify the phenotypic changes of multiple neurons in a single image (named multi-neuron image) of a high-content screen. Therefore, it is desirable to develop an automated image analysis method for analyzing multi-neuron images. We propose an automated analysis method with novel descriptors of neuromorphology features for analyzing HCS-based multi-neuron images, called HCS-neurons. To observe multiple phenotypic changes of neurons, we propose two kinds of descriptors which are neuron feature descriptor (NFD) of 13 neuromorphology features, e.g., neurite length, and generic feature descriptors (GFDs), e.g., Haralick texture. HCS-neurons can 1) automatically extract all quantitative phenotype features in both NFD and GFDs, 2) identify statistically significant phenotypic changes upon drug treatments using ANOVA and regression analysis, and 3) generate an accurate classifier to group neurons treated by different drug concentrations using support vector machine and an intelligent feature selection method. To evaluate HCS-neurons, we treated P19 neurons with nocodazole (a microtubule depolymerizing drug which has been shown to impair neurite development) at six concentrations ranging from 0 to 1000 ng/mL. The experimental results show that all the 13 features of NFD have statistically significant difference with respect to changes in various levels of nocodazole drug concentrations (NDC) and the phenotypic changes of neurites were consistent to the known effect of nocodazole in promoting neurite retraction. Three identified features, total neurite length, average neurite length, and average neurite area were able to achieve an independent test accuracy of 90.28% for the six-dosage classification problem. This NFD module and neuron image datasets are provided as a freely downloadable
Profiling of oligosaccharides and p53 gene mutation in Filipino breast tumors
International Nuclear Information System (INIS)
Deocaris, Custer C.; De Vera, Azucena C.; Magno, Jose Donato A.; Cruz, Michael Joseph B.; Prodigalidad, Abelardo-Alan T.; Jacinto, Sonia D.
2010-01-01
Majority of patients are diagnosed with benign tumors, however, such benign tumors can progress to an invasive disease. Since carbohydrate-mediated cell-cell adhesion and proliferative potential play crucial roles in tumorigenesis and tumor aggressive behavior, we analyzed the qualitative changes in oligosaccharide expression and analyzed for presence of mutation in the tumor suppressor p53 gene, the most mutated gene in all human cancers. Forty-three (43) breast tumors were screened for p53 mutation in exons 2-11 using polymerase chain reaction (PCR)-amplification coupled to temporal temperature gradient electrophoresis (TTGE). Paraffin-embedded tissues were stained with biotinylated-glycoproteins containing the following sugar groups: mannose (Man), lactose (Lac), fucoidan (Fuc), N-acetyl-glucosamine (GlcNac), N-acetyl-b-galactosamine (GalNAc) and hyaluronic acid (Hya). Expression of carbohydrate receptors was significantly elevated (p=0.003) in malignant compared with benign tumors, particularly at receptors for GalNAc, lac and Fuc. No change in overall glycan signatures using our panel of neoglycoconjugates was noted when grouped according to p53 mutation status in both benign and malignant cases. Although the prognostic value of carbohydrate-receptors in breast cancer has not been validated to date, our results indicate that benign and malignant tumors can be defined by their affinities to our battery of neoglyconjugates. However, result from our reverse lectin histochemistry failed to correlated glycan signature with presence of p53 mutations. (author)
Identification and characterization of Burkholderia multivorans CCA53.
Akita, Hironaga; Kimura, Zen-Ichiro; Yusoff, Mohd Zulkhairi Mohd; Nakashima, Nobutaka; Hoshino, Tamotsu
2017-07-06
A lignin-degrading bacterium, Burkholderia sp. CCA53, was previously isolated from leaf soil. The purpose of this study was to determine phenotypic and biochemical features of Burkholderia sp. CCA53. Multilocus sequence typing (MLST) analysis based on fragments of the atpD, gltD, gyrB, lepA, recA and trpB gene sequences was performed to identify Burkholderia sp. CCA53. The MLST analysis revealed that Burkholderia sp. CCA53 was tightly clustered with B. multivorans ATCC BAA-247 T . The quinone and cellular fatty acid profiles, carbon source utilization, growth temperature and pH were consistent with the characteristics of B. multivorans species. Burkholderia sp. CCA53 was therefore identified as B. multivorans CCA53.
Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri
2011-07-01
There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.
Directory of Open Access Journals (Sweden)
Alfredo Ribeiro-Silva
2003-06-01
Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human
Palazzo, E; Kellett, M; Cataisson, C; Gormley, A; Bible, P W; Pietroni, V; Radoja, N; Hwang, J; Blumenberg, M; Yuspa, S H; Morasso, M I
2016-06-16
Epidermal homeostasis depends on the coordinated control of keratinocyte cell cycle. Differentiation and the alteration of this balance can result in neoplastic development. Here we report on a novel DLX3-dependent network that constrains epidermal hyperplasia and squamous tumorigenesis. By integrating genetic and transcriptomic approaches, we demonstrate that DLX3 operates through a p53-regulated network. DLX3 and p53 physically interact on the p21 promoter to enhance p21 expression. Elevating DLX3 in keratinocytes produces a G1-S blockade associated with p53 signature transcriptional profiles. In contrast, DLX3 loss promotes a mitogenic phenotype associated with constitutive activation of ERK. DLX3 expression is lost in human skin cancers and is extinguished during progression of experimentally induced mouse squamous cell carcinoma (SCC). Reinstatement of DLX3 function is sufficient to attenuate the migration of SCC cells, leading to decreased wound closure. Our data establish the DLX3-p53 interplay as a major regulatory axis in epidermal differentiation and suggest that DLX3 is a modulator of skin carcinogenesis.
Microbial Regulation of p53 Tumor Suppressor.
Directory of Open Access Journals (Sweden)
Alexander I Zaika
2015-09-01
Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.
Battle Against Cancer: An Everlasting Saga of p53
Directory of Open Access Journals (Sweden)
Qian Hao
2014-12-01
Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Regulation of p53 tetramerization and nuclear export by ARC.
Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N
2007-12-26
Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.
Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L
2018-05-31
The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression
International Nuclear Information System (INIS)
Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng
2008-01-01
Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression
Tumor hypoxia, p53, and prognosis in cervical cancers
International Nuclear Information System (INIS)
Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen
2001-01-01
Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p
A simple phenotypic method for screening of MCR-1-mediated colistin resistance.
Coppi, M; Cannatelli, A; Antonelli, A; Baccani, I; Di Pilato, V; Sennati, S; Giani, T; Rossolini, G M
2018-02-01
To evaluate a novel method, the colistin-MAC test, for phenotypic screening of acquired colistin resistance mediated by transferable mcr-1 resistance determinants, based on colistin MIC reduction in the presence of dipicolinic acid (DPA). The colistin-MAC test consists in a broth microdilution method, in which colistin MIC is tested in the absence or presence of DPA (900 μg/mL). Overall, 74 colistin-resistant strains of Enterobacteriaceae (65 Escherichia coli and nine other species), including 61 strains carrying mcr-1-like genes and 13 strains negative for mcr genes, were evaluated with the colistin-MAC test. The presence of mcr-1-like and mcr-2-like genes was assessed by real-time PCR and end-point PCR. For 20 strains, whole-genome sequencing data were also available. A ≥8-fold reduction of colistin MIC in the presence of DPA was observed with 59 mcr-1-positive strains, including 53 E. coli of clinical origin, three E. coli transconjugants carrying MCR-1-encoding plasmids, one Enterobacter cloacae complex and two Citrobacter spp. Colistin MICs were unchanged, increased or at most reduced by twofold with the 13 mcr-negative colistin-resistant strains (nine E. coli and four Klebsiella pneumoniae), but also with two mcr-1-like-positive K. pneumoniae strains. The colistin-MAC test could be a simple phenotypic test for presumptive identification of mcr-1-positive strains among isolates of colistin-resistant E. coli, based on a ≥8-fold reduction of colistin MIC in the presence of DPA. Evaluation of the test with a larger number of strains, species and mcr-type resistance determinants would be of interest. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Dumble, Melissa L; Croager, Emma J; Yeoh, George C T; Quail, Elizabeth A
2002-03-01
Oval cells are bipotential liver stem cells able to differentiate into hepatocytes and bile duct epithelia. In normal adult liver oval cells are quiescent, existing in low numbers around the periportal region, and proliferate following severe, prolonged liver trauma. There is evidence implicating oval cells in the development of hepatocellular carcinoma, and hence the availability of an immortalized oval cell line would be invaluable for the study of liver cell lineage differentiation and carcinogenesis. A novel approach in the generation of cell lines is the use of the p53 knockout mouse. Absence of p53 allows a cell to cycle past the normal Hayflick limit, rendering it immortalized, although subsequent genetic alterations are thought necessary for transformation. p53 knockout mice were fed a choline-deficient, ethionine-supplemented diet, previously shown to increase oval cell numbers in wild-type mice. The oval cells were isolated by centrifugal elutriation and maintained in culture. Colonies of hepatic cells were isolated and characterized with respect to phenotype, growth characteristics and tumorigenicity. Analysis of gene expression by Northern blotting and immunocytochemistry suggests they are oval-like cells by virtue of albumin and transferrin expression, as well as the oval cell markers alpha fetoprotein, M(2)-pyruvate kinase and A6. Injection into athymic nude mice shows the cell lines are capable of forming tumors which phenotypically resemble hepatocellular carcinoma. Thus, the use of p53 null hepatic cells successfully generated immortalized and tumorigenic hepatic stem cell lines. The results presented support the idea that deleting p53 allows immortalization and contributes to the transformation of the oval-like cell lines. Further, the tumorigenic status of the cell lines is direct evidence for the participation of oval cells in the formation of hepatocellular carcinoma.
Analysis of p53- immunoreactivity in astrocytic brain tumors
Directory of Open Access Journals (Sweden)
Shinkarenko T.V.
2016-12-01
Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.
Immunohistochemical analysis of P53 protein in odontogenic cysts
Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.
2010-01-01
The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493
iScreen: Image-Based High-Content RNAi Screening Analysis Tools.
Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua
2015-09-01
High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.
DEFF Research Database (Denmark)
Savelyeva, I.; Dobbelstein, M.
2011-01-01
to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...
Brighenti, E; Calabrese, C; Liguori, G; Giannone, F A; Trerè, D; Montanaro, L; Derenzini, M
2014-01-01
Chronic inflammation is an established risk factor for the onset of cancer, and the inflammatory cytokine IL-6 has a role in tumorigenesis by enhancing proliferation and hindering apoptosis. As factors stimulating proliferation also downregulate p53 expression by enhancing ribosome biogenesis, we hypothesized that IL-6 may cause similar changes in inflamed tissues, thus activating a mechanism that favors neoplastic transformation. Here, we showed that IL-6 downregulated the expression and activity of p53 in transformed and untransformed human cell lines. This was the consequence of IL-6-dependent stimulation of c-MYC mRNA translation, which was responsible for the upregulation of rRNA transcription. The enhanced rRNA transcription stimulated the MDM2-mediated proteasomal degradation of p53, by reducing the availability of ribosome proteins for MDM2 binding. The p53 downregulation induced the acquisition of cellular phenotypic changes characteristic of epithelial–mesenchymal transition, such as a reduced level of E-cadherin expression, increased cell invasiveness and a decreased response to cytotoxic stresses. We found that these changes also occurred in colon epithelial cells of patients with ulcerative colitis, a very representative example of chronic inflammation at high risk for tumor development. Histochemical and immunohistochemical analysis of colon biopsy samples showed an upregulation of ribosome biogenesis, a reduced expression of p53, together with a focal reduction or absence of E-cadherin expression in chronic colitis in comparison with normal mucosa samples. These changes disappeared after treatment with anti-inflammatory drugs. Taken together, the present results highlight a new mechanism that may link chronic inflammation to cancer, based on p53 downregulation, which is activated by the enhancement of rRNA transcription upon IL-6 exposure. PMID:24531714
p53 downregulates the Fanconi anaemia DNA repair pathway.
Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck
2016-04-01
Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.
Buglioni, S; D'Agnano, I; Vasselli, S; Perrone Donnorso, R; D'Angelo, C; Brenna, A; Benevolo, M; Cosimelli, M; Zupi, G; Mottolese, M
2001-09-01
To identify the prognostically highest risk patients, DNA content and p53 nuclear or cytoplasmic accumulation, evaluated by monoclonal antibody DO7 and polyclonal antibody CM1, were determined in 94 surgically resected stage II (Dukes B2) colorectal cancers, treated or not with adjuvant 5-fluorouracil-based chemotherapy. Sixty-one (65%) of the tumors were aneuploid, 16 (17%) of which had a multiploid DNA content; 50 (53%) displayed DO7 nuclear p53 accumulation, and 44 (47%) showed cytoplasmic CM1 positivity. In multivariate analysis, only multiploidy and p53 nuclear positivity emerged as independent prognostic indicators of a poorer outcome. Positivity for p53 was associated with shorter survival in 5-fluorouracil-treated and untreated patients. Therefore, in patients with Dukes B2 colorectal cancer, a biologic profile based on the combined evaluation of DNA multiploidy and p53 status can provide valuable prognostic information, identifying patients to be enrolled in alternative, more aggressive therapeutic trials.
Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine
2009-04-01
Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.
Expression of Androgen Receptor Is Negatively Regulated By p53
Directory of Open Access Journals (Sweden)
Fatouma Alimirah
2007-12-01
Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.
Directory of Open Access Journals (Sweden)
Vladim and iacute;r Barto and scaron;
2016-12-01
Full Text Available Objective: Nuclear expression of p53 protein is associated with a biological behavior in a variety of human malignancies. In cutaneous basal cell carcinoma (BCC, however, many studies have provided conflicting results in this regard. We aimed to determine whether there is relationship between p53 expression and different histologic subtypes of BCC, and whether it may indicate tumor aggressiveness. Materials and Methods: Biopsy samples from 66 cutaneous BCCs from 57 patients were collected. P53 expression was demonstrated by immunohistochemical staining using the anti-p53 antibody. Among them, 52 cases were also evaluated for Ki-67 antigen. Results: Immunoreactivity of p53 protein varied in the range of 0 to 100% of total tumor tissue (mean value 46.0%. The expression exceeding 5% of cancer tissue (positive staining was found in 54 BCCs (81.8%. Within this group, there were 25 cases (37.9% with low and 29 cases (43.9% with high expression. In superficial, superficial-nodular, nodular, nodular-infiltrative and infiltrative BCCs, p53 protein positivity was found in 100% (8/8, 80% (8/10, 70.4% (19/27, 88.2% (15/17 and 100% (4/4, respectively. We did not reveal a significant correlation between the extent of p53 protein expression and BCC subtypes except for nodular BCC, in which a number of negative cases (8/27, 29.6% were just above the threshold of statistical significance (P = 0.04. After merging cancers into non-aggressive and aggressive growth phenotype, no association with expression of p53 protein was found. There was no relationship between p53 protein expression and topographical sites after they have been gathered into sun-exposed and sun-protected locations. We did not observe any association between expression of p53 protein and Ki-67 antigen. Conclusion: In cutaneous BCC, the expression of p53 protein does not seem to reflect a biological behavior and tumor aggressiveness. Therefore, in a routine dermatopathological practice
Expression of p53 protein in high-grade gastroenteropancreatic neuroendocrine carcinoma
DEFF Research Database (Denmark)
Ali, Abir Salwa; Grönberg, Malin; Federspiel, Birgitte
2017-01-01
of immunoreactive p53 protein in GEP-NEC. Materials and methods Tumor tissues from 124 GEP-NEC patients with locally advanced or metastatic disease treated with platinum-based chemotherapy were collected from Nordic centers and clinical data were obtained from the Nordic NEC register. Tumor proliferation rate...... In this cohort of GEP-NEC patients, p53 expression could not be correlated with clinical outcome. However, in patients with colorectal NECs, p53 expression was correlated with shorter PFS and OS. Further studies are needed to establish the role of immunoreactive p53 as a prognostic marker for GEP-NEC patients.......Background Gastroenteropancreatic neuroendocrine carcinomas (GEP-NECs) are aggressive, rapidly proliferating tumors. Therapeutic response to current chemotherapy regimens is usually short lasting. The aim of this study was to examine the expression and potential clinical importance...
Zhou, Zhigang; Li, Yumin
2009-10-01
As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.
Energy Technology Data Exchange (ETDEWEB)
Neboori, Hanmanth J.R. [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Haffty, Bruce G., E-mail: hafftybg@umdnj.edu [Department of Radiation Oncology, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Wu Hao [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Yang Qifeng [Department of Breast Surgery, Qilu Hospital, Shandong University, Ji' nan (China); Aly, Amal [Division of Medical Oncology, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Goyal, Sharad; Schiff, Devora [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Moran, Meena S. [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT (United States); Golhar, Ryan [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Chen Chunxia; Moore, Dirk [Department of Biostatistics, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); and others
2012-08-01
Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survival (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their clinical
International Nuclear Information System (INIS)
Neboori, Hanmanth J.R.; Haffty, Bruce G.; Wu Hao; Yang Qifeng; Aly, Amal; Goyal, Sharad; Schiff, Devora; Moran, Meena S.; Golhar, Ryan; Chen Chunxia; Moore, Dirk
2012-01-01
Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log–rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence–free survival (IBRFS), distant metastasis–free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survival (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their
[Punish or cherish: p53, metabolism and tumor suppression].
Albagli, Olivier
2015-10-01
The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.
R248Q mutation--Beyond p53-DNA binding.
Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L
2015-12-01
R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.
Mutations in p53, p53 protein overexpression and breast cancer survival
Czech Academy of Sciences Publication Activity Database
Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.
2009-01-01
Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009
The dynamics of p53 in single cells: physiologically based ODE and reaction–diffusion PDE models
International Nuclear Information System (INIS)
Eliaš, Ján; Clairambault, Jean; Dimitrio, Luna; Natalini, Roberto
2014-01-01
The intracellular signalling network of the p53 protein plays important roles in genome protection and the control of cell cycle phase transitions. Recently observed oscillatory behaviour in single cells under stress conditions has inspired several research groups to simulate and study the dynamics of the protein with the aim of gaining a proper understanding of the physiological meanings of the oscillations. We propose compartmental ODE and PDE models of p53 activation and regulation in single cells following DNA damage and we show that the p53 oscillations can be retrieved by plainly involving p53–Mdm2 and ATM–p53–Wip1 negative feedbacks, which are sufficient for oscillations experimentally, with no further need to introduce any delays into the protein responses and without considering additional positive feedback. (paper)
Mutant p53 protein localized in the cytoplasm inhibits autophagy.
Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido
2008-10-01
The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.
International Nuclear Information System (INIS)
Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.
2002-01-01
The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with
p53 and the Viral Connection: Back into the Future ‡
Directory of Open Access Journals (Sweden)
Ronit Aloni-Grinstein
2018-06-01
Full Text Available The discovery of the tumor suppressor p53, through its interactions with proteins of tumor-promoting viruses, paved the way to the understanding of p53 roles in tumor virology. Over the years, accumulating data suggest that WTp53 is involved in the viral life cycle of non-tumor-promoting viruses as well. These include the influenza virus, smallpox and vaccinia viruses, the Zika virus, West Nile virus, Japanese encephalitis virus, Human Immunodeficiency Virus Type 1, Human herpes simplex virus-1, and more. Viruses have learned to manipulate WTp53 through different strategies to improve their replication and spreading in a stage-specific, bidirectional way. While some viruses require active WTp53 for efficient viral replication, others require reduction/inhibition of WTp53 activity. A better understanding of WTp53 functionality in viral life may offer new future clinical approaches, based on WTp53 manipulation, for viral infections.
p53 as the focus of gene therapy: past, present and future.
Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani
2018-01-15
Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Chuang, Shu-Lin; Chen, Sam Li-Sheng; Yu, Cheng-Ping; Chang, King-Jen; Yen, Amy Ming-Fang; Chiu, Sherry Yueh-Hsia; Fann, Jean Ching-Yuan; Tabár, László; Stephen, Duffy W; Smith, Robert A; Chen, Hsiu-Hsi
2014-08-01
In the era of mass screening for breast cancer with mammography, it has been noted that conventional tumor attributes and mammographic appearance are insufficient to account for the better prognosis of screen-detected tumors. Such prognostication may require additional updated pathological information regarding tumor phenotype (e.g., basal status) and histological tumor distribution (focality). We investigated this hypothesis using a Bayesian approach to analyze breast cancer data from Dalarna County, Sweden. We used data for tumors diagnosed in the Swedish Two-County Trial and early service screening period, 1977-1995, and from the mature service screening period, 1996-1998. In the early period of mammographic screening (1977-1995), the crude hazard ratio (HR) of breast cancer death for screen-detected cases compared with symptomatic ones was 0.22 (95% CI: 0.17-0.29) compared with 0.53 (95% CI: 0.34-0.76) when adjusted for conventional tumor attributes only. Using the data from the mature service screening period, 1996-1998, the HR was 0.23 (95% CI: 0.08-0.44) unadjusted and 0.71 (95% CI: 0.26-1.47) after adjustment for tumor phenotype, mammographic appearance, histological tumor distribution, and conventional tumor attributes. The area under the ROC curve (AUC) for the prediction of breast cancer deaths using these variables without the detection mode was 0.82, only slightly less than that observed when additionally including the detection mode (AUC=0.83). Using Freedman statistics, conventional tumor attributes and mammographic appearances explained 58% (95% CI: 57.5-58.6%) of the difference of breast cancer survival between the screen-detected and the clinically detected breast cancers, whereas the corresponding figure was increased to 77% (95% CI: 75.6-77.6%) when adding the two information on tumor phenotype and histological tumor distribution. The results indicated that conventional tumor attributes and mammographic appearance are not sufficient to be
The genetic alteration of p53 in esophageal cancer
Energy Technology Data Exchange (ETDEWEB)
Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1996-01-01
Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).
Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.
Directory of Open Access Journals (Sweden)
Monica M Horvath
2007-07-01
Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This
Trisomy 12p and monosomy 4p: phenotype-genotype correlation.
Benussi, Daniela Gambel; Costa, Paola; Zollino, Marcella; Murdolo, Marina; Petix, Vincenzo; Carrozzi, Marco; Pecile, Vanna
2009-04-01
4p Monosomy and 12p trisomy have been discussed and redefined along with recently reviewed chromosomal syndromes. 12p Trisomy syndrome is characterized by normal or increased birth weight, developmental delay with early hypotonia, psychomotor delay, and typical facial appearance. Most likely, the observed phenotypic variability depends on the type and extent of the associated partial monosomy. Partial deletions of the short arm of one chromosome 4 cause the Wolf-Hirschhorn syndrome (WHS). Affected patients present Greek helmet face, growth and mental retardation, hypotonia, and seizures. The combination of these characteristics constitutes the phenotypic core of WHS. We present a clinical and molecular cytogenetic characterization of a 4-year old mentally retarded girl with macrosomy, facial dysmorphisms, and epilepsy, in whom an unbalanced t(4;12)(p16.3;p13.3) translocation was detected, giving rise to partial 4p monosomy and partial 12p trisomy. Because the patient shows most of the phenotypic characteristics of 12p trisomy, this case could contribute to a better definition of the duplicate critical region that determines the phenotype of the 12p trisomy syndrome.
International Nuclear Information System (INIS)
Carbone, Michele; Rudzinski, Jennifer; Bocchetta, Maurizio
2003-01-01
SV40 has been linked to some human malignancies, and the evidence that this virus plays a causative role in mesothelioma and brain tumors is mounting. The major SV40 oncoprotein is the Large tumor antigen (Tag). A key Tag transforming activity is connected to its capability to bind and inactivate cellular p53. In this study we developed an effective, high throughput, ELISA-based method to study Tag-p53 interaction in vitro. This assay allowed us to screen a chemical library and to identify a chemical inhibitor of the Tag binding to p53. We propose that our in vitro assay is a useful method to identify molecules that may be used as therapeutic agents for the treatment of SV40-related human cancers
Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.
2015-01-01
Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280
Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia
International Nuclear Information System (INIS)
Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina
2003-01-01
The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence
Directory of Open Access Journals (Sweden)
R Geetha Ramani
Full Text Available Prediction of secondary site mutations that reinstate mutated p53 to normalcy has been the focus of intense research in the recent past owing to the fact that p53 mutants have been implicated in more than half of all human cancers and restoration of p53 causes tumor regression. However laboratory investigations are more often laborious and resource intensive but computational techniques could well surmount these drawbacks. In view of this, we formulated a novel approach utilizing computational techniques to predict the transcriptional activity of multiple site (one-site to five-site p53 mutants. The optimal MCC obtained by the proposed approach on prediction of one-site, two-site, three-site, four-site and five-site mutants were 0.775,0.341,0.784,0.916 and 0.655 respectively, the highest reported thus far in literature. We have also demonstrated that 2D and 3D features generate higher prediction accuracy of p53 activity and our findings revealed the optimal results for prediction of p53 status, reported till date. We believe detection of the secondary site mutations that suppress tumor growth may facilitate better understanding of the relationship between p53 structure and function and further knowledge on the molecular mechanisms and biological activity of p53, a targeted source for cancer therapy. We expect that our prediction methods and reported results may provide useful insights on p53 functional mechanisms and generate more avenues for utilizing computational techniques in biological data analysis.
Heo, Jong-Ik; Cho, Jung Hee; Kim, Jae-Ryong
2013-08-01
Holliday junction recognition protein (HJURP), a centromere protein-A (CENP-A) histone chaperone, mediates centromere-specific assembly of CENP-A nucleosome, contributing to high-fidelity chromosome segregation during cell division. However, the role of HJURP in cellular senescence of human primary cells remains unclear. We found that the expression levels of HJURP decreased in human dermal fibroblasts and umbilical vein endothelial cells in replicative or premature senescence. Ectopic expression of HJURP in senescent cells partially overcame cell senescence. Conversely, downregulation of HJURP in young cells led to premature senescence. p53 knockdown, but not p16 knockdown, abolished senescence phenotypes caused by HJURP reduction. These data suggest that HJURP plays an important role in the regulation of cellular senescence through a p53-dependent pathway and might contribute to tissue or organismal aging and protection of cellular transformation.
Hormonal control of p53 and chemoprevention
International Nuclear Information System (INIS)
Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C
2002-01-01
Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer
Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo
2015-01-01
The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors.
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Chen, Luxi; Long, Chao; Youn, Jonghae; Lee, Jiyong
2018-06-11
We describe a "phenotypic cell-binding screen" by which therapeutic candidate targeting cancer cells of a particular phenotype can be isolated without knowledge of drug targets. Chemical library beads are incubated with cancer cells of the phenotype of interest in the presence of cancer cells lacking the phenotype of interest, and then the beads bound to only cancer cells of the phenotype of interest are selected as hits. We have applied this screening strategy in discovering a novel compound (LC129-8) targeting triple-negative breast cancer (TNBC). LC129-8 displayed highly specific binding to TNBC in cancer cell lines and patient-derived tumor tissues. LC129-8 exerted anti-TNBC activity by inducing apoptosis, inhibiting proliferation, reversing epithelial-mesenchymal transition, downregulating cancer stem cell activity and blocking in vivo tumor growth.
Screen printed thick film based pMUT arrays
DEFF Research Database (Denmark)
Hedegaard, Tobias; Pedersen, T; Thomsen, Erik Vilain
2008-01-01
This article reports on the fabrication and characterization of lambda-pitched piezoelectric micromachined ultrasound transducer (pMUT) arrays fabricated using a unique process combining conventional silicon technology and low cost screen printing of thick film PZT. The pMUTs are designed as 8...
The prognostic value of p53 positive in colorectal cancer: A retrospective cohort study.
Wang, Peng; Liang, Jianwei; Wang, Zheng; Hou, Huirong; Shi, Lei; Zhou, Zhixiang
2017-05-01
This retrospective cohort study aimed to discuss the prognostic value of p53 positive in colorectal cancer. A total of 124 consecutive patients diagnosed with colorectal cancer were evaluated at the National Cancer Center/Cancer Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College from 1 January 2009 to 31 December 2010. The expression of p53 in colorectal cancer was examined by immunohistochemistry. Based on the expression levels of p53, the 124 patients were divided into a p53 positive group and a p53 negative group. In this study, 72 patients were in the p53 positive group and 52 in the p53 negative group. The two groups were well balanced in gender, age, body mass index, American Society of Anesthesiologists scores, and number of lymph nodes harvested. p53 positive was associated with carcinoembryonic antigen ≥5 ng/mL ( p = 0.036), gross type ( p = 0.037), degree of tumor differentiation ( p = 0.026), pathological tumor stage ( p = 0.019), pathological node stage ( p = 0.004), pathological tumor-node-metastasis stage ( p = 0.017), nerve invasion ( p = 0.008), and vessel invasion ( p = 0.018). Tumor site, tumor size, and pathological pattern were not significantly different between these two groups. Disease-free survival and overall survival in the p53 positive group were significantly shorter than the p53 negative group ( p = 0.021 and 0.025, respectively). Colorectal cancer patients with p53 positive tended to be related to a higher degree of malignancy, advanced tumor-node-metastasis stage, and shorter disease-free survival and overall survival. p53 positive was independently an unfavorable prognostic marker for colorectal cancer patients.
Identification of a p53-response element in the promoter of the proline oxidase gene
International Nuclear Information System (INIS)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-01-01
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site
A dual role of p53 in the control of autophagy.
Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido
2008-08-01
Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.
Ouyang, Qiaohong; Duan, Zhongxiang; Jiao, Guangli; Lei, Jixiao
2015-07-01
A biomimic reconstituted high-density-lipoprotein-based drug and p53 gene co-delivery system (rHDL/CD-PEI/p53 complexes) was fabricated as a targeted co-delivery nanovector of drug and gene for potential bladder cancer therapy. Here, CD-PEI was utilized to effectively condense the p53 plasmid, to incorporate the plasmid into rHDL, and to act as an antitumor drug to suppress tumor angiogenesis. The rHDL/CD-PEI/p53 complexes exhibited desirable and homogenous particle size, neutral surface charge, and low cytotoxicity in vitro. The results of confocal laser scanning microscopy and flow cytometry confirmed that SR-BI-targeted function induced specific cytoplasmic delivery and high gene transfection efficiency in MBT-2 murine bladder cells. In addition, rHDL/CD-PEI/p53 complexes co-delivering CD and p53 gene achieved synergistic angiogenesis suppression by more effectively downregulating the expression of vascular endothelial growth factor (VEGF) messenger RNA (mRNA) and protein via different pathways in vitro. In vivo investigation on C3H/He mice bearing MBT-2 tumor xenografts revealed that rHDL/CD-PEI/p53 complexes possessed strong antitumor activity. These findings suggested that rHDL/CD-PEI/p53 complexes could be an ideal tumor-targeting system for simultaneous transfer of drug and gene, which might be a new promising strategy for effective bladder cancer therapy.
Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy
Directory of Open Access Journals (Sweden)
Christian Bressy
2017-06-01
Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.
The role of p53 and pRB in apoptosis and cancer
DEFF Research Database (Denmark)
Hickman, Emma S; Moroni, M Cristina; Helin, Kristian
2002-01-01
Loss of function of both the p53 pathway and the retinoblastoma protein (pRB) pathway plays a significant role in the development of most human cancers. Loss of pRB results in deregulated cell proliferation and apoptosis, whereas loss of p53 desensitizes cells to checkpoint signals, including...
Targeting p53 by small molecules in hematological malignancies
Saha, Manujendra N; Qiu, Lugui; Chang, Hong
2013-01-01
p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...
Directory of Open Access Journals (Sweden)
Martini Leonardo
2011-04-01
Full Text Available Abstract Background The human epidermal growth factor receptor 2 (HER2 and p53 pathways may be involved in chemotherapy sensitivity and/or resistance. We explore the value of HER2 and p53 status to foretell docetaxel sensitivity in advanced breast cancer. Methods HER2 and p53 expression was analysed in 36 (median age 55 yrs; range 37-87 metastatic breast cancer patients receiving docetaxel-based first-line chemotherapy. HER2 was determined by immunohistochemistry (IHC and fluorescence in situ hybridization (FISH, p53 was tested by IHC. We correlate the expression of study parameters with pathologic parameters, RECIST response and survival. The standard cut-off value of 2 was used to determine HER2 overexpression while p53 mean expression level was used to divide low/high expressors tumors. Results Median time to progression and overall survival were 9 (range 2 - 54 and 20 (range 3 - 101 months. Overall response rate was 41.6%. Nine cases showed HER2 overexpression. HER2 was more frequently overexpressed in less differentiated (p = 0.05 and higher stage (p = 0.003 disease. Mean FISH-HER2 values were significantly higher in responder than in non-responder pts (8.53 ± 10.21 vs 2.50 ± 4.12, p = 0.027. Moreover, HER2 overexpression correlates with treatment response at cross-tabulation analysis (p = 0.046. p53 expression was only associated with higher stage disease (p = 0.02 but lack of any significant association with HER status or docetaxel response. No significant relation with survival was observed for any parameter. Conclusion Our data seem to indicate that FISH-determined HER2 status but not p53 is associated with docetaxel sensitivity in metastatic breast cancer.
Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua
2017-06-01
The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.
Knockdown of p53 suppresses Nanog expression in embryonic stem cells
Energy Technology Data Exchange (ETDEWEB)
Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)
2014-01-10
Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.
Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku
2016-01-01
Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981
Structure and stability insights into tumour suppressor p53 evolutionary related proteins.
Directory of Open Access Journals (Sweden)
Bruno Pagano
Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.
Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.
Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I
2013-04-16
Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.
Regulation of Metabolic Activity by p53
Directory of Open Access Journals (Sweden)
Jessica Flöter
2017-05-01
Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.
Directory of Open Access Journals (Sweden)
Liang Y
2018-03-01
vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion: Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous targeting of mtp53 protein and tumor blood vessels in mtp53-expressing cancers. Keywords: breast cancer, blood vessel targeting agent, p53, APR-246, apoptosis, angiogenesis
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Post-translational regulation enables robust p53 regulation.
Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling
2013-08-30
The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.
Sada, Haruki; Shimomura, Manabu; Hinoi, Takao; Egi, Hiroyuki; Kawaguchi, Koji; Yano, Takuya; Niitsu, Hiroaki; Saitou, Yasufumi; Sawada, Hiroyuki; Miguchi, Masashi; Adachi, Tomohiro; Ohdan, Hideki
2015-03-26
The standard operation for colitic cancer in ulcerative colitis (UC) is restorative proctocolectomy; however, sporadic colorectal cancer (CRC) can coincidentally arise in patients with UC and the optimal procedure remains controversial. Therefore, it is crucial to preoperatively determine whether the CRC in UC is a sporadic or colitic cancer. We report a case of avoiding proctocolectomy for sporadic CRC in a patient with UC based on preoperative diagnosis involving p53 immunostaining. A 73-year-old man with CRC in UC had undergone sigmoid colectomy with lymphadenectomy because of the submucosal deep invasion pathologically after endoscopic mucosal resection. The cancer was diagnosed sporadic cancer preoperatively not only based on the endoscopic, clinical, and histological patterns but also that the colon epithelium was unlikely to develop dysplasia as the circumference and unaffected UC mucosa did not detect p53 protein overexpression. Recent reports have shown that the immunohistochemical detection of p53 protein overexpression can be useful for a differential diagnosis and as a predictor of dysplasia and colitic cancer. The analysis of p53 mutation status based on immunostaining of p53 protein expression in the unaffected UC mucosa can be useful for the decision regarding a surgical procedure for CRC in patients with UC.
International Nuclear Information System (INIS)
Kanady, Kirk E.; Mei Su; Proulx, Gary; Malkin, David M.; Pardo, Francisco S.
1995-01-01
of overall p53 expression, and acquire a tumorigenic phenotype in immune-deficient mice. Mechanisms common to both glial tumor progression and the intrinsic cellular radiation sensitivity of glial cells, and therapeutic strategies modulating p53 expression, are currently under investigation
Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function
Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.
2011-01-01
The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107
An adaptive molecular timer in p53-meidated cell fate decision
Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei
The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).
The p53 gene with emphasis on its paralogues in mosquitoes
Directory of Open Access Journals (Sweden)
Tien-Huang Chen
2017-12-01
Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival
Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.
Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu
2017-08-01
p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Mitofusin-2 is a novel direct target of p53
International Nuclear Information System (INIS)
Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen
2010-01-01
Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.
International Nuclear Information System (INIS)
Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.
1995-01-01
Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or
A deep learning and novelty detection framework for rapid phenotyping in high-content screening
Sommer, Christoph; Hoefler, Rudolf; Samwer, Matthias; Gerlich, Daniel W.
2017-01-01
Supervised machine learning is a powerful and widely used method for analyzing high-content screening data. Despite its accuracy, efficiency, and versatility, supervised machine learning has drawbacks, most notably its dependence on a priori knowledge of expected phenotypes and time-consuming classifier training. We provide a solution to these limitations with CellCognition Explorer, a generic novelty detection and deep learning framework. Application to several large-scale screening data sets on nuclear and mitotic cell morphologies demonstrates that CellCognition Explorer enables discovery of rare phenotypes without user training, which has broad implications for improved assay development in high-content screening. PMID:28954863
40 Years of Research Put p53 in Translation
Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques
2018-01-01
Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.
ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway
International Nuclear Information System (INIS)
Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan
2007-01-01
We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation
Pala, Emel Ebru; Bayol, Umit; Keskin, Elif Usturali; Ozguzer, Alp; Kucuk, Ulku; Ozer, Ozge; Koc, Altug
2015-09-01
Triple negative breast cancer (TNBC), an agressive subtype accounts nearly 15 % of all breast carcinomas. Conventional chemotherapy is the only treatment modality thus new, effective targeted therapy methods have been investigated. Epidermal growth factor receptor (EGFR) inhibitors give hope according to the recent studies results. Also therapeutic agents have been tried against aberrant p53 signal activity as TNBC show high p53 mutation rates. Our aim was to detect the incidence of mutations/amplifications identified in TNBC in our population. Here we used sequence analysis to detect HER2 (exon 18-23), p53 (exon 5-8) mutations; fluorescence in situ hybridization (FISH) method to analyse EGFR/chromosome 7 centromere gene status in 82 immunohistochemically TNBC. Basaloid phenotype was identified in 49 (59.8 %) patients. EGFR amplification was noted in 5 cases (6.1 %). All EGFR amplified cases showed EGFR overexpression by immunohistochemistry (IHC). p53 mutations were identified in 33 (40.2 %) cases. Almost 60 % of the basal like breast cancer cases showed p53 mutation. Only one case showed HER2 mutation (exon 20:g.36830_3). Our results showed that gene amplification is not the unique mechanism in EGFR overexpression. IHC might be used in the decision of anti-EGFR therapy in routine practice. p53 mutation rate was lower than the rates reported in the literature probably due to ethnic differences and low sensitivity of sanger sequences in general mutation screening. We also established the rarity of HER2 mutation in TNBC. In conclusion EGFR and p53 are the major targets in TNBC also for our population.
International Nuclear Information System (INIS)
Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang
2008-01-01
Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)
The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status
International Nuclear Information System (INIS)
Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer
2011-01-01
The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21− combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21− carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status
Directory of Open Access Journals (Sweden)
Mohsen Gohari
2016-01-01
Full Text Available The TP53 is important in functions of cell cycle control, apoptosis, and maintenance of DNA integrity. Studies on the association between p53 codon 72 polymorphism and primary open-angle glaucoma (POAG risk have yielded conflicting results. Published literature from PubMed and Web of Science databases was retrieved. All studies evaluating the association between p53 codon 72 polymorphisms and POAG were included. Pooled odds ratio (OR and 95% confidence interval (CI were calculated. Eleven separate studies including 2541 cases and 1844 controls were pooled in the meta-analysis. We did not detect a significant association between POAG risk and p53 codon 72 polymorphism overall population except allele genetic model (C vs. G: OR = 0.961, 95% CI = 0.961–0.820, P = 0.622. In the stratified analysis for Asians and Caucasians, there was an association between p53 codon 72 polymorphism and POAG. In the dominant model in the overall population and by ethnicity subgroups, the highest elevated POAG risk was presented. In summary, these results indicate that p53 codon 72 polymorphism is likely an important genetic factor contributing to susceptibility of POAG. However, more case–controls studies based on larger sample size and stratified by ethnicity are suggested to further clarify the relationship between p53 codon 72 polymorphism and POAG.
MDM2 SNP309 promoter polymorphism and p53 mutations in urinary bladder carcinoma stage T1
Directory of Open Access Journals (Sweden)
Olsson Hans
2013-01-01
Full Text Available Abstract Background Urinary bladder carcinoma stage T1 is an unpredictable disease that in some cases has a good prognosis with only local or no recurrence, but in others can appear as a more aggressive tumor with progression to more advanced stages. The aim here was to investigate stage T1 tumors regarding MDM2 promoter SNP309 polymorphism, mutations in the p53 gene, and expression of p53 and p16 measured by immunohistochemistry, and subsequently relate these changes to tumor recurrence and progression. We examined a cohort of patients with primary stage T1 urothelial carcinoma of the bladder and their tumors. Methods After re-evaluation of the original slides and exclusions, the study population comprised 141 patients, all with primary stage T1 urothelial carcinoma of the bladder. The hospital records were screened for clinical parameters and information concerning presence of histologically proven recurrence and progression. The paraffin-embedded tumor material was evaluated by immunohistochemistry. Any mutations found in the p53 gene were studied by single-strand conformation analysis and Sanger sequencing. The MDM2 SNP309 polymorphism was investigated by pyrosequencing. Multivariate analyses concerning association with prognosis were performed, and Kaplan-Meier analysis was conducted for a combination of changes and time to progression. Results Of the 141 patients, 82 had at least one MDM2 SNP309 G allele, and 53 had a mutation in the p53 gene, but neither of those anomalies was associated with a worse prognosis. A mutation in the p53 gene was associated with immunohistochemically visualized p53 protein expression at a cut-off value of 50%. In the group with p53 mutation Kaplan-Meier analysis showed higher rate of progression and shorter time to progression in patients with immunohistochemically abnormal p16 expression compared to them with normal p16 expression (p = 0.038. Conclusions MDM2 SNP309 promoter polymorphism and mutations in
Influence of X-ray on the P53 gene in human peripheral blood lymphocytes
International Nuclear Information System (INIS)
Jin Wenwei; Cai Ting
2002-01-01
Objective: To evaluate the reliability and safety of varying X-ray dosage. Methods: peripheral lymphocytes of five healthy volunteers were processed by varying X-rays, then detect the P53 gene mutation in 5-9 exons by PCR-SSCP silver staining, investigate the 249 th codon's mutation by PCR-RFLP, through immunohistochemistry staining monitor the abnormal expression of P53 and screen the apoptosis employing the Bio-dUTP terminal labelling technology included by DNA terminal transferase. Results: The frequency of apoptosis represents transparent dose-dependent manner with X-ray. When exposed to X-ray > 50 cGy after 48 h, the apoptosis group has evident difference compared with the control (P 0.05). After treating peripheral lymphocytes with 5-200 cGy X-ray and culturing 96 h, utilizing PCR-SSCP to determine the mutation in 5-9 exons, there was no single strand DNA abnormal migration. PCR-RFLP result indicates no mutation in the hotspot site-249 codon, and there was no obviously abnormal expression of P53 in immunohistochemistry staining. Conclusions: The apoptosis of peripheral lymphocytes is sensitive to the X-ray, and this can be a guideline or model reflecting the body state when exposing to the radiation
Molecular mechanism of X-ray-induced p53-dependent apoptosis
Energy Technology Data Exchange (ETDEWEB)
Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)
1999-03-01
Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.
Effect of p53 genotype on gene expression profiles in murine liver
International Nuclear Information System (INIS)
Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.
2008-01-01
The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs
p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.
Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R
2007-10-01
Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).
Stimulation of autophagy by the p53 target gene Sestrin2.
Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido
2009-05-15
The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.
Thermophotovoltaic cells based on In0.53Ga0.47As/InP heterostructures
International Nuclear Information System (INIS)
Karlina, L. B.; Vlasov, A. S.; Kulagina, M. M.; Timoshina, N. Kh.
2006-01-01
Reflection of infrared radiation from n-InP substrates with a rear MgF 2 /Au mirror is investigated in the wavelength range 1000-2200 nm. It is found that the reflectance weakly depends on substrate thickness and free-carrier concentration in the (0.1-6) x 10 18 cm -3 range. Thermophotovoltaic cells based on the InP/In 0.53 Ga 0.47 As lattice-matched heterostructure of p-n and n-p are fabricated by liquid-phase epitaxy and Zn and P diffusion from a gas phase. The characteristics of p-n and n-p thermophotovoltaic cells with an identical configuration of the contacts of 1 cm 2 area are determined. These characteristics are the open-circuit voltage U oc = 0.465 V, the filling factor FF = 64% at the current density of 1 A/cm 2 , and the reflectance R = 76-80% for wavelengths longer than 1.86 μm
Mottolese, M; Benevolo, M; Del Monte, G; Buglioni, S; Papaldo, P; Nisticò, C; Di Filippo, F; Vasselli, S; Vici, P; Botti, C
2000-12-01
Adjuvant therapy has become an integral component of the managment of primary high-risk breast cancer patients. However, a considerable fraction of women receive no benefit from this treatment. This study investigates whether a number of biopathological factors can influence the outcome of patients submitted to adjuvant chemotherapy involving the use of high-dose epirubicin and cyclophosphamide. One hundred and fifty-seven primary breast cancer patients, considered at high risk according to the St. Gallen Meeting Consensus Conference, were evaluated immunohistochemically for estrogen, progesterone receptors, p53, bcl-2, HER-2/neu, and Ki-67, of which the results were correlated with patient outcome. Results obtained demonstrated that p53 is a significant predictor of disease-free survival (DFS P < 0.0001) and overall survival (OS P = 0.0002) both in ductal and lobular carcinomas, whereas bcl-2 expression seems to be of prognostic value only in lobular carcinomas (DFS P = 0.01; OS P = 0.02). This data indicates that in high-risk breast cancer patients the immunohistochemical evaluation of p53 and bcl-2 may be of clinical value in distinguishing different responses to adjuvant anthracycline-based chemotherapy.
The antagonism between MCT-1 and p53 affects the tumorigenic outcomes
Directory of Open Access Journals (Sweden)
Lin Tai-Du
2010-12-01
Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.
International Nuclear Information System (INIS)
Deocaris, Custer C.
2004-01-01
Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death
Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression
Directory of Open Access Journals (Sweden)
Shang-Jui Wang
2016-10-01
Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.
p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma
Directory of Open Access Journals (Sweden)
Sally Hopkins-Donaldson
2006-07-01
Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
International Nuclear Information System (INIS)
Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina
2006-01-01
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses
Gene expression and apoptosis induction in p53-heterozygous irradiated mice
Energy Technology Data Exchange (ETDEWEB)
Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it
2006-02-22
The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.
International Nuclear Information System (INIS)
Djuzenova, Cholpon S.; Fiedler, Vanessa; Memmel, Simon; Katzer, Astrid; Hartmann, Susanne; Krohne, Georg; Zimmermann, Heiko; Scholz, Claus-Jürgen; Polat, Bülent; Flentje, Michael
2015-01-01
Glioblastoma cells exhibit highly invasive behavior whose mechanisms are not yet fully understood. The present study explores the relationship between the invasion capacity of 5 glioblastoma cell lines differing in p53 and PTEN status, expression of mTOR and several other marker proteins involved in cell invasion, actin cytoskeleton organization and cell morphology. We found that two glioblastoma lines mutated in both p53 and PTEN genes (U373-MG and SNB19) exhibited the highest invasion rates through the Matrigel or collagen matrix. In DK-MG (p53wt/PTENwt) and GaMG (p53mut/PTENwt) cells, F-actin mainly occurred in the numerous stress fibers spanning the cytoplasm, whereas U87-MG (p53wt/PTENmut), U373-MG and SNB19 (both p53mut/PTENmut) cells preferentially expressed F-actin in filopodia and lamellipodia. Scanning electron microscopy confirmed the abundant filopodia and lamellipodia in the PTEN mutated cell lines. Interestingly, the gene profiling analysis revealed two clusters of cell lines, corresponding to the most (U373-MG and SNB19, i.e. p53 and PTEN mutated cells) and less invasive phenotypes. The results of this study might shed new light on the mechanisms of glioblastoma invasion. - Highlights: • We examine 5 glioblastoma lines on the invasion capacity and actin cytoskeleton. • Glioblastoma cell lines mutated in both p53 and PTEN were the most invasive. • Less invasive cells showed much less lamellipodia, but more actin stress fibers. • A mechanism for the differences in tumor cell invasion is proposed
Energy Technology Data Exchange (ETDEWEB)
Djuzenova, Cholpon S., E-mail: djuzenova_t@ukw.de [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); Fiedler, Vanessa [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); Memmel, Simon [Lehrstuhl für Biotechnologie und Biophysik, Universität Würzburg, Biozentrum Am Hubland, 97070 Würzburg (Germany); Katzer, Astrid; Hartmann, Susanne [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); Krohne, Georg [Elektronenmikroskopie, Biozentrum, Universität Würzburg, Am Hubland, 97070 Würzburg (Germany); Zimmermann, Heiko [Hauptabteilung Biophysik and Kryotechnologie, Fraunhofer-Institut für Biomedizinische Technik, Lehrstuhl für Molekulare und Zelluläre Biotechnologie/Nanotechnologie, Universität des Saarlandes, Ensheimer Strasse 48, 66386 St. Ingbert (Germany); Scholz, Claus-Jürgen [Interdisciplinary Center for Clinical Research, University Hospital, Versbacher Strasse 7, 97078 Würzburg (Germany); Polat, Bülent; Flentje, Michael [Department of Radiation Oncology, University Hospital, Josef-Schneider-Strasse 11, D-97080 Würzburg (Germany); and others
2015-01-15
Glioblastoma cells exhibit highly invasive behavior whose mechanisms are not yet fully understood. The present study explores the relationship between the invasion capacity of 5 glioblastoma cell lines differing in p53 and PTEN status, expression of mTOR and several other marker proteins involved in cell invasion, actin cytoskeleton organization and cell morphology. We found that two glioblastoma lines mutated in both p53 and PTEN genes (U373-MG and SNB19) exhibited the highest invasion rates through the Matrigel or collagen matrix. In DK-MG (p53wt/PTENwt) and GaMG (p53mut/PTENwt) cells, F-actin mainly occurred in the numerous stress fibers spanning the cytoplasm, whereas U87-MG (p53wt/PTENmut), U373-MG and SNB19 (both p53mut/PTENmut) cells preferentially expressed F-actin in filopodia and lamellipodia. Scanning electron microscopy confirmed the abundant filopodia and lamellipodia in the PTEN mutated cell lines. Interestingly, the gene profiling analysis revealed two clusters of cell lines, corresponding to the most (U373-MG and SNB19, i.e. p53 and PTEN mutated cells) and less invasive phenotypes. The results of this study might shed new light on the mechanisms of glioblastoma invasion. - Highlights: • We examine 5 glioblastoma lines on the invasion capacity and actin cytoskeleton. • Glioblastoma cell lines mutated in both p53 and PTEN were the most invasive. • Less invasive cells showed much less lamellipodia, but more actin stress fibers. • A mechanism for the differences in tumor cell invasion is proposed.
Family matters: sibling rivalry and bonding between p53 and p63 in cancer.
Romano, Rose-Anne; Sinha, Satrajit
2014-04-01
The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
p53 tumor suppressor gene: significance in neoplasia - a review
International Nuclear Information System (INIS)
Alam, J.M.
2000-01-01
p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)
Directory of Open Access Journals (Sweden)
Fuqiang Xing
Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.
POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.
Energy Technology Data Exchange (ETDEWEB)
ANDERSON,C.W.APPELLA,E.
2003-10-23
The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.
The role of p53 molecule in radiation and hyperthermic therapies
International Nuclear Information System (INIS)
Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo
2003-01-01
In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4
Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma
International Nuclear Information System (INIS)
Frey, L. M.; Houben, R.; Brocker, E. B.
2011-01-01
Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.
P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability
International Nuclear Information System (INIS)
Mukh-Syaifudin
2006-01-01
Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and
A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif
Directory of Open Access Journals (Sweden)
Asita Elengoe
2015-01-01
Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455
Directory of Open Access Journals (Sweden)
Anthony Arnoldo
2008-02-01
Full Text Available Pseudomonas aeruginosa is an opportunistic human pathogen that is a key factor in the mortality of cystic fibrosis patients, and infection represents an increased threat for human health worldwide. Because resistance of Pseudomonas aeruginosa to antibiotics is increasing, new inhibitors of pharmacologically validated targets of this bacterium are needed. Here we demonstrate that a cell-based yeast phenotypic assay, combined with a large-scale inhibitor screen, identified small molecule inhibitors that can suppress the toxicity caused by heterologous expression of selected Pseudomonas aeruginosa ORFs. We identified the first small molecule inhibitor of Exoenzyme S (ExoS, a toxin involved in Type III secretion. We show that this inhibitor, exosin, modulates ExoS ADP-ribosyltransferase activity in vitro, suggesting the inhibition is direct. Moreover, exosin and two of its analogues display a significant protective effect against Pseudomonas infection in vivo. Furthermore, because the assay was performed in yeast, we were able to demonstrate that several yeast homologues of the known human ExoS targets are likely ADP-ribosylated by the toxin. For example, using an in vitro enzymatic assay, we demonstrate that yeast Ras2p is directly modified by ExoS. Lastly, by surveying a collection of yeast deletion mutants, we identified Bmh1p, a yeast homologue of the human FAS, as an ExoS cofactor, revealing that portions of the bacterial toxin mode of action are conserved from yeast to human. Taken together, our integrated cell-based, chemical-genetic approach demonstrates that such screens can augment traditional drug screening approaches and facilitate the discovery of new compounds against a broad range of human pathogens.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-07-15
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137
Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4
Directory of Open Access Journals (Sweden)
Ravshan Burikhanov
2014-01-01
Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.
Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H
1992-01-01
Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...
Apoptosis in spermatogonia irradiated P53 null mice
International Nuclear Information System (INIS)
Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.
2007-01-01
Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after
iBeetle-Base: a database for RNAi phenotypes in the red flour beetle Tribolium castaneum.
Dönitz, Jürgen; Schmitt-Engel, Christian; Grossmann, Daniela; Gerischer, Lizzy; Tech, Maike; Schoppmeier, Michael; Klingler, Martin; Bucher, Gregor
2015-01-01
The iBeetle-Base (http://ibeetle-base.uni-goettingen.de) makes available annotations of RNAi phenotypes, which were gathered in a large scale RNAi screen in the red flour beetle Tribolium castaneum (iBeetle screen). In addition, it provides access to sequence information and links for all Tribolium castaneum genes. The iBeetle-Base contains the annotations of phenotypes of several thousands of genes knocked down during embryonic and metamorphic epidermis and muscle development in addition to phenotypes linked to oogenesis and stink gland biology. The phenotypes are described according to the EQM (entity, quality, modifier) system using controlled vocabularies and the Tribolium morphological ontology (TrOn). Furthermore, images linked to the respective annotations are provided. The data are searchable either for specific phenotypes using a complex 'search for morphological defects' or a 'quick search' for gene names and IDs. The red flour beetle Tribolium castaneum has become an important model system for insect functional genetics and is a representative of the most species rich taxon, the Coleoptera, which comprise several devastating pests. It is used for studying insect typical development, the evolution of development and for research on metabolism and pest control. Besides Drosophila, Tribolium is the first insect model organism where large scale unbiased screens have been performed. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Loss of P53 Function in Colon Cancer Cells Results in Increased Phosphocholine and Total Choline
Directory of Open Access Journals (Sweden)
Noriko Mori
2004-10-01
Full Text Available Mutations in the p53 gene are the most frequently observed genetic lesions in human cancers. Human cancers that contain a p53 mutation are more aggressive, more apt to metastasize, and more often fatal. p53 controls numerous downstream targets that can influence various outcomes such as apoptosis, growth arrest, and DNA repair. Based on previous observations using 1H magnetic resonance spectroscopy (MRS, we have identified choline phospholipid metabolite intensities typical of increased malignancy. Here we have used 1H MRS to characterize the choline phospholipid metabolite levels of p53+/+ and p53−/– cells, and demonstrated that loss of p53 function results in increased phosphocholine and total choline. These data suggest that the increased malignancy of cancer cells resulting from loss of p53 may be mediated, in part, through the choline phospholipid pathway.
Pax3 stimulates p53 ubiquitination and degradation independent of transcription.
Directory of Open Access Journals (Sweden)
Xiao Dan Wang
Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.
cDNA sequencing improves the detection of P53 missense mutations in colorectal cancer
International Nuclear Information System (INIS)
Szybka, Malgorzata; Kordek, Radzislaw; Zakrzewska, Magdalena; Rieske, Piotr; Pasz-Walczak, Grazyna; Kulczycka-Wojdala, Dominika; Zawlik, Izabela; Stawski, Robert; Jesionek-Kupnicka, Dorota; Liberski, Pawel P
2009-01-01
Recently published data showed discrepancies beteween P53 cDNA and DNA sequencing in glioblastomas. We hypothesised that similar discrepancies may be observed in other human cancers. To this end, we analyzed 23 colorectal cancers for P53 mutations and gene expression using both DNA and cDNA sequencing, real-time PCR and immunohistochemistry. We found P53 gene mutations in 16 cases (15 missense and 1 nonsense). Two of the 15 cases with missense mutations showed alterations based only on cDNA, and not DNA sequencing. Moreover, in 6 of the 15 cases with a cDNA mutation those mutations were difficult to detect in the DNA sequencing, so the results of DNA analysis alone could be misinterpreted if the cDNA sequencing results had not also been available. In all those 15 cases, we observed a higher ratio of the mutated to the wild type template by cDNA analysis, but not by the DNA analysis. Interestingly, a similar overexpression of P53 mRNA was present in samples with and without P53 mutations. In terms of colorectal cancer, those discrepancies might be explained under three conditions: 1, overexpression of mutated P53 mRNA in cancer cells as compared with normal cells; 2, a higher content of cells without P53 mutation (normal cells and cells showing K-RAS and/or APC but not P53 mutation) in samples presenting P53 mutation; 3, heterozygous or hemizygous mutations of P53 gene. Additionally, for heterozygous mutations unknown mechanism(s) causing selective overproduction of mutated allele should also be considered. Our data offer new clues for studying discrepancy in P53 cDNA and DNA sequencing analysis
DEFF Research Database (Denmark)
Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin
2016-01-01
with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...
Rapid detection of single nucleotide mutation in p53 gene based on ...
Indian Academy of Sciences (India)
mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.
Kamal, Muna; Tamana, Sukhpreet K; Smithson, Lisa; Ding, Linda; Lau, Amanda; Chikuma, Joyce; Mariasine, Jennifer; Lefebvre, Diana L; Subbarao, Padmaja; Becker, Allan B; Turvey, Stuart E; Sears, Malcolm R; Pei, Jacqueline; Mandhane, Piush J
2018-05-03
Childhood sleep-disordered breathing (SDB) symptoms may comprise multiple phenotypes depending on craniofacial anatomy, tonsil and adenoid growth, body habitus, and rhinitis symptoms. The primary objective of this study is to identify and characterize the different SDB phenotypes to two years of age. Data from 770 infants in the Edmonton sub-cohort of the Canadian Healthy Infant Longitudinal Study (CHILD) were analyzed to identify SDB phenotypes based on age of onset and duration of symptoms. Parents completed the 22-item sleep-related breathing disorder (SRBD) scale. Children with a SRBD ratio greater than 0.33 were considered positive for SDB at each quarterly assessment between three months and two years. The STATA Proc trajectory extension identified SDB phenotypes based on their age of onset and duration of symptoms and attributed the percentage chance of a participant being assigned to each phenotype. Multivariate linear regression identified factors associated with increased risk of being assigned to each SDB phenotype. Trajectory analysis identified four phenotypes: no SDB (65.7%), early-onset SDB (15.7%) with peak symptoms at nine months, late-onset SDB (14.2%) with peak symptoms at 18 months, and persistent SDB (5.3%) with symptoms from 3 to 24 months. Rhinitis was associated with all three SDB symptom trajectories (p sleep apnea syndrome (OSAS) was associated with persistent (p = 0.01) and late SDB (p < 0.001). Atopy (positive skin prick test at one year) was associated with persistent SDB (p = 0.04). Infants born prior to 36.5 weeks gestational age were more likely to present with late SDB (p = 0.03). Childhood SDB symptoms, rather than being a homogenous disorder, may comprise multiple overlapping phenotypes each with unique risk factors. Copyright © 2018 Elsevier B.V. All rights reserved.
p53-dependent non-coding RNA networks in chronic lymphocytic leukemia
Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.
2015-01-01
Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We
Thymocyte apoptosis induced by p53-dependent and independent pathways
International Nuclear Information System (INIS)
Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.
1993-01-01
The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)
Reversible p53 inhibition prevents cisplatin ototoxicity without blocking chemotherapeutic efficacy.
Benkafadar, Nesrine; Menardo, Julien; Bourien, Jérôme; Nouvian, Régis; François, Florence; Decaudin, Didier; Maiorano, Domenico; Puel, Jean-Luc; Wang, Jing
2017-01-01
Cisplatin is a widely used chemotherapy drug, despite its significant ototoxic side effects. To date, the mechanism of cisplatin-induced ototoxicity remains unclear, and hearing preservation during cisplatin-based chemotherapy in patients is lacking. We found activation of the ATM-Chk2-p53 pathway to be a major determinant of cisplatin ototoxicity. However, prevention of cisplatin-induced ototoxicity is hampered by opposite effects of ATM activation upon sensory hair cells: promoting both outer hair cell death and inner hair cell survival. Encouragingly, however, genetic or pharmacological ablation of p53 substantially attenuated cochlear cell apoptosis, thus preserving hearing. Importantly, systemic administration of a p53 inhibitor in mice bearing patient-derived triple-negative breast cancer protected auditory function, without compromising the anti-tumor efficacy of cisplatin. Altogether, these findings highlight a novel and effective strategy for hearing protection in cisplatin-based chemotherapy. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
Phenotypic Screening Approaches to Develop Aurora Kinase Inhibitors: Drug Discovery Perspectives.
Marugán, Carlos; Torres, Raquel; Lallena, María José
2015-01-01
Targeting mitotic regulators as a strategy to fight cancer implies the development of drugs against key proteins, such as Aurora-A and -B. Current drugs, which target mitosis through a general mechanism of action (stabilization/destabilization of microtubules), have several side effects (neutropenia, alopecia, and emesis). Pharmaceutical companies aim at avoiding these unwanted effects by generating improved and selective drugs that increase the quality of life of the patients. However, the development of these drugs is an ambitious task that involves testing thousands of compounds through biochemical and cell-based assays. In addition, molecules usually target complex biological processes, involving several proteins and different molecular pathways, further emphasizing the need for high-throughput screening techniques and multiplexing technologies in order to identify drugs with the desired phenotype. We will briefly describe two multiplexing technologies [high-content imaging (HCI) and flow cytometry] and two key processes for drug discovery research (assay development and validation) following our own published industry quality standards. We will further focus on HCI as a useful tool for phenotypic screening and will provide a concrete example of HCI assay to detect Aurora-A or -B selective inhibitors discriminating the off-target effects related to the inhibition of other cell cycle or non-cell cycle key regulators. Finally, we will describe other assays that can help to characterize the in vitro pharmacology of the inhibitors.
Web-based phenotyping for Tourette Syndrome: Reliability of common co-morbid diagnoses.
Darrow, Sabrina M; Illmann, Cornelia; Gauvin, Caitlin; Osiecki, Lisa; Egan, Crystelle A; Greenberg, Erica; Eckfield, Monika; Hirschtritt, Matthew E; Pauls, David L; Batterson, James R; Berlin, Cheston M; Malaty, Irene A; Woods, Douglas W; Scharf, Jeremiah M; Mathews, Carol A
2015-08-30
Collecting phenotypic data necessary for genetic analyses of neuropsychiatric disorders is time consuming and costly. Development of web-based phenotype assessments would greatly improve the efficiency and cost-effectiveness of genetic research. However, evaluating the reliability of this approach compared to standard, in-depth clinical interviews is essential. The current study replicates and extends a preliminary report on the utility of a web-based screen for Tourette Syndrome (TS) and common comorbid diagnoses (obsessive compulsive disorder (OCD) and attention deficit/hyperactivity disorder (ADHD)). A subset of individuals who completed a web-based phenotyping assessment for a TS genetic study was invited to participate in semi-structured diagnostic clinical interviews. The data from these interviews were used to determine participants' diagnostic status for TS, OCD, and ADHD using best estimate procedures, which then served as the gold standard to compare diagnoses assigned using web-based screen data. The results show high rates of agreement for TS. Kappas for OCD and ADHD diagnoses were also high and together demonstrate the utility of this self-report data in comparison previous diagnoses from clinicians and dimensional assessment methods. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.
Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino
2015-10-01
The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.
Distinct p53 genomic binding patterns in normal and cancer-derived human cells
Energy Technology Data Exchange (ETDEWEB)
Botcheva K.; McCorkle S. R.; McCombie W. R.; Dunn J. J.; Anderson C. W.
2011-12-15
We report here genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands, in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIPseq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K
2017-01-01
The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Directory of Open Access Journals (Sweden)
Anup K Kundu
Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Prodosmo, Andrea; Buffone, Amelia; Mattioni, Manlio; Barnabei, Agnese; Persichetti, Agnese; De Leo, Aurora; Appetecchia, Marialuisa; Nicolussi, Arianna; Coppa, Anna; Sciacchitano, Salvatore; Giordano, Carolina; Pinnarò, Paola; Sanguineti, Giuseppe; Strigari, Lidia; Alessandrini, Gabriele; Facciolo, Francesco; Cosimelli, Maurizio; Grazi, Gian Luca; Corrado, Giacomo; Vizza, Enrico; Giannini, Giuseppe; Soddu, Silvia
2016-09-06
Variant ATM heterozygotes have an increased risk of developing cancer, cardiovascular diseases, and diabetes. Costs and time of sequencing and ATM variant complexity make large-scale, general population screenings not cost-effective yet. Recently, we developed a straightforward, rapid, and inexpensive test based on p53 mitotic centrosomal localization (p53-MCL) in peripheral blood mononuclear cells (PBMCs) that diagnoses mutant ATM zygosity and recognizes tumor-associated ATM polymorphisms. Fresh PBMCs from 496 cancer patients were analyzed by p53-MCL: 90 cases with familial BRCA1/2-positive and -negative breast and/or ovarian cancer, 337 with sporadic cancers (ovarian, lung, colon, and post-menopausal breast cancers), and 69 with breast/thyroid cancer. Variants were confirmed by ATM sequencing. A total of seven individuals with ATM variants were identified, 5/65 (7.7 %) in breast cancer cases of familial breast and/or ovarian cancer and 2/69 (2.9 %) in breast/thyroid cancer. No variant ATM carriers were found among the other cancer cases. Excluding a single case in which both BRCA1 and ATM were mutated, no p53-MCL alterations were observed in BRCA1/2-positive cases. These data validate p53-MCL as reliable and specific test for germline ATM variants, confirm ATM as breast cancer susceptibility gene, and highlight a possible association with breast/thyroid cancers.
HEXIM1, a New Player in the p53 Pathway
Energy Technology Data Exchange (ETDEWEB)
Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)
2013-07-04
Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.
Regulation of Mdmx and its role in the p53 pathway
Meulmeester, Erik
2006-01-01
The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to
Directory of Open Access Journals (Sweden)
Katrin Friedrich
1997-01-01
Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.
Mutual interactions between P53 and growth factors in cancer
Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE
1998-01-01
The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic
International Nuclear Information System (INIS)
Wei Tang; Powell, Simon N.
1996-01-01
Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA
Restriction of human herpesvirus 6B replication by p53
DEFF Research Database (Denmark)
Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina
2008-01-01
Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...
Directory of Open Access Journals (Sweden)
Sabine M Hölter
Full Text Available Huntington's disease (HD is an autosomal dominant neurodegenerative disorder caused by the expansion of a CAG trinucleotide repeat in the HTT gene encoding huntingtin. The disease has an insidious course, typically progressing over 10-15 years until death. Currently there is no effective disease-modifying therapy. To better understand the HD pathogenic process we have developed genetic HTT CAG knock-in mouse models that accurately recapitulate the HD mutation in man. Here, we describe results of a broad, standardized phenotypic screen in 10-46 week old heterozygous HdhQ111 knock-in mice, probing a wide range of physiological systems. The results of this screen revealed a number of behavioral abnormalities in HdhQ111/+ mice that include hypoactivity, decreased anxiety, motor learning and coordination deficits, and impaired olfactory discrimination. The screen also provided evidence supporting subtle cardiovascular, lung, and plasma metabolite alterations. Importantly, our results reveal that a single mutant HTT allele in the mouse is sufficient to elicit multiple phenotypic abnormalities, consistent with a dominant disease process in patients. These data provide a starting point for further investigation of several organ systems in HD, for the dissection of underlying pathogenic mechanisms and for the identification of reliable phenotypic endpoints for therapeutic testing.
Tachibana, Masatsugu; Shinagawa, Yasuhiro; Kawamata, Hitoshi; Omotehara, Fumie; Horiuchi, Hideki; Ohkura, Yasuo; Kubota, Keiichi; Imai, Yutaka; Fujibayashi, Takashi; Fujimori, Takahiro
2003-01-01
We present a new approach towards the detection of the mRNAs in formalin-fixed, paraffin-embedded samples using a reverse transcriptase (RT)-polymerase chain reaction (PCR). The total RNAs were extracted from 10-micron-thick sections and were reverse-transcribed, then the RT-products were subjected to PCR amplification of GAPDH mRNA for screening the mRNA degradation. Next, nested PCR was performed for examining the expression of p53-related genes, p21WAF1, MDM2, p33ING1 and p14ARF. GAPDH mRNA expression was detectable in 12 out of 21 oral squamous cell carcinoma (SCC) samples. p21WAF1 mRNA expression was detectable in 5 out of 12 SCC samples, MDM2 mRNA expression was detectable in 5 our of 12 SCC samples and p33ING1 mRNA expression was detectable in 6 out of 12 SCC samples. However, the expression of p14ARF mRNA was not detectable in any of the samples. Seven out of 12 oral SCC samples showed abnormal nuclear accumulation of p53 protein by immunohistochemical staining, whereas 5 out of 12 oral SCCs showed negative staining for p53 protein. Of of p33ING1 mRNA. One of these was a verrucous carcinoma in which the p53 gene products might be inactivated by the oncoprotein E6 of human papilloma virus. Thus, the p53 tumor suppressor pathway was disrupted in most oral SCCs at the cellular levels, due to either an abnormality in p53 itself or loss of expression of p53 regulatory factors. This method would assist in making diagnosis, determining therapeutic strategy and predicting the prognosis of various cancers including oral SCCs.
Recurrent pregnancy failure is associated with a polymorphism in the p53 tumour suppressor gene.
Pietrowski, Detlef; Bettendorf, Hertha; Riener, Eva-Katrin; Keck, Christoph; Hefler, Lukas A; Huber, Johannes C; Tempfer, Clemens
2005-04-01
The p53 tumour suppressor gene is a well-known factor regulating apoptosis in a wide variety of cells and tissues. Alterations in the p53 gene are among the most common genetic changes in human cancers. In addition, recent data provide evidence that p53 plays a critical role in mediating pregnancy by regulating steroid hormone activation. In idiopathic recurrent miscarriages (IRM), causes and associations are much debated as the exact pathophysiological mechanisms are unknown. In this study, we assess whether an established polymorphism in the p53 gene is associated with the occurrence of IRM. Genotyping was performed by PCR-based amplification of the p53 Arg and Pro variants at codon 72 in 175 cases of IRM and 143 controls. We observed a statistically significant association between carriage of the Pro allele and the occurrence of IRM (P = 0.03, odds ratio 1.49, confidence interval 1.04-2.14). Distribution of genotypes was in Hardy-Weinberg equilibrium. Our results indicate an over-representation of the Pro allele of the p53 gene in women with IRM, giving support to the theory that p53 has a potential role during pregnancy.
Mutation screening of the TP53 gene by temporal temperature gradient gel electrophoresis.
Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise
2005-01-01
A protocol for detection of mutations in the TP53 gene using temporal temperature gradient gel electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques denaturing gradient gel electrophoresis (DGGE) and constant denaturant gel electrophoresis (CDGE) and eliminates some of the problems. The result is a rapid and sensitive screening technique that is robust and easily set up in smaller laboratory environments.
Mutation screening of the TP53 gene by temporal temperature gel electrophoresis (TTGE).
Sørlie, Therese; Johnsen, Hilde; Vu, Phuong; Lind, Guro Elisabeth; Lothe, Ragnhild; Børresen-Dale, Anne-Lise
2014-01-01
A protocol for detection of mutations in the TP53 gene using temporal temperature gradient electrophoresis (TTGE) is described. TTGE is a mutation detection technique that separates DNA fragments differing by single base pairs according to their melting properties in a denaturing gel. It is based on constant denaturing conditions in the gel combined with a temperature gradient during the electrophoretic run. This method combines some of the advantages of the related techniques, denaturing gradient gel electrophoresis and constant denaturant gel electrophoresis, and eliminates some of the problems. The result is a rapid and sensitive screening technique which is robust and easily set up in smaller laboratory environments.
Frequent alteration of MDM2 and p53 in the molecular progression of recurring non-Hodgkin's lymphoma
DEFF Research Database (Denmark)
Møller, Michael Boe; Nielsen, O; Pedersen, Niels Tinggaard
2002-01-01
-Hodgkin's lymphoma. METHODS AND RESULTS: We have analysed sequential biopsies from 42 non-Hodgkin's lymphoma patients immunohistochemically for p53 alterations (based on p53 and p21Waf1 expression), as well as for expression of MDM2, p27Kip1 and cyclin D3. Relapse of follicle centre lymphoma was associated with p53...... alterations as 5/6 (83%) follicle centre lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. Of these cases, three showed transformation to diffuse large B-cell lymphoma. p53 alteration was also associated with relapse of de novo diffuse large B-cell lymphoma and T-cell non......-Hodgkin's lymphoma, as 2/5 (40%) diffuse large B-cell lymphomas and 3/9 (33%) T-cell non-Hodgkin's lymphomas with normal p53 at diagnosis showed p53 alterations at relapse. No indolent non-Hodgkin's lymphoma case showed MDM2 over-expression at diagnosis, whereas 4/5 (80%) transformed diffuse large B-cell lymphomas...
Induction of B-cell lymphoma by UVB Radiation in p53 Haploinsufficient Mice
International Nuclear Information System (INIS)
Puebla-Osorio, Nahum; Miyahara, Yasuko; Coimbatore, Sreevidya; Limón-Flores, Alberto Y; Kazimi, Nasser; Ullrich, Stephen E; Zhu, Chengming
2011-01-01
The incidence of non-Hodgkin's lymphoma has increased over recent years. The exact etiology of lymphoma remains unknown. Ultraviolet light exposure has been associated with the development of internal lymphoid malignancies and some reports suggest that it may play a role in the development of lymphoma in humans. Here we describe the characterization and progression of lymphoma in p53 heterozygous mice exposed to UVB irradiation. UVB-irradiated p53 +/- mice developed enlargement of the spleen. Isolated spleen cells were transplanted into Rag deficient hosts. The UV-induced tumor cells were analyzed by flow cytometry. The tumor cells were tagged with GFP to study their metastatic potential. SKY and karyotypic analysis were carried out for the detection of chromosomal abnormalities. Functional assays included in vitro class switch recombination assay, immunoglobulin rearrangement assay, as well as cytokine profiling. UVB-exposed mice showed enlargement of the spleen and lymph nodes. Cells transplanted into Rag deficient mice developed aggressive tumors that infiltrated the lymph nodes, the spleen and the bone marrow. The tumor cells did not grow in immune competent syngeneic C57Bl/6 mice yet showed a modest growth in UV-irradiated B6 mice. Phenotypic analysis of these tumor cells revealed these cells are positive for B cell markers CD19 + , CD5 + , B220 + , IgM + and negative for T cell, NK or dendritic cell markers. The UV-induced tumor cells underwent robust in vitro immunoglobulin class switch recombination in response to lipopolysaccharide. Cytogenetic analysis revealed a t(14;19) translocation and trisomy of chromosome 6. These tumor cells secret IL-10, which can promote tumor growth and cause systemic immunosuppression. UV-irradiated p53 +/- mice developed lymphoid tumors that corresponded to a mature B cell lymphoma. Our results suggest that an indirect mechanism is involved in the development of internal tumors after chronic exposure to UV light. The
Induction of B-cell lymphoma by UVB Radiation in p53 Haploinsufficient Mice
Directory of Open Access Journals (Sweden)
Ullrich Stephen E
2011-01-01
Full Text Available Abstract Background The incidence of non-Hodgkin's lymphoma has increased over recent years. The exact etiology of lymphoma remains unknown. Ultraviolet light exposure has been associated with the development of internal lymphoid malignancies and some reports suggest that it may play a role in the development of lymphoma in humans. Here we describe the characterization and progression of lymphoma in p53 heterozygous mice exposed to UVB irradiation. Methods UVB-irradiated p53+/- mice developed enlargement of the spleen. Isolated spleen cells were transplanted into Rag deficient hosts. The UV-induced tumor cells were analyzed by flow cytometry. The tumor cells were tagged with GFP to study their metastatic potential. SKY and karyotypic analysis were carried out for the detection of chromosomal abnormalities. Functional assays included in vitro class switch recombination assay, immunoglobulin rearrangement assay, as well as cytokine profiling. Results UVB-exposed mice showed enlargement of the spleen and lymph nodes. Cells transplanted into Rag deficient mice developed aggressive tumors that infiltrated the lymph nodes, the spleen and the bone marrow. The tumor cells did not grow in immune competent syngeneic C57Bl/6 mice yet showed a modest growth in UV-irradiated B6 mice. Phenotypic analysis of these tumor cells revealed these cells are positive for B cell markers CD19+, CD5+, B220+, IgM+ and negative for T cell, NK or dendritic cell markers. The UV-induced tumor cells underwent robust in vitro immunoglobulin class switch recombination in response to lipopolysaccharide. Cytogenetic analysis revealed a t(14;19 translocation and trisomy of chromosome 6. These tumor cells secret IL-10, which can promote tumor growth and cause systemic immunosuppression. Conclusion UV-irradiated p53+/- mice developed lymphoid tumors that corresponded to a mature B cell lymphoma. Our results suggest that an indirect mechanism is involved in the development of internal
Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans.
Bokhoven, J.H.L.M. van; McKeon, F.
2002-01-01
p63 is the most recently discovered but most ancient member of the p53 family. In marked contrast to p53, p63 is highly expressed in embryonic ectoderm and in the basal, regenerative layers of many epithelial tissues in the adult. The p63-knockout mouse dies at birth and lacks limbs, epidermis,
Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation
Directory of Open Access Journals (Sweden)
Giovanna Damia
2001-01-01
Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.
The pro-survival function of p53 in HeLa cells
Energy Technology Data Exchange (ETDEWEB)
Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)
2014-11-15
The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.
Directory of Open Access Journals (Sweden)
2006-01-01
Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.
P53 expression in prostatic cancer: an immunohistochemical study
International Nuclear Information System (INIS)
Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.
2011-01-01
Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).
Carr, Michael I; Roderick, Justine E; Zhang, Hong; Woda, Bruce A; Kelliher, Michelle A; Jones, Stephen N
2016-12-27
The p53 tumor suppressor acts as a guardian of the genome by preventing the propagation of DNA damage-induced breaks and mutations to subsequent generations of cells. We have previously shown that phosphorylation of the Mdm2 oncoprotein at Ser394 by the ATM kinase is required for robust p53 stabilization and activation in cells treated with ionizing radiation, and that loss of Mdm2 Ser394 phosphorylation leads to spontaneous tumorigenesis and radioresistance in Mdm2 S394A mice. Previous in vitro data indicate that the c-Abl kinase phosphorylates Mdm2 at the neighboring residue (Tyr393) in response to DNA damage to regulate p53-dependent apoptosis. In this present study, we have generated an Mdm2 mutant mouse (Mdm2 Y393F ) to determine whether c-Abl phosphorylation of Mdm2 regulates the p53-mediated DNA damage response or p53 tumor suppression in vivo. The Mdm2 Y393F mice develop accelerated spontaneous and oncogene-induced tumors, yet display no defects in p53 stabilization and activity following acute genotoxic stress. Although apoptosis is unaltered in these mice, they recover more rapidly from radiation-induced bone marrow ablation and are more resistant to whole-body radiation-induced lethality. These data reveal an in vivo role for c-Abl phosphorylation of Mdm2 in regulation of p53 tumor suppression and bone marrow failure. However, c-Abl phosphorylation of Mdm2 Tyr393 appears to play a lesser role in governing Mdm2-p53 signaling than ATM phosphorylation of Mdm2 Ser394. Furthermore, the effects of these phosphorylation events on p53 regulation are not additive, as Mdm2 Y393F/S394A mice and Mdm2 S394A mice display similar phenotypes.
International Nuclear Information System (INIS)
Bodis, Stephan; Pruschy, Martin; Wirbelauer, Christiane; Glanzmann, Christoph; Krek, Wilhelm
1997-01-01
Purpose: Correct advance of cells through the S-phase of the mammalian cell cycle depends on the timely controlled activity of the E2F-1 transcription factor by cyclin A-cdk2. We are studying the reproductive integrity and radiosensitation of isogenic mouse fibrosarcoma cells, differing only in their p53 status, after expression of E2F-1 wildtype (wt) and specific E2F-1 mutants (mt) lacking the cyclin-A-binding domain. In this tumor model system only p53 wild-type expressing tumor cells are sensitive to ionizing radiation in vitro and in vivo. Material and Methods: Either wild-type p53 or genetically engineered p53 'null' mouse embryo fibroblasts were transfected with the oncogenes E1A and ras. These otherwise isogenic fibrosarcoma cells, with a malignant phenotype and tumorigenic in nude mice, were transfected with retroviruses containing either E2F-1 wild-type or specific E2F-1 mutants lacking the cyclin-A binding domain. Reproductive integrity after E2F-1 transfection with or without ionizing radiation (RT) was tested using the clonogenic assay. Tumor cell morphology of treated cells is analyzed for cell death mechanism. Results: E2F-1 wild-type expression in fibrosarcoma cells induced a clear p53 dependent cell death. While clonogenic survival of p53 'null' tumor cells was only slightly reduced with the expression of E2F-1 wild type (survival fraction of 0.5), the clonogenic survival of p53 wild-type fibrosarcoma tumor cells was reduced by at least one logarithm (survival fraction of 0.05). However, expression of the specific E2F-1 mutant lacking the cyclin-A binding domain reduced clonogenic survival in both the p53 'null' and the p53 wild-type fibrosarcoma cells by at least 2 logarithms (survival fraction 0.01 for p53 'null' and 0.002 for p53 wild-type). The mean values of the survival fractions after 2 and 5 Gy radiation alone in p53 'null' fibrosarcoma cells (SF 2 and SF 5) were SF 2 0.7, SF 5 = 0.15, respectively. The combination of ionizing RT in the p53
The critical role of catalase in prooxidant and antioxidant function of p53
Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J
2013-01-01
The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438
Mathematical Modeling of E6-p53 interactions in Cervical Cancer
Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar
2017-04-01
Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License
p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells
Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua
2011-01-01
Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149
Stress-specific response of the p53-Mdm2 feedback loop
Directory of Open Access Journals (Sweden)
Jensen Mogens H
2010-07-01
Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.
Directory of Open Access Journals (Sweden)
Alicja Sznarkowska
2010-08-01
Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.
Chronology of p53 protein accumulation in gastric carcinogenesis
Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.
1995-01-01
p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early
A nanobody modulates the p53 transcriptional program without perturbing its functional architecture
Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan
2014-01-01
The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313
Hernández-Acosta, N Carolina; Cabrera-Socorro, Alfredo; Morlans, Mercedes Pueyo; Delgado, Francisco J González; Suárez-Solá, M Luisa; Sottocornola, Roberta; Lu, Xin; González-Gómez, Miriam; Meyer, Gundela
2011-02-04
p63 and p73, family members of the tumor suppressor p53, are critically involved in the life and death of mammalian cells. They display high homology and may act in concert. The p73 gene is relevant for brain development, and p73-deficient mice display important malformations of the telencephalon. In turn, p63 is essential for the development of stratified epithelia and may also play a part in neuronal survival and aging. We show here that p63 and p73 are dynamically expressed in the embryonic and adult mouse and human telencephalon. During embryonic stages, Cajal-Retzius cells derived from the cortical hem co-express p73 and p63. Comparison of the brain phenotypes of p63- and p73- deficient mice shows that only the loss of p73 function leads to the loss of Cajal-Retzius cells, whereas p63 is apparently not essential for brain development and Cajal-Retzius cell formation. In postnatal mice, p53, p63, and p73 are present in cells of the subventricular zone (SVZ) of the lateral ventricle, a site of continued neurogenesis. The neurogenetic niche is reduced in size in p73-deficient mice, and the numbers of young neurons near the ventricular wall, marked with doublecortin, Tbr1 and calretinin, are dramatically decreased, suggesting that p73 is important for SVZ proliferation. In contrast to their restricted expression during brain development, p73 and p63 are widely detected in pyramidal neurons of the adult human cortex and hippocampus at protein and mRNA levels, pointing to a role of both genes in neuronal maintenance in adulthood. Copyright © 2010 Elsevier B.V. All rights reserved.
Phenotypic screening approaches to develop Aurora kinase inhibitors: Drug Discovery perspectives
Directory of Open Access Journals (Sweden)
Carlos eMarugán
2016-01-01
Full Text Available Targeting mitotic regulators as a strategy to fight cancer implies the development of drugs against key proteins such as Aurora A and B. Current drugs which target mitosis through a general mechanism of action (stabilization/destabilization of microtubules, have several side effects (neutropenia, alopecia, emesis. Pharmaceutical companies aim at avoiding these unwanted effects by generating improved and selective drugs that increase the quality of life of the patients. However, the development of these drugs is an ambitious task that involves testing thousands of compounds through biochemical and cell-based assays. In addition, molecules usually target complex biological processes, involving several proteins and different molecular pathways, further emphasizing the need for high-throughput screening techniques and multiplexing technologies in order to identify drugs with the desired phenotype.We will briefly describe two multiplexing technologies (high-content imaging, microarrays and flow cytometry and two key processes for drug discovery research (assay development and validation following our own published industry quality standards. We will further focus on high-content imaging as a useful tool for phenotypic screening and will provide a concrete example of high-content imaging assay to detect Aurora A or B selective inhibitors discriminating the off-target effects related to inhibition of other cell cycle or non-cell cycle key regulators. Finally, we will describe other assays that can help to characterize the in vitro pharmacology of the inhibitors.
The prognostic value of p53 mutation in pediatric marrow hypoplasia
Directory of Open Access Journals (Sweden)
Sharaf Alzahraa EA
2011-06-01
Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.
Correlation between p53 expression and clinical-pathological characteristics of gastric cancer
Directory of Open Access Journals (Sweden)
Radovanović Dragče
2011-01-01
Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.
Mitochondrial localization of the low level p53 protein in proliferative cells
Energy Technology Data Exchange (ETDEWEB)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)
2009-10-02
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication
Directory of Open Access Journals (Sweden)
Constance Qiao Xin Yeo
2016-04-01
Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.
Mitochondrial localization of the low level p53 protein in proliferative cells
International Nuclear Information System (INIS)
Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc
2009-01-01
p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.
Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT
Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.
2015-01-01
Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent
P53 suppresses expression of the 14-3-3gamma oncogene
Directory of Open Access Journals (Sweden)
Qi Wenqing
2011-08-01
Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.
Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S
p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector
Status and advances of p53-gene therapy and radiotherapy in malignant tumor
International Nuclear Information System (INIS)
Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong
2006-01-01
Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)
Wang, Yiping; Wong, Matthew Man-Kin; Zhang, Xiaojian; Chiu, Sung-Kay
2015-11-15
When cells are grown to confluence, cell-cell contact inhibition occurs and drives the cells to enter reversible quiescence rather than senescence. Confluent retinal pigment epithelial (RPE) cells exhibiting contact inhibition was used as a model in this study to examine the role of overexpression of transcription factor AP4, a highly expressed transcription factor in many types of cancer, in these cells during long-term culture. We generated stable inducible RPE cell clones expressing AP4 or AP4 without the DNA binding domain (DN-AP4) and observed that, when cultured for 24 days, RPE cells with a high level of AP4 exhibit a large, flattened morphology and even cease proliferating; these changes were not observed in DN-AP4-expressing cells or non-induced cells. In addition, AP4-expressing cells exhibited senescence-associated β-galactosidase activity and the senescence-associated secretory phenotype. We demonstrated that the induced cellular senescence was mediated by enhanced p53 expression and that AP4 regulates the p53 gene by binding directly to two of the three E-boxes present on the promoter of the p53 gene. Moreover, we showed that serum is essential for AP4 in inducing p53-associated cellular senescence. Collectively, we showed that overexpression of AP4 mediates cellular senescence involving in activation of p53 in long-term post-confluent RPE cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes
Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.
2013-01-01
Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, Akihisa
2002-01-01
We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)
miR-34 and p53: New Insights into a Complex Functional Relationship.
Directory of Open Access Journals (Sweden)
Francisco Navarro
Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.
Functions of MDMX in the Modulation of the p53-Response
Directory of Open Access Journals (Sweden)
Kristiaan Lenos
2011-01-01
Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.
Increased Arf/p53 activity in stem cells, aging and cancer.
Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander
2017-04-01
Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
The expression of p53 protein in patients with multiple myeloma
Directory of Open Access Journals (Sweden)
Marković Olivera
2007-01-01
Full Text Available Introduction: Although mutations of p53 are one of the most often acquired genetic changes in malignant tumors, these mutations are rare events in patients with newly diagnosed multiple myeloma (MM. Moreover, there are a few literature data about clinical significance of p53 overexpression in multiple myeloma. Objective The aim of our study was to evaluate the clinical significance of p53 immunoexpression in multiple myeloma. Method A total of 58 patients with newly diagnosed MM (26 females and 32 males, mean age 62 years were enrolled in the study. The diagnosis of MM was made according to criteria of Chronic Leukemia-Myeloma Task Force. Clinical staging was done according to Durie and Salmon classification (4 patients had disease stage I, 15 patients stage II and 39 patients stage III. The histological grade and histological stage were determined according to predominant plasma cell morphology and volume of myeloma infiltration, respectively. Standard immunohistochemical analysis with p53 antibody in B5-fixed and paraffin- embedded bone marrow specimens was used to evaluate the expression of p53 in myeloma cells. The specimens were considered positive when ≥5% of plasma cells exhibited clear nuclear positivity. Results Out of 58 patients, p53 expression was detected in 9 (15.52%. No significant correlation was found between p53 expression and clinical stage (I+II vs. III, Я2-microglobulin level (≤6 mg/L vs. >6mg/L, histological grade (I vs. II+III, histological stage (<20% vs. 21-50% vs. >50% and the extent of osteolytic lesions (≤3 vs. >3 lesions. Median survival of patients with p53 immunoreactivity in =>5% of plasma cells was 10 months, whilst median survival of patients with p53 immunoreactivity in <5% of plasma cells was 36 months. However, such difference was not significant (p=0.2. Conclusion The frequency of p53 immunoexpression in our group of newly diagnosed MM was relatively low. Although p53 immunoexpression was not
Public support for neonatal screening for Pompe disease, a broad-phenotype condition
Directory of Open Access Journals (Sweden)
Weinreich Stephanie
2012-03-01
Full Text Available Abstract Background Neonatal screening for Pompe disease has been introduced in Taiwan and a few U.S. states, while other jurisdictions including some European countries are piloting or considering this screening. First-tier screening flags both classic infantile and late-onset Pompe disease, which challenges current screening criteria. Previously, advocacy groups have sometimes supported expanded neonatal screening more than professional experts, while neutral citizens' views were unknown. This study aimed to measure support for neonatal screening for Pompe disease in the general public and to compare it to support among (parents of patients with this condition. The study was done in the Netherlands, where newborns are not currently screened for Pompe disease. Newborn screening is not mandatory in the Netherlands but current uptake is almost universal. Methods A consumer panel (neutral group and (parents of patients with Pompe disease (Pompe group were sent information and a questionnaire. Responses were analyzed of 555 neutral and 58 Pompe-experienced informants who had demonstrated sufficient understanding. Results 87% of the neutral group and 88% of the Pompe group supported the introduction of screening (95% CI of difference -10 to 7%. The groups were similar in their moral reasoning about screening and acceptance of false positives, but the Pompe-experienced group expected greater benefit from neonatal detection of late-onset disease. Multivariate regression analysis controlling for demographics confirmed that approval of the introduction of screening was independent of having (a child with Pompe disease. Furthermore, respondents with university education, regardless of whether they have (a child with Pompe disease, were more likely to be reluctant about the introduction of screening than those with less education, OR for approval 0.29 (95% CI 0.18 to 0.49, p Conclusions This survey suggests a rather high level of support for newborn
Dynamics of p53: A Master Decider of Cell Fate
Directory of Open Access Journals (Sweden)
Qingyin Luo
2017-02-01
Full Text Available Cellular stress‐induced temporal alterations—i.e., dynamics—are typically exemplified by the dynamics of p53 that serve as a master to determine cell fate. p53 dynamics were initially identified as the variations of p53 protein levels. However, a growing number of studies have shown that p53 dynamics are also manifested in variations in the activity, spatial location, and posttranslational modifications of p53 proteins, as well as the interplay among all p53 dynamical features. These are essential in determining a specific outcome of cell fate. In this review, we discuss the importance of the multifaceted features of p53 dynamics and their roles in the cell fate decision process, as well as their potential applications in p53‐based cancer therapy. The review provides new insights into p53 signaling pathways and their potentials in the development of new strategies in p53‐based cancer therapy.
Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event
Directory of Open Access Journals (Sweden)
Alnawaz Rehemtulla
2004-01-01
Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.
Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.
Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J
2014-06-01
Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.
Directory of Open Access Journals (Sweden)
Maria Teresa de Seixas Alves
2008-04-01
Full Text Available INTRODUÇÃO: Osteossarcoma (OS, o mais freqüente tumor primário maligno do osso, tem comportamento local agressivo e alto índice de disseminação sistêmica. Os eventos que permitem o crescimento e a disseminação tumoral ainda permanecem controversos. Os estudos sobre a carcinogênese e a progressão dessa neoplasia, com base na imunoexpressão de c-erb-B2, P-glicoproteína (P-gp e p53, apresentam resultados conflitantes acerca do real valor prognóstico e suas correlações com parâmetros histológicos. A anaplasia, em neoplasias na infância, constitui parâmetro histológico de agressividade tumoral e quimiorresistência. Nos OS primários ou metastáticos, seu significado permanece controverso. Por outro lado, em outras neoplasias humanas, a expressão do c-erb-B2 relaciona-se com p53, grau nuclear e outros parâmetros de agressividade. OBJETIVO: Avaliar a imunoexpressão de p53, c-erb-B2 e P-gp em OS, correlacionando os par��metros entre si e com a presença de anaplasia. MÉTODO: O estudo incluiu 96 biópsias pré-quimioterapia de pacientes com OS de alto grau, diagnosticados entre 1991 e 2000. A pesquisa imuno-histoquímica de p53, P-gp e c-erb-B2 foi feita pela técnica da estreptoavidina-biotina-peroxidase. Foram considerados positivos os casos onde havia imunoexpressão em 10% ou mais das células neoplásicas. Somente colorações membranosa (para cerb-B2 e P-gp e nuclear (para p53 foram consideradas positivas. Anaplasia foi definida como no tumor de Wilms, sendo considerada presente ou ausente. RESULTADOS: Anaplasia pôde ser avaliada em 82/96 casos, estando presente em 29 (35,36%. Imunoexpressão de p53 foi detectada em 25 dos 60 casos (36,23%; de P-gp, em 30 dos 73 casos (41,1%; e de c-erb-B2, em 22 dos 55 casos (40%. Os resultados demonstraram associação entre as imunoexpressões de c-erb-B2 e p53 (p = 0,042, p53 e o parâmetro anaplasia (p = 0,015, anaplasia e Pg (p = 0.034 CONCLUSÕES: A imunoexpressão de p53, c
Robustness of the p53 network and biological hackers.
Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G
2005-06-06
The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.
Stabilization and activation of p53 are regulated independently by different phosphorylation events
Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.
1998-01-01
Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877
Heart Failure as an Aging-Related Phenotype.
Morita, Hiroyuki; Komuro, Issei
2018-01-27
The molecular pathophysiology of heart failure, which is one of the leading causes of mortality, is not yet fully understood. Heart failure can be regarded as a systemic syndrome of aging-related phenotypes. Wnt/β-catenin signaling and the p53 pathway, both of which are key regulators of aging, have been demonstrated to play a critical role in the pathogenesis of heart failure. Circulating C1q was identified as a novel activator of Wnt/β-catenin signaling, promoting systemic aging-related phenotypes including sarcopenia and heart failure. On the other hand, p53 induces the apoptosis of cardiomyocytes in the failing heart. In these molecular mechanisms, the cross-talk between cardiomyocytes and non-cardiomyocytes (e,g,. endothelial cells, fibroblasts, smooth muscle cells, macrophages) deserves mentioning. In this review, we summarize recent advances in the understanding of the molecular pathophysiology underlying heart failure, focusing on Wnt/β-catenin signaling and the p53 pathway.
Directory of Open Access Journals (Sweden)
Mikael S Lindström
Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.
International Nuclear Information System (INIS)
Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio
2010-01-01
The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)
Directory of Open Access Journals (Sweden)
Magali Olivier
2007-02-01
yeast and human cells to measure the impact of these mutations on various protein properties: (1 transactivation activities (TA of mutant proteins on reporter genes placed under the control of various p53 responseelements, (2 capacity of mutant proteins to induce cellcycle arrest or apoptosis, (3 ability to exert dominantnegative effect (DNE over the wild-type protein, (4 activities of mutant proteins that are independent and unrelated to the wild-type protein (gain of function, GOF. Prediction models based on interspecies protein sequence conservation have also been developed to predict the functional impact of all possible single amino-acid substitutions.p> <p class="MsoNormal">These data have been used to produce systematic functional classifications of mutant proteins and these classifications have been integrated in the IARC TP53 database. New tools have been implemented to visualize these data and analyze mutation frequencies in relation to their functional impact and intrinsic nucleotide substitution rates.p> <p class="MsoNormal">Thus, the database allows systematic analyses of the factors that shape the patterns and influence the phenotype of missense mutations in human cancers. In a recent analysis of the database, we showed that that loss of TA capacity is a key factor for the selection of missense mutations, and that difference in mutation frequencies is closely related to nucleotide substitution rates along TP53 coding sequence. TA capacity of inherited missense mutations was also found to be related the age at onset of specific tumor types, mutations with total loss of TA being associated with earlier cancer onset cancers compared to mutations that retain partial trans-activation capacity. Furthermore, 80% of the most common mutants show a capacity to exert dominant-negative effect (DNE over wildtype p53, compared to only 45% of
Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...
African Journals Online (AJOL)
The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.
Directory of Open Access Journals (Sweden)
Mariell Pettersson
Full Text Available The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2 via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.
NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation
Directory of Open Access Journals (Sweden)
Labhart Paul
2007-05-01
Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...
2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.
Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R
2016-09-06
The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.
Basal p53 expression is indispensable for mesenchymal stem cell integrity.
Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G
2018-03-01
Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-11-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.
p53 functions as a cell cycle control protein in osteosarcomas.
Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B
1990-01-01
Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717
The expanding regulatory universe of p53 in gastrointestinal cancer.
Fesler, Andrew; Zhang, Ning; Ju, Jingfang
2016-01-01
Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs. Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology. With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.
Directory of Open Access Journals (Sweden)
Rejane Mattar
2004-01-01
Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea
Super p53 for Treatment of Ovarian Cancer
2017-09-01
System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14
Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.
Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido
2008-07-01
We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.
Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity
Directory of Open Access Journals (Sweden)
Masataka Yokoyama
2014-06-01
Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.
Directory of Open Access Journals (Sweden)
Philip W. Brownjohn
2017-04-01
Full Text Available Summary: Human stem cell models have the potential to provide platforms for phenotypic screens to identify candidate treatments and cellular pathways involved in the pathogenesis of neurodegenerative disorders. Amyloid precursor protein (APP processing and the accumulation of APP-derived amyloid β (Aβ peptides are key processes in Alzheimer's disease (AD. We designed a phenotypic small-molecule screen to identify modulators of APP processing in trisomy 21/Down syndrome neurons, a complex genetic model of AD. We identified the avermectins, commonly used as anthelmintics, as compounds that increase the relative production of short Aβ peptides at the expense of longer, potentially more toxic peptides. Further studies demonstrated that this effect is not due to an interaction with the core γ-secretase responsible for Aβ production. This study demonstrates the feasibility of phenotypic drug screening in human stem cell models of Alzheimer-type dementia, and points to possibilities for indirectly modulating APP processing, independently of γ-secretase modulation. : In this article, Livesey and colleagues perform a phenotypic drug screen in a human stem cell model of Alzheimer's disease. The anthelminthic avermectins are identified as a family of compounds that increase the production of short Aβ peptides over longer more toxic Aβ forms. The effect is analogous to existing γ-secretase modulators, but is independent of the core γ-secretase complex. Keywords: neural stem cells, Alzheimer's disease, phenotypic screening, iPSCs, human neurons, dementia, Down syndrome, amyloid beta, ivermectin, selamectin
The tumor suppressors pRB and p53 as regulators of adipocyte differentiation and function
DEFF Research Database (Denmark)
Hallenborg, Philip; Feddersen, Søren; Madsen, Lise
2009-01-01
BACKGROUND: The retinoblastoma protein (pRB) and p53 are crucial members of regulatory networks controlling the cell cycle and apoptosis, and a hallmark of virtually all cancers is dysregulation of expression or function of pRB or p53. Although they are best known for their role in cancer...
P53 overexpression in head and neck carcinoma and radiotherapy results
International Nuclear Information System (INIS)
Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John
1996-01-01
Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a
Association of p53 protein expression with clinical outcome in advanced supraglottic cancer
International Nuclear Information System (INIS)
Kang, Jin Oh; Hong, Seong Eon
1998-01-01
To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression
Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.
Directory of Open Access Journals (Sweden)
Simon Leuchs
Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.
Directory of Open Access Journals (Sweden)
María Pedrero
2016-11-01
Full Text Available An amperometric magnetoimmunosensor for the determination of human p53 protein is described in this work using a sandwich configuration involving the covalent immobilization of a specific capture antibody onto activated carboxylic-modified magnetic beads (HOOC-MBs and incubation of the modified MBs with a mixture of the target protein and horseradish peroxidase-labeled antibody (HRP-anti-p53. The resulting modified MBs are captured by a magnet placed under the surface of a disposable carbon screen-printed electrode (SPCE and the amperometric responses are measured at −0.20 V (vs. an Ag pseudo-reference electrode, upon addition of hydroquinone (HQ as a redox mediator and H2O2 as the enzyme substrate. The magnetoimmunosensing platform was successfully applied for the detection of p53 protein in different cell lysates without any matrix effect after a simple sample dilution. The results correlated accurately with those provided by a commercial ELISA kit, thus confirming the immunosensor as an attractive alternative for rapid and simple determination of this protein using portable and affordable instrumentation.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence
Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.
2009-01-01
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...
p21-LacZ reporter mice reflect p53-dependent toxic insult
International Nuclear Information System (INIS)
Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.
2008-01-01
There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity
P53 overexpression and outcome of radiation therapy in head and neck cancers
International Nuclear Information System (INIS)
Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae
1999-01-01
Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers
P53 overexpression and outcome of radiation therapy in head and neck cancers
Energy Technology Data Exchange (ETDEWEB)
Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)
1999-03-01
Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.
p53 regulates cytoskeleton remodeling to suppress tumor progression.
Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko
2015-11-01
Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.
Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer
International Nuclear Information System (INIS)
Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko
2015-01-01
Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer
Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients
DEFF Research Database (Denmark)
Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune
2011-01-01
patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...
International Nuclear Information System (INIS)
Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip
2011-01-01
Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.
Pre-irradiation at a low dose-rate blunted p53 response
International Nuclear Information System (INIS)
Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.
2003-01-01
Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation
AAVPG: A vigilant vector where transgene expression is induced by p53
Energy Technology Data Exchange (ETDEWEB)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.
Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways
Directory of Open Access Journals (Sweden)
Lisa Wiesmüller
2001-01-01
Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.
Nucleotide excision repair- and p53-deficient mouse models in cancer research
Energy Technology Data Exchange (ETDEWEB)
Hoogervorst, Esther M. [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Utrecht University, Department of Pathobiology, Utrecht (Netherlands); Steeg, Harry van [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Vries, Annemieke de [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: Annemieke.de.Vries@rivm.nl
2005-07-01
Cancer is caused by the loss of controlled cell growth due to mutational (in)activation of critical genes known to be involved in cell cycle regulation. Three main mechanisms are known to be involved in the prevention of cells from becoming cancerous; DNA repair and cell cycle control, important to remove DNA damage before it will be fixed into mutations and apoptosis, resulting in the elimination of cells containing severe DNA damage. Several human syndromes are known to have (partially) deficiencies in these pathways, and are therefore highly cancer prone. Examples are xeroderma pigmentosum (XP) caused by an inborn defect in the nucleotide excision repair (NER) pathway and the Li-Fraumeni syndrome, which is the result of a germ line mutation in the p53 gene. XP patients develop skin cancer on sun exposed areas at a relatively early age, whereas Li-Fraumeni patients spontaneously develop a wide variety of early onset tumors, including sarcomas, leukemia's and mammary gland carcinomas. Several mouse models have been generated to mimic these human syndromes, providing us information about the role of these particular gene defects in the tumorigenesis process. In this review, spontaneous phenotypes of mice deficient for nucleotide excision repair and/or the p53 gene will be described, together with their responses upon exposure to either chemical carcinogens or radiation. Furthermore, possible applications of these and newly generated mouse models for cancer will be given.
Meng, X; Carlson, NR; Dong, J; Zhang, Y
2015-01-01
The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...
Vuister, P.H.
The 52Cr(p, γ)53Mn reaction was investigated in the energy region Ep = 1.36–2.26 MeV. The resonance energies, the corresponding 53Mn excitation energies and the resonance strengths of 199 resonances, assigned to this reaction, are reported. The excitation energies and gamma-ray branchings of 13
The role of p53 in the response to mitotic spindle damage
International Nuclear Information System (INIS)
Meek, D.W.
2000-01-01
The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)
Relationship between P53 and bystander effect induced by radiated hepatoma cells
International Nuclear Information System (INIS)
Zhao Meijia; Shen Bo; Yuan Dexiao; Cheng Honghong; Shao Chunlin
2009-01-01
The role of p53 in bystander responses on normal liver cells were investigated by co-culturing irradiated hepatoma cells with non-irradiated bystander Chang liver cells. It was found that radiosensitivity of the hepatoma cells was relative to p53. HepG2 cells with wtp53 had the highest radiosensitivity followed by PLC/PRF/5 cells with mtp53 and Hep3B cells with null-p53. The induction of bystander micronucleus(MN) was observed only in the Chang liver cells that had been co-cultured with HepG2 cells but not co-cultured with PLC/PRF/5 or Hep3B. Also, this bystander MN was relative to the irradiation dose and the cell co-culture rime. When the hepatoma cells were treated with pifithrin-α, a p53 inhibitor, their radiosensitivities were reduced, and the bystander effect was diminished. The results indicate that p53 could regulate not only the radiosensitivity but also the bystander response. (authors)
International Nuclear Information System (INIS)
Hafez, N.H.; Tahoun, N.S.
2011-01-01
The differentiation of benign mesothelial cells from malignant tumor cells, primary, or metastatic, in serous effusions based on cytomorphologic features alone can be problematic. Purpose: This study was conducted to evaluate the utility of p53 and ki67 imrminocytochemical markers in differentiating benign from malignant tumor cells in serous effusions. Patients and methods: Archival Papanicolaou-stained smears of 91 pleura and peritoneal effusions were retrieved from Cytology Unit, Pathology Department, NCI, Cairo University between 2008 and 2010. Forty-one cases were positive for malignant cells and 50 cases were benign based on cytomorphologic features. Cases having doubt were excluded from the study. The slides were de stained and subjected to immunocytochemical staining for p53 and ki67. Histologic sections of colonic carcinoma and tonsillar tissue were used as positive control for p53 and ki67, respectively. Smears having > 5% positively stained nuclei for p53 were taken as positive and labeling index 10% of ki67 was considered positive. Frequencies of the individual immunocytochemical stains; p53 and ki67, in benign and malignant effusion as well as the combination of both stains were calculated. Results: p53 immunostaining showed nuclear positivity in 31 out of 41 malignant effusions (75.6%) and in 3 out of 50 benign effusions (6%), p < 0.005. p53 had 75.6% sensitivity, 94% specificity, 91.2% PPV, and 82.5% NPV. ki67 immunostaining was positive in 30 out of 41 malignant effusions (73.2%) and in 17 out of 50 benign effusions (34%), p < 0.05. ki67 had 73.2% sensitivity, 66% specificity, 63.8% PPV, and 75% NPV. Cases were then analyzed for combined immuno profile of p3 and ki67. Among the 24 cases that coexpressed both antigens, 22 cases (91.7%) were malignant. Thirty two out of 34 cases (94.1%) that showed negative results for both antigens were benign. For the cases that showed p53 immunostaining only, 9 out of 10 cases (90%) were malignant. Fifteen out of
p53-Dependent suppression of genome instability in germ cells
Energy Technology Data Exchange (ETDEWEB)
Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)
2014-02-15
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.
p53-Dependent suppression of genome instability in germ cells
International Nuclear Information System (INIS)
Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi
2014-01-01
Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells
p53-Mediated Molecular Control of Autophagy in Tumor Cells
Directory of Open Access Journals (Sweden)
Maria Mrakovcic
2018-03-01
Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.
A STUDY OF P53 EXPRESSION IN UROTHELIAL NEOPLASMS OF URINARY BLADDER
Directory of Open Access Journals (Sweden)
G. Sathish Kumar
2017-07-01
Full Text Available BACKGROUND Urothelial Cell Carcinoma (UCC of urinary bladder is the seventh commonest cancer wordwide.1 At initial diagnosis, 30% of UCC display solid and invasive growth patterns and are locally advanced or metastatic at the time of diagnosis. 70% of tumours are noninvasive papillary UCC confined to the epithelium and subepithelial connective tissue,2 which can be managed by endoscopic resection. A significant number of post-resected cases, progress for recurrence of tumour and infiltration to muscle layers. Invasive bladder cancer has high morbidity and uniform mortality when it is metastatic. There are no effective tools to predict aggressiveness of tumour, so that these cases can be managed more successfully. Mutated Tp53/p53 is the genetic abnormality most frequently associated with UCC and related to cell transformation, malignancy and high recurrence rates.2 MATERIALS AND METHODS This is a descriptive study conducted in the departments of urology and pathology and during the period of March 2014 to February 2015. All consecutive cystoscopic biopsies, Trans urethral resection of bladder tumour (TURBT and radical cystectomy specimens histopathologically diagnosed as UCC were included in the study. p53 expression was assessed by immunohistochemistry. Positive and negative controls were used. Bivariate analysis was done using Chi-square test in all cases. RESULTS A total of 80 cases were analysed. Significant association of p53 expression was found in higher grades of tumour. Also, noted relation of p53 mutation with tumour size, multifocality, multiplicity, muscle invasion and tumour stage, which were statistically not significant. CONCLUSION Bladder tumour grade shows significant association to p53 expression. Papillary neoplasm of low malignant potential (PUNLMP tumours are negative for p53, and in the present study, there was significant difference in p53 over expression low-grade papillary UCC compared with PUNLMP. 90% of low
An N-terminal Region of Mot-2 Binds to p53 In Vitro
Directory of Open Access Journals (Sweden)
Sunil C. Kaul
2001-01-01
Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.
He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang
2010-08-27
P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
International Nuclear Information System (INIS)
Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.
2009-01-01
The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.
Changes in protein expression in p53 deleted spontaneous thymic lymphomas
DEFF Research Database (Denmark)
Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm
2004-01-01
with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....
Energy Technology Data Exchange (ETDEWEB)
Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)
2012-07-13
Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp
Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53
International Nuclear Information System (INIS)
O'Hagan, Heather M.; Ljungman, Mats
2004-01-01
It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation
Mutant p53 drives cancer by subverting multiple tumour suppression pathways
Directory of Open Access Journals (Sweden)
Sue eHaupt
2016-01-01
Full Text Available The tumour suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counter-productively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins (including many transcription factors, which normally partner with its wild type, tumour-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism and corrupt them to become cancer promoting.
Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl MJ; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie
2015-01-01
The function of the majority of genes in the mouse and human genomes remains unknown. The mouse ES cell knockout resource provides a basis for characterisation of relationships between gene and phenotype. The EUMODIC consortium developed and validated robust methodologies for broad-based phenotyping of knockouts through a pipeline comprising 20 disease-orientated platforms. We developed novel statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no prior functional annotation. We captured data from over 27,000 mice finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. Novel phenotypes were uncovered for many genes with unknown function providing a powerful basis for hypothesis generation and further investigation in diverse systems. PMID:26214591
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Rappsilber, Juri
2014-01-01
linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...
Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression
Directory of Open Access Journals (Sweden)
Takahiro Ebata
2017-01-01
Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.
Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas
Directory of Open Access Journals (Sweden)
Ming-Fu eChiang
2013-03-01
Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.
p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.
Cox, Darren P
2012-01-01
Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.
Conformational detection of p53's oligomeric state by FlAsH Fluorescence.
Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J
2009-06-19
The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.
The duplication 17p13.3 phenotype
DEFF Research Database (Denmark)
Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica
2013-01-01
. Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....
A dynamic P53-MDM2 model with time delay
Energy Technology Data Exchange (ETDEWEB)
Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com
2006-11-15
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.
A dynamic P53-MDM2 model with time delay
International Nuclear Information System (INIS)
Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.
2006-01-01
Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results
p53 represses autophagy in a cell cycle-dependent fashion.
Tasdemir, Ezgi; Maiuri, Maria Chiara; Orhon, Idil; Kepp, Oliver; Morselli, Eugenia; Criollo, Alfredo; Kroemer, Guido
2008-10-01
Autophagy is one of the principal mechanisms of cellular defense against nutrient depletion and damage to cytoplasmic organelles. When p53 is inhibited by a pharmacological antagonist (cyclic pifithrin-alpha), depleted by a specific small interfering RNA (siRNA) or deleted by homologous recombination, multiple signs of autophagy are induced. Here, we show by epistatic analysis that p53 inhibition results in a maximum level of autophagy that cannot be further enhanced by a variety of different autophagy inducers including lithium, tunicamycin-induced stress of the endoplasmic reticulum (ER) or inhibition of Bcl-2 and Bcl-X(L) with the BH3 mimetic ABT737. Chemical inducers of autophagy (including rapamycin, lithium, tunicamycin and ABT737) induced rapid depletion of the p53 protein. The absence or the inhibition of p53 caused autophagy mostly in the G(1) phase, less so in the S phase and spares the G(2)/M phase of the cell cycle. The possible pathophysiological implications of these findings are discussed.
Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.
Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina
2010-05-01
Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.
Directory of Open Access Journals (Sweden)
Wei Xu
2010-08-01
Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.
Non-Canonical Cell Death Induced by p53
Directory of Open Access Journals (Sweden)
Atul Ranjan
2016-12-01
Full Text Available Programmed cell death is a vital biological process for multicellular organisms to maintain cellular homeostasis, which is regulated in a complex manner. Over the past several years, apart from apoptosis, which is the principal mechanism of caspase-dependent cell death, research on non-apoptotic forms of programmed cell death has gained momentum. p53 is a well characterized tumor suppressor that controls cell proliferation and apoptosis and has also been linked to non-apoptotic, non-canonical cell death mechanisms. p53 impacts these non-canonical forms of cell death through transcriptional regulation of its downstream targets, as well as direct interactions with key players involved in these mechanisms, in a cell type- or tissue context-dependent manner. In this review article, we summarize and discuss the involvement of p53 in several non-canonical modes of cell death, including caspase-independent apoptosis (CIA, ferroptosis, necroptosis, autophagic cell death, mitotic catastrophe, paraptosis, and pyroptosis, as well as its role in efferocytosis which is the process of clearing dead or dying cells.
Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor.
Salama, Asmaa; Kamel, Ahmad
2011-03-01
Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p=0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p<0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p=0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p=0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p=0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p=0.004). Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification. Copyright © 2011. Published by Elsevier B.V.
Evaluation of nuclear unrest and p53 immunostaining in Wilms' tumor
International Nuclear Information System (INIS)
Salama, A.; Kamel, A.
2011-01-01
Nuclear unrest is a term applied to Wilms' tumors (WT) that show nuclear abnormalities close to anaplasia but without abnormal mitoses. p53 is claimed to be associated with anaplasia and poor prognosis. This study was undertaken to evaluate the clinical significance of nuclear unrest and p53 immunostaining in Wilms' tumor. Material and methods: This is a retrospective study of 63 patients who presented at NCI with Wilms' tumors, and underwent preoperative chemotherapy followed by nephrectomy. Histopathologic assessment and p53 immunohistochemistry were done. Results: WT with nuclear unrest grade III closely resembled anaplastic tumors and both of them (group 1) constituted 19% of cases. Group 1 constituted 29% of cases showing blastema dominant morphology compared to 9.4% of cases without blastema dominant morphology with significant statistical difference (p = 0.047). Almost 83% of cases that achieved 1st complete remission were stages I, II and III, while 17% were stages IV and V with significant statistical difference (p < 0.001). Stage affected the 3-year relapse-free-survival (RFS) significantly (p = 0.014) as it was more in stages I, II and III than in stages IV and V (75.4% versus 50%). Blastema dominant morphology and high risk state significantly lowered the 3-year overall survival (OS) into 54.8% in comparison to 80.9% for cases with non-blastema dominant morphology (p = 0.042). Regarding p53 immunohistochemistry, group 1 tumors showed positive p53 more than group 2 with significant statistical difference (p = 0.014). p53 Positive immunostaining was significantly associated with high risk nephroblastoma (p = 0.004). Conclusion: Tumor stage and blastema dominant morphology are potent prognostic factors. p53 is linked to blastema dominant morphology. WT with nuclear unrest grade III closely resembles anaplastic WT. It may be appropriate to group tumors with nuclear unrest grade III with anaplastic histology regarding treatment stratification
Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response
Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.
2005-01-01
p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161
Koster, R.; Timmer-Bosscha, H.; Bischoff, R.; Gietema, J. A.; de Jong, S.
Wild-type p53 has a major role in the response and execution of apoptosis after chemotherapy in many cancers. Although high levels of wild-type p53 and hardly any TP53 mutations are found in testicular cancer (TC), chemotherapy resistance is still observed in a significant subgroup of TC patients.
Isolation and characterization of DUSP11, a novel p53 target gene
DEFF Research Database (Denmark)
Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina
2009-01-01
target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...
Phenotypic screening of hepatocyte nuclear factor (HNF) 4-γ receptor knockout mice
International Nuclear Information System (INIS)
Gerdin, Anna Karin; Surve, Vikas V.; Joensson, Marie; Bjursell, Mikael; Bjoerkman, Maria; Edenro, Anne; Schuelke, Meint; Saad, Alaa; Bjurstroem, Sivert; Lundgren, Elisabeth Jensen; Snaith, Michael; Fransson-Steen, Ronny; Toernell, Jan; Berg, Anna-Lena; Bohlooly-Y, Mohammad
2006-01-01
Using the mouse as a model organism in pharmaceutical research presents unique advantages as its physiology in many ways resembles the human physiology, it also has a relatively short generation time, low breeding and maintenance costs, and is available in a wide variety of inbred strains. The ability to genetically modify mouse embryonic stem cells to generate mouse models that better mimic human disease is another advantage. In the present study, a comprehensive phenotypic screening protocol is applied to elucidate the phenotype of a novel mouse knockout model of hepatocyte nuclear factor (HNF) 4-γ. HNF4-γ is expressed in the kidneys, gut, pancreas, and testis. First level of the screen is aimed at general health, morphologic appearance, normal cage behaviour, and gross neurological functions. The second level of the screen looks at metabolic characteristics and lung function. The third level of the screen investigates behaviour more in-depth and the fourth level consists of a thorough pathological characterisation, blood chemistry, haematology, and bone marrow analysis. When compared with littermate wild-type mice (HNF4-γ +/+ ), the HNF4-γ knockout (HNF4-γ -/- ) mice had lowered energy expenditure and locomotor activity during night time that resulted in a higher body weight despite having reduced intake of food and water. HNF4-γ -/- mice were less inclined to build nest and were found to spend more time in a passive state during the forced swim test
Protein expression of P13K and P53 in prediction of response to radiotherapy in cervical cancer
International Nuclear Information System (INIS)
Teja Kisnanto; Devita Tetriana; Iin Kurnia; Sudiono S; Mellova Amir; Budiningsih Siregar; Ramli; Andrijono; Setiawan Soetopo; Irwan; Tjahya Kurjana; Bethy S Hernowo; Maringan DL Tobing
2015-01-01
Cervical cancer is a malignant disease that is common in women and is the first order of malignant disease in Indonesia. Radiotherapy is the main treatment on cervical cancer, especially at an advanced stage (IIB-IIB). P13K and P-53 protein plays a role in the regulation of apoptosis (programmed cell death). The purpose of this study was to determine the protein expression of P13K and P-53 in the prediction of response to radiotherapy action in patients with cervical cancer. Microscopic preparations obtained from biopsy tissue cancer (IIB-IIIB) to 20 patients from RSCM and RSHS. The method used is the method of immunohistochemistry using P13K and P-53 protein biomarkers in cervical cancer tissue preparations. P13K protein expression value obtained by the method of immuno reactive Score (IRS). P13K protein positive expression marked in blue on the cell cytoplasm and P-53 protein is characterized by brown or dark colors contained in the cell nucleus. Results showed that IRS value by 10% a negative P13K, P13K IRS weaker by 70%, IRS P13K was at 15%, and the IRS P13K stronger by 5%. While the index positive P-53 was obtained by 75% and negative P-53 index by 5%. Radiotherapy response analysis showed that there were 75% good response and 25% a bad response. The conclusion from this study is the expression of the protein P13K and P-53 for response prediction of radiotherapy IRS P13K values obtained in response to both radiotherapy is higher compared with radiotherapy response is bad, and the P-53 protein is not found differences in response to radiotherapy between positive and negative expressions. (author)
de Angelis, Martin Hrabě; Nicholson, George; Selloum, Mohammed; White, Jacqui; Morgan, Hugh; Ramirez-Solis, Ramiro; Sorg, Tania; Wells, Sara; Fuchs, Helmut; Fray, Martin; Adams, David J; Adams, Niels C; Adler, Thure; Aguilar-Pimentel, Antonio; Ali-Hadji, Dalila; Amann, Gregory; André, Philippe; Atkins, Sarah; Auburtin, Aurelie; Ayadi, Abdel; Becker, Julien; Becker, Lore; Bedu, Elodie; Bekeredjian, Raffi; Birling, Marie-Christine; Blake, Andrew; Bottomley, Joanna; Bowl, Mike; Brault, Véronique; Busch, Dirk H; Bussell, James N; Calzada-Wack, Julia; Cater, Heather; Champy, Marie-France; Charles, Philippe; Chevalier, Claire; Chiani, Francesco; Codner, Gemma F; Combe, Roy; Cox, Roger; Dalloneau, Emilie; Dierich, André; Di Fenza, Armida; Doe, Brendan; Duchon, Arnaud; Eickelberg, Oliver; Esapa, Chris T; El Fertak, Lahcen; Feigel, Tanja; Emelyanova, Irina; Estabel, Jeanne; Favor, Jack; Flenniken, Ann; Gambadoro, Alessia; Garrett, Lilian; Gates, Hilary; Gerdin, Anna-Karin; Gkoutos, George; Greenaway, Simon; Glasl, Lisa; Goetz, Patrice; Da Cruz, Isabelle Goncalves; Götz, Alexander; Graw, Jochen; Guimond, Alain; Hans, Wolfgang; Hicks, Geoff; Hölter, Sabine M; Höfler, Heinz; Hancock, John M; Hoehndorf, Robert; Hough, Tertius; Houghton, Richard; Hurt, Anja; Ivandic, Boris; Jacobs, Hughes; Jacquot, Sylvie; Jones, Nora; Karp, Natasha A; Katus, Hugo A; Kitchen, Sharon; Klein-Rodewald, Tanja; Klingenspor, Martin; Klopstock, Thomas; Lalanne, Valerie; Leblanc, Sophie; Lengger, Christoph; le Marchand, Elise; Ludwig, Tonia; Lux, Aline; McKerlie, Colin; Maier, Holger; Mandel, Jean-Louis; Marschall, Susan; Mark, Manuel; Melvin, David G; Meziane, Hamid; Micklich, Kateryna; Mittelhauser, Christophe; Monassier, Laurent; Moulaert, David; Muller, Stéphanie; Naton, Beatrix; Neff, Frauke; Nolan, Patrick M; Nutter, Lauryl Mj; Ollert, Markus; Pavlovic, Guillaume; Pellegata, Natalia S; Peter, Emilie; Petit-Demoulière, Benoit; Pickard, Amanda; Podrini, Christine; Potter, Paul; Pouilly, Laurent; Puk, Oliver; Richardson, David; Rousseau, Stephane; Quintanilla-Fend, Leticia; Quwailid, Mohamed M; Racz, Ildiko; Rathkolb, Birgit; Riet, Fabrice; Rossant, Janet; Roux, Michel; Rozman, Jan; Ryder, Ed; Salisbury, Jennifer; Santos, Luis; Schäble, Karl-Heinz; Schiller, Evelyn; Schrewe, Anja; Schulz, Holger; Steinkamp, Ralf; Simon, Michelle; Stewart, Michelle; Stöger, Claudia; Stöger, Tobias; Sun, Minxuan; Sunter, David; Teboul, Lydia; Tilly, Isabelle; Tocchini-Valentini, Glauco P; Tost, Monica; Treise, Irina; Vasseur, Laurent; Velot, Emilie; Vogt-Weisenhorn, Daniela; Wagner, Christelle; Walling, Alison; Weber, Bruno; Wendling, Olivia; Westerberg, Henrik; Willershäuser, Monja; Wolf, Eckhard; Wolter, Anne; Wood, Joe; Wurst, Wolfgang; Yildirim, Ali Önder; Zeh, Ramona; Zimmer, Andreas; Zimprich, Annemarie; Holmes, Chris; Steel, Karen P; Herault, Yann; Gailus-Durner, Valérie; Mallon, Ann-Marie; Brown, Steve Dm
2015-09-01
The function of the majority of genes in the mouse and human genomes remains unknown. The mouse embryonic stem cell knockout resource provides a basis for the characterization of relationships between genes and phenotypes. The EUMODIC consortium developed and validated robust methodologies for the broad-based phenotyping of knockouts through a pipeline comprising 20 disease-oriented platforms. We developed new statistical methods for pipeline design and data analysis aimed at detecting reproducible phenotypes with high power. We acquired phenotype data from 449 mutant alleles, representing 320 unique genes, of which half had no previous functional annotation. We captured data from over 27,000 mice, finding that 83% of the mutant lines are phenodeviant, with 65% demonstrating pleiotropy. Surprisingly, we found significant differences in phenotype annotation according to zygosity. New phenotypes were uncovered for many genes with previously unknown function, providing a powerful basis for hypothesis generation and further investigation in diverse systems.
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.
Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine
2009-06-17
P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Hassinger, James P; Holubar, Stefan D; Pendlimari, Rajesh; Dozois, Eric J; Larson, David W; Cima, Robert R
2010-09-01
Limited data exist regarding colon cancer literacy in screening colonoscopy patients. We aimed to prospectively assess baseline colon cancer literacy and to determine whether a multimedia educational intervention was associated with improved colon cancer literacy. Colon cancer literacy was assessed in a convenience sample of colonoscopy patients before and after educational intervention. Statistically significant associations with colon cancer literacy scores were assessed by use of multivariate logistic regression analysis. Results are frequency (proportion), mean +/- SD, and odds ratio (OR (95% CI)). Seventy-three subjects participated: mean age, 57 +/- 12 years, 35 (48%) were women, 41 (57%) had a college degree, 43 (59%) had prior colonoscopy, 21 (29%) were accompanying family, and 16 (22%) were health care employees. Multivariate factors associated with a higher baseline colon cancer literacy score included health care employee status (7.9 (95% CI, 1.6-63); P = .02) and family colon cancer history (5.3 (95% CI, 1.3-25); P = .02). After multimedia education, mean scores improved from 53% +/- 23% to 88% +/- 12% (Delta = 35%; P screening colonoscopy. Multimedia-based educational intervention was an effective, satisfying strategy for addressing cancer-specific knowledge deficit in laypersons.
Czerniecki, Stefan M; Cruz, Nelly M; Harder, Jennifer L; Menon, Rajasree; Annis, James; Otto, Edgar A; Gulieva, Ramila E; Islas, Laura V; Kim, Yong Kyun; Tran, Linh M; Martins, Timothy J; Pippin, Jeffrey W; Fu, Hongxia; Kretzler, Matthias; Shankland, Stuart J; Himmelfarb, Jonathan; Moon, Randall T; Paragas, Neal; Freedman, Benjamin S
2018-05-15
Organoids derived from human pluripotent stem cells are a potentially powerful tool for high-throughput screening (HTS), but the complexity of organoid cultures poses a significant challenge for miniaturization and automation. Here, we present a fully automated, HTS-compatible platform for enhanced differentiation and phenotyping of human kidney organoids. The entire 21-day protocol, from plating to differentiation to analysis, can be performed automatically by liquid-handling robots, or alternatively by manual pipetting. High-content imaging analysis reveals both dose-dependent and threshold effects during organoid differentiation. Immunofluorescence and single-cell RNA sequencing identify previously undetected parietal, interstitial, and partially differentiated compartments within organoids and define conditions that greatly expand the vascular endothelium. Chemical modulation of toxicity and disease phenotypes can be quantified for safety and efficacy prediction. Screening in gene-edited organoids in this system reveals an unexpected role for myosin in polycystic kidney disease. Organoids in HTS formats thus establish an attractive platform for multidimensional phenotypic screening. Copyright © 2018 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)
2002-03-01
The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)
Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish
Directory of Open Access Journals (Sweden)
Seok-Hyung Kim
2013-07-01
Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.
P53 Gene Mutagenesis in Breast Cancer
National Research Council Canada - National Science Library
Sommer, Steve S
2005-01-01
.... The central hypothesis of this proposal is that variability in the patterns of p53 mutagensis in breast cancer reflects differences in exposures to different amounts and/or types of diverse environmental mutagens...
Soto-Cruz, Isabel; Legorreta-Herrera, Martha
2009-01-01
We have devised and implemented a module for an upper division undergraduate laboratory based on the amplification and analysis of a p53 polymorphism associated with cancer susceptibility. First, students collected a drop of peripheral blood cells using a sterile sting and then used FTA cards to extract the genomic DNA. The p53 region is then PCR…
MDM2, p53 and pRb Expression Prior to Definitive Chemoradiotherapy in Esophageal Carcinoma
International Nuclear Information System (INIS)
Yoon, Mee Sun; Nam, Taek Keun; Lee, Jae Hyuk; Cho, Sang Hee; Song, Ju Young; Ahn, Sung Ja; Chung, Ik Joo; Chung, Woong Ki; Nah, Byung Sik
2007-01-01
Purpose: This study evaluated the pretreatment expression patterns of MDM2, p53, and pRb proteins to determine if the expression patterns could predict the outcome of concurrent chemoradiotherapy (CCRT) for esophageal squamous cell carcinoma and aid in the decisions for the selection of treatment modalities. Materials and Methods: Fifty-one patients that were treated with definitive hemoradiotherapy for stage I∼ IVa esohageal squamous cell carcinoma were selected for this study. Radiotherapy was administered with daily 1.8∼2 Gy fractions up to a median dose of 54 Gy for primary tumors, and with four cycles of cisplatin/5-fluorouracil chemotherapy that was administered every 4 weeks, the first two cycles of which were administered concurrently with radiotherapy. Expression of MDM2, p53, and pRb was investigated by immunohistochemical analysis using pretreatment biopsy specimens. Results: MDM2, p53, and pRb were detected with high immunoreactivity in 19.6%, 27.5%, and 66.7% of the patients, respectively. However, there was no significant correlation between expression of these factors and clinical outcome. By the use of multivariate analysis with nine covariates-age, tumor location, tumor length, stage, pathological response, clinical response, MDM2 expression, p53 expression, and pRb expression, only pathological response and stage were significant factors for cause-specific survival. Conclusion: Expression of MDM2, p53, and pRb was not found to be clinically significant for predicting outcomes after CCRT in this study. Further studies with a larger patient population and longer follow-up periods are needed to re-evaluate the expression pattern and to identify new predictors for CCRT response
Almannai, Mohammed; Marom, Ronit; Divin, Kristian; Scaglia, Fernando; Sutton, V Reid; Craigen, William J; Lee, Brendan; Burrage, Lindsay C; Graham, Brett H
2017-09-01
Cobalamin C disease is a multisystemic disease with variable manifestations and age of onset. Genotype-phenotype correlations are well-recognized in this disorder. Here, we present a large cohort of individuals with cobalamin C disease, several of whom are heterozygous for the c.482G>A pathogenic variant (p.Arg161Gln). We compared clinical characteristics of individuals with this pathogenic variant to those who do not have this variant. To our knowledge, this study represents the largest single cohort of individuals with the c.482G>A (p.Arg161Gln) pathogenic variant. A retrospective chart review of 27 individuals from 21 families with cobalamin C disease who are followed at our facility was conducted. 13 individuals (48%) are compound heterozygous with the c.482G>A (p.Arg161Gln) on one allele and a second pathogenic variant on the other allele. Individuals with the c.482G>A (p.Arg161Gln) pathogenic variant had later onset of symptoms and easier metabolic control. Moreover, they had milder biochemical abnormalities at presentation which likely contributed to the observation that 4 individuals (31%) in this group were missed by newborn screening. The c.482G>A (p.Arg161Gln) pathogenic variant is associated with milder disease. These individuals may not receive a timely diagnosis as they may not be identified on newborn screening or because of unrecognized, late onset symptoms. Despite the milder presentation, significant complications can occur, especially if treatment is delayed. Copyright © 2017 Elsevier Inc. All rights reserved.
Surmiak, Ewa; Twarda-Clapa, Aleksandra; Zak, Krzysztof M.; Musielak, Bogdan; Tomala, Marcin D.; Kubica, Katarzyna; Grudnik, Przemyslaw; Madej, Mariusz; Jablonski, Mateusz; Potempa, Jan; Kalinowska-Tluscik, Justyna; Dömling, Alexander; Dubin, Grzegorz; Holak, Tad A.
2016-01-01
The p53 pathway is inactivated in almost all types of cancer by mutations in the p53 encoding gene or overexpression of the p53 negative regulators, Mdm2 and/or Mdmx. Restoration of the p53 function by inhibition of the p53-Mdm2/Mdmx interaction opens up a prospect for a nongenotoxic anticancer
Immunohistochemical study of p53 overexpression in radiation-induced colon cancers
International Nuclear Information System (INIS)
Minami, Kazunori; Hayashi, Nobuyuki; Mokarim, A.; Matsuzaki, Sumihiro; Ito, Masahiro; Sekine, Ichiro.
1998-01-01
The expressions of p53 and proliferating cell nuclear antigen (PCNA) were studied immunohistochemically from paraffin sections of 7 cases (9 lesions) of radiation-induced colon cancer and 42 cases of spontaneous colon cancer. Age distribution of radiation-induced and spontaneous colon cancer were 68.1 years (range, 56 to 77 years) and 67.4 years (range, 31 to 85 years), respectively. Among the radiation-induced colon cancers, there were 3 lesions of mucinous carcinoma (33%), a much higher than found for spontaneous mucinous cancer. Immunohistochemically, p53 protein expression was detected in 7/9 (78%) of radiation-induced cancers and in 23/42 (55%) of spontaneous colon cancers. χ 2 analysis found no significant differences between radiation-induced and spontaneous colon cancers in age distribution or p53-positive staining for frequency, histopathology, or Dukes'' classification. In radiation colitis around the cancers including aberrant crypts, spotted p53 staining and abnormal and scattered PCNA-positive staining were observed. In histologically normal cells, p53 staining was almost absent and PCNA-positive staining was regularly observed in the lower half of the crypt. In radiation colitis including aberrant glands, cellular proliferation increased and spotted p53 expression was observed. This study suggests that radiation colitis and aberrant glands might possess malignant potential and deeply associate with carcinogenesis of radiation-induced colon cancer. (author)
Ikegaki, Naohiko; Hicks, Sakeenah L; Regan, Paul L; Jacobs, Joshua; Jumbo, Amina S; Leonhardt, Payton; Rappaport, Eric F; Tang, Xao X
2014-01-01
Neuroblastoma is a common pediatric solid tumor that exhibits a striking clinical bipolarity: favorable and unfavorable. The survival rate of children with unfavorable neuroblastoma remains low among all childhood cancers. MYCN and MYC play a crucial role in determining the malignancy of unfavorable neuroblastomas, whereas high-level expression of the favorable neuroblastoma genes is associated with a good disease outcome and confers growth suppression of neuroblastoma cells. A small fraction of neuroblastomas harbors TP53 mutations at diagnosis, but a higher proportion of the relapse cases acquire TP53 mutations. In this study, we investigated the effect of S(+)-ibuprofen on neuroblastoma cell lines, focusing on the expression of the MYCN, MYC, AKT, p53 proteins and the favorable neuroblastoma genes in vitro as biomarkers of malignancy. Treatment of neuroblastoma cell lines with S(+)-ibuprofen resulted in a significant growth suppression. This growth effect was accompanied by a marked decrease in the expression of MYC, MYCN, AKT and an increase in p53 expression in neuroblastoma cell lines without TP53 mutation. In addition, S(+)-ibuprofen enhanced the expression of some favorable neuroblastoma genes (EPHB6, CD44) and genes involved in growth suppression and differentiation (EGR1, EPHA2, NRG1 and SEL1L). Gene expression profile and Ingenuity pathway analyses using TP53-mutated SKNAS cells further revealed that S(+)-ibuprofen suppressed molecular pathways associated with cell growth and conversely enhanced those of cell cycle arrest and the unfolded protein response. Collectively, these results suggest that S(+)-ibuprofen or its related compounds may have the potential for therapeutic and/or palliative use for unfavorable neuroblastoma.
Palli, D; Caporaso, N E; Shiao, Y H; Saieva, C; Amorosi, A; Masala, G; Rice, J M; Fraumeni, J F
1997-12-01
A series of 105 gastric cancer (GC) cases with paraffin-embedded specimens interviewed in a previous population-based case-control study conducted in a high-risk area around Florence, Italy, was examined for the presence of p53 mutations. Overall, 33 of 105 cases had a mutation (p53+) identified by single-strand conformational polymorphism and confirmed by sequencing (Y-H. Shiao et al., submitted for publication). p53+ cases had a more traditional dietary pattern (i.e., corn meal mush, meat soup, and other homemade dishes) and reported less frequent consumption of raw vegetables (particularly lettuce and raw carrots). A positive association with a high nitrite intake and a negative association with raw vegetables and diffuse type histology persisted in a multivariate analysis. In addition, p53+ cases tended to be located in the upper portion of the stomach and to be associated with advanced age and blood group A. No relation was found between the presence of p53 mutations and histologically defined Helicobacter pylori infection, smoking history, family history of gastric cancer, education, and social class. Of the 33 p53+ cases, 19 had G:C-->A:T transitions at CpG sites. These tumors tended to occur in females and in association with H. pylori infection but not other risk factors. The remaining 14 cases with a p53 mutation had mainly transversions but also two deletions and two transitions at non-CpG sites. These tumors showed a strong positive association with a traditional dietary pattern and with the estimated intake of selected nutrients (nitrite, protein, and fat, particularly from animal sources). The findings of this case-case analysis suggest that p53 mutations at non-CpG sites are related to exposure to alkylating compounds from diet, whereas p53 mutations at CpG sites might be related to H. pylori infection.
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Synergistic anti-tumor effects of nitroreductase mutants and p53
Directory of Open Access Journals (Sweden)
Mahboobeh Razmkhah
2014-01-01
Conclusion: Combination of T41L/F70A NTR with p53 may have more advantages for treatment of different types of cancers compared to the other NTRs and p53 alone. The present study results may open new windows for getting desired outcome in gene therapy of different types of cancer.
Recent progress of the study of p53 control mechanism by ionizing radiation
International Nuclear Information System (INIS)
Kawai, Hidehiko
2004-01-01
Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)
Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage
Directory of Open Access Journals (Sweden)
Rolletschek Alexandra
2009-06-01
Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.
Generation of a selectively cytotoxic fusion protein against p53 mutated cancers
International Nuclear Information System (INIS)
Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A
2012-01-01
A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology
Generation of a selectively cytotoxic fusion protein against p53 mutated cancers
Directory of Open Access Journals (Sweden)
Kousparou Christina A
2012-08-01
Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.
International Nuclear Information System (INIS)
Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu
2014-01-01
Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells
Cell and small animal models for phenotypic drug discovery
Directory of Open Access Journals (Sweden)
Szabo M
2017-06-01
Full Text Available Mihaly Szabo,1 Sara Svensson Akusjärvi,1 Ankur Saxena,1 Jianping Liu,2 Gayathri Chandrasekar,1 Satish S Kitambi1 1Department of Microbiology Tumor, and Cell Biology, 2Department of Biochemistry and Biophysics, Karolinska Institutet, Solna, Sweden Abstract: The phenotype-based drug discovery (PDD approach is re-emerging as an alternative platform for drug discovery. This review provides an overview of the various model systems and technical advances in imaging and image analyses that strengthen the PDD platform. In PDD screens, compounds of therapeutic value are identified based on the phenotypic perturbations produced irrespective of target(s or mechanism of action. In this article, examples of phenotypic changes that can be detected and quantified with relative ease in a cell-based setup are discussed. In addition, a higher order of PDD screening setup using small animal models is also explored. As PDD screens integrate physiology and multiple signaling mechanisms during the screening process, the identified hits have higher biomedical applicability. Taken together, this review highlights the advantages gained by adopting a PDD approach in drug discovery. Such a PDD platform can complement target-based systems that are currently in practice to accelerate drug discovery. Keywords: phenotype, screening, PDD, discovery, zebrafish, drug
International Nuclear Information System (INIS)
Garza, Rene; Hudson, Robert A.; McMahan, C. Alex; Walter, Christi A.; Vogel, Kristine S.
2007-01-01
Defects in genes that control DNA repair, proliferation, and apoptosis can increase genomic instability, and thus promote malignant progression. Although most tumors that arise in humans with neurofibromatosis type 1 (NF1) are benign, these individuals are at increased risk for malignant peripheral nerve sheath tumors (MPNST). To characterize additional mutations required for the development of MPNST from benign plexiform neurofibromas, we generated a mouse model for these tumors by combining targeted null mutations in Nf1 and p53, in cis. CisNf1+/-; p53+/- mice spontaneously develop PNST, and these tumors exhibit loss-of-heterozygosity at both the Nf1 and p53 loci. Because p53 has well-characterized roles in the DNA damage response, DNA repair, and apoptosis, and because DNA repair genes have been proposed to act as modifiers in NF1, we used the cisNf1+/-; p53+/- mice to determine whether a mutator phenotype arises in NF1-associated malignancies. To quantitate spontaneous mutant frequencies (MF), we crossed the Big Blue mouse, which harbors a lacI transgene, to the cisNf1+/-; p53+/- mice, and isolated genomic DNA from both tumor and normal tissues in compound heterozygotes and wild-type siblings. Many of the PNST exhibited increased mutant frequencies (MF = 4.70) when compared to normal peripheral nerve and brain (MF = 2.09); mutations occurred throughout the entire lacI gene, and included base substitutions, insertions, and deletions. Moreover, the brains, spleens, and livers of these cisNf1+/-; p53+/- animals exhibited increased mutant frequencies when compared to tissues from wild-type littermates. We conclude that a mild mutator phenotype arises in the tumors and tissues of cisNf1+/-; p53+/- mice, and propose that genomic instability influences NF1 tumor progression and disease severity
p53 Represses the Oncogenic Sno-MiR-28 Derived from a SnoRNA.
Directory of Open Access Journals (Sweden)
Feng Yu
Full Text Available p53 is a master tumour repressor that participates in vast regulatory networks, including feedback loops involving microRNAs (miRNAs that regulate p53 and that themselves are direct p53 transcriptional targets. We show here that a group of polycistronic miRNA-like non-coding RNAs derived from small nucleolar RNAs (sno-miRNAs are transcriptionally repressed by p53 through their host gene, SNHG1. The most abundant of these, sno-miR-28, directly targets the p53-stabilizing gene, TAF9B. Collectively, p53, SNHG1, sno-miR-28 and TAF9B form a regulatory loop which affects p53 stability and downstream p53-regulated pathways. In addition, SNHG1, SNORD28 and sno-miR-28 are all significantly upregulated in breast tumours and the overexpression of sno-miR-28 promotes breast epithelial cell proliferation. This research has broadened our knowledge of the crosstalk between small non-coding RNA pathways and roles of sno-miRNAs in p53 regulation.
International Nuclear Information System (INIS)
Hennig, E.M.; Norwegian Radium Hospital, Oslo; Kvinnsland, S.; Holm, R.; Nesland, J.M.
1999-01-01
Human papillomavirus (HPV) 16 has previously been found in 19/41 breast carcinomas (46%) in women with a history of HPV 16 positive CIN III lesions. There was no significant difference in distribution of histological subtypes, mean or median tumour diameter or number of regional lymph node metastases in the HPV positive and HPV negative breast carcinoma groups. P53, p21 and c-erbB-2 proteins were analyzed by immunohistochemistry in the HPV 16 positive and HPV negative breast carcinomas. There was a significant difference in p53 and p21 protein immunoreactivity between HPV 16 positive and HPV negative breast carcinomas (p=0.0091 and p=0.0040), with a significant less detectable p53 and p21 protein immunoreactivity in the HPV 16 positive cases. There was also a significant difference in the coexpression of p53/p21 between the HPV 16 positive and HPV 16 negative breast carcinomas (p=0.002). No significant difference in immunostaining for c-erbB-2 protein in the two groups was found (p=0.15), or for the coexpression of p53/c-erbB-2 (p=0.19). The significantly lower expression of p53 and p21 proteins in HPV 16 positive than in HPV 16 negative breast carcinomas supports the hypothesis of inactivation and degradation of wild-type p53 proteins by HPV 16 E6 and that p53 mutation is not necessary for transformation in the HPV 16 positive cases. (orig.)
Human NTH1 physically interacts with p53 and proliferating cell nuclear antigen
International Nuclear Information System (INIS)
Oyama, Masaki; Wakasugi, Mitsuo; Hama, Takashi; Hashidume, Hatsuho; Iwakami, Yasutaka; Imai, Rika; Hoshino, Sanae; Morioka, Hiroshi; Ishigaki, Yasuhito; Nikaido, Osamu; Matsunaga, Tsukasa
2004-01-01
Thymine glycol (Tg) is one of predominant oxidative DNA lesions caused by ionizing radiation and other oxidative stresses. Human NTH1 is a bifunctional enzyme with DNA glycosylase and AP lyase activities and removes Tg as the first step of base excision repair (BER). We have searched for the factors interacting with NTH1 by using a pull-down assay and found that GST-NTH1 fusion protein precipitates proliferating cell nuclear antigen (PCNA) and p53 as well as XPG from human cell-free extracts. GST-NTH1 also bound to recombinant FLAG-tagged XPG, PCNA, and (His) 6 -tagged p53 proteins, indicating direct protein-protein interaction between those proteins. Furthermore, His-p53 and FLAG-XPG, but not PCNA, stimulated the Tg DNA glycosylase/AP lyase activity of GST-NTH1 or NTH1. These results provide an insight into the positive regulation of BER reaction and also suggest a possible linkage between BER of Tg and other cellular mechanisms
Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.
Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald
2013-04-17
The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.
Directory of Open Access Journals (Sweden)
Suzanne M Quartuccio
Full Text Available Epithelial ovarian cancer is the most lethal gynecological malignancy among US women. The etiology of this disease, although poorly understood, may involve the ovarian surface epithelium or the epithelium of the fallopian tube fimbriae as the progenitor cell. Disruptions in the transforming growth factor beta (TGFβ pathway and p53 are frequently found in chemotherapy-resistant serous ovarian tumors. Transgenic mice expressing a dominant negative form of Smad2 (Smad2DN, a downstream transcription factor of the TGFβ signaling pathway, targeted to tissues of the reproductive tract were created on a FVB background. These mice developed epithelium-lined inclusion cysts, a potential precursor lesion to ovarian cancer, which morphologically resembled oviductal epithelium but exhibited protein expression more closely resembling the ovarian surface epithelium. An additional genetic "hit" of p53 deletion was predicted to result in ovarian tumors. Tissue specific deletion of p53 in the ovaries and oviducts alone was attempted through intrabursal or intraoviductal injection of Cre-recombinase expressing adenovirus (AdCreGFP into p53 (flox/flox mice. Ovarian bursal cysts were detected in some mice 6 months after intrabursal injection. No pathological abnormalities were detected in mice with intraoviductal injections, which may be related to decreased infectivity of the oviductal epithelium with adenovirus as compared to the ovarian surface epithelium. Bitransgenic mice, expressing both the Smad2DN transgene and p53 (flox/flox, were then exposed to AdCreGFP in the bursa and oviductal lumen. These mice did not develop any additional phenotypes. Exposure to AdCreGFP is not an effective methodology for conditional deletion of floxed genes in oviductal epithelium and tissue specific promoters should be employed in future mouse models of the disease. In addition, a novel phenotype was observed in mice with high expression of the Smad2DN transgene as validated
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
Energy Technology Data Exchange (ETDEWEB)
Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)
2013-02-15
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.
p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells
International Nuclear Information System (INIS)
Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer
2013-01-01
Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status
Detection of genotoxic and non-genotoxic carcinogens in Xpc−/−p53+/− mice
International Nuclear Information System (INIS)
Melis, Joost P.M.; Speksnijder, Ewoud N.; Kuiper, Raoul V.; Salvatori, Daniela C.F.; Schaap, Mirjam M.; Maas, Saskia; Robinson, Joke; Verhoef, Aart; Benthem, Jan van; Luijten, Mirjam; Steeg, Harry van
2013-01-01
An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.
Dose selenomethionine have radio-protective effect on cell lines with wild type p53?
International Nuclear Information System (INIS)
Tsuji, K.; Hagihira, T.; Ohnishi, K.; Ohnishi, T.; Matsumoto, H.
2003-01-01
Full text: Selenium compounds are known to have cancer preventive effects. It is reported recently that selenium in the form of selenomethionine (SeMet) can protect cells with wild type p53 from UV-induced cell killing by activating the DNA repair mechanism of p53 tumor suppressor protein via redox factor Ref1 by reducing p53 cysteine residue 275 and 277. In contrast, SeMet has no protective effect on UV-induced cell killing in p53-null cells. If SeMet also has protective effect in cells with wild type p53 on cell killing by photon irradiation, SeMet can be used as normal tissue radio-protector. We examined the effect of SeMet on cell killing by X-ray irradiation in several cell lines with different p53 status at exponentially growing phase. Cell lines used in this experiment were as follows: H1299/neo; human lung cancer cell line of p53 null type tranfected with control vector with no p53, H1299/wp53; wild type p53 transfected counterpart. A172/neo; human glioblastoma cell line with wild type p53, A172/mp53-248; mp53-248 (248-mutant, ARG >TRP) transfected counterpart. SAS/neo; human tongue cancer cell line with wild type p53, and SAS/mp53-248; mp53-248 transfected counterpart. Cells were subcultured at monolayer in D-MEM containing 10% FBS. Survivals of the cells were determined by colony forming ability. Ten-MV linac X-ray was used to irradiate the cells. Exponentially growing cells were incubated with 20μM of SeMet for 15 hours before irradiation. After 24 hours exposure of SeMet, cells were incubated up to two weeks in growth medium for colony formation. Twenty-four hours exposure of 20μM of SeMet had no cytotoxicity on these cell lines. SeMet had no modification effect on cell killing by photon irradiation in H1299/neo, H1299/wp53, SAS/neo, SAS/mp53-248, and A172/mp53-248. On the other hand, SeMet sensitized A172/neo in radiation cell killing. The effects of p53 on interaction of SeMet and photon irradiation differ according to cell lines
P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation
International Nuclear Information System (INIS)
Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.
2006-01-01
Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells
Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee
2018-05-05
The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.
Bladder-like graphical representation of p53 gene alterations in some human cancers
International Nuclear Information System (INIS)
Helal, N.L.; Dorrah, M.; LI, C.
2005-01-01
the p53 tumor suppressor gene is mutated in about half of all human cancer cells. These mutations are not only important in tumor progression but apparently also in the response of some tumors to chemotherapy and radiation treatment, thus to clinical outcome. Recent studies have shown that cells carrying p53 mutations are more resistant to radiation and chemotherapy than cells with functional p53. More than 15000 tumors with Tp53 mutations were published, leadingto the description of more than 1500 different Tp53 mutants (at the site http:// p53. curie.fr). To exploit this huge bulk of data, specific analytic tools were highly warranted. Also, new computational techniques for rapid determination of such information and comparative studies of different mutations are required. In the present study, a mathematical method for the IARC library p53 mutation database comparing p53 mutations occurring in four different cancers was described. The sizes of the four cancers in the database were bladder (860), liver (786), brain (1170) and skin (38) cancers, for a total of 2854 of p53 mutations. The study was carried out on exons 4-8 of p53 for the four cancers under investigation. From this study, it can be quantitatively obtained some information for each characteristic sequence. The data showed that exon 8 was the most mutant exon in skin cancer and exon 7 was the lowest one. In hepatocellular carcinoma, exon 4 was the most mutant exon and exon 7 was the lowest mutant exon. Brain cancer showed high mutation in exon 8 and low mutation at exon 6. Finally, bladder mutation was mostly mutated at exon 6 comparing to the least value of exon 7. It is expected that this study of p53 mutation may provide useful information for the diagnosis, prognosis and treatment of cancer
RNA content in the nucleolus alters p53 acetylation via MYBBP1A
Kuroda, Takao; Murayama, Akiko; Katagiri, Naohiro; Ohta, Yu-mi; Fujita, Etsuko; Masumoto, Hiroshi; Ema, Masatsugu; Takahashi, Satoru; Kimura, Keiji; Yanagisawa, Junn
2011-01-01
A number of external and internal insults disrupt nucleolar structure, and the resulting nucleolar stress stabilizes and activates p53. We show here that nucleolar disruption induces acetylation and accumulation of p53 without phosphorylation. We identified three nucleolar proteins, MYBBP1A, RPL5, and RPL11, involved in p53 acetylation and accumulation. MYBBP1A was tethered to the nucleolus through nucleolar RNA. When rRNA transcription was suppressed by nucleolar stress, MYBBP1A translocated to the nucleoplasm and facilitated p53–p300 interaction to enhance p53 acetylation. We also found that RPL5 and RPL11 were required for rRNA export from the nucleolus. Depletion of RPL5 or RPL11 blocked rRNA export and counteracted reduction of nucleolar RNA levels caused by inhibition of rRNA transcription. As a result, RPL5 or RPL11 depletion inhibited MYBBP1A translocation and p53 activation. Our observations indicated that a dynamic equilibrium between RNA generation and export regulated nucleolar RNA content. Perturbation of this balance by nucleolar stress altered the nucleolar RNA content and modulated p53 activity. PMID:21297583
Survivin inhibits anti-growth effect of p53 activated by aurora B
International Nuclear Information System (INIS)
Jung, Ji-Eun; Kim, Tae-Kyung; Lee, Joong-Seob; Oh, Se-Yeong; Kwak, Sungwook; Jin, Xun; Sohn, Jin-Young; Song, Min-Keun; Sohn, Young-Woo; Lee, Soo-Yeon; Pian, Xumin; Lee, Jang-Bo; Chung, Yong Gu; Choi, Young Ki; You, Seungkwon; Kim, Hyunggee
2005-01-01
Genomic instability and apoptosis evasion are hallmarks of cancer, but the molecular mechanisms governing these processes remain elusive. Here, we found that survivin, a member of the apoptosis-inhibiting gene family, and aurora B kinase, a chromosomal passenger protein, were co-overexpressed in the various glioblastoma cell lines and tumors. Notably, exogenous introduction of the aurora B in human BJ cells was shown to decrease cell growth and increase the senescence-associated β-galactosidase activity by activation of p53 tumor suppressor. However, aurora B overexpression failed to inhibit cell proliferation in BJ and U87MG cells transduced with dominant-negative p53 as well as in p53 -/- mouse astrocytes. Aurora B was shown to increase centrosome amplification in the p53 -/- astrocytes. Survivin was shown to induce anchorage-independent growth and inhibit anti-proliferation and drug-sensitive apoptosis caused by aurora B. Overexpression of both survivin and aurora B further accelerated the proliferation of BJ cells. Taken together, the present study indicates that survivin should accelerate tumorigenesis by inhibiting the anti-proliferative effect of p53 tumor suppressor that is activated by aurora B in normal and glioblastoma cells containing intact p53
ER, p53 and MIB-1 are significantly associated with malignant phyllodes tumor
Directory of Open Access Journals (Sweden)
Nurhayati H Munawer
2012-12-01
Full Text Available Background: Phyllodes tumors (PT are rare. We evaluated the expression status of ER, Bcl2, p53, and MIB-1 protein in these tumors. Methods: One hundred and ninety-three tumors were examined using immunohistochemistry on tissue microarray. Results: ERβ (p <0.001, and p53 (p=0.006 in the stromal component were associated with tumor size. p53 expression was significantly associated with both epithelial and stromal components of malignant PTs (p<0.05. In PT, the decreased expressions of p53 and MIB-1 were significantly different with positive Bcl2 protein expression in epithelial component (p=0.000. Besides, MIB-1 was also found to be associated with ERα and ERβ in stromal component (p=0.000. Conclusion: The expression of p53 with tumor size and histological grade in PTs may increase risk for malignancy.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage
International Nuclear Information System (INIS)
Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru
2005-01-01
The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR
Polymorphism at codon 36 of the p53 gene.
Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A
1994-01-01
A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.
Energy Technology Data Exchange (ETDEWEB)
Sun, Lin [West Biostatistics and Cost-effectiveness Research Center, Medical Insurance Office, West China Hospital of Sichuan University, 610041, Sichuan (China); Li, Yu [Department of Anesthesiology, West China Hospital, Sichuan University, 610041, Sichuan (China); Yang, Bangxiang, E-mail: b19933009@qq.coom [Department of Pain Management, West China Hospital of Sichuan University, 610041, Sichuan (China)
2016-09-09
Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition of proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.
Directory of Open Access Journals (Sweden)
Nyiraneza Christine
2012-06-01
Full Text Available Abstract Background It has been suggested that inactivation of p14ARF, a tumor suppressor central to regulating p53 protein stability through interaction with the MDM2 oncoprotein, abrogates p53 activity in human tumors retaining the wild-type TP53 gene. Differences in expression of tumor suppressor genes are frequently associated with cancer. We previously reported on a pattern of restricted p53 immunohistochemical overexpression significantly associated with microsatellite instability (MSI, low TP53 mutation frequency, and MDM2 overexpression in colorectal cancers (CRCs. In this study, we investigated whether p14ARF alterations could be a mechanism for disabling the p53 pathway in this subgroup of CRCs. Results Detailed maps of the alterations in the p14ARF gene were determined in a cohort of 98 CRCs to detect both nucleotide and copy-number changes. Methylation-specific PCR combined with bisulfite sequencing was used to evaluate the prevalence and distribution of p14ARF methylation. p14ARF alterations were then correlated with MSI status, TP53 mutations, and immunohistochemical expression of p53 and MDM2. The frequency of p14ARF mutations was extremely low (1/98; 1%, whereas coexistence of methylated and unmethylated alleles in both tumors and normal colon mucosa was common (91/98; 93%. Only seven of ninety-eight tumors (7% had a distinct pattern of methylation compared with normal colon mucosa. Evaluation of the prevalence and distribution of p14ARF promoter methylation in a region containing 27 CpG sites in 35 patients showed a range of methylated CpG sites in tumors (0 to 25 (95% CI 1 to 13 versus 0 to 17 (95% CI 0 to 2 in adjacent colon mucosa (P = 0.004. Hypermethylation of the p14ARF promoter was significantly correlated with the restricted p53 overexpression pattern (P = 0.03, and MDM2 overexpression (P = 0.02, independently of MSI phenotype. Although no significant correlation between p14ARF methylation and TP53 mutational
Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.
Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E
2014-07-01
Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.
Shahrami, Seyedeh Hajar; Abbasi Ranjbar, Zahra; Milani, Forozan; Kezem-Nejad, Ehsan; Hassanzadeh Rad, Afagh; Dalil Heirat, Seyedeh Fatemeh
2016-02-01
Critical issue regarding to variation of findings based on different phenotypes led investigators to define whether they are distinct features or overlapping ones. Therefore, we aimed to investigate the association between diverse phenotypes of PCOS (Poly Cystic Ovary Syndrome) with clinical manifestations, anthropometric indices, and metabolic characteristics. This was a descriptive cross-sectional study conducted in 15-39 years old women with PCOS referred to infertility clinics in the north part of Iran, Rasht during 2010-2011. Data were gathered through an interview by a form consisted of demographic characteristics, laboratory findings, ovarian volume and anthropometric indices. A total of 214 patients consisted of 161 PCOS (cases) and 53 normal women (controls) participated in this study. The most prevalent phenotype in PCOS population was IM/PCO/HA (54%), followed by IM/HA (28%) and IM/PCO (13%). PCO/HA was present only in 6 PCOS patients (5%). PCOS patients were significantly younger than controls (P=0.07). Results showed that increased ovarian volume were higher in PCOS group in comparison with controls and IM/PCO/HA, and IM/PCO had respectively the largest ovarian volumes. Also, a significant relation was observed based on Cholesterol, 17OHP, LH, TG, 2hpp, and LH/FSH between patients with PCOS and control groups. There were significant differences in demographic, anthropometric, hormonal and ultrasound findings between PCOS and controls. Therefore, it seems that classification of the characteristics of each phenotype could offer an appropriate guide for screening risks of PCOS and may facilitate performing most favorable treatment for these complications.
Differential programming of p53-deficient embryonic cells during rotenone block
Mitochondrial dysfunction has been implicated in chemical toxicities. The present study used an in vitro model to investigate the differential expression of metabolic pathways during cellular stress in p53- efficient embryonic fibroblasts compared to p53-deficient cells. These c...
HER-2 positive and p53 negative breast cancers are associated with poor prognosis.
LENUS (Irish Health Repository)
2011-06-01
p53 and HER-2 coexpression in breast cancer has been controversial. These markers were tested using immunohistochemistry and HercepTest. HER-2 expression is related to reduced breast cancer survival (p = .02) . p53 expression relates to HER-2 expression (p = .029). Coexpression between p53 and HER-2 has no relation to prognosis. On univariate and multivariate analysis, combination of HER-2 positive and p53 negative expression was associated with a poor prognosis (p = .018 and p = .027, respectively), while the combination of HER-2 negative and p53 positive expression was associated with a favorable prognosis (p = .022 and p = .010, respectively). Therefore the expression of these markers should be considered collectively.
HER-2 positive and p53 negative breast cancers are associated with poor prognosis.
LENUS (Irish Health Repository)
2012-02-01
p53 and HER-2 coexpression in breast cancer has been controversial. These markers were tested using immunohistochemistry and HercepTest. HER-2 expression is related to reduced breast cancer survival (p = .02) . p53 expression relates to HER-2 expression (p = .029). Coexpression between p53 and HER-2 has no relation to prognosis. On univariate and multivariate analysis, combination of HER-2 positive and p53 negative expression was associated with a poor prognosis (p = .018 and p = .027, respectively), while the combination of HER-2 negative and p53 positive expression was associated with a favorable prognosis (p = .022 and p = .010, respectively). Therefore the expression of these markers should be considered collectively.
Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.
Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi
2018-05-18
The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.
Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry
International Nuclear Information System (INIS)
Cavalcanti, M.B.; Fernandes, T.S.; Melo, J.A.; Neves, M.A.B.; Machado, C.G.F
2005-01-01
Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10 6 /mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO 2 at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results obtained
Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry
Energy Technology Data Exchange (ETDEWEB)
Cavalcanti, M.B.; Fernandes, T.S. [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear; Amaral, A. [Universite Paris XII (UPXII) (France); Melo, J.A. [Centro de Radioterapia de Pernambuco (CERAPE), PE (Brazil); Neves, M.A.B.; Machado, C.G.F, E-mail: maribrayner@yahoo.com.br [Fundacao de Hematologia e Hemoterapia de Pernambuco, PE (Brazil)
2005-07-01
Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10{sub 6}/mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO{sub 2} at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results
Directory of Open Access Journals (Sweden)
Tayebeh Hamzehloie
2012-03-01
Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.
Integral analysis of p53 and its value as prognostic factor in sporadic colon cancer
International Nuclear Information System (INIS)
Fariña Sarasqueta, Arantza; Morreau, Hans; Forte, Giusi; Corver, Wim E; Miranda, Noel F de; Ruano, Dina; Eijk, Ronald van; Oosting, Jan; Tollenaar, Rob AEM; Wezel, Tom van
2013-01-01
p53 (encoded by TP53) is involved in DNA damage repair, cell cycle regulation, apoptosis, aging and cellular senescence. TP53 is mutated in around 50% of human cancers. Nevertheless, the consequences of p53 inactivation in colon cancer outcome remain unclear. Recently, a new role of p53 together with CSNK1A1 in colon cancer invasiveness has been described in mice. By combining data on different levels of p53 inactivation, we aimed to predict p53 functionality and to determine its effects on colon cancer outcome. Moreover, survival effects of CSNK1A1 together with p53 were also studied. Eighty-three formalin fixed paraffin embedded colon tumors were enriched for tumor cells using flow sorting, the extracted DNA was used in a custom SNP array to determine chr17p13-11 allelic state; p53 immunostaining, TP53 exons 5, 6, 7 and 8 mutations were determined in combination with mRNA expression analysis on frozen tissue. Patients with a predicted functional p53 had a better prognosis than patients with non functional p53 (Log Rank p=0.009). Expression of CSNK1A1 modified p53 survival effects. Patients with low CSNK1A1 expression and non-functional p53 had a very poor survival both in the univariate (Log Rank p<0.001) and in the multivariate survival analysis (HR=4.74 95% CI 1.45 – 15.3 p=0.009). The combination of mutational, genomic, protein and downstream transcriptional activity data predicted p53 functionality which is shown to have a prognostic effect on colon cancer patients. This effect was specifically modified by CSKN1A1 expression
International Nuclear Information System (INIS)
Schwartz, Jeffrey L.; Tamura, Yasuko; Jordan, Robert; Grierson, John R.; Krohn, Kenneth A.
2004-01-01
The use of thymidine (TdR) and thymidine analogs such as 3'-deoxy-3'-fluorothymidine (FLT) as positron emission tomography (PET)-based tracers of tumor proliferation rate is based on the hypothesis that measurement of uptake of these nucleosides, a function primarily of thymidine kinase-1 (TK 1 ) activity, provides an accurate measure of cell proliferation in tumors. Tumor growth is influenced by many factors including the oxygen concentration within tumors and whether tumor cells have been exposed to cytotoxic therapies. The p53 gene plays an important role in regulating growth under both of these conditions. The goal of this study was to investigate the influence of p53 activation on cell growth, TK 1 activity, and FLT uptake. To accomplish this, TK 1 activity, S phase fraction, and the uptake of FLT were determined in plateau-phase and exponentially growing cultures of an isogenic pair of human tumor cell lines in which p53 expression was normal or inactivated by human papilloma virus type 16 E6 expression. Ionizing radiation exposure was used to stimulate p53 activity and to induce alterations in cell cycle progression. We found that exposure of cells to ionizing radiation induced dose-dependent changes in cell cycle progression in both cell lines. The relationship between S phase percentage, TK 1 activity, and FLT uptake were essentially unchanged in the p53-normal cell line. In contrast, TK 1 activity and FLT uptake remained high in the p53-deficient variant even when S phase percentage was low due to a p53-dependent G2 arrest. We conclude that a functional p53 response is required to maintain the normal relationship between TK1 activity and S phase percentage following radiation exposure
Armitage, Mark
Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
International Nuclear Information System (INIS)
Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.
2011-01-01
Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
Energy Technology Data Exchange (ETDEWEB)
Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.
G2-block after irradiation of cells with different p53 status
Energy Technology Data Exchange (ETDEWEB)
Zoelzer, Friedo [University of South Bohemia in Ceske Budejovice, Department of Radiology, Toxicology and Civil Protection, Faculty of Health and Social Studies, Ceske Budejovice (Czech Republic); University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Jagetia, Ganesh [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany); Mizoram University, Department of Zoology, School of Life Sciences, Aizawl (India); Streffer, Christian [University Duisburg-Essen, Institute of Medical Radiobiology, Medical Faculty, Essen (Germany)
2014-11-15
Although it is clear that functional p53 is not required for radiation-induced G{sub 2} block, certain experimental findings suggest a role for p53 in this context. For instance, as we also confirm here, the maximum accumulation in the G{sub 2} compartment after X-ray exposure occurs much later in p53 mutants than in wild types. It remains to be seen, however, whether this difference is due to a longer block in the G{sub 2} phase itself. We observed the movement of BrdU-labeled cells through G{sub 2} and M into G{sub 1}. From an analysis of the fraction of labeled cells that entered the second posttreatment cell cycle, we were able to determine the absolute duration of the G{sub 2} and M phases in unirradiated and irradiated cells. Our experiments with four cell lines, two melanomas and two squamous carcinomas, showed that the radiation-induced delay of transition through the G{sub 2} and M phases did not correlate with p53 status. We conclude that looking at the accumulation of cells in the G{sub 2} compartment alone is misleading when differences in the G{sub 2} block are investigated and that the G{sub 2} block itself is indeed independent of functional p53. (orig.) [German] Obwohl klar ist, dass ein funktionelles p53-Protein fuer die Ausbildung des strahleninduzierten G{sub 2}-Blocks nicht zwingend erforderlich ist, gibt es experimentelle Befunde, die nahe legen, dass p53 in diesem Zusammenhang doch eine gewisse Rolle spielt. Zum Beispiel bestaetigen wir hier fruehere Berichte, dass die Akkumulation von Zellen im G{sub 2}-Kompartiment bei p53-Mutanten deutlich spaeter nach Bestrahlung ihr Maximum erreicht als bei p53-Wildtypen. Es bleibt jedoch zu klaeren, ob dieser Unterschied seinen Grund in einem laengeren Block der G{sub 2}-Phase selbst hat. Beobachtet wurde die Bewegung von BrdU-markierten Zellen durch G{sub 2} und M nach G{sub 1}. Aus der zeitlichen Veraenderung des Anteils markierter Zellen im G{sub 1}-Kompartiment des naechsten Zellzyklus konnte die
Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.
Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer
2016-03-01
The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.
The role of p53 in radiation therapy outcomes for favorable-to-intermediate-risk prostate cancer
International Nuclear Information System (INIS)
Ritter, Mark A.; Gilchrist, Kennedy W.; Voytovich, Marta; Chappell, Richard J.; Verhoven, Bret M.
2002-01-01
Purpose: Some prostate cancers may have molecular alterations that render them less responsive to radiation therapy; identification of these alterations before treatment might allow improved treatment optimization. This study investigated whether p53, a potential molecular determinant, could predict long-term radiation therapy outcome in a restricted group of relatively favorable-risk prostate cancer patients treated uniformly with irradiation alone. Methods and Materials: This study included 53 patients previously treated with radiotherapy for favorable-to-intermediate-risk prostate cancer. These patients were selected for relatively low pretreatment PSAs (≤21 ng/mL) and Gleason scores (≤7) to decrease the likelihood of nonlocalized disease, because disease localization was necessary to examine the efficacy of localized radiation therapy. The status of p53 was immunohistochemically assessed in paraffin-embedded pretreatment biopsy specimens, along with appropriate controls. This marker was selected based upon a usable mutation prevalence in early-stage prostate cancer and its potential linkage with radiation response via cell cycle, DNA repair, and cell death pathways. Correlation between p53 mutation and clinical outcome was analyzed in univariate and multivariate fashion and included conventional prognosticators, such as stage, grade, and PSA. Freedom from biochemical failure was determined using American Society for Therapeutic Radiology and Oncology criteria. Limitations of prior studies were potentially avoided by requiring adequate posttreatment follow-up (median follow-up in nonfailing patients of 5.1 years), as well as pretreatment PSA and Gleason scores that suggested localized disease, and uniformity of treatment. Results: The total group of 53 favorable-to-intermediate-risk patients demonstrated an actuarial biochemical failure rate of 35% at 5 years. Forty percent of all specimens had a greater than 10% labeling index for p53 mutation, and
DEFF Research Database (Denmark)
Scheel, Andreas Hans Joachim; Beyer, Ulrike; Agami, Reuven
2009-01-01
The tumor suppressor homologue p63 is required for proper skin and limb development, but specific isoforms of it also act as a "guardian of the germline." To gain insight into the regulation of p63 expression, we performed immunofluorescence-based screening assays. Using a large collection of micro...
Electrophoretic detection of protein p53 in human leukocytes
International Nuclear Information System (INIS)
Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.
1986-01-01
The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients
A Phenotypic Screen for Functional Mutants of Human Adenosine Deaminase Acting on RNA 1.
Wang, Yuru; Havel, Jocelyn; Beal, Peter A
2015-11-20
Adenosine deaminases acting on RNA (ADARs) are RNA-editing enzymes responsible for the conversion of adenosine to inosine at specific locations in cellular RNAs. ADAR1 and ADAR2 are two members of the family that have been shown to be catalytically active. Earlier, we reported a phenotypic screen for the study of human ADAR2 using budding yeast S. cerevisiae as the host system. While this screen has been successfully applied to the study of ADAR2, it failed with ADAR1. Here, we report a new reporter that uses a novel editing substrate and is suitable for the study of ADAR1. We screened plasmid libraries with randomized codons for two important residues in human ADAR1 (G1007 and E1008). The screening results combined with in vitro deamination assays led to the identification of mutants that are more active than the wild type protein. Furthermore, a screen of the ADAR1 E1008X library with a reporter construct bearing an A•G mismatch at the editing site suggests one role for the residue at position 1008 is to sense the identity of the base pairing partner for the editing site adenosine. This work has provided a starting point for future in vitro evolution studies of ADAR1 and led to new insight into ADAR's editing site selectivity.
Essentials in clinical application of p53 for tumors intervention-example of liver cancer
International Nuclear Information System (INIS)
Guan Yongsong; He Qing
2008-01-01
Recombinant human adenovirus p53 (Ad-p53)injection has been used for treating tumors in combination with several local therapeutic methods. Taking liver cancer as an example, this article introduces the combination of Ad-p53 in procedures of interventional therapy. Mechanisms of their effects are emphasized to pursue an optimal synergism in killing tumors. Intratumoral injection is suggested as the first choice of Ad- p53 administration with the least recommended dosage for a single tumor. The optimal time for intervention of liver cancer is supposed to be 2 to 5 days after the administration of Ad-p53. There are several theories on the therapeutic method taking p53 as a target, some of them are contradictional; therefore one has to select either activating or inhibiting the p53 pathway beforehand. For advanced malignancies, the selection should be cautious for appropriater cases from the proper candidates. (authors)
International Nuclear Information System (INIS)
Che Mingxin; DeSilvio, Michelle; Pollack, Alan; Grignon, David J.; Venkatesan, Varagur Mohan; Hanks, Gerald E.; Sandler, Howard M.
2007-01-01
Purpose: The goal of this study was to verify the significance of p53 as a prognostic factor in Radiation Therapy Oncology Group 9202, which compared short-term androgen deprivation (STAD) with radiation therapy (RT) to long-term androgen deprivation + RT in men with locally advanced prostate cancer (Pca). Methods and Materials: Tumor tissue was sufficient for p53 analysis in 777 cases. p53 status was determined by immunohistochemistry. Abnormal p53 expression was defined as 20% or more tumor cells with positive nuclei. Univariate and multivariate Cox proportional hazards models were used to evaluate the relationships of p53 status to patient outcomes. Results: Abnormal p53 was detected in 168 of 777 (21.6%) cases, and was significantly associated with cause-specific mortality (adjusted hazard ratio [HR] = 1.89; 95% confidence interval (CI) 1.14 - 3.14; p = 0.014) and distant metastasis (adjusted HR = 1.72; 95% CI 1.13-2.62; p = 0.013). When patients were divided into subgroups according to assigned treatment, only the subgroup of patients who underwent STAD + RT showed significant correlation between p53 status and cause-specific mortality (adjusted HR = 2.43; 95% CI = 1.32-4.49; p = 0.0044). When patients were divided into subgroups according to p53 status, only the subgroup of patients with abnormal p53 showed significant association between assigned treatment and cause-specific mortality (adjusted HR = 3.81; 95% CI 1.40-10.37; p = 0.0087). Conclusions: Abnormal p53 is a significant prognostic factor for patients with prostate cancer who undergo short-term androgen deprivation and radiotherapy. Long-term androgen deprivation may significantly improve the cause-specific survival for those with abnormal p53
Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction
Directory of Open Access Journals (Sweden)
Louis Chesler
2008-11-01
Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.
p53 Mutagenesis by Benzo[a]pyrene derived Radical Cations
Sen, Sushmita; Bhojnagarwala, Pratik; Francey, Lauren; Lu, Ding; Jeffrey Field, Trevor M. Penning
2013-01-01
Benzo[a]pyrene (B[a]P), a major human carcinogen in combustion products such as cigarette smoke and diesel exhaust, is metabolically activated into DNA-reactive metabolites via three different enzymatic pathways. The pathways are the anti-(+)-benzo[a]pyrene 7,8-diol 9, 10-epoxide pathway (P450/ epoxide hydrolase catalyzed) (B[a]PDE), the benzo[a]pyrene o-quinone pathway (aldo ketose reductase (AKR) catalyzed) and the B[a]P radical cation pathway (P450 peroxidase catalyzed). We used a yeast p53 mutagenesis system to assess mutagenesis by B[a]P radical cations. Because radical cations are short-lived, they were generated in situ by reacting B[a]P with cumene hydroperoxide (CuOOH) and horse radish peroxidase (HRP) and then monitoring the generation of the more stable downstream products, B[a]P-1,6-dione and B[a]P-3,6-dione. Based on the B[a]P-1,6 and 3,6-dione formation, approximately 4µM of radical cation was generated. In the mutagenesis assays, the radical cations produced in situ showed a dose-dependent increase in mutagenicity from 0.25 µM to 10 µM B[a]P with no significant increase seen with further escalation to 50 µM B[a]P. However, mutagenesis was 200-fold less than with the AKR pathway derived B[a]P, 7–8 dione. Mutant p53 plasmids, which yield red colonies, were recovered from the yeast to study the pattern and spectrum of mutations. The mutation pattern observed was G to T (31%) > G to C (29%) > G to A (14%). The frequency of codons mutated by the B[a]P radical cations was essentially random and not enriched at known cancer hotspots. The quinone products of radical cations, B[a]P-1,6-dione and B[a]P-3,6-dione were more mutagenic than the radical cation reactions, but still less mutagenic than AKR derived B[a]P-7,8-dione. We conclude that B[a]P radical cations and their quinone products are weakly mutagenic in this yeast-based system compared to redox cycling PAH o-quinones. PMID:22768918
Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.
Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles
2006-10-16
The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.
Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma
International Nuclear Information System (INIS)
Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.
2014-01-01
Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)
GTPBP4 Promotes Gastric Cancer Progression via Regulating P53 Activity
Directory of Open Access Journals (Sweden)
Li Li
2018-01-01
Full Text Available Background/Aims: gastric cancer is a serious health concern with high morbidity and mortality. Therefore, it is urgent to find novel targets for gastric cancer diagnosis and treatment. Methods: qRT-PCR and immunohistochemistry assays were used to detect GTPBP4 expression in gastric cancer tissues, and gastric cancer and gastric epithelial cells. Lentivirus infection was used to construct GTPBP4 stable knockdown cells. Annexin V/PI apoptosis, CCK8, EdU incorporation and cell clone formation analysis were performed to evaluate the effects of GTPBP4 on gastric cancer cell proliferation and apoptosis. Further RNA-based high-throughput sequencing and co-IP assays were constructed to explore the related mechanisms contributing to GTPBP4-mediated effects. Results: GTPBP4 expression was significantly increased in gastric cancer tissues compared with that in adjacent normal tissues, and positively correlated with gastric cancer stages. Meanwhile, GTPBP4 level was markedly upregulated in gastric cancer cells than in gastric epithelial cells. Additionaly, stable knockdown of GTPBP4 inhibited cell proliferation and promoted cell apoptosis. Mechanistically, p53 and its related signaling were significantly activated in GTPBP4 stable knockdown cells. And GTPBP4 interacted with p53 in gastric cancer cells. Conclusions: our results provide insights into mechanistic regulation and linkage of the GTPBP4-p53 in gastric cancer, and also a valuable potential target for gastric cancer.
p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer
DEFF Research Database (Denmark)
Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F
2014-01-01
The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....
Ruijs, M.W.G.; Verhoef, S.; Rookus, M.A.; Pruntel, R.; van der Hout, A.H.; Hogervorst, F.B.L.; Kluijt, I.; Sijmons, R.H.; Aalfs, C.M.; Wagner, A.; Ausems, M.G.E.M.; Hoogerbrugge, N.; van Asperen, C.J.; Gómez García, E.B.; Meijers-Heijboer, H.; ten Kate, L.P.; Menko, F.H.; van 't Veer, L.J.
2010-01-01
Background Li-Fraumeni syndrome (LFS) is a rare autosomal dominant cancer predisposition syndrome. Most families fulfilling the classical diagnostic criteria harbour TP53 germline mutations. However, TP53 germline mutations may also occur in less obvious phenotypes. As a result, different criteria
Cell surface area and membrane folding in glioblastoma cell lines differing in PTEN and p53 status.
Directory of Open Access Journals (Sweden)
Simon Memmel
Full Text Available Glioblastoma multiforme (GBM is characterized by rapid growth, invasion and resistance to chemo-/radiotherapy. The complex cell surface morphology with abundant membrane folds, microvilli, filopodia and other membrane extensions is believed to contribute to the highly invasive behavior and therapy resistance of GBM cells. The present study addresses the mechanisms leading to the excessive cell membrane area in five GBM lines differing in mutational status for PTEN and p53. In addition to scanning electron microscopy (SEM, the membrane area and folding were quantified by dielectric measurements of membrane capacitance using the single-cell electrorotation (ROT technique. The osmotic stability and volume regulation of GBM cells were analyzed by video microscopy. The expression of PTEN, p53, mTOR and several other marker proteins involved in cell growth and membrane synthesis were examined by Western blotting. The combined SEM, ROT and osmotic data provided independent lines of evidence for a large variability in membrane area and folding among tested GBM lines. Thus, DK-MG cells (wild type p53 and wild type PTEN exhibited the lowest degree of membrane folding, probed by the area-specific capacitance C m = 1.9 µF/cm(2. In contrast, cell lines carrying mutations in both p53 and PTEN (U373-MG and SNB19 showed the highest C m values of 3.7-4.0 µF/cm(2, which corroborate well with their heavily villated cell surface revealed by SEM. Since PTEN and p53 are well-known inhibitors of mTOR, the increased membrane area/folding in mutant GBM lines may be related to the enhanced protein and lipid synthesis due to a deregulation of the mTOR-dependent downstream signaling pathway. Given that membrane folds and extensions are implicated in tumor cell motility and metastasis, the dielectric approach presented here provides a rapid and simple tool for screening the biophysical cell properties in studies on targeting chemo- or radiotherapeutically the
CD40-mediated apoptosis in murine B-lymphoma lines containing mutated p53
DEFF Research Database (Denmark)
Hollmann, Annette C; Gong, Qiaoke; Owens, Trevor
2002-01-01
Crosslinking CD40 induces normal B-cells to proliferate and differentiate but causes many tumor cell lines to undergo apoptosis. As p53 is required for many apoptotic pathways, we analyzed the effects of CD40 ligation and their correlation with p53 function in four murine B-lymphoma lines. A20...... of detectable p21 mRNA in A20 and M12 cells. P21 mRNA was increased to detectable levels in M12 cells upon CD40 ligation; however, blocking this effect with the p53 inhibitor pifithrin had no effect on CD40-mediated apoptosis. Sequencing showed that p53 in A20 and M12 cells contained point mutations leading...... to amino acid substitutions in DNA binding regions, but was unmutated in WEHI231 and WEHI 279. These results suggest that CD40-mediated apoptosis can occur in the absence of functional p53....
The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances
International Nuclear Information System (INIS)
Zawacka-Pankau, Joanna; Krachulec, Justyna; Grulkowski, Ireneusz; Bielawski, Krzysztof P.; Selivanova, Galina
2008-01-01
Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT
Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy
Directory of Open Access Journals (Sweden)
Christian M. Simon
2017-12-01
Full Text Available The hallmark of spinal muscular atrophy (SMA, an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons.
Prognosis for Survival of Young Women with Breast Cancer by Quantitative p53 Immunohistochemistry
Axelrod, David E.; Shah, Kinsuk; Yang, Qifeng; Haffty, Bruce G.
2015-01-01
p53 protein detected immunohistochemically has not been accepted as a biomarker for breast cancer patients because of disparate reports of the relationship between the amount of p53 protein detected and patient survival. The purpose of this study was to determine experimental conditions and methods of data analysis for which p53 stain intensity could be prognostic for survival of young breast cancer patients. A tissue microarray of specimens from 93 patients was stained with anti-p53 antibody, and stain intensity measured with a computer-aided image analysis system. A cut-point at one standard deviation below the mean of the distribution of p53 stain intensity separated patients into two groups with significantly different survival. These results were confirmed by Quantitative Nuclear Grade determined by DNA-specific Feulgen staining. P53 provided information beyond ER and PR status. Therefore, under the conditions reported here, p53 protein can be an effective prognostic factor for young breast cancer patients. PMID:26322145
Alexandrova, A; Ivanov, A; Chumakov, P; Kopnin, B; Vasiliev, J
2000-11-23
Effects of p53 expression on cell morphology and motility were studied using the derivatives of p53-null 10(1) mouse fibroblasts with tetracycline-regulated expression of exogenous human p53. Induction of p53 expression was accompanied by significant decrease in extracellular matrix (fibronectin) and reduction of matrix fibrils, diminution of the number and size of focal contacts, decrease of cell areas, establishment of more elongated cell shape and alterations of actin cytoskeleton (actin bundles became thinner, their number and size decreased). Expression of His175 and Gln22/ Ser23 p53 mutants caused no such effects. To study the influence of p53 expression on cell motility we used wound technique and videomicroscopy observation of single living cells. It was found that induction of p53 expression led to increase of lamellar activity of cell edge. However, in spite of enhanced lamellar activity p53-expressing cells migrated to shorter distance and filled the narrow wound in longer time as compared with their p53-null counterparts. Possible mechanisms of the influence of p53 expression on cell morphology and motility are discussed.
Directory of Open Access Journals (Sweden)
J.V. Moro
2010-04-01
Full Text Available The expression of p53 protein was evaluated in canine transmissible venereal tumor (CTVT, as following: natural occurrence (n=8; resistant to chemotherapy (n=4; and allogeneic transplanted in progression (n=8, stable (n=8, and regression (n=8stages. The collected specimens were submitted to GM1 immunohistochemical reaction. Results showed a mean percentage of immunomarked cells around 18.6% in CTVT of natural occurrence, 23.8% in CTVT resistant to chemotherapy, 22.9% in allogeneic transplanted CTVT in both progression and stable stages, and 35.8% in transplanted CTVT in regression stage. The results suggest that there is a functional abnormality in p53 gene and its products in the studied tumors; although, it is not possible to correlate the percentage of cells marked by p53 and a prognosis.A expressão da proteína p53 foi avaliada em espécimes de tumor venéreo transmissível canino (TVT de ocorrência natural (n=8; resistente à quimioterapia (n=4 e transplantado em cão nas fases de progressão tumoral (n=8, de latência (n=8 e de regressão (n=8. Os espécimes foram submetidos à reação de imunoistoquímica. Os resultados mostraram porcentagem média de células imunomarcadas de 18,6% no TVT de ocorrência natural, de 23,8% no TVT refratário, 22,9% nos TVTs transplantados nas fases de progressão e latência e de 35,8% na fase de regressão. Os resultados sugerem que há uma anormalidade funcional no gene P53 e seus produtos nos tumores estudados, apesar de não ser possível correlacionar a porcentagem de células marcadas pelo p53 ao prognóstico.
p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells
International Nuclear Information System (INIS)
Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd; Groesch, Sabine
2008-01-01
S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53 wt ) or being p(HCT-116 p53 -/- ), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53 -/- xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53 wt cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53 wt cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75 NTR , p53 and Bax
COX-2 and p53 in human sinonasal cancer
DEFF Research Database (Denmark)
Holmila, Reetta; Cyr, Diane; Luce, Danièle
2008-01-01
The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...
Arecoline-induced growth arrest and p21WAF1 expression are dependent on p53 in rat hepatocytes
International Nuclear Information System (INIS)
Chou, W.-W.; Guh, J.-Y.; Tsai, J.-F.; Hwang, C.-C.; Chen, H.-C.; Huang, J.-S.; Yang, Y.-L.; Hung, W.-C.; Chuang, L.-Y.
2008-01-01
Betel-quid use is associated with the risk of liver cirrhosis and hepatocellular carcinoma and arecoline, the major alkaloid of betel-quid, is hepatotoxic in mice. Therefore, we studied the cytotoxic and genotoxic effects of arecoline in normal rat hepatocytes (Clone-9 cells). Arecoline dose-dependently (0.1-1 mM) decreased cell cycle-dependent proliferation while inducing DNA damage at 24 h. Moreover, arecoline (1 mM)-induced apoptosis and necrosis at 24 h. Arecoline dose-dependently (0.1-0.5 mM) increased transforming growth factor-β (TGF-β) mRNA, gene transcription and bioactivity and neutralizing TGF-β antibody attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. Arecoline (0.5 mM) also increased p21 WAF1 protein expression and p21 WAF1 gene transcription. Moreover, arecoline (0.5 mM) time-dependently (8-24 h) increased p53 serine 15 phosphorylation. Pifithrin-α (p53 inhibitor) and the loss of the two p53-binding elements in the p21 WAF1 gene promoter attenuated arecoline-induced p21 WAF1 gene transcription at 24 h. Pifithrin-α also attenuated arecoline (0.5 mM)-inhibited cell proliferation at 24 h. We concluded that arecoline induces cytotoxicity, DNA damage, G 0 /G 1 cell cycle arrest, TGF-β1, p21 WAF1 and activates p53 in Clone-9 cells. Moreover, arecoline-induced p21 WAF1 is dependent on p53 while arecoline-inhibited growth is dependent on both TGF-β and p53
Butein activates p53 in hepatocellular carcinoma cells via blocking MDM2-mediated ubiquitination
Directory of Open Access Journals (Sweden)
Zhou Y
2018-04-01
Full Text Available Yuanfeng Zhou,1,2 Kuifeng Wang,2 Ni Zhou,2 Tingting Huang,2 Jiansheng Zhu,2 Jicheng Li1 1Institute of Cell Biology, Zhejiang University, Hangzhou, People’s Republic of China; 2Department of Infectious Diseases, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou, People’s Republic of China Introduction: In this study, we aimed to investigate the effect of butein on p53 in hepatocellular carcinoma (HCC cells and the related molecular mechanisms by which p53 was activated. Methods: MTS assay and clonogenic survival assay were used to examine the antitumor activity of butein in vitro. Reporter gene assay was adopted to evaluate p53 transcriptional activity. Flow cytometry and western blotting were performed to study apoptosis induction and protein expression respectively. Xenograft model was applied to determine the in vivo efficacy and the expression of p53 in tumor tissue was detected by immunohistochemistry. Results: HCC cell proliferation and clonogenic survival were significantly inhibited after butein treatment. With the activation of cleaved-PARP and capsase-3, butein induced apoptosis in HCC cells in a dose-dependent manner. The transcriptional activity of p53 was substantially promoted by butein, and the expression of p53-targeted gene was increased accordingly. Mechanism studies demonstrated that the interaction between MDM2 and p53 was blocked by butein and MDM2-mediated p53 ubiquitination was substantially decreased. Short-hairpin RNA experiment results showed that the sensitivity of HCC cells to butein was substantially impaired after p53 was knocked down and butein-induced apoptosis was dramatically decreased. In vivo experiments validated substantial antitumor efficacy of butein against HepG2 xenograft growth, and the expression of p53 in butein-treated tumor tissue was significantly increased. Conclusion: Butein demonstrated potent antitumor activities in HCC by activating p53, and butein or its analogs had
Role of Peroxiredoxin I in Rectal Cancer and Related to p53 Status
International Nuclear Information System (INIS)
Chen, Miao-Fen; Lee, Kuan-Der; Yeh, Chung-Hung; Chen, Wen-Cheng; Huang, Wen-Shih; Chin, Chih-Chien; Lin, Paul- Yang; Wang, Jeng-Yi
2010-01-01
Background: Neoadjuvant chemoradiotherapy is widely accepted for the treatment of localized rectal cancer. Although peroxiredoxin I (PrxI) and p53 have been implicated in carcinogenesis and cancer treatment, the role of PrxI and its interaction with p53 in the prognosis and treatment response of rectal cancer remain relatively unstudied. Methods and Materials: In the present study, we examined the levels of PrxI and p53 in rectal cancer patients using membrane arrays and compared them with normal population samples. To demonstrate the biologic changes after manipulation of PrxI expression, we established stable transfectants of HCT-116 (wild-type p53) and HT-29 (mutant p53) cells with a PrxI silencing vector. The predictive capacities of PrxI and p53 were also assessed by relating the immunohistochemical staining of a retrospective series of rectal cancer cases to the clinical outcome. Results: The membrane array and immunochemical staining data showed that PrxI, but not p53, was significantly associated with the tumor burden. Our immunochemistry findings further indicated that PrxI positivity was linked to a poor response to neoadjuvant therapy and worse survival. In cellular and animal experiments, the inhibition of PrxI significantly decreased tumor growth and sensitized the tumor to irradiation, as indicated by a lower capacity to scavenge reactive oxygen species and more extensive DNA damage. The p53 status might have contributed to the difference between HCT-116 and HT-29 after knockdown of PrxI. Conclusion: According to our data, the level of PrxI combined with the p53 status is relevant to the prognosis and the treatment response. We suggested that PrxI might be a new biomarker for rectal cancer.
Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef
2005-07-01
To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
Immunohistochemical positive stained p53 protein in bladder transitional cell carcinoma
Directory of Open Access Journals (Sweden)
Halimi Monireh
2009-04-01
Full Text Available Background: Molecular genetics and immunopathologic analysis of bladder cancer have shown some abnormalities in a number of genes and proteins that have been implicated in the development and progression of such tumors, mainly in the p53 pathway. Aims: To investigate the rate of positively stained p53 protein in patients with urothelial papillary carcinoma of the bladder (UCB by immunohistochemistry and its relationship with tumor grade, gender and age of the patients. Settings and Design: During the present cross-sectional study, 100 paraffin-embedded specimens of UCB, which were provided from biopsies of the bladder by transurethral access, were immunohistochemically stained and studied for p53 protein from May 2006 to May 2007 in our referral center pathology laboratory. Materials and Methods: First, 4 µm slices of paraffin sections were provided and then stained by the avidin-biotin peroxidase method. The rate of positively stained p53 protein (defined as positive nuclear staining in over 10% of the cells was assessed. This rate was also estimated and compared between grades, genders and age-related groups (< 70 years, ≥70 years. Statistical Analysis: The χ2 , Fisher′s exact test and Mann-Whitney U test were used for comparing. Results: The overall rate of positively stained specimens was 11% for nuclear p53 protein. This rate was significantly higher in females (10/29 vs. 1/71; P < 0.001; odds ratio [OR]: 0.23; 95% confidence interval [CI]: 4.43-306.08, patients with 70 or older than 70 years (8/42 vs. 3/58; P = 0.04; OR: 0.55; 95% CI: 1.07-17.39 and in high-grade tumors (10/58 vs. 1/42; P = 0.02; OR: 0.59; 95% CI: 0.01-0.95. Conclusions: The rate of positively stained p53 protein for UCB was lower in our population. This rate was also higher in females, patients with 70 or older than 70 years and high grade of UCB.
Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.
Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K
2010-12-01
Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.
Mutant p53 interactions with supercoiled DNA
Czech Academy of Sciences Publication Activity Database
Brázdová, Marie; Němcová, Kateřina; Činčárová, Lenka; Šebest, Peter; Pivoňková, Hana; Brázda, Václav; Fojta, Miroslav; Paleček, Emil
2007-01-01
Roč. 24, č. 6 (2007), s. 639-640 ISSN 0739-1102. [Alban 2007: The 15th Conversation . 19.06.2007-23.06.2007, Albany] R&D Projects: GA MŠk(CZ) 1K04119; GA ČR(CZ) GP204/06/P369; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : mutant p53 * supercoiled DNA * cancer Subject RIV: BO - Biophysics
Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.
Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen
2017-10-15
Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and
Directory of Open Access Journals (Sweden)
Anirban Chakraborty
Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.
Contribution of caspase-3 differs by p53 status in apoptosis induced by X-irradiation
International Nuclear Information System (INIS)
Kobayashi, Daisuke; Tokino, Takashi; Watanabe, Naoki
2001-01-01
We investigated the effect of p53 status on involvement of caspase-3 activation in cell death induced by X-irradiation, using rat embryonic fibroblasts (REFs) transduced with a temperature-sensitive mutant (mt) p53 gene. Cells with wild-type (wt) p53 showed greater resistance to X-irradiation than cells with mt p53. In cells with wt p53, X-irradiation-induced apoptosis was not inhibited by the caspase-3 inhibitor acetyl-L-aspartyl-L-methionyl-L-glutaminyl-L-aspartyl-aldehyde (Ac-DMQD-CHO) and caspase-3 activity was not elevated following X-irradiation, although induction of p53 and p21/WAF-1 protein was observed. In contrast, irradiated cells with mt p53 showed 89% inhibition of cell death with Ac-DMQD-CHO and 98% inhibition with the antioxidant N-acetyl-L-cysteine (NAC). In cells with mt p53, caspase-3 activity was increased approximately 5 times beyond baseline activity at 24 h after irradiation. This increase was almost completely inhibited by NAC. However, inhibition of caspase-3 by Ac-DMQD-CHO failed to decrease production of reactive oxygen species by cells with mt p53. Differential involvement of caspase-3 is a reason for differences in sensitivity to X-irradiation in cells with different p53 status. Caspase-3 activation appears to occur downstream from generation of reactive oxygen species occurring independently of wt p53 during X-irradiation-induced cell death. (author)
Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z
2012-10-01
The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.
Energy Technology Data Exchange (ETDEWEB)
Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Monti, Paola; Fronza, Gilberto [Mutagenesis Unit, Istituto di Ricerca e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, 16132 Genoa (Italy); Pereira, Clara [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Saraiva, Lucília, E-mail: lucilia.saraiva@ff.up.pt [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal)
2015-01-01
In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.
International Nuclear Information System (INIS)
Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana; Monti, Paola; Fronza, Gilberto; Pereira, Clara; Saraiva, Lucília
2015-01-01
In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73
Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function
Directory of Open Access Journals (Sweden)
Jianzhong Chen
2012-08-01
Full Text Available As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level.
Directory of Open Access Journals (Sweden)
Brandon J Walters
Full Text Available p27Kip1 is a cell cycle inhibitor that prevents cyclin dependent kinase (CDK/cyclin complexes from phosphorylating their targets. p27Kip1 is a known tumor suppressor, as the germline loss of p27Kip1 results in sporadic pituitary formation in aged rodents, and its presence in human cancers is indicative of a poor prognosis. In addition to its role in cancer, loss of p27Kip1 results in regenerative phenotypes in some tissues and maintenance of stem cell pluripotency, suggesting that p27Kip1 inhibitors could be beneficial for tissue regeneration. Because p27Kip1 is an intrinsically disordered protein, identifying direct inhibitors of the p27Kip1 protein is difficult. Therefore, we pursued a high-throughput screening strategy to identify novel p27Kip1 transcriptional inhibitors. We utilized a luciferase reporter plasmid driven by the p27Kip1 promoter to transiently transfect HeLa cells and used cyclohexamide as a positive control for non-specific inhibition. We screened a "bioactive" library consisting of 8,904 (4,359 unique compounds, of which 830 are Food and Drug Administration (FDA approved. From this screen, we successfully identified 111 primary hits with inhibitory effect against the promoter of p27Kip1. These hits were further refined using a battery of secondary screens. Here we report four novel p27Kip1 transcriptional inhibitors, and further demonstrate that our most potent hit compound (IC50 = 200 nM Alsterpaullone 2-cyanoethyl, inhibits p27Kip1 transcription by preventing FoxO3a from binding to the p27Kip1 promoter. This screen represents one of the first attempts to identify inhibitors of p27Kip1 and may prove useful for future tissue regeneration studies.
Energy Technology Data Exchange (ETDEWEB)
Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji [Showa Univ., Tokyo (Japan). School of Medicine
2001-05-01
A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)
International Nuclear Information System (INIS)
Ito, Tomohiro; Kaneko, Kazuhiro; Makino, Reiko; Ito, Hiroaki; Konishi, Kazuo; Kurahashi, Toshinori; Kitahara, Tadashi; Mitamura, Keiji
2001-01-01
A significant correlation has been found between p53 mutation and response to chemotherapy or radiotherapy. To determine the prognostic value of p53 mutation in patients with locally advanced esophageal carcinoma treated with definitive chemoradiotherapy, p53 mutation was analyzed using the biopsied specimens taken for diagnosis. Concurrent chemoradiotherapy was performed for 40 patients with severe dysphagia caused by esophageal squamous cell carcinoma associated with T3 or T4 disease. Chemotherapy consisted of protracted infusion of 5-fluorouracil, combined with an infusion of cisplatinum. Radiation treatment of the mediastinum was administered concomitantly with chemotherapy. The p53 gene mutation was detected by fluorescence-based polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) methods. DNA sequences were determined for DNA fragments with shifted peaks by SSCP methods. Of the 40 patients, 15 had T3 disease and 25 had T4 disease; 11 patients had M1 lymph node (LYM) disease. Of the 40 patients, 13 (33%) achieved a complete response. The median survival time was 14 months, and the 2-year survival rate was 20%. Among the 40 tumor samples, p53 mutation was detected in 24 tumors (60%). The survival rate in the 24 patients with p53 mutation did not differ significantly from that in the 16 patients without p53 mutation. In contrast, the 15 patients with T3 disease survived longer than the 25 patients with T4 disease (P=0.016); however, the survival rate in the 11 patients with M1 LYM disease did not differ significantly from that in the 29 patients without M1 LYM disease. Concurrent chemoradiotherapy is potentially curative for locally advanced esophageal carcinoma, but p53 genetic abnormality has no impact on prognosis. (author)
Directory of Open Access Journals (Sweden)
Júlio Santos
2014-12-01
Full Text Available Bladder cancer is a significant health problem in rural areas of Africa and the Middle East where Schistosoma haematobium is prevalent, supporting an association between malignant transformation and infection by this blood fluke. Nevertheless, the molecular mechanisms linking these events are poorly understood. Bladder cancers in infected populations are generally diagnosed at a late stage since there is a lack of non-invasive diagnostic tools, hence enforcing the need for early carcinogenesis markers.Forty-three formalin-fixed paraffin-embedded bladder biopsies of S. haematobium-infected patients, consisting of bladder tumours, tumour adjacent mucosa and pre-malignant/malignant urothelial lesions, were screened for bladder cancer biomarkers. These included the oncoprotein p53, the tumour proliferation rate (Ki-67>17%, cell-surface cancer-associated glycan sialyl-Tn (sTn and sialyl-Lewisa/x (sLea/sLex, involved in immune escape and metastasis. Bladder tumours of non-S. haematobium etiology and normal urothelium were used as controls. S. haematobium-associated benign/pre-malignant lesions present alterations in p53 and sLex that were also found in bladder tumors. Similar results were observed in non-S. haematobium associated tumours, irrespectively of their histological nature, denoting some common molecular pathways. In addition, most benign/pre-malignant lesions also expressed sLea. However, proliferative phenotypes were more prevalent in lesions adjacent to bladder tumors while sLea was characteristic of sole benign/pre-malignant lesions, suggesting it may be a biomarker of early carcionogenesis associated with the parasite. A correlation was observed between the frequency of the biomarkers in the tumor and adjacent mucosa, with the exception of Ki-67. Most S. haematobium eggs embedded in the urothelium were also positive for sLea and sLex. Reinforcing the pathologic nature of the studied biomarkers, none was observed in the healthy urothelium
High-throughput Screening for Protein-based Inheritance in S. cerevisiae.
Byers, James S; Jarosz, Daniel F
2017-08-08
The encoding of biological information that is accessible to future generations is generally achieved via changes to the DNA sequence. Long-lived inheritance encoded in protein conformation (rather than sequence) has long been viewed as paradigm-shifting but rare. The best characterized examples of such epigenetic elements are prions, which possess a self-assembling behavior that can drive the heritable manifestation of new phenotypes. Many archetypal prions display a striking N/Q-rich sequence bias and assemble into an amyloid fold. These unusual features have informed most screening efforts to identify new prion proteins. However, at least three known prions (including the founding prion, PrP Sc ) do not harbor these biochemical characteristics. We therefore developed an alternative method to probe the scope of protein-based inheritance based on a property of mass action: the transient overexpression of prion proteins increases the frequency at which they acquire a self-templating conformation. This paper describes a method for analyzing the capacity of the yeast ORFeome to elicit protein-based inheritance. Using this strategy, we previously found that >1% of yeast proteins could fuel the emergence of biological traits that were long-lived, stable, and arose more frequently than genetic mutation. This approach can be employed in high throughput across entire ORFeomes or as a targeted screening paradigm for specific genetic networks or environmental stimuli. Just as forward genetic screens define numerous developmental and signaling pathways, these techniques provide a methodology to investigate the influence of protein-based inheritance in biological processes.
Effect of UV C irradiation on P53 in FADD+/+ and FADD-/- cells
International Nuclear Information System (INIS)
Matic, Igor; Radnic, Maja; Marijanovic, Inga; Furcic, Ivana; Nagy, Biserka
2008-01-01
not mutant-specific. Allele-specific PCR detection of P53 in genomic DNA from UV-irradiated knockout and wild type cells were analyzed by gel electrophoresis.The results indicated that the mutant-specific primers (154-155, 175-176 and 275) didn't amplified 119-, 55- and 134-base pair (bp) products, unexpectedly, from irradiated FADD +/+ and FADD -/- cell DNAs as well as expected from non-radiated FADD +/+ and FADD -/- cell DNAs. In contrast, the mutant-specific primer for codon 270 amplified 134-base pair product from irradiated from FADD +/+ and FADD -/- cell DNAs. Because FADD is required for elimination of UV-irradiated cells, its loss could inhibit apoptosis and lead to expansion of apoptosis defective cells that contain P53 mutations. The data presented here suggest that loss of FADD expression and loss of wild type P53 function due to mutations can inhibit apoptosis and lead to the expansion of UV carcinogenesis. (author)
de Groot, Reinoud; Lüthi, Joel; Lindsay, Helen; Holtackers, René; Pelkmans, Lucas
2018-01-23
High-content imaging using automated microscopy and computer vision allows multivariate profiling of single-cell phenotypes. Here, we present methods for the application of the CISPR-Cas9 system in large-scale, image-based, gene perturbation experiments. We show that CRISPR-Cas9-mediated gene perturbation can be achieved in human tissue culture cells in a timeframe that is compatible with image-based phenotyping. We developed a pipeline to construct a large-scale arrayed library of 2,281 sequence-verified CRISPR-Cas9 targeting plasmids and profiled this library for genes affecting cellular morphology and the subcellular localization of components of the nuclear pore complex (NPC). We conceived a machine-learning method that harnesses genetic heterogeneity to score gene perturbations and identify phenotypically perturbed cells for in-depth characterization of gene perturbation effects. This approach enables genome-scale image-based multivariate gene perturbation profiling using CRISPR-Cas9. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.