WorldWideScience

Sample records for p53 upstream signaling

  1. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  2. Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

    International Nuclear Information System (INIS)

    Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

    2005-01-01

    Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

  3. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  4. Depression of p53-independent Akt survival signals in human oral cancer cells bearing mutated p53 gene after exposure to high-LET radiation

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Advanced Scientific Research Leader Development Unit, Gunma University, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511 (Japan); Kajihara, Atsuhisa; Yamakawa, Nobuhiro; Imai, Yuichiro [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ota, Ichiro; Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Mori, Eiichiro [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Noda, Taichi [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Furusawa, Yoshiya [Heavy-ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Kirita, Tadaaki [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Takeo, E-mail: tohnishi@naramed-u.ac.jp [Department of Radiation Oncology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer High-LET radiation induces efficiently apoptosis regardless of p53 gene status. Black-Right-Pointing-Pointer We examined whether high-LET radiation depresses the Akt-survival signals. Black-Right-Pointing-Pointer High-LET radiation depresses of survival signals even in the mp53 cancer cells. Black-Right-Pointing-Pointer High-LET radiation activates Caspase-9 through depression of survival signals. Black-Right-Pointing-Pointer High-LET radiation suppresses cell growth through depression of survival signals. -- Abstract: Although mutations and deletions in the p53 tumor suppressor gene lead to resistance to low linear energy transfer (LET) radiation, high-LET radiation efficiently induces cell lethality and apoptosis regardless of the p53 gene status in cancer cells. Recently, it has been suggested that the induction of p53-independent apoptosis takes place through the activation of Caspase-9 which results in the cleavage of Caspase-3 and poly (ADP-ribose) polymerase (PARP). This study was designed to examine if high-LET radiation depresses serine/threonine protein kinase B (PKB, also known as Akt) and Akt-related proteins. Human gingival cancer cells (Ca9-22 cells) harboring a mutated p53 (mp53) gene were irradiated with 2 Gy of X-rays or Fe-ion beams. The cellular contents of Akt-related proteins participating in cell survival signaling were analyzed with Western Blotting 1, 2, 3 and 6 h after irradiation. Cell cycle distributions after irradiation were assayed with flow cytometric analysis. Akt-related protein levels decreased when cells were irradiated with high-LET radiation. High-LET radiation increased G{sub 2}/M phase arrests and suppressed the progression of the cell cycle much more efficiently when compared to low-LET radiation. These results suggest that high-LET radiation enhances apoptosis through the activation of Caspase-3 and Caspase-9, and suppresses cell growth by suppressing Akt-related signaling, even in mp

  5. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    Science.gov (United States)

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  6. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  7. Modeling oscillatory control in NF-¿B, p53 and Wnt signaling

    DEFF Research Database (Denmark)

    Mengel, Benedicte; Hunziker, Alexander; Pedersen, Lykke

    2010-01-01

    Oscillations are commonly observed in cellular behavior and span a wide range of timescales, from seconds in calcium signaling to 24 hours in circadian rhythms. In between lie oscillations with time periods of 1-5 hours seen in NF-¿B, p53 and Wnt signaling, which play key roles in the immune system......, cell growth/death and embryo development, respectively. In the first part of this article, we provide a brief overview of simple deterministic models of oscillations. In particular, we explain the mechanism of saturated degradation that has been used to model oscillations in the NF-¿B, p53 and Wnt...

  8. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  9. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Manujendra N Saha

    Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

  10. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    Science.gov (United States)

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  11. Role of DNA mismatch repair and p53 in signaling induction of apoptosis by alkylating agents.

    Science.gov (United States)

    Hickman, M J; Samson, L D

    1999-09-14

    All cells are unavoidably exposed to chemicals that can alkylate DNA to form genotoxic damage. Among the various DNA lesions formed, O(6)-alkylguanine lesions can be highly cytotoxic, and we recently demonstrated that O(6)-methylguanine (O(6)MeG) and O(6)-chloroethylguanine (O(6)CEG) specifically initiate apoptosis in hamster cells. Here we show, in both hamster and human cells, that the MutSalpha branch of the DNA mismatch repair pathway (but not the MutSbeta branch) is absolutely required for signaling the initiation of apoptosis in response to O(6)MeGs and is partially required for signaling apoptosis in response to O(6)CEGs. Further, O(6)MeG lesions signal the stabilization of the p53 tumor suppressor, and such signaling is also MutSalpha-dependent. Despite this, MutSalpha-dependent apoptosis can be executed in a p53-independent manner. DNA mismatch repair status did not influence the response of cells to other inducers of p53 and apoptosis. Thus, it appears that mismatch repair status, rather than p53 status, is a strong indicator of the susceptibility of cells to alkylation-induced apoptosis. This experimental system will allow dissection of the signal transduction events that couple a specific type of DNA base lesion with the final outcome of apoptotic cell death.

  12. Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

    Science.gov (United States)

    El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

    2016-08-01

    Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Nuclear localization signal of ING4 plays a key role in its binding to p53

    International Nuclear Information System (INIS)

    Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang

    2005-01-01

    ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53

  14. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  15. An ultrasensitive colorimeter assay strategy for p53 mutation assisted by nicking endonuclease signal amplification.

    Science.gov (United States)

    Lin, Zhenyu; Yang, Weiqiang; Zhang, Guiyun; Liu, Qida; Qiu, Bin; Cai, Zongwei; Chen, Guonan

    2011-08-28

    A novel catalytic colorimetric assay assisted by nicking endonuclease signal amplification (NESA) was developed. With the signal amplification, the detection limit of the p53 target gene can be as low as 1 pM, which is nearly 5 orders of magnitude lower than that of other previously reported colorimetric DNA detection strategies based on catalytic DNAzyme.

  16. Tumour suppression in skin and other tissues via cross-talk between vitamin D- and p53-signalling

    Directory of Open Access Journals (Sweden)

    Joerg eReichrath

    2014-06-01

    Full Text Available P53 and its family members have been implicated in the direct regulation of the vitamin D receptor (VDR. Vitamin D- and p53-signaling pathways have a significant impact on spontaneous or carcinogen-induced malignant transformation of cells, with VDR and p53 representing important tumour suppressors. VDR and the p53/p63/p73 proteins all function typically as receptors or sensors that turn into transcriptional regulators upon stimulus, with the main difference being that the nuclear VDR is activated as a transcription factor after binding its naturally occurring ligand 1,25-dihydroxyvitamin D with high affinity while the p53 family of transcription factors, mostly in the nucleoplasm, responds to a large number of alterations in cell homeostasis commonly referred to as stress. An increasing body of evidence now convincingly demonstrates a cross-talk between vitamin D- and p53-signaling that occurs at different levels, has genome-wide implications and that should be of high importance for many malignancies, including non-melanoma skin cancer. One interaction involves the ability of p53 to increase skin pigmentation via POMC derivatives including alpha-MSH and ACTH. Pigmentation protects the skin against UV-induced DNA damage and skin carcinogenesis, yet on the other hand reduces cutaneous synthesis of vitamin D. A second level of interaction may be through the ability of 1,25-dihydroxyvitamin D to increase the survival of skin cells after UV irradiation. UV irradiation-surviving cells show significant reductions in thymine dimers in the presence of 1,25-dihydroxyvitamin D that are associated with increased nuclear p53 protein expression, and significantly reduced NO products. A third level of interaction is documented by the ability of vitamin D compounds to regulate the expression of the murine double minute 2 (MDM2 gene in dependence of the presence of wild-type p53. MDM2 has a well established role as a key negative regulator of p53 activity

  17. SIGNALING TO THE P53 TUMOR SUPPRESSOR THROUGH PATHWAYS ACTIVATED BY GENOTOXIC AND NON-GENOTOXIC STRESSES.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2002-07-01

    The p53 tumor suppressor is a tetrameric transcription factor that is post-translational modified at {approx}18 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review the posttranslational modifications to p53 and the pathways that produce them in response to both genotoxic and non-genotoxic stresses.

  18. The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

    Science.gov (United States)

    Noda, Takeshi

    2011-12-01

    I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  20. TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

    International Nuclear Information System (INIS)

    Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen

    2014-01-01

    Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence

  1. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    International Nuclear Information System (INIS)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook

    2009-01-01

    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference

  2. Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2009-05-15

    The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.

  3. Imiquimod activates p53-dependent apoptosis in a human basal cell carcinoma cell line.

    Science.gov (United States)

    Huang, Shi-Wei; Chang, Shu-Hao; Mu, Szu-Wei; Jiang, Hsin-Yi; Wang, Sin-Ting; Kao, Jun-Kai; Huang, Jau-Ling; Wu, Chun-Ying; Chen, Yi-Ju; Shieh, Jeng-Jer

    2016-03-01

    The tumor suppressor p53 controls DNA repair, cell cycle, apoptosis, autophagy and numerous other cellular processes. Imiquimod (IMQ), a synthetic toll-like receptor (TLR) 7 ligand for the treatment of superficial basal cell carcinoma (BCC), eliminates cancer cells by activating cell-mediated immunity and directly inducing apoptosis and autophagy in cancer cells. To evaluate the role of p53 in IMQ-induced cell death in skin cancer cells. The expression, phosphorylation and subcellular localization of p53 were detected by real-time PCR, luciferase reporter assay, cycloheximide chase analysis, immunoblotting and immunocytochemistry. Using BCC/KMC1 cell line as a model, the upstream signaling of p53 activation was dissected by over-expression of TLR7/8, the addition of ROS scavenger, ATM/ATR inhibitors and pan-caspase inhibitor. The role of p53 in IMQ-induced apoptosis and autophagy was assessed by genetically silencing p53 and evaluated by a DNA content assay, immunoblotting, LC3 puncta detection and acridine orange staining. IMQ induced p53 mRNA expression and protein accumulation, increased Ser15 phosphorylation, promoted nuclear translocation and up-regulated its target genes in skin cancer cells in a TLR7/8-independent manner. In BCC/KMC1 cells, the induction of p53 by IMQ was achieved through increased ROS production to stimulate the ATM/ATR-Chk1/Chk2 axis but was not mediated by inducing DNA damage. The pharmacological inhibition of ATM/ATR significantly suppressed IMQ-induced p53 activation and apoptosis. Silencing of p53 significantly decreased the IMQ-induced caspase cascade activation and apoptosis but enhanced autophagy. Mutant p53 skin cancer cell lines were more resistant to IMQ-induced apoptosis than wildtype p53 skin cancer cell lines. IMQ induced ROS production to stimulate ATM/ATR pathways and contributed to p53-dependent apoptosis in a skin basal cell carcinoma cell line BCC/KMC1. Copyright © 2015 Japanese Society for Investigative Dermatology

  4. Magnetic Particle-Based Immunoassay of Phosphorylated p53 Using Protein-Cage Templated Lead Phosphate and Carbon Nanospheres for Signal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Aiqiong; Bao, Yuanwu; Ge, Xiaoxiao; Shin, Yongsoon; Du, Dan; Lin, Yuehe

    2012-11-20

    Phosphorylated p53 at serin 15 (phospho-p53-15) is a potential biomarker of Gamma-radiation exposure. In this paper, we described a new magnetic particles (MPs)-based electrochemical immunoassay of human phospho-p53-15 using carbon nanospheres (CNS) and protein-cage templated lead phosphate nanoparticles for signal amplification. Greatly enhanced sensitivity was achieved by three aspects: 1) The protein-cage nanoparticle (PCN) and p53-15 signal antibody (p53-15 Ab2) are linked to CNS (PCNof each apoferritin; 3) MPs capture a large amount of primary antibodies. Using apoferritin templated metallic phosphate instead of enzyme as label has the advantage of eliminating the addition of mediator or immunoreagents and thus makes the immunoassay system simpler. The subsequent stripping voltammetric analysis of the released lead ions were detected on a disposable screen printed electrode. The response current was proportional to the phospho-p53-15 concentration in the range of 0.02 to 20 ng mL-1 with detection limit of 0.01 ng mL-1. This method shows a good stability, reproducibility and recovery.

  5. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  6. Platelet-derived growth factor (PDGF)-signaling mediates radiation-induced apoptosis in human prostate cancer cells with loss of p53 function

    International Nuclear Information System (INIS)

    Kim, Harold E.; Han, Sue J.; Kasza, Thomas; Han, Richard; Choi, Hyeong-Seon; Palmer, Kenneth C.; Kim, Hyeong-Reh C.

    1997-01-01

    Platelet-derived growth factor (PDGF) signals a diversity of cellular responses in vitro, including cell proliferation, survival, transformation, and chemotaxis. PDGF functions as a 'competence factor' to induce a set of early response genes expressed in G 1 including p21 WAF1/CIP1 , a functional mediator of the tumor suppressor gene p53 in G 1 /S checkpoint. For PDGF-stimulated cells to progress beyond G 1 and transit the cell cycle completely, progression factors in serum such as insulin and IGF-1 are required. We have recently shown a novel role of PDGF in inducing apoptosis in growth-arrested murine fibroblasts. The PDGF-induced apoptosis is rescued by insulin, suggesting that G 1 /S checkpoint is a critical determinant for PDGF-induced apoptosis. Because recent studies suggest that radiation-induced signal transduction pathways interact with growth factor-mediated signaling pathways, we have investigated whether activation of the PDGF-signaling facilitates the radiation-induced apoptosis in the absence of functional p53. For this study we have used the 125-IL cell line, a mutant p53-containing, highly metastatic, and hormone-unresponsive human prostate carcinoma cell line. PDGF signaling is constitutively activated by transfection with a p28 v-sis expression vector, which was previously shown to activate PDGF α- and β- receptors. Although the basal level of p21 WAF1/CIP1 expression and radiation-induced apoptosis were not detectable in control 125-IL cells as would be predicted in mutant p53-containing cells, activation of PDGF-signaling induced expression of p21 WAF1/CIP1 and radiation-induced apoptosis. Our study suggests that the level of 'competence' growth factors including PDGF may be one of the critical determinants for radiation-induced apoptosis, especially in cells with loss of p53 function at the site of radiotherapy in vivo

  7. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    Science.gov (United States)

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    Science.gov (United States)

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  9. The role of p53 and pRB in apoptosis and cancer

    DEFF Research Database (Denmark)

    Hickman, Emma S; Moroni, M Cristina; Helin, Kristian

    2002-01-01

    Loss of function of both the p53 pathway and the retinoblastoma protein (pRB) pathway plays a significant role in the development of most human cancers. Loss of pRB results in deregulated cell proliferation and apoptosis, whereas loss of p53 desensitizes cells to checkpoint signals, including...

  10. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  11. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  12. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    Science.gov (United States)

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  13. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  14. Expression of p53/HGF/c-met/STAT3 signal in fetuses with neural tube defects.

    Science.gov (United States)

    Trovato, Maria; D'Armiento, Maria; Lavra, Luca; Ulivieri, Alessandra; Dominici, Roberto; Vitarelli, Enrica; Grosso, Maddalena; Vecchione, Raffaella; Barresi, Gaetano; Sciacchitano, Salvatore

    2007-02-01

    Neural tube defects (NTD) are morphogenetic alterations due to a defective closure of neural tube. Hepatocyte growth factor (HGF)/c-met system plays a role in morphogenesis of nervous system, lung, and kidney. HGF/c-met morphogenetic effects are mediated by signal transducers and activators of transcription (STAT)3 and both HGF and c-met genes are regulated from p53. The aim of our study was to analyze mRNA and protein expressions of p53, HGF, c-met, and STAT3 in fetuses with NTD. By reverse transcriptase-polymerase chain reaction and immunohistochemistry, we analyzed neural tissues from four NTD fetuses and the corresponding non-malformed lungs, kidneys and placentas. We found a reduced mRNA expression of HGF/c-met/STAT3 pathway, in the malformed nervous systems and placentas. The reduced expression of this pathway correlated with the absence of p53 in all these samples. On the contrary, detectable expression levels of p53, HGF, c-met, and STAT3 were observed in non-malformed lungs and kidneys obtained from the same fetuses. Comparable results were obtained by immunohistochemistry, with the exception of p53, which was undetected in all fetal tissues. In conclusion, in NTD fetuses, both the defective neural tube tissue and the placenta have a reduction in all components of the p53/HGF/c-met/STAT3 cascade. This raises the possibility of using the suppression of these genes for early diagnosis of NTD especially on chorionic villus sampling.

  15. Cellular response to DNA damage. Link between p53 and DNA-PK

    International Nuclear Information System (INIS)

    Salles-Passador, I.; Fotedar, R.; Fotedar, A.

    1999-01-01

    Cells which lack DNA-activated protein kinase (DNA-PK) are very susceptible to ionizing radiation and display an inability to repair double-strand DNA breaks. DNA-PK is a member of a protein kinase family that includes ATR and ATM which have strong homology in their carboxy-terminal kinase domain with Pl-3 kinase. ATM has been proposed to act upstream of p53 in cellular response to ionizing radiation. DNA-PK may similarly interact with p53 in cellular growth control and in mediation of the response to ionizing radiation. (author)

  16. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

    2011-01-01

    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  17. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  18. Kaempferol induces ATM/p53-mediated death receptor and mitochondrial apoptosis in human umbilical vein endothelial cells.

    Science.gov (United States)

    Lee, Chiu-Fang; Yang, Jai-Sing; Tsai, Fuu-Jen; Chiang, Ni-Na; Lu, Chi-Cheng; Huang, Yu-Syuan; Chen, Chun; Chen, Fu-An

    2016-05-01

    Kaempferol is a member of the flavonoid compounds found in vegetables and fruits. It is shown to exhibit biological impact and anticancer activity, but no report exists on the angiogenic effect of kaempferol and induction of cell apoptosis in vitro. In this study, we investigated the role of kaempferol on anti-angiogenic property and the apoptotic mechanism of human umbilical vein endothelial cells (HUVECs). Our results demonstrated that kaempferol decreased HUVEC viability in a time- and concentration-dependent manner. Kaempferol also induced morphological changes and sub-G1 phase cell population (apoptotic cells). Kaempferol triggered apoptosis of HUVECs as detecting by DNA fragmentation, comet assay and immunofluorescent staining for activated caspase-3. The caspase signals, including caspase-8, -9 and -3, were time-dependently activated in HUVECs after kaempferol exposure. Furthermore, pre-treatment with a specific inhibitor of caspase-8 (Z-IETD-FMK) significantly reduced the activity of caspase-8, -9 and -3, indicating that extrinsic pathway is a major signaling pathway in kaempferol-treated HUVECs. Importantly, kaempferol promoted reactive oxygen species (ROS) evaluated using flow cytometric assay in HUVECs. We further investigated the upstream extrinsic pathway and showed that kaempferol stimulated death receptor signals [Fas/CD95, death receptor 4 (DR4) and DR5] through increasing the levels of phosphorylated p53 and phosphorylated ATM pathways in HUVECs, which can be individually confirmed by N-acetylcysteine (NAC), ATM specific inhibitor (caffeine) and p53 siRNA. Based on these results, kaempferol-induced HUVEC apoptosis was involved in an ROS-mediated p53/ATM/death receptor signaling. Kaempferol might possess therapeutic effects on cancer treatment in anti-vascular targeting.

  19. Ubiquitin specific peptidase 5 mediates Histidine-rich protein Hpn induced cell apoptosis in hepatocellular carcinoma through P14-P53 signaling.

    Science.gov (United States)

    Liu, Yi; Wang, Wei-Mao; Zou, Li-Yi; Li, Li; Feng, Lu; Pan, Ming-Zhu; Lv, Min-Yi; Cao, Ying; Wang, Hua; Kung, Hsiang-Fu; Pang, Jian-Xin; Fu, Wei-Ming; Zhang, Jin-Fang

    2017-06-01

    Hpn is a small histidine-rich cytoplasmic protein from Helicobacter pylori and has been recognized as a high-risk factor for several cancers including gastric cancer, colorectal cancer, and MALT lymphoma. However, the relationship between Hpn and cancers remains elusive. In this study, we discovered that Hpn protein effectively suppressed cell growth and induced apoptosis in hepatocellular carcinoma (HCC). A two-dimensional gel electrophoresis and mass spectrometry-based comparative proteomics was performed to find the molecular targets of Hpn in HCC cells. It was identified that twelve proteins were differentially expressed, with USP5 being one of the most significantly downregulated protein. The P14 ARF -P53 signaling was activated by USP5 knockdown in HCC cells. Furthermore, USP5 overexpression significantly rescued the suppressive effect of Hpn on the viability of HCC cells. In conclusion, our study suggests that Hpn plays apoptosis-inducing roles through suppressing USP5 expression and activating the P14 ARF -P53 signaling. Therefore, Hpn may be a potential candidate for developing novel anti-HCC drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Avian Reovirus Protein p17 Functions as a Nucleoporin Tpr Suppressor Leading to Activation of p53, p21 and PTEN and Inactivation of PI3K/AKT/mTOR and ERK Signaling Pathways.

    Directory of Open Access Journals (Sweden)

    Wei-Ru Huang

    Full Text Available Avian reovirus (ARV protein p17 has been shown to regulate cell cycle and autophagy by activation of p53/PTEN pathway; nevertheless, it is still unclear how p53 and PTEN are activated by p17. Here, we report for the first time that p17 functions as a nucleoporin Tpr suppressor that leads to p53 nuclear accumulation and consequently activates p53, p21, and PTEN. The nuclear localization signal (119IAAKRGRQLD128 of p17 has been identified for Tpr binding. This study has shown that Tpr suppression occurs by p17 interacting with Tpr and by reducing the transcription level of Tpr, which together inhibit Tpr function. In addition to upregulation of PTEN by activation of p53 pathway, this study also suggests that ARV protein p17 acts as a positive regulator of PTEN. ARV p17 stabilizes PTEN by stimulating phosphorylation of cytoplasmic PTEN and by elevating Rak-PTEN association to prevent it from E3 ligase NEDD4-1 targeting. To activate PTEN, p17 is able to promote β-arrestin-mediated PTEN translocation from the cytoplasm to the plasma membrane via a Rock-1-dependent manner. The accumulation of p53 in the nucleus induces the PTEN- and p21-mediated downregulation of cyclin D1 and CDK4. Furthermore, Tpr and CDK4 knockdown increased virus production in contrast to depletion of p53, PTEN, and LC3 reducing virus yield. Taken together, our data suggest that p17-mediated Tpr suppression positively regulates p53, PTEN, and p21 and negatively regulates PI3K/AKT/mTOR and ERK signaling pathways, both of which are beneficial for virus replication.

  1. Stress-specific response of the p53-Mdm2 feedback loop

    Directory of Open Access Journals (Sweden)

    Jensen Mogens H

    2010-07-01

    Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.

  2. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, Akihisa

    2002-01-01

    We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)

  3. Heterozygous inactivation of tsc2 enhances tumorigenesis in p53 mutant zebrafish

    Directory of Open Access Journals (Sweden)

    Seok-Hyung Kim

    2013-07-01

    Tuberous sclerosis complex (TSC is a multi-organ disorder caused by mutations of the TSC1 or TSC2 genes. A key function of these genes is to inhibit mTORC1 (mechanistic target of rapamycin complex 1 kinase signaling. Cells deficient for TSC1 or TSC2 have increased mTORC1 signaling and give rise to benign tumors, although, as a rule, true malignancies are rarely seen. In contrast, other disorders with increased mTOR signaling typically have overt malignancies. A better understanding of genetic mechanisms that govern the transformation of benign cells to malignant ones is crucial to understand cancer pathogenesis. We generated a zebrafish model of TSC and cancer progression by placing a heterozygous mutation of the tsc2 gene in a p53 mutant background. Unlike tsc2 heterozygous mutant zebrafish, which never exhibited cancers, compound tsc2;p53 mutants had malignant tumors in multiple organs. Tumorigenesis was enhanced compared with p53 mutant zebrafish. p53 mutants also had increased mTORC1 signaling that was further enhanced in tsc2;p53 compound mutants. We found increased expression of Hif1-α, Hif2-α and Vegf-c in tsc2;p53 compound mutant zebrafish compared with p53 mutant zebrafish. Expression of these proteins probably underlies the increased angiogenesis seen in compound mutant zebrafish compared with p53 mutants and might further drive cancer progression. Treatment of p53 and compound mutant zebrafish with the mTORC1 inhibitor rapamycin caused rapid shrinkage of tumor size and decreased caliber of tumor-associated blood vessels. This is the first report using an animal model to show interactions between tsc2, mTORC1 and p53 during tumorigenesis. These results might explain why individuals with TSC rarely have malignant tumors, but also suggest that cancer arising in individuals without TSC might be influenced by the status of TSC1 and/or TSC2 mutations and be potentially treatable with mTORC1 inhibitors.

  4. Signal transduction of p53-independent apoptotic pathway induced by hexavalent chromium in U937 cells

    International Nuclear Information System (INIS)

    Hayashi, Yoko; Kondo, Takashi; Zhao Qingli; Ogawa Ryohei; Cui Zhengguo; Feril, Loreto B.; Teranishi, Hidetoyo; Kasuya, Minoru

    2004-01-01

    It has been reported that the hexavalent chromium compound (Cr(VI)) can induce both p53-dependent and p53-independent apoptosis. While a considerable amount of information is available on the p53-dependent pathway, only little is known about the p53-independent pathway. To elucidate the p53-independent mechanism, the roles of the Ca 2+ -calpain- and mitochondria-caspase-dependent pathways in apoptosis induced by Cr(VI) were investigated. When human lymphoma U937 cells, p53 mutated cells, were treated with 20 μM Cr(VI) for 24 h, nuclear morphological changes and DNA fragmentation were observed. Production of hydroxyl radicals revealed by electron paramagnetic resonance (EPR)-spin trapping, and increase of intracellular calcium ion concentration monitored by digital imaging were also observed in Cr(VI)-treated cells. An intracellular Ca 2+ chelator, BAPTA-AM, and calpain inhibitors suppressed the Cr(VI)-induced DNA fragmentation. The number of cells showing low mitochondrial membrane potential (MMP), high level of superoxide anion radicals (O 2 - ), and high activity of caspase-3, which are indicators of mitochondria-caspase-dependent pathway, increased significantly in Cr(VI)-treated cells. An antioxidant, N-acetyl-L-cysteine (NAC), decreased DNA fragmentation and inhibited the changes in MMP, O 2 - formation, and activation of caspase-3 induced by Cr(VI). No increase of the expressions of Fas and phosphorylated JNK was observed after Cr(VI) treatment. Cell cycle analysis revealed that the fraction of G2/M phase tended to increase after 24 h of treatment, suggesting that Cr(VI)-induced apoptosis is related to the G2 block. These results indicate that Ca 2+ -calpain- and mitochondria-caspase-dependent pathways play significant roles in the Cr(VI)-induced apoptosis via the G2 block, which are independent of JNK and Fas activation. The inhibition of apoptosis and all its signal transductions by NAC suggests that intracellular reactive oxygen species (ROS) are

  5. Study of cellular signaling of apoptosis induced by different types of ionizing radiations in lymphoblastoid cells differing in their P53 status

    International Nuclear Information System (INIS)

    Fischer, Barbara

    2004-01-01

    The general objective of this thesis was to identify the cellular mechanisms that govern the induction of apoptosis by ionizing radiations with high linear energy transfer (LET), particularly fast neutrons and carbon ions. It was also attempted to determine the role in these mechanisms of the p53 tumor suppressor protein. For this, lymphoblastoid lines differing by their p53 status have been used: TK6 (p53 + / +), WTK1 (p53 mute) and NH32 (p53 - / -). At first, the study concerned the induction of apoptosis by fast neutrons, and the effects of these radiations have been compared with those of X-rays on cell lines. Results show that for the same irradiation dose, fast neutrons are more efficient than X-rays in terms of inducing apoptosis. This induction of apoptosis also varies according to the p53 status of the cells. These data suggest that fast neutrons activate apoptosis in two distinct ways: a p53-dependent pathway that occurs in the first hours after irradiation, and an independent pathway of p53, which is slower, but also involves caspases. The author then tried to characterize the two active apoptotic signaling pathways in lymphoblastoid lines by fast neutrons, in order to identify the different mechanisms involved in triggering the apoptotic process as a function of p53. Results show that the p53 status not only affects the kinetics of induction of apoptosis but also the nature of active caspases. The p53-dependent apoptosis is associated with the activation of caspases-3, 7, 8 and 9, the cleavage of BID by caspase-8, the fall of Δψm and the release of cytochrome c from mitochondria to cytoplasm. On the other hand, caspase-7 seems to be activated by an independent p53 signaling pathway. In the following experiments, the mechanisms leading to the initiation of apoptotic pathways induced by fast neutrons were explored, and more particularly the activation of caspase-8 in p53-dependent apoptosis. The involvement of the Fas necrosis receptor in the activation

  6. Regulation of Metabolic Activity by p53

    Directory of Open Access Journals (Sweden)

    Jessica Flöter

    2017-05-01

    Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

  7. Sirtuin7 is involved in protecting neurons against oxygen-glucose deprivation and reoxygenation-induced injury through regulation of the p53 signaling pathway.

    Science.gov (United States)

    Lv, Jianrui; Tian, Junbin; Zheng, Guoxi; Zhao, Jing

    2017-10-01

    Sirtuin7 (SIRT7) is known to regulate apoptosis and stress responses. So far, very little is known about the role of SIRT7 in cerebral ischemia/reperfusion injury. In this study, we aimed to investigate the potential role of SIRT7 in regulating oxygen-glucose deprivation and reoxygenation (OGD/R)-induced injury in neurons. We found a significant increase of SIRT7 expression in neurons in response to OGD/R treatment. Knockdown of SIRT7 aggravated OGD/R-induced injury. Knockdown of SIRT7 augmented the levels of total and acetylated p53 protein. Moreover, knockdown of SIRT7 markedly increased the transcriptional activity of p53 toward apoptosis and activated the p53-mediated proapoptotic signaling pathway. By contrast, overexpression of SIRT7 showed the opposite effects. Taken together, the results of our study suggest that SIRT7 is involved in protecting neurons against OGD/R-induced injury, possibly through regulation of the p53-mediated proapoptotic signaling pathway, indicating a potential therapeutic target for cerebral ischemia/reperfusion injury. © 2017 Wiley Periodicals, Inc.

  8. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA

    DEFF Research Database (Denmark)

    Glahder, Jacob-Andreas Harald; Norrild, Bodil

    2011-01-01

    Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...

  10. Knockdown of p53 suppresses Nanog expression in embryonic stem cells

    Energy Technology Data Exchange (ETDEWEB)

    Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

    2014-01-10

    Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

  11. Enzastaurin inhibits ABCB1-mediated drug efflux independently of effects on protein kinase C signalling and the cellular p53 status.

    Science.gov (United States)

    Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich

    2015-07-10

    The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.

  12. P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent

    International Nuclear Information System (INIS)

    Dbaibo, G.; El-Assaad, W.

    2000-01-01

    Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation

  13. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  14. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    Science.gov (United States)

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  15. Therapeutic targeting of the p53 pathway in cancer stem cells

    Science.gov (United States)

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  16. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  17. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production.

    Directory of Open Access Journals (Sweden)

    Dana Austin

    Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.

  18. Cdk5 phosphorylates non-genotoxically overexpressed p53 following inhibition of PP2A to induce cell cycle arrest/apoptosis and inhibits tumor progression

    Directory of Open Access Journals (Sweden)

    Kumari Ratna

    2010-07-01

    Full Text Available Abstract Background p53 is the most studied tumor suppressor and its overexpression may or may not cause cell death depending upon the genetic background of the cells. p53 is degraded by human papillomavirus (HPV E6 protein in cervical carcinoma. Several stress activated kinases are known to phosphorylate p53 and, among them cyclin dependent kinase 5 (Cdk5 is one of the kinase studied in neuronal cell system. Recently, the involvement of Cdk5 in phosphorylating p53 has been shown in certain cancer types. Phosphorylation at specific serine residues in p53 is essential for it to cause cell growth inhibition. Activation of p53 under non stress conditions is poorly understood. Therefore, the activation of p53 and detection of upstream kinases that phosphorylate non-genotoxically overexpressed p53 will be of therapeutic importance for cancer treatment. Results To determine the non-genotoxic effect of p53; Tet-On system was utilized and p53 inducible HPV-positive HeLa cells were developed. p53 overexpression in HPV-positive cells did not induce cell cycle arrest or apoptosis. However, we demonstrate that overexpressed p53 can be activated to upregulate p21 and Bax which causes G2 arrest and apoptosis, by inhibiting protein phosphatase 2A. Additionally, we report that the upstream kinase cyclin dependent kinase 5 interacts with p53 to phosphorylate it at Serine20 and Serine46 residues thereby promoting its recruitment on p21 and bax promoters. Upregulation and translocation of Bax causes apoptosis through intrinsic mitochondrial pathway. Interestingly, overexpressed activated p53 specifically inhibits cell-growth and causes regression in vivo tumor growth as well. Conclusion Present study details the mechanism of activation of p53 and puts forth the possibility of p53 gene therapy to work in HPV positive cervical carcinoma.

  19. An adaptive molecular timer in p53-meidated cell fate decision

    Science.gov (United States)

    Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

    The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

  20. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    Science.gov (United States)

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  1. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.

    2003-01-01

    Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation

  2. p53-Mediated Molecular Control of Autophagy in Tumor Cells

    Directory of Open Access Journals (Sweden)

    Maria Mrakovcic

    2018-03-01

    Full Text Available Autophagy is an indispensable mechanism of the eukaryotic cell, facilitating the removal and renewal of cellular components and thereby balancing the cell’s energy consumption and homeostasis. Deregulation of autophagy is now regarded as one of the characteristic key features contributing to the development of tumors. In recent years, the suppression of autophagy in combination with chemotherapeutic treatment has been approached as a novel therapy in cancer treatment. However, depending on the type of cancer and context, interference with the autophagic machinery can either promote or disrupt tumorigenesis. Therefore, disclosure of the major signaling pathways that regulate autophagy and control tumorigenesis is crucial. To date, several tumor suppressor proteins and oncogenes have emerged as eminent regulators of autophagy whose depletion or mutation favor tumor formation. The mammalian cell “janitor” p53 belongs to one of these tumor suppressors that are most commonly mutated in human tumors. Experimental evidence over the last decade convincingly reports that p53 can act as either an activator or an inhibitor of autophagy depending on its subcellular localization and its mode of action. This finding gains particular significance as p53 deficiency or mutant variants of p53 that accumulate in the cytoplasm of tumor cells enable activation of autophagy. Accordingly, we recently identified p53 as a molecular hub that regulates autophagy and apoptosis in histone deacetylase inhibitor-treated uterine sarcoma cells. In light of this novel experimental evidence, in this review, we focus on p53 signaling as a mediator of the autophagic pathway in tumor cells.

  3. Honokiol induces autophagic cell death in malignant glioma through reactive oxygen species-mediated regulation of the p53/PI3K/Akt/mTOR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Chien-Ju [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China); Chen, Ta-Liang [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Tseng, Yuan-Yun [Department of Neurosurgery, Shuang-Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Wu, Gong-Jhe [Department of Anesthesiology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Hsieh, Ming-Hui [Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Department of Anesthesiology, Taipei Medical University Hospital, Taipei, Taiwan (China); Lin, Yung-Wei [Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Chen, Ruei-Ming, E-mail: rmchen@tmu.edu.tw [Graduate Institute of Medical Sciences, Taipei Medical University, Taipei, Taiwan (China); Anesthetics and Toxicology Research Center, Taipei Medical University Hospital, Taipei, Taiwan (China); Brain Disease Research Center, Taipei Medical University Wan-Fang Hospital, Taipei, Taiwan (China); Comprehensive Cancer Center, Taipei Medical University, Taipei, Taiwan (China)

    2016-08-01

    Honokiol, an active constituent extracted from the bark of Magnolia officinalis, possesses anticancer effects. Apoptosis is classified as type I programmed cell death, while autophagy is type II programmed cell death. We previously proved that honokiol induces cell cycle arrest and apoptosis of U87 MG glioma cells. Subsequently in this study, we evaluated the effect of honokiol on autophagy of glioma cells and examined the molecular mechanisms. Administration of honokiol to mice with an intracranial glioma increased expressions of cleaved caspase 3 and light chain 3 (LC3)-II. Exposure of U87 MG cells to honokiol also induced autophagy in concentration- and time-dependent manners. Results from the addition of 3-methyladenine, an autophagy inhibitor, and rapamycin, an autophagy inducer confirmed that honokiol-induced autophagy contributed to cell death. Honokiol decreased protein levels of PI3K, phosphorylated (p)-Akt, and p-mammalian target of rapamycin (mTOR) in vitro and in vivo. Pretreatment with a p53 inhibitor or transfection with p53 small interfering (si)RNA suppressed honokiol-induced autophagy by reversing downregulation of p-Akt and p-mTOR expressions. In addition, honokiol caused generation of reactive oxygen species (ROS), which was suppressed by the antioxidant, vitamin C. Vitamin C also inhibited honokiol-induced autophagic and apoptotic cell death. Concurrently, honokiol-induced alterations in levels of p-p53, p53, p-Akt, and p-mTOR were attenuated following vitamin C administration. Taken together, our data indicated that honokiol induced ROS-mediated autophagic cell death through regulating the p53/PI3K/Akt/mTOR signaling pathway. - Highlights: • Exposure of mice with intracranial gliomas to honokiol induces cell apoptosis and autophagy. • Honokiol triggers autophagy of human glioma cells via the PISK/AKT/mTOR signaling pathway. • P53 induces autophagy via regulating the AKT/mTOR pathway in honokiol-treated glioma cells. • ROS participates

  4. Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways

    Directory of Open Access Journals (Sweden)

    Lisa Wiesmüller

    2001-01-01

    Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.

  5. Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

    International Nuclear Information System (INIS)

    Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu

    2014-01-01

    Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells

  6. The role of p53 molecule in radiation and hyperthermic therapies

    International Nuclear Information System (INIS)

    Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

    2003-01-01

    In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

  7. [Effect of microRNA-34a/SIRT1/p53 signal pathway on notoginsenoside R₁ delaying vascular endothelial cell senescence].

    Science.gov (United States)

    Lai, Xiao-Hua; Lei, Yan; Yang, Jing; Xiu, Cheng-Kui

    2018-02-01

    This study aimed to investigate the effect of notoginsenoside R₁ in delaying H₂O₂-induced vascular endothelial cell senescence through microRNA-34a/SIRT1/p53 signal pathway. In this study, human umbilical vein endothelial cells(HUVECs) were selected as the study object; the aging model induced by hydrogen peroxide(H₂O₂) was established, with resveratrol as the positive drug. HUVECs were randomly divided into four groups, youth group, senescence model group, notoginsenoside R₁ group and resveratrol group. Notoginsenoside R₁ group and resveratrol group were modeled with 100 μmoL·L⁻¹ H₂O₂ for 4 h after 24 h treatment with notoginsenoside R₁(30 μmoL·L⁻¹) and resveratrol(10 μmoL·L⁻¹) respectively. At the end, each group was cultured with complete medium for 24 h. The degree of cellular senescence was detected by senescence-associated β-galactosidase(SA-β-Gal) staining kit, the cell viability was detected by cell counting kit-8, the cell cycle distribution was analyzed by flow cytometry, and the cellular SOD activity was detected by WST-1 method in each group. The expressions of SIRT1, p53p21 and p16 proteins in HUVECs were detected by Western blot. In addition, the mRNA expressions of miRNA-34a, SIRT1 and p53 in HUVECs were assayed by Real-time PCR. These results indicated that notoginsenoside R₁ significantly reduced the positive staining rate of senescent cells, enhanced the cell proliferation capacity and intracellular SOD activity, decreased the proportion of cells in G₀/G₁ phase, and increased the percentage of cells in S phase simultaneously compared with the senescence model group. Moreover, notoginsenoside R₁ decreased the mRNA expressions of miRNA-34a and p53 and the protein expression of p53p21 and p16.At the same time, notoginsenoside R₁ increased the protein and mRNA expressions of SIRT1. The differences in these results between the senescence model group and the

  8. Andrographolide promotes vincristine-induced SK-NEP-1 tumor cell death via PI3K-AKT-p53 signaling pathway

    Directory of Open Access Journals (Sweden)

    Zhang M

    2016-09-01

    Full Text Available Mingsheng Zhang, Enda Xue, Wei Shao Department of Pediatric Surgery, Liaocheng People’s Hospital, Liaocheng, Shandong Province, People’s Republic of China Background: Nephroblastoma (Wilms’ tumor [WT] is the most common malignant renal cancer in children. Although the outcome of WT has significantly improved as a result of the combination of surgery, chemotherapy, and radiotherapy; in some cases WT results in severe complications. Thus, novel strategies that would decrease treatment burden are required. The aim of the current study was to investigate the synergistic antitumor effect of andrographolide (AND in combination with vincristine (VCR on WT cells.Methods: Cell Counting Kit-8 assay was used to investigate the synergistic antiproliferation effect of AND and/or VCR on SK-NEP-1 cells in vitro. Meanwhile, SK-NEP-1 xenografts were used to detect the antitumor effect in vivo. Apoptosis and autophagy were then detected by Annexin V, monodansylcadaverine staining. Finally, the underlying signaling transduction was determined with Western blotting.Results: The combination of AND with VCR significantly suppressed SK-NEP-1 cell proliferation in vitro and inhibited xenograft tumor growth in vivo, compared with AND or VCR treatment alone. In addition, the synergistic antitumor effect of AND on the cells was due to an increased apoptosis, not autophagy. Moreover, PI3K-AKT-p53 signaling pathway was involved in the process of combination treatment, which was confirmed when a selective AKT activator was applied.Conclusion: The combination of AND with VCR has a strong synergistic antitumor effect on WT via PI3K-AKT-p53 signaling pathway, thereby representing a potential treatment for WT in the near future. Keywords: andrographolide, vincristine, p53, drug combination

  9. P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.

    Science.gov (United States)

    Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A

    2015-10-29

    Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.

  10. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  11. Requirement of the ATM/p53 tumor suppressor pathway for glucose homeostasis.

    Science.gov (United States)

    Armata, Heather L; Golebiowski, Diane; Jung, Dae Young; Ko, Hwi Jin; Kim, Jason K; Sluss, Hayla K

    2010-12-01

    Ataxia telangiectasia (A-T) patients can develop multiple clinical pathologies, including neuronal degeneration, an elevated risk of cancer, telangiectasias, and growth retardation. Patients with A-T can also exhibit an increased risk of insulin resistance and type 2 diabetes. The ATM protein kinase, the product of the gene mutated in A-T patients (Atm), has been implicated in metabolic disease, which is characterized by insulin resistance and increased cholesterol and lipid levels, blood pressure, and atherosclerosis. ATM phosphorylates the p53 tumor suppressor on a site (Ser15) that regulates transcription activity. To test whether the ATM pathway that regulates insulin resistance is mediated by p53 phosphorylation, we examined insulin sensitivity in mice with a germ line mutation that replaces the p53 phosphorylation site with alanine. The loss of p53 Ser18 (murine Ser15) led to increased metabolic stress, including severe defects in glucose homeostasis. The mice developed glucose intolerance and insulin resistance. The insulin resistance correlated with the loss of antioxidant gene expression and decreased insulin signaling. N-Acetyl cysteine (NAC) treatment restored insulin signaling in late-passage primary fibroblasts. The addition of an antioxidant in the diet rendered the p53 Ser18-deficient mice glucose tolerant. This analysis demonstrates that p53 phosphorylation on an ATM site is an important mechanism in the physiological regulation of glucose homeostasis.

  12. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  13. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    Science.gov (United States)

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  14. p53/PUMA expression in human pulmonary fibroblasts mediates cell activation and migration in silicosis.

    Science.gov (United States)

    Wang, Wei; Liu, Haijun; Dai, Xiaoniu; Fang, Shencun; Wang, Xingang; Zhang, Yingming; Yao, Honghong; Zhang, Xilong; Chao, Jie

    2015-11-18

    Phagocytosis of SiO2 into the lung causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Clinical evidence has indicated that the activation of alveolar macrophages by SiO2 produces rapid and sustained inflammation characterized by the generation of monocyte chemotactic protein 1, which, in turn, induces fibrosis. However, the details of events downstream of monocyte chemotactic protein 1 activity in pulmonary fibroblasts remain unclear. Here, to elucidate the role of p53 in fibrosis induced by silica, both the upstream molecular mechanisms and the functional effects on cell proliferation and migration were investigated. Experiments using primary cultured adult human pulmonary fibroblasts led to the following results: 1) SiO2 treatment resulted in a rapid and sustained increase in p53 and PUMA protein levels; 2) the MAPK and PI3K pathways were involved in the SiO2-induced alteration of p53 and PUMA expression; and 3) RNA interference targeting p53 and PUMA prevented the SiO2-induced increases in fibroblast activation and migration. Our study elucidated a link between SiO2-induced p53/PUMA expression in fibroblasts and cell migration, thereby providing novel insight into the potential use of p53/PUMA in the development of novel therapeutic strategies for silicosis treatment.

  15. Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

    International Nuclear Information System (INIS)

    Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

    2001-01-01

    Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

  16. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  17. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  18. Heterozygous loss of TSC2 alters p53 signaling and human stem cell reprogramming.

    Science.gov (United States)

    Armstrong, Laura C; Westlake, Grant; Snow, John P; Cawthon, Bryan; Armour, Eric; Bowman, Aaron B; Ess, Kevin C

    2017-12-01

    Tuberous sclerosis complex (TSC) is a pediatric disorder of dysregulated growth and differentiation caused by loss of function mutations in either the TSC1 or TSC2 genes, which regulate mTOR kinase activity. To study aberrations of early development in TSC, we generated induced pluripotent stem cells using dermal fibroblasts obtained from patients with TSC. During validation, we found that stem cells generated from TSC patients had a very high rate of integration of the reprogramming plasmid containing a shRNA against TP53. We also found that loss of one allele of TSC2 in human fibroblasts is sufficient to increase p53 levels and impair stem cell reprogramming. Increased p53 was also observed in TSC2 heterozygous and homozygous mutant human stem cells, suggesting that the interactions between TSC2 and p53 are consistent across cell types and gene dosage. These results support important contributions of TSC2 heterozygous and homozygous mutant cells to the pathogenesis of TSC and the important role of p53 during reprogramming. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  20. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  1. Gene expression patterns associated with p53 status in breast cancer

    International Nuclear Information System (INIS)

    Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

    2006-01-01

    that were associated with subtype but not downstream of p53 signaling, and identified a signature for p53 loss that is shared across breast cancer subtypes

  2. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang, E-mail: songyangwenrong@hotmail.com

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings.

  3. RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

    Science.gov (United States)

    Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

    2014-06-14

    The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

  4. p53 Dependent Centrosome Clustering Prevents Multipolar Mitosis in Tetraploid Cells

    Science.gov (United States)

    Yi, Qiyi; Zhao, Xiaoyu; Huang, Yun; Ma, Tieliang; Zhang, Yingyin; Hou, Heli; Cooke, Howard J.; Yang, Da-Qing; Wu, Mian; Shi, Qinghua

    2011-01-01

    Background p53 abnormality and aneuploidy often coexist in human tumors, and tetraploidy is considered as an intermediate between normal diploidy and aneuploidy. The purpose of this study was to investigate whether and how p53 influences the transformation from tetraploidy to aneuploidy. Principal Findings Live cell imaging was performed to determine the fates and mitotic behaviors of several human and mouse tetraploid cells with different p53 status, and centrosome and spindle immunostaining was used to investigate centrosome behaviors. We found that p53 dominant-negative mutation, point mutation, or knockout led to a 2∼ 33-fold increase of multipolar mitosis in N/TERT1, 3T3 and mouse embryonic fibroblasts (MEFs), while mitotic entry and cell death were not significantly affected. In p53-/- tetraploid MEFs, the ability of centrosome clustering was compromised, while centrosome inactivation was not affected. Suppression of RhoA/ROCK activity by specific inhibitors in p53-/- tetraploid MEFs enhanced centrosome clustering, decreased multipolar mitosis from 38% to 20% and 16% for RhoA and ROCK, respectively, while expression of constitutively active RhoA in p53+/+ tetraploid 3T3 cells increased the frequency of multipolar mitosis from 15% to 35%. Conclusions p53 could not prevent tetraploid cells entering mitosis or induce tetraploid cell death. However, p53 abnormality impaired centrosome clustering and lead to multipolar mitosis in tetraploid cells by modulating the RhoA/ROCK signaling pathway. PMID:22076149

  5. Pharmacological activation of tumor suppressor, wild-type p53 as a promising strategy to fight cancer

    Directory of Open Access Journals (Sweden)

    Alicja Sznarkowska

    2010-08-01

    Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.

  6. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  7. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  8. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  9. COX-2 and p53 in human sinonasal cancer

    DEFF Research Database (Denmark)

    Holmila, Reetta; Cyr, Diane; Luce, Danièle

    2008-01-01

    The causal role of wood-dust exposure in sinonasal cancer (SNC) has been established in epidemiological studies, but the mechanisms of SNC carcinogenesis are still largely unknown. Increased amounts of COX-2 are found in both premalignant and malignant tissues, and experimental evidence link COX-2...... to development of cancer. Many signals that activate COX-2 also induce tumor suppressor p53, a transcription factor central in cellular stress response. We investigated COX-2 and p53 expressions by immunohistochemistry in 50 SNCs (23 adenocarcinomas, and 27 squamous cell carcinomas (SCC); 48 analyzed for COX-2...... displayed adenocarcinoma. COX-2 was expressed at higher levels in adenocarcinoma as compared to SSC (p COX-2 expression showed significant association with occupational exposure to wood dust (p = 0.024), and with nonsmoking status (p = 0.001). No statistically significant associations between...

  10. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    Science.gov (United States)

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  12. Immunohistochemical study of p53, pRb, p16 in esophageal cancer

    International Nuclear Information System (INIS)

    Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee

    1998-01-01

    To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs

  13. Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy

    Directory of Open Access Journals (Sweden)

    Christian M. Simon

    2017-12-01

    Full Text Available The hallmark of spinal muscular atrophy (SMA, an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons.

  14. Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeyran eShahbazi

    2013-05-01

    Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

  15. Andrographolide promotes vincristine-induced SK-NEP-1 tumor cell death via PI3K-AKT-p53 signaling pathway

    Science.gov (United States)

    Zhang, Mingsheng; Xue, Enda; Shao, Wei

    2016-01-01

    Background Nephroblastoma (Wilms’ tumor [WT]) is the most common malignant renal cancer in children. Although the outcome of WT has significantly improved as a result of the combination of surgery, chemotherapy, and radiotherapy; in some cases WT results in severe complications. Thus, novel strategies that would decrease treatment burden are required. The aim of the current study was to investigate the synergistic antitumor effect of andrographolide (AND) in combination with vincristine (VCR) on WT cells. Methods Cell Counting Kit-8 assay was used to investigate the synergistic antiproliferation effect of AND and/or VCR on SK-NEP-1 cells in vitro. Meanwhile, SK-NEP-1 xenografts were used to detect the antitumor effect in vivo. Apoptosis and autophagy were then detected by Annexin V, monodansylcadaverine staining. Finally, the underlying signaling transduction was determined with Western blotting. Results The combination of AND with VCR significantly suppressed SK-NEP-1 cell proliferation in vitro and inhibited xenograft tumor growth in vivo, compared with AND or VCR treatment alone. In addition, the synergistic antitumor effect of AND on the cells was due to an increased apoptosis, not autophagy. Moreover, PI3K-AKT-p53 signaling pathway was involved in the process of combination treatment, which was confirmed when a selective AKT activator was applied. Conclusion The combination of AND with VCR has a strong synergistic antitumor effect on WT via PI3K-AKT-p53 signaling pathway, thereby representing a potential treatment for WT in the near future. PMID:27729773

  16. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    International Nuclear Information System (INIS)

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd; Groesch, Sabine

    2008-01-01

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53 wt ) or being p(HCT-116 p53 -/- ), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53 -/- xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53 wt cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53 wt cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75 NTR , p53 and Bax

  17. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    Science.gov (United States)

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  18. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  19. p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors

    NARCIS (Netherlands)

    Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't

    1999-01-01

    Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this

  20. Recent progress of the study of p53 control mechanism by ionizing radiation

    International Nuclear Information System (INIS)

    Kawai, Hidehiko

    2004-01-01

    Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)

  1. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.

    1985-01-01

    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  2. Restoration of mp53 to wtp53 by chemical chaperones restores p53-dependent apoptosis after radiotherapy

    International Nuclear Information System (INIS)

    Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.

    2003-01-01

    The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future

  3. p53 inactivation decreases dependence on estrogen/ERK signalling for proliferation but promotes EMT and susceptility to 3-bromopyruvate in ERα+ breast cancer MCF-7 cells.

    Science.gov (United States)

    Rieber, Manuel; Strasberg-Rieber, Mary

    2014-03-15

    Most breast cancers express the estrogen receptor alpha (ERα(+)), harbor wt TP53, depend on estrogen/ERK signalling for proliferation, and respond to anti-estrogens. However, concomittant activation of the epidermal growth factor receptor (EGFR)/MEK pathway promotes resistance by decreasing estrogen dependence. Previously, we showed that retroviral transduction of mutant p53 R175H into wt TP53 ERα(+) MCF-7 cells induces epidermal growth factor (EGF)-independent proliferation, activation of the EGF receptor (p-EGFR) and some characteristics of epithelial-mesenchymal transition (EMT). To investigate whether p53 inactivation augments ERα(+) cell proliferation in response to restrictive estradiol, chemical MEK inhibition or metabolic inhibitors. Introduction of mutant p53 R175H lowered expression of p53-dependent PUMA and p21WAF1, decreased E-cadherin and cytokeratin 18 associated with EMT, but increased the % of proliferating ERα(+)/Ki67 cells, diminishing estrogen dependence. These cells also exhibited higher proliferation in the presence of MEK-inhibitor UO126, reciprocally correlating with preferential susceptibility to the pyruvate analog 3-bromopyruvate (3-BrPA) without a comparable response to 2-deoxyglucose. p53 siRNA silencing by electroporation in wt TP53 MCF-7 cells also decreased estrogen dependence and response to MEK inhibition, while also conferring susceptibility to 3-BrPA. (a) ERα(+) breast cancer cells dysfunctional for TP53 which proliferate irrespective of low estrogen and chemical MEK inhibition are likely to increase metabolic consumption becoming increasingly susceptible to 3-BrPA; (b) targeting the pyruvate pathway may improve response to endocrine therapy in ERα(+) breast cancer with p53 dysfunction. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  4. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  5. Agmatine Ameliorates High Glucose-Induced Neuronal Cell Senescence by Regulating the p21 and p53 Signaling.

    Science.gov (United States)

    Song, Juhyun; Lee, Byeori; Kang, Somang; Oh, Yumi; Kim, Eosu; Kim, Chul-Hoon; Song, Ho-Taek; Lee, Jong Eun

    2016-02-01

    Neuronal senescence caused by diabetic neuropathy is considered a common complication of diabetes mellitus. Neuronal senescence leads to the secretion of pro-inflammatory cytokines, the production of reactive oxygen species, and the alteration of cellular homeostasis. Agmatine, which is biosynthesized by arginine decarboxylation, has been reported in previous in vitro to exert a protective effect against various stresses. In present study, agmatine attenuated the cell death and the expression of pro-inflammatory cytokines such as IL-6, TNF-alpha and CCL2 in high glucose in vitro conditions. Moreover, the senescence associated-β-galatosidase's activity in high glucose exposed neuronal cells was reduced by agmatine. Increased p21 and reduced p53 in high glucose conditioned cells were changed by agmatine. Ultimately, agmatine inhibits the neuronal cell senescence through the activation of p53 and the inhibition of p21. Here, we propose that agmatine may ameliorate neuronal cell senescence in hyperglycemia.

  6. RITA enhances irradiation-induced apoptosis in p53-defective cervical cancer cells via upregulation of IRE1α/XBP1 signaling.

    Science.gov (United States)

    Zhu, Hong; Abulimiti, Muyasha; Liu, Huan; Su, Xiang-Jiang; Liu, Cai-Hong; Pei, Hai-Ping

    2015-09-01

    Radiation therapy is the most widely used treatment for patients with cervical cancer. Recent studies have shown that endoplasmic reticulum (ER) stress induces apoptosis and sensitizes tumor cells to radiotherapy, which reportedly induces ER stress in cells. Classical key tumor suppressor p53 is involved in the response to a variety of cellular stresses, including those incurred by ionizing irradiation. A recent study demonstrated that small-molecule RITA (reactivation of p53 and induction of tumor cell apoptosis) increased the radiosensitivity of tumor cells expressing mutant p53 (mtp53). In the present study, we explored the effects and the underlying mechanisms of RITA in regards to the radiosensitivity and ER stress in mtp53-expressing human cervix cancer cells. Treatment with 1 µM of RITA for 24 h before irradiation markedly decreased survival and increased apoptosis in C-33A and HT-3 cells; the effects were not significantly altered by knockdown of p53. In the irradiated C-33A and HT-3 cells, RITA significantly increased the expression of IRE1α, the spliced XBP1 mRNA level, as well as apoptosis; the effects were abolished by knockdown of IRE1α. Transcriptional pulse-chase assays revealed that RITA significantly increased the stability of IRE1α mRNA in the irradiated C-33A and HT-3 cells. In contrast, the same RITA treatment did not show any significant effect on sham-irradiated cells. In conclusion, the present study provides initial evidence that RITA upregulates the expression level of IRE1α by increasing the stability of IRE1α mRNA in irradiated mtp53-expressing cervical cancer cells; the effect leads to enhanced IRE1α/XBP1 ER stress signaling and increased apoptosis in the cells. The present study offers novel insight into the pharmacological potential of RITA in the radiotherapy for cervical cancer.

  7. Starvation-induced activation of ATM/Chk2/p53 signaling sensitizes cancer cells to cisplatin

    Directory of Open Access Journals (Sweden)

    Shi Yandong

    2012-12-01

    Full Text Available Abstract Background Optimizing the safety and efficacy of standard chemotherapeutic agents such as cisplatin (CDDP is of clinical relevance. Serum starvation in vitro and short-term food starvation in vivo both stress cells by the sudden depletion of paracrine growth stimulation. Methods The effects of serum starvation on CDDP toxicity were investigated in normal and cancer cells by assessing proliferation, cell cycle distribution and activation of DNA-damage response and of AMPK, and were compared to effects observed in cells grown in serum-containing medium. The effects of short-term food starvation on CDDP chemotherapy were assessed in xenografts-bearing mice and were compared to effects on tumor growth and/or regression determined in mice with no diet alteration. Results We observed that serum starvation in vitro sensitizes cancer cells to CDDP while protecting normal cells. In detail, in normal cells, serum starvation resulted in a complete arrest of cellular proliferation, i.e. depletion of BrdU-incorporation during S-phase and accumulation of the cells in the G0/G1-phase of the cell cycle. Further analysis revealed that proliferation arrest in normal cells is due to p53/p21 activation, which is AMPK-dependent and ATM-independent. In cancer cells, serum starvation also decreased the fraction of S-phase cells but to a minor extent. In contrast to normal cells, serum starvation-induced p53 activation in cancer cells is both AMPK- and ATM-dependent. Combination of CDDP with serum starvation in vitro increased the activation of ATM/Chk2/p53 signaling pathway compared to either treatment alone resulting in an enhanced sensitization of cancer cells to CDDP. Finally, short-term food starvation dramatically increased the sensitivity of human tumor xenografts to cisplatin as indicated not only by a significant growth delay, but also by the induction of complete remission in 60% of the animals bearing mesothelioma xenografts, and in 40% of the

  8. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

    Science.gov (United States)

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

    2017-10-01

    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  9. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  11. Activation of the Nkx2.5–Calr–p53 signaling pathway by hyperglycemia induces cardiac remodeling and dysfunction in adult zebrafish

    Directory of Open Access Journals (Sweden)

    Yanyi Sun

    2017-10-01

    Full Text Available Hyperglycemia is an independent risk factor for diabetic cardiomyopathy in humans; however, the underlying mechanisms have not been thoroughly elucidated. Zebrafish (Danio rerio was used in this study as a novel vertebrate model to explore the signaling pathways of human adult cardiomyopathy. Hyperglycemia was induced by alternately immersing adult zebrafish in a glucose solution or water. The hyperglycemic fish gradually exhibited some hallmarks of cardiomyopathy such as myocardial hypertrophy and apoptosis, myofibril loss, fetal gene reactivation, and severe arrhythmia. Echocardiography of the glucose-treated fish demonstrated diastolic dysfunction at an early stage and systolic dysfunction at a later stage, consistent with what is observed in diabetic patients. Enlarged hearts with decreased myocardial density, accompanied by decompensated cardiac function, indicated that apoptosis was critical in the pathological process. Significant upregulation of the expression of Nkx2.5 and its downstream targets calreticulin (Calr and p53 was noted in the glucose-treated fish. High-glucose stimulation in vitro evoked marked apoptosis of primary cardiomyocytes, which was rescued by the p53 inhibitor pifithrin-μ. In vitro experiments were performed using compound treatment and genetically via cell infection. Genetically, knockout of Nkx2.5 induced decreased expression of Nkx2.5, Calr and p53. Upregulation of Calr resulted in increased p53 expression, whereas the level of Nkx2.5 remained unchanged. An adult zebrafish model of hyperglycemia-induced cardiomyopathy was successfully established. Hyperglycemia-induced myocardial apoptosis was mediated, at least in part, by activation of the Nkx2.5–Calr–p53 pathway in vivo, resulting in cardiac dysfunction and hyperglycemia-induced cardiomyopathy.

  12. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  13. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  14. Epigenetic identification of ZNF545 as a functional tumor suppressor in multiple myeloma via activation of p53 signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Fan, Yu [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Zhan, Qian [The Center for Clinical Molecular Medical Detection, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xu, Hongying [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili; Li, Chen [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Xiao, Qian; Xiang, Shili; Hui, Tianli [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xiang, Tingxiu, E-mail: larissaxiang@163.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Ren, Guosheng, E-mail: rengs726@126.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)

    2016-06-10

    The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.

  15. Epigenetic identification of ZNF545 as a functional tumor suppressor in multiple myeloma via activation of p53 signaling pathway

    International Nuclear Information System (INIS)

    Fan, Yu; Zhan, Qian; Xu, Hongying; Li, Lili; Li, Chen; Xiao, Qian; Xiang, Shili; Hui, Tianli; Xiang, Tingxiu; Ren, Guosheng

    2016-01-01

    The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.

  16. Aspalathin Reverts Doxorubicin-Induced Cardiotoxicity through Increased Autophagy and Decreased Expression of p53/mTOR/p62 Signaling

    Directory of Open Access Journals (Sweden)

    Rabia Johnson

    2017-09-01

    Full Text Available Doxorubicin (Dox is an effective chemotherapeutic agent used in the treatment of various cancers. Its clinical use is often limited due to its potentially fatal cardiotoxic side effect. Increasing evidence indicates that tumour protein p53 (p53, adenosine monophosphate-activated protein kinase (AMPK, nucleoporin p62 (p62, and the mammalian target of rapamycin (mTOR are critical mediators of Dox-induced apoptosis, and subsequent dysregulation of autophagy. Aspalathin, a polyphenolic dihydrochalcone C-glucoside has been shown to activate AMPK while decreasing the expression of p53. However, the role that aspalathin could play in the inhibition of Dox-induced cardiotoxicity through increased autophagy flux remained unexplored. H9c2 cardiomyocytes and Caov-3 ovarian cancer cells were cultured in Dulbecco’s Modified Eagle’s medium and treated with or without Dox for five days. Thereafter, cells exposed to 0.2 µM Dox were co-treated with either 20 µM Dexrazozane (Dexra or 0.2 µM aspalathin (ASP daily for 5 days. Results obtained showed that ASP mediates its cytoprotective effect in a p53-dependent manner, by increasing the Bcl-2/Bax ratio and decreasing apoptosis. The latter effect was diminished through ASP-induced activation of autophagy-related genes (Atgs with an associated decrease in p62 through induction of AMPK and Fox01. Furthermore, we showed that ASP was able to potentiate this effect without decreasing the anti-cancer efficacy of Dox, as could be observed in Caov-3 ovarian cancer cells. Taken together, the data presented in this study provides a credible mechanism by which ASP co-treatment could protect the myocardium from Dox-induced cardiotoxicity.

  17. Repeated stimulation by LPS promotes the senescence of DPSCs via TLR4/MyD88-NF-κB-p53/p21 signaling.

    Science.gov (United States)

    Feng, Guijuan; Zheng, Ke; Cao, Tong; Zhang, Jinlong; Lian, Min; Huang, Dan; Wei, Changbo; Gu, Zhifeng; Feng, Xingmei

    2018-02-26

    Dental pulp stem cells (DPSCs), one type of mesenchymal stem cells, are considered to be a type of tool cells for regenerative medicine and tissue engineering. Our previous studies found that the stimulation with lipopolysaccharide (LPS) might introduce senescence of DPSCs, and this senescence would have a positive correlation with the concentration of LPS. The β-galactosidase (SA-β-gal) staining was used to evaluate the senescence of DPSCs and immunofluorescence to show the morphology of DPSCs. Our findings suggested that the activity of SA-β-gal has increased after repeated stimulation with LPS and the morphology of DPSCs has changed with the stimulation with LPS. We also found that LPS bound to the Toll-like receptor 4 (TLR4)/myeloid differentiation factor (MyD) 88 signaling pathway. Protein and mRNA expression of TLR4, MyD88 were enhanced in DPSCs with LPS stimulation, resulting in the activation of nuclear factor-κB (NF-κB) signaling, which exhibited the expression of p65 improved in the nucleus while the decreasing of IκB-α. Simultaneously, the expression of p53 and p21, the downstream proteins of the NF-κB signaling, has increased. In summary, DPSCs tend to undergo senescence after repeated stimulation in an inflammatory microenvironment. Ultimately, these findings may lead to a new direction for cell-based therapy in oral diseases and other regenerative medicines.

  18. Metformin and Resveratrol Inhibited High Glucose-Induced Metabolic Memory of Endothelial Senescence through SIRT1/p300/p53/p21 Pathway.

    Science.gov (United States)

    Zhang, Erli; Guo, Qianyun; Gao, Haiyang; Xu, Ruixia; Teng, Siyong; Wu, Yongjian

    2015-01-01

    Endothelial senescence plays crucial roles in diabetic vascular complication. Recent evidence indicated that transient hyperglycaemia could potentiate persistent diabetic vascular complications, a phenomenon known as "metabolic memory." Although SIRT1 has been demonstrated to mediate high glucose-induced endothelial senescence, whether and how "metabolic memory" would affect endothelial senescence through SIRT1 signaling remains largely unknown. In this study, we investigated the involvement of SIRT1 axis as well as the protective effects of resveratrol (RSV) and metformin (MET), two potent SIRT1 activators, during the occurrence of "metabolic memory" of cellular senescence (senescent "memory"). Human umbilical vascular endothelial cells (HUVECs) were cultured in either normal glucose (NG)/high glucose (HG) media for 6 days, or 3 days of HG followed by 3 days of NG (HN), with or without RSV or MET treatment. It was shown that HN incubation triggered persistent downregulation of deacetylase SIRT1 and upregulation of acetyltransferase p300, leading to sustained hyperacetylation (at K382) and activation of p53, and subsequent p53/p21-mediated senescent "memory." In contrast, senescent "memory" was abrogated by overexpression of SIRT1 or knockdown of p300. Interestingly, we found that SIRT1 and p300 could regulate each other in response to HN stimulation, suggesting that a delicate balance between acetyltransferases and deacetylases may be particularly important for sustained acetylation and activation of non-histone proteins (such as p53), and eventually the occurrence of "metabolic memory." Furthermore, we found that RSV or MET treatment prevented senescent "memory" by modulating SIRT1/p300/p53/p21 pathway. Notably, early and continuous treatment of MET, but not RSV, was particularly important for preventing senescent "memory." In conclusion, short-term high glucose stimulation could induce sustained endothelial senescence via SIRT1/p300/p53/p21 pathway. RVS or MET

  19. Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

    International Nuclear Information System (INIS)

    Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

    2008-01-01

    Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

  20. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  1. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

    2015-11-13

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  2. p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

    International Nuclear Information System (INIS)

    Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

    2015-01-01

    Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

  3. Abrogation of Gli3 expression suppresses the growth of colon cancer cells via activation of p53

    International Nuclear Information System (INIS)

    Kang, Han Na; Oh, Sang Cheul; Kim, Jun Suk; Yoo, Young A.

    2012-01-01

    p53, the major human tumor suppressor, appears to be related to sonic hedgehog (Shh)–Gli-mediated tumorigenesis. However, the role of p53 in tumor progression by the Shh–Gli signaling pathway is poorly understood. Herein we investigated the critical regulation of Gli3–p53 in tumorigenesis of colon cancer cells and the molecular mechanisms underlying these effects. RT-PCR analysis indicated that the mRNA level of Shh and Gli3 in colon tumor tissues was significantly higher than corresponding normal tissues (P < 0.001). The inhibition of Gli3 by treatment with Gli3 siRNA resulted in a clear decrease in cell proliferation and enhanced the level of expression of p53 proteins compared to treatment with control siRNA. The half-life of p53 was dramatically increased by treatment with Gli3 siRNA. In addition, treatment with MG132 blocked MDM2-mediated p53 ubiquitination and degradation, and led to accumulation of p53 in Gli3 siRNA-overexpressing cells. Importantly, ectopic expression of p53 siRNA reduced the ability of Gli3 siRNA to suppress proliferation of those cells compared with the cells treated with Gli3 siRNA alone. Moreover, Gli3 siRNA sensitized colon cancer cells to treatment with anti-cancer agents (5-FU and bevacizumab). Taken together, our studies demonstrate that loss of Gli3 signaling leads to disruption of the MDM2–p53 interaction and strongly potentiate p53-dependent cell growth inhibition in colon cancer cells, indicating a basis for the rational use of Gli3 antagonists as a novel treatment option for colon cancer.

  4. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  5. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    International Nuclear Information System (INIS)

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira

    2007-01-01

    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

  6. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

    Science.gov (United States)

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

    2013-04-16

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  7. A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine

    International Nuclear Information System (INIS)

    Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R

    2008-01-01

    p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development

  8. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    NARCIS (Netherlands)

    Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

  9. Mir-34a mimics are potential therapeutic agents for p53-mutated and chemo-resistant brain tumour cells.

    Directory of Open Access Journals (Sweden)

    Yuen Ngan Fan

    Full Text Available Chemotherapeutic drug resistance and relapse remains a major challenge for paediatric (medulloblastoma and adult (glioblastoma brain tumour treatment. Medulloblastoma tumours and cell lines with mutations in the p53 signalling pathway have been shown to be specifically insensitive to DNA damaging agents. The aim of this study was to investigate the potential of triggering cell death in p53 mutated medulloblastoma cells by a direct activation of pro-death signalling downstream of p53 activation. Since non-coding microRNAs (miRNAs have the ability to fine tune the expression of a variety of target genes, orchestrating multiple downstream effects, we hypothesised that triggering the expression of a p53 target miRNA could induce cell death in chemo-resistant cells. Treatment with etoposide, increased miR-34a levels in a p53-dependent fashion and the level of miR-34a transcription was correlated with the cell sensitivity to etoposide. miR-34a activity was validated by measuring the expression levels of one of its well described target: the NADH dependent sirtuin1 (SIRT1. Whilst drugs directly targeting SIRT1, were potent to trigger cell death at high concentrations only, introduction of synthetic miR-34a mimics was able to induce cell death in p53 mutated medulloblastoma and glioblastoma cell lines. Our results show that the need of a functional p53 signaling pathway can be bypassed by direct activation of miR-34a in brain tumour cells.

  10. Tumor-promoting phorbol ester transiently down-modulates the p53 level and blocks the cell cycle

    DEFF Research Database (Denmark)

    Skouv, J.; Jensen, P O; Forchhammer, J

    1994-01-01

    Activation of the protein kinase C signaling pathway by tumor-promoting phorbol esters, such as 4 beta-phorbol 12-myristate 13-acetate (PMA), induced a decrease in the level of p53 mRNA in several serum-starved human cell lines. Also, the tumor-promoting phosphatase inhibitor okadaic acid induced...... a decrease in the p53 mRNA level in the cell lines. Normal diploid as well as various tumor cell lines were tested. Two tumor cell lines, HeLa and A549, both containing the wild-type p53 gene, but very different levels of p53 protein, were studied in detail. In both cell lines, the level of p53 m......RNA was minimal after 9 h of exposure to PMA. After approximately 120 h, the p53 mRNA level was similar to the pretreatment level. PMA induced a similar transient decrease in the level of p53 protein in the A549 cell line. The decrease in the p53 mRNA level could not be explained by changes in the transcriptional...

  11. Long term effect of curcumin in restoration of tumour suppressor p53 and phase-II antioxidant enzymes via activation of Nrf2 signalling and modulation of inflammation in prevention of cancer.

    Directory of Open Access Journals (Sweden)

    Laxmidhar Das

    Full Text Available Inhibition of carcinogenesis may be a consequence of attenuation of oxidative stress via activation of antioxidant defence system, restoration and stabilization of tumour suppressor proteins along with modulation of inflammatory mediators. Previously we have delineated significant role of curcumin during its long term effect in regulation of glycolytic pathway and angiogenesis, which in turn results in prevention of cancer via modulation of stress activated genes. Present study was designed to investigate long term effect of curcumin in regulation of Nrf2 mediated phase-II antioxidant enzymes, tumour suppressor p53 and inflammation under oxidative tumour microenvironment in liver of T-cell lymphoma bearing mice. Inhibition of Nrf2 signalling observed during lymphoma progression, resulted in down regulation of phase II antioxidant enzymes, p53 as well as activation of inflammatory signals. Curcumin potentiated significant increase in Nrf2 activation. It restored activity of phase-II antioxidant enzymes like GST, GR, NQO1, and tumour suppressor p53 level. In addition, curcumin modulated inflammation via upregulation of TGF-β and reciprocal regulation of iNOS and COX2. The study suggests that during long term effect, curcumin leads to prevention of cancer by inducing phase-II antioxidant enzymes via activation of Nrf2 signalling, restoration of tumour suppressor p53 and modulation of inflammatory mediators like iNOS and COX2 in liver of lymphoma bearing mice.

  12. Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.

    Science.gov (United States)

    Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei

    2013-07-01

    Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

  13. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  14. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G

    2013-01-01

    Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

  15. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  16. The dynamics of p53 in single cells: physiologically based ODE and reaction–diffusion PDE models

    International Nuclear Information System (INIS)

    Eliaš, Ján; Clairambault, Jean; Dimitrio, Luna; Natalini, Roberto

    2014-01-01

    The intracellular signalling network of the p53 protein plays important roles in genome protection and the control of cell cycle phase transitions. Recently observed oscillatory behaviour in single cells under stress conditions has inspired several research groups to simulate and study the dynamics of the protein with the aim of gaining a proper understanding of the physiological meanings of the oscillations. We propose compartmental ODE and PDE models of p53 activation and regulation in single cells following DNA damage and we show that the p53 oscillations can be retrieved by plainly involving p53–Mdm2 and ATM–p53–Wip1 negative feedbacks, which are sufficient for oscillations experimentally, with no further need to introduce any delays into the protein responses and without considering additional positive feedback. (paper)

  17. Chemical Variations on the p53 Reactivation Theme

    Directory of Open Access Journals (Sweden)

    Carlos J. A. Ribeiro

    2016-05-01

    Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

  18. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    International Nuclear Information System (INIS)

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-01-01

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  19. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  20. p53 specific (auto)immunity in mice

    NARCIS (Netherlands)

    Lauwen, Marjolein Monique

    2008-01-01

    Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

  1. Naphthoquinone Derivative PPE8 Induces Endoplasmic Reticulum Stress in p53 Null H1299 Cells

    Directory of Open Access Journals (Sweden)

    Jin-Cherng Lien

    2015-01-01

    Full Text Available Endoplasmic reticulum (ER plays a key role in synthesizing secretory proteins and sensing signal function in eukaryotic cells. Responding to calcium disturbance, oxidation state change, or pharmacological agents, ER transmembrane protein, inositol-regulating enzyme 1 (IRE1, senses the stress and triggers downstream signals. Glucose-regulated protein 78 (GRP78 dissociates from IRE1 to assist protein folding and guard against cell death. In prolonged ER stress, IRE1 recruits and activates apoptosis signal-regulating kinase 1 (ASK1 as well as downstream JNK for cell death. Naphthoquinones are widespread natural phenolic compounds. Vitamin K3, a derivative of naphthoquinone, inhibits variant tumor cell growth via oxygen uptake and oxygen stress. We synthesized a novel naphthoquinone derivative PPE8 and evaluated capacity to induce ER stress in p53 null H1299 and p53 wild-type A549 cells. In H1299 cells, PPE8 induced ER enlargement, GRP78 expression, and transient IER1 activation. Activated IRE1 recruited ASK1 for downstream JNK phosphorylation. IRE1 knockdown by siRNA attenuated PPE8-induced JNK phosphorylation and cytotoxicity. Prolonged JNK phosphorylation may be involved in PPE8-induced cytotoxicity. Such results did not arise in A549 cells, but p53 knockdown by siRNA restored PPE8-induced GRP78 expression and JNK phosphorylation. We offer a novel compound to induce ER stress and cytotoxicity in p53-deficient cancer cells, presenting an opportunity for treatment.

  2. Limited role of murine ATM in oncogene-induced senescence and p53-dependent tumor suppression.

    Directory of Open Access Journals (Sweden)

    Alejo Efeyan

    Full Text Available Recent studies in human fibroblasts have provided a new general paradigm of tumor suppression according to which oncogenic signaling produces DNA damage and this, in turn, results in ATM/p53-dependent cellular senescence. Here, we have tested this model in a variety of murine experimental systems. Overexpression of oncogenic Ras in murine fibroblasts efficiently induced senescence but this occurred in the absence of detectable DNA damage signaling, thus suggesting a fundamental difference between human and murine cells. Moreover, lung adenomas initiated by endogenous levels of oncogenic K-Ras presented abundant senescent cells, but undetectable DNA damage signaling. Accordingly, K-Ras-driven adenomas were also senescent in Atm-null mice, and the tumorigenic progression of these lesions was only modestly accelerated by Atm-deficiency. Finally, we have examined chemically-induced fibrosarcomas, which possess a persistently activated DNA damage response and are highly sensitive to the activity of p53. We found that the absence of Atm favored genomic instability in the resulting tumors, but did not affect the persistent DNA damage response and did not impair p53-dependent tumor suppression. All together, we conclude that oncogene-induced senescence in mice may occur in the absence of a detectable DNA damage response. Regarding murine Atm, our data suggest that it plays a minor role in oncogene-induced senescence or in p53-dependent tumor suppression, being its tumor suppressive activity probably limited to the maintenance of genomic stability.

  3. Novel recurrent neural network for modelling biological networks: oscillatory p53 interaction dynamics.

    Science.gov (United States)

    Ling, Hong; Samarasinghe, Sandhya; Kulasiri, Don

    2013-12-01

    Understanding the control of cellular networks consisting of gene and protein interactions and their emergent properties is a central activity of Systems Biology research. For this, continuous, discrete, hybrid, and stochastic methods have been proposed. Currently, the most common approach to modelling accurate temporal dynamics of networks is ordinary differential equations (ODE). However, critical limitations of ODE models are difficulty in kinetic parameter estimation and numerical solution of a large number of equations, making them more suited to smaller systems. In this article, we introduce a novel recurrent artificial neural network (RNN) that addresses above limitations and produces a continuous model that easily estimates parameters from data, can handle a large number of molecular interactions and quantifies temporal dynamics and emergent systems properties. This RNN is based on a system of ODEs representing molecular interactions in a signalling network. Each neuron represents concentration change of one molecule represented by an ODE. Weights of the RNN correspond to kinetic parameters in the system and can be adjusted incrementally during network training. The method is applied to the p53-Mdm2 oscillation system - a crucial component of the DNA damage response pathways activated by a damage signal. Simulation results indicate that the proposed RNN can successfully represent the behaviour of the p53-Mdm2 oscillation system and solve the parameter estimation problem with high accuracy. Furthermore, we presented a modified form of the RNN that estimates parameters and captures systems dynamics from sparse data collected over relatively large time steps. We also investigate the robustness of the p53-Mdm2 system using the trained RNN under various levels of parameter perturbation to gain a greater understanding of the control of the p53-Mdm2 system. Its outcomes on robustness are consistent with the current biological knowledge of this system. As more

  4. Exploring a minimal two-component p53 model

    International Nuclear Information System (INIS)

    Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

    2010-01-01

    The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

  5. DWARF 53 acts as a repressor of strigolactone signalling in rice

    Science.gov (United States)

    Jiang, Liang; Liu, Xue; Xiong, Guosheng; Liu, Huihui; Chen, Fulu; Wang, Lei; Meng, Xiangbing; Liu, Guifu; Yu, Hong; Yuan, Yundong; Yi, Wei; Zhao, Lihua; Ma, Honglei; He, Yuanzheng; Wu, Zhongshan; Melcher, Karsten; Qian, Qian; Xu, H. Eric; Wang, Yonghong; Li, Jiayang

    2013-12-01

    Strigolactones (SLs) are a group of newly identified plant hormones that control plant shoot branching. SL signalling requires the hormone-dependent interaction of DWARF 14 (D14), a probable candidate SL receptor, with DWARF 3 (D3), an F-box component of the Skp-Cullin-F-box (SCF) E3 ubiquitin ligase complex. Here we report the characterization of a dominant SL-insensitive rice (Oryza sativa) mutant dwarf 53 (d53) and the cloning of D53, which encodes a substrate of the SCFD3 ubiquitination complex and functions as a repressor of SL signalling. Treatments with GR24, a synthetic SL analogue, cause D53 degradation via the proteasome in a manner that requires D14 and the SCFD3 ubiquitin ligase, whereas the dominant form of D53 is resistant to SL-mediated degradation. Moreover, D53 can interact with transcriptional co-repressors known as TOPLESS-RELATED PROTEINS. Our results suggest a model of SL signalling that involves SL-dependent degradation of the D53 repressor mediated by the D14-D3 complex.

  6. Long Non-Coding RNAs Embedded in the Rb and p53 Pathways

    Energy Technology Data Exchange (ETDEWEB)

    Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish, E-mail: ashish.lal@nih.gov [Genetics Branch, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892 (United States)

    2013-12-04

    In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways.

  7. Long Non-Coding RNAs Embedded in the Rb and p53 Pathways

    International Nuclear Information System (INIS)

    Subramanian, Murugan; Jones, Matthew F.; Lal, Ashish

    2013-01-01

    In recent years, long non-coding RNAs (lncRNAs) have gained significant attention as a novel class of gene regulators. Although a small number of lncRNAs have been shown to regulate gene expression through diverse mechanisms including transcriptional regulation, mRNA splicing and translation, the physiological function and mechanism of action of the vast majority are not known. Profiling studies in cell lines and tumor samples have suggested a potential role of lncRNAs in cancer. Indeed, distinct lncRNAs have been shown to be embedded in the p53 and Rb networks, two of the major tumor suppressor pathways that control cell cycle progression and survival. Given the fact that inactivation of Rb and p53 is a hallmark of human cancer, in this review we discuss recent evidence on the function of lncRNAs in the Rb and p53 signaling pathways

  8. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  9. Cell-Cycle-Specific Function of p53 in Fanconi Anemia Hematopoietic Stem and Progenitor Cell Proliferation

    Directory of Open Access Journals (Sweden)

    Xiaoli Li

    2018-02-01

    Full Text Available Summary: Overactive p53 has been proposed as an important pathophysiological factor for bone marrow failure syndromes, including Fanconi anemia (FA. Here, we report a p53-dependent effect on hematopoietic stem and progenitor cell (HSPC proliferation in mice deficient for the FA gene Fanca. Deletion of p53 in Fanca−/− mice leads to replicative exhaustion of the hematopoietic stem cell (HSC in transplant recipients. Using Fanca−/− HSCs expressing the separation-of-function mutant p53515C transgene, which selectively impairs the p53 function in apoptosis but keeps its cell-cycle checkpoint activities intact, we show that the p53 cell-cycle function is specifically required for the regulation of Fanca−/− HSC proliferation. Our results demonstrate that p53 plays a compensatory role in preventing FA HSCs from replicative exhaustion and suggest a cautious approach to manipulating p53 signaling as a therapeutic utility in FA. : In this article, Pang and colleagues demonstrate a p53-dependent HSPC proliferation regulation in mice deficient for the Fanca gene in the Fanconi anemia (FA pathway. They show that the p53 cell-cycle function is specifically required for the regulation of FA HSC proliferation. These results suggest that overactive p53 may represent a compensatory checkpoint mechanism for FA HSC proliferation. Keywords: p53, bone marrow failure, Fanconi anemia, hematopoietic stem and progenitor cells, apoptosis, cell cycle, proliferation

  10. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

    1993-01-01

    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  11. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

    1993-01-01

    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  12. p53 in differentiation of thyroid cancer

    International Nuclear Information System (INIS)

    Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

    1993-01-01

    P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

  13. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  14. p53 and the pathogenesis of skin cancer

    International Nuclear Information System (INIS)

    Benjamin, Cara L.; Ananthaswamy, Honnavara N.

    2007-01-01

    The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

  15. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    Science.gov (United States)

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Gain-of-function mutant p53 activates small GTPase Rac1 through SUMOylation to promote tumor progression.

    Science.gov (United States)

    Yue, Xuetian; Zhang, Cen; Zhao, Yuhan; Liu, Juan; Lin, Alan W; Tan, Victor M; Drake, Justin M; Liu, Lianxin; Boateng, Michael N; Li, Jun; Feng, Zhaohui; Hu, Wenwei

    2017-08-15

    Tumor suppressor p53 is frequently mutated in human cancer. Mutant p53 often promotes tumor progression through gain-of-function (GOF) mechanisms. However, the mechanisms underlying mutant p53 GOF are not well understood. In this study, we found that mutant p53 activates small GTPase Rac1 as a critical mechanism for mutant p53 GOF to promote tumor progression. Mechanistically, mutant p53 interacts with Rac1 and inhibits its interaction with SUMO-specific protease 1 (SENP1), which in turn inhibits SENP1-mediated de-SUMOylation of Rac1 to activate Rac1. Targeting Rac1 signaling by RNAi, expression of the dominant-negative Rac1 (Rac1 DN), or the specific Rac1 inhibitor NSC23766 greatly inhibits mutant p53 GOF in promoting tumor growth and metastasis. Furthermore, mutant p53 expression is associated with enhanced Rac1 activity in clinical tumor samples. These results uncover a new mechanism for Rac1 activation in tumors and, most importantly, reveal that activation of Rac1 is an unidentified and critical mechanism for mutant p53 GOF in tumorigenesis, which could be targeted for therapy in tumors containing mutant p53. © 2017 Yue et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Lunatic Fringe and p53 Cooperatively Suppress Mesenchymal Stem-Like Breast Cancer

    Directory of Open Access Journals (Sweden)

    Wen-Cheng Chung

    2017-11-01

    Full Text Available Claudin-low breast cancer (CLBC is a poor prognosis molecular subtype showing stemness and mesenchymal features. We previously discovered that deletion of a Notch signaling modulator, Lunatic Fringe (Lfng, in the mouse mammary gland induced a subset of tumors resembling CLBC. Here we report that deletion of one copy of p53 on this background not only accelerated mammary tumor development but also led to a complete penetrance of the mesenchymal stem-like phenotype. All mammary tumors examined in the Lfng/p53 compound mutant mice displayed a mesenchymal/spindloid pathology. These tumors showed high level expressions of epithelial-to-mesenchymal transition (EMT markers including Vimentin, Twist, and PDGFRα, a gene known to be enriched in CLBC. Prior to tumor onset, Lfng/p53 mutant mammary glands exhibited increased levels of Vimentin and E-cadherin, but decreased expressions of cytokeratin 14 and cytokeratin 8, accompanied by elevated basal cell proliferation and an expanded mammary stem cell-enriched population. Lfng/p53 mutant glands displayed increased accumulation of Notch3 intracellular fragment, up-regulation of Hes5 and down-regulation of Hes1. Analysis in human breast cancer datasets found the lowest HES1 and second lowest LFNG expressions in CLBC among molecular subtypes, and low level of LFNG is associated with poor survival. Immunostaining of human breast cancer tissue array found correlation between survival and LFNG immunoreactivity. Finally, patients carrying TP53 mutations express lower LFNG than patients with wild type TP53. Taken together, these data revealed genetic interaction between Lfng and p53 in mammary tumorigenesis, established a new mouse model resembling CLBC, and may suggest targeting strategy for this disease.

  18. A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

    Directory of Open Access Journals (Sweden)

    Alfredo Ribeiro-Silva

    2003-06-01

    Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

  19. System-based strategies for p53 recovery.

    Science.gov (United States)

    Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

    2018-06-01

    The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

  20. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  1. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  2. Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

    International Nuclear Information System (INIS)

    Tommaso, Anne di; Hagen, Jussara; Tompkins, Van; Muniz, Viviane; Dudakovic, Amel; Kitzis, Alain; Ladeveze, Veronique; Quelle, Dawn E.

    2009-01-01

    The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala 14 and Thr 31 ) were found to destabilize the protein while two others (Val 24 and Ala 41 ) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significant biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val 24 was required for p53-independent growth suppression whereas multiple residues (Val 24 , Thr 31 , Ala 41 and His 60 ) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.

  3. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

    Science.gov (United States)

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

    2018-05-31

    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Tumor hypoxia, p53, and prognosis in cervical cancers

    International Nuclear Information System (INIS)

    Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

    2001-01-01

    Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

  5. Analysis of p53- immunoreactivity in astrocytic brain tumors

    Directory of Open Access Journals (Sweden)

    Shinkarenko T.V.

    2016-12-01

    Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

  6. Phosphorylation of Tip60 by GSK-3 determines the induction of PUMA and apoptosis by p53

    Science.gov (United States)

    Charvet, Céline; Wissler, Manuela; Brauns-Schubert, Prisca; Wang, Shang-Jui; Tang, Yi; Sigloch, Florian C.; Mellert, Hestia; Brandenburg, Martin; Lindner, Silke E.; Breit, Bernhard; Green, Douglas R.; McMahon, Steven B.; Borner, Christoph; Gu, Wei; Maurer, Ulrich

    2011-01-01

    Summary Activation of p53 by DNA damage results in either cell cycle arrest, allowing DNA repair and cell survival, or induction of apoptosis. As these opposite outcomes are both mediated by p53 stabilization, additional mechanisms to determine this decision must exist. Here we show that glycogen synthase kinase-3 (GSK-3) is required for the p53-mediated induction of the pro-apoptotic BH3 only-protein PUMA, an essential mediator of p53-induced apoptosis. Inhibition of GSK-3 protected from cell death induced by DNA damage and promoted increased long-term cell survival. We demonstrate that GSK-3 phosphorylates serine 86 of the p53-acetyltransferase Tip60. A Tip60S86A mutant was less active to induce p53 K120 acetylation, Histone 4 acetylation and expression of PUMA. Our data suggest that GSK-3 mediated Tip60S86-phosphorylation provides a link between PI3K signaling and the choice for or against apoptosis induction by p53. PMID:21658600

  7. The Coordinated P53 and Estrogen Receptor Cis-Regulation at an FLT1 Promoter SNP Is Specific to Genotoxic Stress and Estrogenic Compound

    Science.gov (United States)

    Langen, Jan-Stephan; Schoenfelder, Gilbert; Resnick, Michael A.; Inga, Alberto

    2010-01-01

    Background Recently, we established that a C>T single nucleotide polymorphism (SNP) in the promoter of the VEGF receptor FLT1 gene generates a ½ site p53 response element (RE-T) that results in p53 responsiveness of the promoter. The transcriptional control required an estrogen receptor (ER) ½ site response element (ERE1) 225 nt upstream to the RE-T. Methodology/Principal Findings Here we report the identification of a second ER ½ site (ERE2) located 145 bp downstream of the RE-T and establish that both EREs can impact p53-mediated transactivation of FLT1-T in a manner that is cell type and ER level dependent. Gene reporter assays and ChIP experiments conducted in the breast cancer-derived MCF7 cells revealed that the ERE2 site was sufficient for p53-mediated ERα recruitment and transactivation of the FLT1-T promoter/reporter construct. Surprisingly, unlike the case for other p53 target promoters, p53-mediated transactivation of FLT1-T constructs or expression of the endogenous FLT1 gene, as well as binding of p53 and ER at the promoter constructs, was inducible by doxorubicin but not by 5-fluorouracil. Furthermore, ER activity at FLT1-T was differentially affected by ER ligands, compared to a control TFF1/pS2 ER target promoter. The p53-related transcription factors (TFs) p73 and p63 had no effect on FLT1 transactivation. Conclusions/Significance We establish a new dimension to the p53 master regulatory network where p53-mediated transcription from a ½ site RE can be determined by ER binding at one or more cis-acting EREs in manner that is dependent on level of ER protein, the type of ER ligand and the specific p53-inducing agent. PMID:20422012

  8. The nucleolus directly regulates p53 export and degradation.

    Science.gov (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  9. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  10. Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?

    International Nuclear Information System (INIS)

    Blackburn, Anneke C; Jerry, D Joseph

    2002-01-01

    The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer

  11. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Science.gov (United States)

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  12. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Matthew L Hirsch

    Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  13. Resveratrol suppresses IGF-1 induced human colon cancer cell proliferation and elevates apoptosis via suppression of IGF-1R/Wnt and activation of p53 signaling pathways

    Directory of Open Access Journals (Sweden)

    Radhakrishnan Sridhar

    2010-05-01

    Full Text Available Abstract Background Obesity is a global phenomenon and is associated with various types of cancer, including colon cancer. There is a growing interest for safe and effective bioactive compounds that suppress the risk for obesity-promoted colon cancer. Resveratrol (trans-3, 4', 5,-trihydroxystilbene, a stilbenoid found in the skin of red grapes and peanuts suppresses many types of cancers by regulating cell proliferation and apoptosis through a variety of mechanisms, however, resveratrol effects on obesity-promoted colon cancer are not clearly established. Methods We investigated the anti-proliferative effects of resveratrol on HT-29 and SW480 human colon cancer cells in the presence and absence of insulin like growth factor-1 (IGF-1; elevated during obesity and elucidated the mechanisms of action using IGF-1R siRNA in HT-29 cells which represents advanced colon carcinogenesis. Results Resveratrol (100-150 μM exhibited anti-proliferative properties in HT-29 cells even after IGF-1 exposure by arresting G0/G1-S phase cell cycle progression through p27 stimulation and cyclin D1 suppression. Treatment with resveratrol suppressed IGF-1R protein levels and concurrently attenuated the downstream Akt/Wnt signaling pathways that play a critical role in cell proliferation. Targeted suppression of IGF-1R using IGF-1R siRNA also affected these signaling pathways in a similar manner. Resveratrol treatment induced apoptosis by activating tumor suppressor p53 protein, whereas IGF-1R siRNA treatment did not affect apoptosis. Our data suggests that resveratrol not only suppresses cell proliferation by inhibiting IGF-1R and its downstream signaling pathways similar to that of IGF-1R siRNA but also enhances apoptosis via activation of the p53 pathway. Conclusions For the first time, we report that resveratrol suppresses colon cancer cell proliferation and elevates apoptosis even in the presence of IGF-1 via suppression of IGF-1R/Akt/Wnt signaling pathways and

  14. Resveratrol suppresses IGF-1 induced human colon cancer cell proliferation and elevates apoptosis via suppression of IGF-1R/Wnt and activation of p53 signaling pathways

    International Nuclear Information System (INIS)

    Vanamala, Jairam; Reddivari, Lavanya; Radhakrishnan, Sridhar; Tarver, Chris

    2010-01-01

    Obesity is a global phenomenon and is associated with various types of cancer, including colon cancer. There is a growing interest for safe and effective bioactive compounds that suppress the risk for obesity-promoted colon cancer. Resveratrol (trans-3, 4', 5,-trihydroxystilbene), a stilbenoid found in the skin of red grapes and peanuts suppresses many types of cancers by regulating cell proliferation and apoptosis through a variety of mechanisms, however, resveratrol effects on obesity-promoted colon cancer are not clearly established. We investigated the anti-proliferative effects of resveratrol on HT-29 and SW480 human colon cancer cells in the presence and absence of insulin like growth factor-1 (IGF-1; elevated during obesity) and elucidated the mechanisms of action using IGF-1R siRNA in HT-29 cells which represents advanced colon carcinogenesis. Resveratrol (100-150 μM) exhibited anti-proliferative properties in HT-29 cells even after IGF-1 exposure by arresting G 0 /G 1 -S phase cell cycle progression through p27 stimulation and cyclin D1 suppression. Treatment with resveratrol suppressed IGF-1R protein levels and concurrently attenuated the downstream Akt/Wnt signaling pathways that play a critical role in cell proliferation. Targeted suppression of IGF-1R using IGF-1R siRNA also affected these signaling pathways in a similar manner. Resveratrol treatment induced apoptosis by activating tumor suppressor p53 protein, whereas IGF-1R siRNA treatment did not affect apoptosis. Our data suggests that resveratrol not only suppresses cell proliferation by inhibiting IGF-1R and its downstream signaling pathways similar to that of IGF-1R siRNA but also enhances apoptosis via activation of the p53 pathway. For the first time, we report that resveratrol suppresses colon cancer cell proliferation and elevates apoptosis even in the presence of IGF-1 via suppression of IGF-1R/Akt/Wnt signaling pathways and activation of p53, suggesting its potential role as a

  15. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    Science.gov (United States)

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or

  16. Infection with E1B-mutant adenovirus stabilizes p53 but blocks p53 acetylation and activity through E1A

    DEFF Research Database (Denmark)

    Savelyeva, I.; Dobbelstein, M.

    2011-01-01

    to the suppression of p21 transcription. Depending on the E1A conserved region 3, E1B-defective adenovirus impaired the ability of the transcription factor Sp1 to bind the p21 promoter. Moreover, the amino terminal region of E1A, binding the acetyl transferases p300 and CREB-binding protein, blocked p53 K382...... accumulation of p53, without obvious defects in p53 localization, phosphorylation, conformation and oligomerization. Nonetheless, p53 completely failed to induce its target genes in this scenario, for example, p21/CDKN1A, Mdm2 and PUMA. Two regions of the E1A gene products independently contributed...... acetylation in infected cells. Mutating either of these E1A regions, in addition to E1B, partially restored p21 mRNA levels. Our findings argue that adenovirus attenuates p53-mediated p21 induction, through at least two E1B-independent mechanisms. Other virus species and cancer cells may employ analogous...

  17. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  18. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    Science.gov (United States)

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  19. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    Science.gov (United States)

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  20. p53 and ATF4 mediate distinct and additive pathways to skeletal muscle atrophy during limb immobilization

    Science.gov (United States)

    Fox, Daniel K.; Ebert, Scott M.; Bongers, Kale S.; Dyle, Michael C.; Bullard, Steven A.; Dierdorff, Jason M.; Kunkel, Steven D.

    2014-01-01

    Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways. PMID:24895282

  1. Expression of Androgen Receptor Is Negatively Regulated By p53

    Directory of Open Access Journals (Sweden)

    Fatouma Alimirah

    2007-12-01

    Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

  2. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  3. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    Science.gov (United States)

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  4. Reactivating p53 and Inducing Tumor Apoptosis (RITA Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin

    Directory of Open Access Journals (Sweden)

    Armin Wiegering

    2017-04-01

    Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number

  5. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

    2009-01-01

    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  6. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  7. P53-miR-191-SOX4 regulatory loop affects apoptosis in breast cancer.

    Science.gov (United States)

    Sharma, Shivani; Nagpal, Neha; Ghosh, Prahlad C; Kulshreshtha, Ritu

    2017-08-01

    miRNAs have emerged as key participants of p53 signaling pathways because they regulate or are regulated by p53. Here, we provide the first study demonstrating direct regulation of an oncogenic miRNA, miR-191-5p, by p53 and existence of a regulatory feedback loop. Using a combination of qRT-PCR, promoter-luciferase, and chromatin-immunoprecipitation assays, we show that p53 brings about down-regulation of miR-191-5p in breast cancer. miR-191-5p overexpression brought about inhibition of apoptosis in breast cancer cell lines (MCF7 and ZR-75) as demonstrated by reduction in annexin-V stained cells and caspase 3/7 activity, whereas miR-191-5p down-regulation showed the opposite. We further unveiled that SOX4 was a direct target of miR-191-5p. SOX4 overexpression was shown to increase p53 protein levels in MCF7 cells. miR-191-5p overexpression brought about down-regulation of SOX4 and thus p53 levels, suggesting the existence of a regulatory feedback loop. Breast cancer treatment by doxorubicin, an anti-cancer drug, involves induction of apoptosis by p53; we thus wanted to check whether miR-191-5p affects doxorubicin sensitivity. Interestingly, Anti-miR-191 treatment significantly decreased the IC50 of the doxorubicin drug and thus sensitized breast cancer cells to doxorubicin treatment by promoting apoptosis. Overall, this work highlights the importance of the p53-miR-191- SOX4 axis in the regulation of apoptosis and drug resistance in breast cancer and offers a preclinical proof-of-concept for use of an Anti-miR-191 and doxorubicin combination as a rational approach to pursue for better breast cancer treatment. © 2017 Sharma et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. The genetic alteration of p53 in esophageal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1996-01-01

    Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

  9. A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

    Science.gov (United States)

    Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

    2018-05-23

    PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

  10. The induction of a tumor suppressor gene (p53) expression by low-dose radiation and its biological meaning

    International Nuclear Information System (INIS)

    Ohnishi, Takeo

    1997-01-01

    I report the induced accumulation of wild-type p53 protein of a tumor suppressor gene within 12 h in various organs of rats exposed to X-ray irradiation at low doses (10-50 cGy). The levels of p53 in some organs of irradiated rats were increased about 2- to 3-fold in comparison with the basal p53 levels in non-irradiated rats. Differences in the levels of p53 induction after low-dose X-ray irradiation were observed among the small intestine, bone marrow, brain, liver, adrenal gland, spleen, hypophysis and skin. In contrast, there was no obvious accumulation of p53 protein in the testis and ovary. Thus, the induction of cellular p.53 accumulation by low-dose X-ray irradiation in rats seems to be organ-specific. I consider that cell type, and interactions with other signal transduction pathways of the hormone system, immune system and nervous system may contribute to the variable induction of p53 by low-dose X-ray irradiation. I discussed the induction of p53 by radiation and its biological meaning from an aspect of the defense system for radiation-induced cancer. (author)

  11. Low grade inflammation inhibits VEGF induced HUVECs migration in p53 dependent manner

    International Nuclear Information System (INIS)

    Panta, Sushil; Yamakuchi, Munekazu; Shimizu, Toshiaki; Takenouchi, Kazunori; Oyama, Yoko; Koriyama, Toyoyasu; Kojo, Tsuyoshi; Hashiguchi, Teruto

    2017-01-01

    In the course of studying crosstalk between inflammation and angiogenesis, high doses of pro-inflammatory factors have been reported to induce apoptosis in cells. Under normal circumstances also the pro-inflammatory cytokines are being released in low doses and are actively involved in cell signaling pathways. We studied the effects of low grade inflammation in growth factor induced angiogenesis using tumor necrosis factor alfa (TNFα) and vascular endothelial growth factor A (VEGF) respectively. We found that low dose of TNFα can inhibit VEGF induced angiogenesis in human umbilical vein endothelial cells (HUVECs). Low dose of TNFα induces mild upregulation and moreover nuclear localization of tumor suppressor protein 53 (P53) which causes decrease in inhibitor of DNA binding-1 (Id1) expression and shuttling to the cytoplasm. In absence of Id1, HUVECs fail to upregulate β 3 -integrin and cell migration is decreased. Connecting low dose of TNFα induced p53 to β 3 -integrin through Id1, we present additional link in cross talk between inflammation and angiogenesis. - Highlights: • Low grade inflammation (low dose of TNF alfa) inhibits VEGF induced endothelial cells migration. • The low grade inflammation with VEGF treatment upregulates P53 to a nonlethal level. • P53 activation inhibits Id1 shuttling to the cytoplasm in endothelial cells. • Inhibition of Id1 resulted in downregulation of β 3 -integrin which cause decrease in cell migration. • Inflammation and angiogenesis might cross-talk by P53 – Id1 – β 3 -integrin pathway in endothelial cells.

  12. The Satellite Cell Niche Regulates the Balance between Myoblast Differentiation and Self-Renewal via p53.

    Science.gov (United States)

    Flamini, Valentina; Ghadiali, Rachel S; Antczak, Philipp; Rothwell, Amy; Turnbull, Jeremy E; Pisconti, Addolorata

    2018-03-13

    Satellite cells are adult muscle stem cells residing in a specialized niche that regulates their homeostasis. How niche-generated signals integrate to regulate gene expression in satellite cell-derived myoblasts is poorly understood. We undertook an unbiased approach to study the effect of the satellite cell niche on satellite cell-derived myoblast transcriptional regulation and identified the tumor suppressor p53 as a key player in the regulation of myoblast quiescence. After activation and proliferation, a subpopulation of myoblasts cultured in the presence of the niche upregulates p53 and fails to differentiate. When satellite cell self-renewal is modeled ex vivo in a reserve cell assay, myoblasts treated with Nutlin-3, which increases p53 levels in the cell, fail to differentiate and instead become quiescent. Since both these Nutlin-3 effects are rescued by small interfering RNA-mediated p53 knockdown, we conclude that a tight control of p53 levels in myoblasts regulates the balance between differentiation and return to quiescence. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  14. Hormonal control of p53 and chemoprevention

    International Nuclear Information System (INIS)

    Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

    2002-01-01

    Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

  15. Friend or Foe: MicroRNAs in the p53 network.

    Science.gov (United States)

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  16. Deficiency of G1 regulators P53, P21Cip1 and/or pRb decreases hepatocyte sensitivity to TGFβ cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Harrison David J

    2007-11-01

    Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of

  17. CD95 is part of a let-7/p53/miR-34 regulatory network.

    Directory of Open Access Journals (Sweden)

    Annika Hau

    Full Text Available The death receptor CD95 (APO-1/Fas mediates apoptosis induction upon ligation by its cognate ligand CD95L. Two types of CD95 signaling pathways have been identified, which are characterized by the absence (Type I or presence (Type II of mitochondrial involvement. Micro(miRNAs are small noncoding RNAs that negatively regulate gene expression. They are important regulators of differentiation processes and are found frequently deregulated in many human cancers. We recently showed that Type I cells express less of the differentiation marker miRNA let-7 and, hence, likely represent more advanced tumor cells than the let-7 high expressing Type II cells. We have now identified miR-34a as a selective marker for cells that are sensitive to CD95-mediated apoptosis. Both CD95 and miR-34a are p53 target genes, and consequently, both the sensitivity of cancer cells to CD95-mediated apoptosis and the ability to respond to p53 mediated DNA genotoxic stress are linked. Interestingly, while miR-34a was found to positively correlate with the ability of cells to respond to genotoxic stress, let-7 was negatively correlated. The expression level of CD95 inversely correlated with the expression of let-7 suggesting regulation of let-7 expression by CD95. To test a link between p53 and miR-34a, we altered the expression of CD95. This affected the ability of cells to activate p53 and to regulate miR-34a. Our data point to a novel regulatory network comprising p53, CD95, let-7, and miR-34a that affects cancer cell survival, differentiation, and sensitivity to apoptotic signals. The possible relevance of this regulatory network for cancer stem cells is discussed.

  18. UVC-induced apoptosis in Dubca cells is independent of JNK activation and p53Ser-15 phosphorylation

    International Nuclear Information System (INIS)

    Chathoth, Shahanas; Thayyullathil, Faisal; Hago, Abdulkader; Shahin, Allen; Patel, Mahendra; Galadari, Sehamuddin

    2009-01-01

    Ultraviolet C (UVC) irradiation in mammalian cell lines activates a complex signaling network that leads to apoptosis. By using Dubca cells as a model system, we report the presence of a UVC-induced apoptotic pathway that is independent of c-Jun N-terminal kinases (JNKs) activation and p53 phosphorylation at Ser 15 . Irradiation of Dubca cells with UVC results in a rapid JNK activation and phosphorylation of its downstream target c-Jun, as well as, phosphorylation of activating transcription factor 2 (ATF2). Pre-treatment with JNK inhibitor, SP600125, inhibited UVC-induced c-Jun phosphorylation without preventing UVC-induced apoptosis. Similarly, inhibition of UVC-induced p53 phosphorylation did not prevent Dubca cell apoptosis, suggesting that p53 Ser-15 phosphorylation is not associated with UVC-induced apoptosis signaling. The pan-caspase inhibitor z-VAD-fmk inhibited UVC-induced PARP cleavage, DNA fragmentation, and ultimately apoptosis of Dubca cells. Altogether, our study clearly indicates that UVC-induced apoptosis is independent of JNK and p53 activation in Dubca cells, rather, it is mediated through a caspase dependent pathway. Our findings are not in line with the ascribed critical role for JNKs activation, and downstream phosphorylation of targets such as c-Jun and ATF2 in UVC-induced apoptosis.

  19. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  20. A dual role of p53 in the control of autophagy.

    Science.gov (United States)

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  1. TAF6delta controls apoptosis and gene expression in the absence of p53.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Wilhelm

    Full Text Available BACKGROUND: Life and death decisions of metazoan cells hinge on the balance between the expression of pro- versus anti-apoptotic gene products. The general RNA polymerase II transcription factor, TFIID, plays a central role in the regulation of gene expression through its core promoter recognition and co-activator functions. The core TFIID subunit TAF6 acts in vitro as an essential co-activator of transcription for the p53 tumor suppressor protein. We previously identified a splice variant of TAF6, termed TAF6delta that can be induced during apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: To elucidate the impact of TAF6delta on cell death and gene expression, we have employed modified antisense oligonucleotides to enforce expression of endogenous TAF6delta. The induction of endogenous TAF6delta triggered apoptosis in tumor cell lines, including cells devoid of p53. Microarray experiments revealed that TAF6delta activates gene expression independently of cellular p53 status. CONCLUSIONS: Our data define TAF6delta as a pivotal node in a signaling pathway that controls gene expression programs and apoptosis in the absence of p53.

  2. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  3. Exercise Activates p53 and Negatively Regulates IGF-1 Pathway in Epidermis within a Skin Cancer Model.

    Science.gov (United States)

    Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun

    2016-01-01

    Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.

  4. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  5. Targeting p53 by small molecules in hematological malignancies

    OpenAIRE

    Saha, Manujendra N; Qiu, Lugui; Chang, Hong

    2013-01-01

    p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...

  6. Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

    Science.gov (United States)

    Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

    2017-06-01

    The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

  7. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    Science.gov (United States)

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514

  8. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription

    OpenAIRE

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-01-01

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulat...

  9. Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

    Science.gov (United States)

    Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

    2016-01-01

    Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

  10. CK1α ablation in keratinocytes induces p53-dependent, sunburn-protective skin hyperpigmentation.

    Science.gov (United States)

    Chang, Chung-Hsing; Kuo, Che-Jung; Ito, Takamichi; Su, Yu-Ya; Jiang, Si-Tse; Chiu, Min-Hsi; Lin, Yi-Hsiung; Nist, Andrea; Mernberger, Marco; Stiewe, Thorsten; Ito, Shosuke; Wakamatsu, Kazumasa; Hsueh, Yi-An; Shieh, Sheau-Yann; Snir-Alkalay, Irit; Ben-Neriah, Yinon

    2017-09-19

    Casein kinase 1α (CK1α), a component of the β-catenin destruction complex, is a critical regulator of Wnt signaling; its ablation induces both Wnt and p53 activation. To characterize the role of CK1α (encoded by Csnk1a1 ) in skin physiology, we crossed mice harboring floxed Csnk1a1 with mice expressing K14-Cre-ER T2 to generate mice in which tamoxifen induces the deletion of Csnk1a1 exclusively in keratinocytes [single-knockout (SKO) mice]. As expected, CK1α loss was accompanied by β-catenin and p53 stabilization, with the preferential induction of p53 target genes, but phenotypically most striking was hyperpigmentation of the skin, importantly without tumorigenesis, for at least 9 mo after Csnk1a1 ablation. The number of epidermal melanocytes and eumelanin levels were dramatically increased in SKO mice. To clarify the putative role of p53 in epidermal hyperpigmentation, we established K14-Cre-ER T2 CK1α/p53 double-knockout (DKO) mice and found that coablation failed to induce epidermal hyperpigmentation, demonstrating that it was p53-dependent. Transcriptome analysis of the epidermis revealed p53-dependent up-regulation of Kit ligand (KitL). SKO mice treated with ACK2 (a Kit-neutralizing antibody) or imatinib (a Kit inhibitor) abrogated the CK1α ablation-induced hyperpigmentation, demonstrating that it requires the KitL/Kit pathway. Pro-opiomelanocortin (POMC), a precursor of α-melanocyte-stimulating hormone (α-MSH), was not activated in the CK1α ablation-induced hyperpigmentation, which is in contrast to the mechanism of p53-dependent UV tanning. Nevertheless, acute sunburn effects were successfully prevented in the hyperpigmented skin of SKO mice. CK1α inhibition induces skin-protective eumelanin but no carcinogenic pheomelanin and may therefore constitute an effective strategy for safely increasing eumelanin via UV-independent pathways, protecting against acute sunburn.

  11. Post-translational regulation enables robust p53 regulation.

    Science.gov (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-08-30

    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  12. SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease

    Energy Technology Data Exchange (ETDEWEB)

    Wang, P.; Israelian, L.; Xue, Y.; Song, S.; Attisano, L.; Minassian, B.

    2016-07-01

    Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

  13. SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease

    International Nuclear Information System (INIS)

    Wang, P.; Israelian, L.; Xue, Y.; Song, S.; Attisano, L.; Minassian, B.

    2016-01-01

    Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

  14. Data on the putative role of p53 in breast cancer cell adhesion: Technical information for adhesion assay

    Directory of Open Access Journals (Sweden)

    Kallirroi Voudouri

    2016-12-01

    Full Text Available In this data article, the potential role of p53 tumor suppressor gene (p53 on the attachment ability of MCF-7 breast cancer cells was investigated. In our main article, “IGF-I/ EGF and E2 signaling crosstalk through IGF-IR conduit point affect breast cancer cell adhesion” (K. Voudouri, D. Nikitovic, A. Berdiaki, D. Kletsas, N.K. Karamanos, G.N. Tzanakakis, 2016 [1], we describe the key role of IGF-IR in breast cancer cell adhesion onto fibronectin (FN. p53 tumor suppressor gene is a principal regulator of cancer cell proliferation. Various data have demonstrated an association between p53 and IGF-IR actions on cell growth through its’ putative regulation of IGF-IR expression. According to our performed experiments, p53 does not modify IGF-IR expression and does not affect basal MCF-7 cells adhesion onto FN. Moreover, technical details about the performance of adhesion assay onto the FN substrate were provided.

  15. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    Science.gov (United States)

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  16. Specific TP53 Mutants Overrepresented in Ovarian Cancer Impact CNV, TP53 Activity, Responses to Nutlin-3a, and Cell Survival

    Directory of Open Access Journals (Sweden)

    Lisa K. Mullany

    2015-10-01

    Full Text Available Evolutionary Action analyses of The Cancer Gene Atlas data sets show that many specific p53 missense and gain-of-function mutations are selectively overrepresented and functional in high-grade serous ovarian cancer (HGSC. As homozygous alleles, p53 mutants are differentially associated with specific loss of heterozygosity (R273; chromosome 17; copy number variation (R175H; chromosome 9; and up-stream, cancer-related regulatory pathways. The expression of immune-related cytokines was selectively related to p53 status, showing for the first time that specific p53 mutants impact, and are related to, the immune subtype of ovarian cancer. Although the majority (31% of HGSCs exhibit loss of heterozygosity, a significant number (24% maintain a wild-type (WT allele and represent another HGSC subtype that is not well defined. Using human and mouse cell lines, we show that specific p53 mutants differentially alter endogenous WT p53 activity; target gene expression; and responses to nutlin-3a, a small molecular that activates WT p53 leading to apoptosis, providing “proof of principle” that ovarian cancer cells expressing WT and mutant alleles represent a distinct ovarian cancer subtype. We also show that siRNA knock down of endogenous p53 in cells expressing homozygous mutant alleles causes apoptosis, whereas cells expressing WT p53 (or are heterozygous for WT and mutant p53 alleles are highly resistant. Therefore, despite different gene regulatory pathways associated with specific p53 mutants, silencing mutant p53 might be a suitable, powerful, global strategy for blocking ovarian cancer growth in those tumors that rely on mutant p53 functions for survival. Knowing p53 mutational status in HGSC should permit new strategies tailored to control this disease.

  17. Increased toll-like receptors and p53 levels regulate apoptosis and angiogenesis in non-muscle invasive bladder cancer: mechanism of action of P-MAPA biological response modifier.

    Science.gov (United States)

    Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; de Mello Júnior, Wilson; Duran, Nelson; Macedo, Alda Maria; de Oliveira, Alexandre Gabarra; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José

    2016-07-07

    The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic

  18. Interactions between the otitis media gene, Fbxo11, and p53 in the mouse embryonic lung.

    Science.gov (United States)

    Tateossian, Hilda; Morse, Susan; Simon, Michelle M; Dean, Charlotte H; Brown, Steve D M

    2015-12-01

    Otitis media with effusion (OME) is the most common cause of hearing loss in children, and tympanostomy (ear tube insertion) to alleviate the condition remains the commonest surgical intervention in children in the developed world. Chronic and recurrent forms of otitis media (OM) are known to have a very substantial genetic component; however, until recently, little was known of the underlying genes involved. The Jeff mouse mutant carries a mutation in the Fbxo11 gene, a member of the F-box family, and develops deafness due to a chronic proliferative OM. We previously reported that Fbxo11 is involved in the regulation of transforming growth factor beta (TGF-β) signalling by regulating the levels of phospho-Smad2 in the epithelial cells of palatal shelves, eyelids and airways of the lungs. It has been proposed that FBXO11 regulates the cell's response to TGF-β through the ubiquitination of CDT2. Additional substrates for FBXO11 have been identified, including p53. Here, we have studied both the genetic and biochemical interactions between FBXO11 and p53 in order to better understand the function of FBXO11 in epithelial development and its potential role in OM. In mice, we show that p53 (also known as Tp53) homozygous mutants and double heterozygous mutants (Jf/+ p53/+) exhibit similar epithelial developmental defects to Fbxo11 homozygotes. FBXO11 and p53 interact in the embryonic lung, and mutation in Fbxo11 prevents the interaction with p53. Both p53 and double mutants show raised levels of pSMAD2, recapitulating that seen in Fbxo11 homozygotes. Overall, our results support the conclusion that FBXO11 regulates the TGF-β pathway in the embryonic lung via cross-talk with p53. © 2015. Published by The Company of Biologists Ltd.

  19. Genomic alterations during p53-dependent apoptosis induced by γ-irradiation of Molt-4 leukemia cells.

    Directory of Open Access Journals (Sweden)

    Rouba Hage-Sleiman

    Full Text Available Molt-4 leukemia cells undergo p53-dependent apoptosis accompanied by accumulation of de novo ceramide after 14 hours of γ-irradiation. In order to identify the potential mediators involved in ceramide accumulation and the cell death response, differentially expressed genes were identified by Affymetrix Microarray Analysis. Molt-4-LXSN cells, expressing wild type p53, and p53-deficient Molt-4-E6 cells were irradiated and harvested at 3 and 8 hours post-irradiation. Human genome U133 plus 2.0 array containing >47,000 transcripts was used for gene expression profiling. From over 10,000 probes, 281 and 12 probes were differentially expressed in Molt-4-LXSN and Molt-4-E6 cells, respectively. Data analysis revealed 63 (upregulated and 20 (downregulated genes (>2 fold in Molt-4-LXSN at 3 hours and 140 (upregulated and 21 (downregulated at 8 hours post-irradiation. In Molt-4-E6 cells, 5 (upregulated genes each were found at 3 hours and 8 hours, respectively. In Molt-4-LXSN cells, a significant fraction of the genes with altered expression at 3 hours were found to be involved in apoptosis signaling pathway (BCL2L11, p53 pathway (PMAIP1, CDKN1A and FAS and oxidative stress response (FDXR, CROT and JUN. Similarly, at 8 hours the genes with altered expression were involved in the apoptosis signaling pathway (BAX, BIK and JUN, p53 pathway (BAX, CDKN1A and FAS, oxidative stress response (FDXR and CROT and p53 pathway feedback loops 2 (MDM2 and CDKN1A. A global molecular and biological interaction map analysis showed an association of these altered genes with apoptosis, senescence, DNA damage, oxidative stress, cell cycle arrest and caspase activation. In a targeted study, activation of apoptosis correlated with changes in gene expression of some of the above genes and revealed sequential activation of both intrinsic and extrinsic apoptotic pathways that precede ceramide accumulation and subsequent execution of apoptosis. One or more of these altered genes

  20. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  1. Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

    Science.gov (United States)

    Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

    2017-08-01

    p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

  2. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  4. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

  5. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  6. Haploinsufficiency for Core Exon Junction Complex Components Disrupts Embryonic Neurogenesis and Causes p53-Mediated Microcephaly.

    Directory of Open Access Journals (Sweden)

    Hanqian Mao

    2016-09-01

    Full Text Available The exon junction complex (EJC is an RNA binding complex comprised of the core components Magoh, Rbm8a, and Eif4a3. Human mutations in EJC components cause neurodevelopmental pathologies. Further, mice heterozygous for either Magoh or Rbm8a exhibit aberrant neurogenesis and microcephaly. Yet despite the requirement of these genes for neurodevelopment, the pathogenic mechanisms linking EJC dysfunction to microcephaly remain poorly understood. Here we employ mouse genetics, transcriptomic and proteomic analyses to demonstrate that haploinsufficiency for each of the 3 core EJC components causes microcephaly via converging regulation of p53 signaling. Using a new conditional allele, we first show that Eif4a3 haploinsufficiency phenocopies aberrant neurogenesis and microcephaly of Magoh and Rbm8a mutant mice. Transcriptomic and proteomic analyses of embryonic brains at the onset of neurogenesis identifies common pathways altered in each of the 3 EJC mutants, including ribosome, proteasome, and p53 signaling components. We further demonstrate all 3 mutants exhibit defective splicing of RNA regulatory proteins, implying an EJC dependent RNA regulatory network that fine-tunes gene expression. Finally, we show that genetic ablation of one downstream pathway, p53, significantly rescues microcephaly of all 3 EJC mutants. This implicates p53 activation as a major node of neurodevelopmental pathogenesis following EJC impairment. Altogether our study reveals new mechanisms to help explain how EJC mutations influence neurogenesis and underlie neurodevelopmental disease.

  7. ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

    International Nuclear Information System (INIS)

    Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

    2007-01-01

    We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

  8. FGF1 protects neuroblastoma SH-SY5Y cells from p53-dependent apoptosis through an intracrine pathway regulated by FGF1 phosphorylation

    Science.gov (United States)

    Pirou, Caroline; Montazer-Torbati, Fatemeh; Jah, Nadège; Delmas, Elisabeth; Lasbleiz, Christelle; Mignotte, Bernard; Renaud, Flore

    2017-01-01

    Neuroblastoma, a sympathetic nervous system tumor, accounts for 15% of cancer deaths in children. In contrast to most human tumors, p53 is rarely mutated in human primary neuroblastoma, suggesting impaired p53 activation in neuroblastoma. Various studies have shown correlations between fgf1 expression levels and both prognosis severity and tumor chemoresistance. As we previously showed that fibroblast growth factor 1 (FGF1) inhibited p53-dependent apoptosis in neuron-like PC12 cells, we initiated the study of the interaction between the FGF1 and p53 pathways in neuroblastoma. We focused on the activity of either extracellular FGF1 by adding recombinant rFGF1 in media, or of intracellular FGF1 by overexpression in human SH-SY5Y and mouse N2a neuroblastoma cell lines. In both cell lines, the genotoxic drug etoposide induced a classical mitochondrial p53-dependent apoptosis. FGF1 was able to inhibit p53-dependent apoptosis upstream of mitochondrial events in SH-SY5Y cells by both extracellular and intracellular pathways. Both rFGF1 addition and etoposide treatment increased fgf1 expression in SH-SY5Y cells. Conversely, rFGF1 or overexpressed FGF1 had no effect on p53-dependent apoptosis and fgf1 expression in neuroblastoma N2a cells. Using different FGF1 mutants (that is, FGF1K132E, FGF1S130A and FGF1S130D), we further showed that the C-terminal domain and phosphorylation of FGF1 regulate its intracrine anti-apoptotic activity in neuroblastoma SH-SY5Y cells. This study provides the first evidence for a role of an intracrine growth factor pathway on p53-dependent apoptosis in neuroblastoma, and could lead to the identification of key regulators involved in neuroblastoma tumor progression and chemoresistance. PMID:29048426

  9. IGF-I enhances cellular senescence via the reactive oxygen species-p53 pathway

    Energy Technology Data Exchange (ETDEWEB)

    Handayaningsih, Anastasia-Evi; Takahashi, Michiko; Fukuoka, Hidenori; Iguchi, Genzo; Nishizawa, Hitoshi; Yamamoto, Masaaki; Suda, Kentaro [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan); Takahashi, Yutaka, E-mail: takahash@med.kobe-u.ac.jp [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan)

    2012-08-24

    Highlights: Black-Right-Pointing-Pointer Cellular senescence plays an important role in tumorigenesis and aging process. Black-Right-Pointing-Pointer We demonstrated IGF-I enhanced cellular senescence in primary confluent cells. Black-Right-Pointing-Pointer IGF-I enhanced cellular senescence in the ROS and p53-dependent manner. Black-Right-Pointing-Pointer These results may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging. -- Abstract: Cellular senescence is characterized by growth arrest, enlarged and flattened cell morphology, the expression of senescence-associated {beta}-galactosidase (SA-{beta}-gal), and by activation of tumor suppressor networks. Insulin-like growth factor-I (IGF-I) plays a critical role in cellular growth, proliferation, tumorigenesis, and regulation of aging. In the present study, we show that IGF-I enhances cellular senescence in mouse, rat, and human primary cells in the confluent state. IGF-I induced expression of a DNA damage marker, {gamma}H2AX, the increased levels of p53 and p21 proteins, and activated SA-{beta}-gal. In the confluent state, an altered downstream signaling of IGF-I receptor was observed. Treatment with a reactive oxygen species (ROS) scavenger, N-acetylcystein (NAC) significantly suppressed induction of these markers, indicating that ROS are involved in the induction of cellular senescence by IGF-I. In p53-null mouse embryonic fibroblasts, the IGF-I-induced augmentation of SA-{beta}-gal and p21 was inhibited, demonstrating that p53 is required for cellular senescence induced by IGF-I. Thus, these data reveal a novel pathway whereby IGF-I enhances cellular senescence in the ROS and p53-dependent manner and may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging.

  10. IGF-I enhances cellular senescence via the reactive oxygen species–p53 pathway

    International Nuclear Information System (INIS)

    Handayaningsih, Anastasia-Evi; Takahashi, Michiko; Fukuoka, Hidenori; Iguchi, Genzo; Nishizawa, Hitoshi; Yamamoto, Masaaki; Suda, Kentaro; Takahashi, Yutaka

    2012-01-01

    Highlights: ► Cellular senescence plays an important role in tumorigenesis and aging process. ► We demonstrated IGF-I enhanced cellular senescence in primary confluent cells. ► IGF-I enhanced cellular senescence in the ROS and p53-dependent manner. ► These results may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging. -- Abstract: Cellular senescence is characterized by growth arrest, enlarged and flattened cell morphology, the expression of senescence-associated β-galactosidase (SA-β-gal), and by activation of tumor suppressor networks. Insulin-like growth factor-I (IGF-I) plays a critical role in cellular growth, proliferation, tumorigenesis, and regulation of aging. In the present study, we show that IGF-I enhances cellular senescence in mouse, rat, and human primary cells in the confluent state. IGF-I induced expression of a DNA damage marker, γH2AX, the increased levels of p53 and p21 proteins, and activated SA-β-gal. In the confluent state, an altered downstream signaling of IGF-I receptor was observed. Treatment with a reactive oxygen species (ROS) scavenger, N-acetylcystein (NAC) significantly suppressed induction of these markers, indicating that ROS are involved in the induction of cellular senescence by IGF-I. In p53-null mouse embryonic fibroblasts, the IGF-I-induced augmentation of SA-β-gal and p21 was inhibited, demonstrating that p53 is required for cellular senescence induced by IGF-I. Thus, these data reveal a novel pathway whereby IGF-I enhances cellular senescence in the ROS and p53-dependent manner and may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging.

  11. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  12. Newly synthesized quinazolinone HMJ-38 suppresses angiogenetic responses and triggers human umbilical vein endothelial cell apoptosis through p53-modulated Fas/death receptor signaling

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, Jo-Hua [Department of Life Sciences, National Chung Hsing University, 250, Kuo-Kuang Road, Taichung 402, Taiwan (China); Yang, Jai-Sing [Department of Pharmacology, China Medical University, Taichung 404, Taiwan (China); Lu, Chi-Cheng [Department of Life Sciences, National Chung Hsing University, 250, Kuo-Kuang Road, Taichung 402, Taiwan (China); Hour, Mann-Jen; Chang, Shu-Jen [School of Pharmacy, China Medical University, Taichung 40402, Taiwan (China); Lee, Tsung-Han, E-mail: thlee@email.nchu.edu.tw [Department of Life Sciences, National Chung Hsing University, 250, Kuo-Kuang Road, Taichung 402, Taiwan (China); Department of Biological Science and Technology, China Medical University, 91, Hsueh-Shih Road, Taichung 404, Taiwan (China); Chung, Jing-Gung, E-mail: jgchung@mail.cmu.edu.tw [Department of Biological Science and Technology, China Medical University, 91, Hsueh-Shih Road, Taichung 404, Taiwan (China); Department of Biotechnology, Asia University, Taichung 413, Taiwan (China)

    2013-06-01

    The current study aims to investigate the antiangiogenic responses and apoptotic death of human umbilical vein endothelial cells (HUVECs) by a newly synthesized compound named 2-(3′-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone (HMJ-38). This work attempted to not only explore the effects of angiogenesis on in vivo and ex vivo studies but also hypothesize the implications for HUVECs (an ideal cell model for angiogenesis in vitro) and further undermined apoptotic experiments to verify the underlying molecular signaling by HMJ-38. Our results demonstrated that HMJ-38 significantly inhibited blood vessel growth and microvessel formation by the mouse Matrigel plug assay of angiogenesis, and the suppression of microsprouting from the rat aortic ring assay was observed after HMJ-38 exposure. In addition, HMJ-38 disrupted the tube formation and blocked the ability of HUVECs to migrate in response to VEGF. We also found that HMJ-38 triggered cell apoptosis of HUVECs in vitro. HMJ-38 concentration-dependently suppressed viability and induced apoptotic damage in HUVECs. HMJ-38-influenced HUVECs were performed by determining the oxidative stress (ROS production) and ATM/p53-modulated Fas and DR4/DR5 signals that were examined by flow cytometry, Western blotting, siRNA and real-time RT-PCR analyses, respectively. Our findings demonstrate that p53-regulated extrinsic pathway might fully contribute to HMJ-38-provoked apoptotic death in HUVECs. In view of these observations, we conclude that HMJ-38 reduces angiogenesis in vivo and ex vivo as well as induces apoptosis of HUVECs in vitro. Overall, HMJ-38 has a potent anti-neovascularization effect and could warrant being a vascular targeting agent in the future. - Highlights: • HMJ-38 suppresses angiogenic actions in vivo and ex vivo. • Inhibitions of blood vessel and microvessel formation by HMJ-38 are acted. • Cytotoxic effects of HUVECs occur by HMJ-38 challenge. • p53-modulated extrinsic pathway contributes to HMJ-38

  13. The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status

    International Nuclear Information System (INIS)

    Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer

    2011-01-01

    The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21− combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21− carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status

  14. Dynamics of p53: A Master Decider of Cell Fate

    Directory of Open Access Journals (Sweden)

    Qingyin Luo

    2017-02-01

    Full Text Available Cellular stress‐induced temporal alterations—i.e., dynamics—are typically exemplified  by the dynamics of p53 that serve as a master to determine cell fate. p53 dynamics were initially  identified as the variations of p53 protein levels. However, a growing number of studies have  shown that p53 dynamics are also manifested in variations in the activity, spatial location, and  posttranslational modifications of p53 proteins, as well as the interplay among all p53 dynamical  features. These are essential in determining a specific outcome of cell fate. In this review, we  discuss the importance of the multifaceted features of p53 dynamics and their roles in the cell fate  decision process, as well as their potential applications in p53‐based cancer therapy. The review  provides new insights into p53 signaling pathways and their potentials in the development of new  strategies in p53‐based cancer therapy.

  15. GTPBP4 Promotes Gastric Cancer Progression via Regulating P53 Activity

    Directory of Open Access Journals (Sweden)

    Li Li

    2018-01-01

    Full Text Available Background/Aims: gastric cancer is a serious health concern with high morbidity and mortality. Therefore, it is urgent to find novel targets for gastric cancer diagnosis and treatment. Methods: qRT-PCR and immunohistochemistry assays were used to detect GTPBP4 expression in gastric cancer tissues, and gastric cancer and gastric epithelial cells. Lentivirus infection was used to construct GTPBP4 stable knockdown cells. Annexin V/PI apoptosis, CCK8, EdU incorporation and cell clone formation analysis were performed to evaluate the effects of GTPBP4 on gastric cancer cell proliferation and apoptosis. Further RNA-based high-throughput sequencing and co-IP assays were constructed to explore the related mechanisms contributing to GTPBP4-mediated effects. Results: GTPBP4 expression was significantly increased in gastric cancer tissues compared with that in adjacent normal tissues, and positively correlated with gastric cancer stages. Meanwhile, GTPBP4 level was markedly upregulated in gastric cancer cells than in gastric epithelial cells. Additionaly, stable knockdown of GTPBP4 inhibited cell proliferation and promoted cell apoptosis. Mechanistically, p53 and its related signaling were significantly activated in GTPBP4 stable knockdown cells. And GTPBP4 interacted with p53 in gastric cancer cells. Conclusions: our results provide insights into mechanistic regulation and linkage of the GTPBP4-p53 in gastric cancer, and also a valuable potential target for gastric cancer.

  16. Molecular mechanism of X-ray-induced p53-dependent apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

    1999-03-01

    Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

  17. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  18. Mycotoxin zearalenone induces AIF- and ROS-mediated cell death through p53- and MAPK-dependent signaling pathways in RAW264.7 macrophages.

    Science.gov (United States)

    Yu, Ji-Yeon; Zheng, Zhong-Hua; Son, Young-Ok; Shi, Xianglin; Jang, Young-Oh; Lee, Jeong-Chae

    2011-12-01

    Zearalenone (ZEN) is commonly found in many food commodities and is known to cause reproductive disorders and genotoxic effects. However, the mode of ZEN-induced cell death of macrophages and the mechanisms by which ZEN causes cytotoxicity remain unclear. The present study shows that ZEN treatment reduces viability of RAW264.7 cells in a dose-dependent manner. ZEN causes predominantly necrotic and late apoptotic cell death. ZEN treatment also results in the loss of mitochondrial membrane potential (MMP), mitochondrial changes in Bcl-2 and Bax proteins, and cytoplasmic release of cytochrome c and apoptosis-inducing factor (AIF). Pre-treatment of the cells with either z-VAD-fmk or z-IETD-fmk does not attenuate ZEN-mediated cell death, whereas catalase suppresses the ZEN-induced decrease in viability in RAW264.7 cells. Treating the cells with c-Jun N-terminal kinase (JNK), p38 mitogen-activated protein kinase (MAPK), or p53 inhibitor prevented ZEN-mediated changes, such as MMP loss, cellular reactive oxygen species (ROS) increase, and cell death. JNK or p38 MAPK inhibitor inhibited mitochondrial alterations of Bcl-2 and Bax proteins with attendant decreases in cellular ROS levels. Knockdown of AIF via siRNA transfection also diminished ZEN-induced cell death. Further, adenosine triphosphate was markedly depleted in the ZEN-exposed cells. Collectively, these results suggest that ZEN induces cytotoxicity in RAW264.7 cells via AIF- and ROS-mediated signaling, in which the activations of p53 and JNK/p38 play a key role. Copyright © 2011 Elsevier Ltd. All rights reserved.

  19. Stimulation of autophagy by the p53 target gene Sestrin2.

    Science.gov (United States)

    Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

    2009-05-15

    The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

  20. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du

    2010-12-01

    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  1. Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

    International Nuclear Information System (INIS)

    Deocaris, Custer C.

    2004-01-01

    Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

  2. Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

    Directory of Open Access Journals (Sweden)

    Kristina Kirschner

    2015-03-01

    Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

  3. Downregulation of B-myb promotes senescence via the ROS-mediated p53/p21 pathway, in vascular endothelial cells.

    Science.gov (United States)

    Zhou, Zhihui; Yin, Yanlin; Chang, Qun; Sun, Guanqun; Lin, Jiahui; Dai, Yalei

    2017-04-01

    To reveal whether B-myb is involved in preventing senescence of vascular endothelial cells, and if so, to identify possible mechanisms for it. C57/BL6 male mice and primary human aortic endothelial cells (HAECs) were used. Bleomycin was applied to induce stress-related premature senescence. B-myb knockdown was achieved using an siRNA technique and cell senescence was assessed using the senescence-associated β-galactosidase (SA-β-gal) assay. Intracellular reactive oxygen species (ROS) production was analysed using an ROS assay kit and cell proliferation was evaluated using KFluor488 EdU kit. Capillary tube network formation was determined by Matrigel assay. Expressions of mRNA and protein levels were detected by real-time PCR and western blotting. B-myb expression significantly decreased, while p53 and p21 expressions increased in the aortas of aged mice. This expression pattern was also found in replicative senescent HAECs and senescent HAECs induced by bleomycin. B-myb knockdown resulted in upregulation of p22 phox , ROS accumulation and cell senescence of HAECs. Downregulation of B-myb significantly inhibited cell proliferation and capillary tube network formation and activated the p53/p21 signalling pathway. Blocking ROS production or inhibiting p53 activation remarkably attenuated SA-β-gal activity and delayed cell senescence induced by B-myb-silencing. Downregulation of B-myb induced senescence by upregulation of p22 phox and activation of the ROS/p53/p21 pathway, in our vascular endothelial cells, suggesting that B-myb may be a novel candidate for regulating cell senescence to protect against endothelial senescence-related cardiovascular diseases. © 2016 John Wiley & Sons Ltd.

  4. Probucol Attenuates Cyclophosphamide-induced Oxidative Apoptosis, p53 and Bax Signal Expression in Rat Cardiac Tissues

    Directory of Open Access Journals (Sweden)

    Yousif A. Asiri

    2010-01-01

    Full Text Available Cyclophosphamide (CP is a widely used drug in cancer chemotherapy and immunosuppression, which could cause toxicity of the normal cells due to its toxic metabolites. Probucol, a cholesterol-lowering drug, acts as potential inhibitor of DNA damage and shows to protect against doxorubicin-induced cardiomyopathy by enhancing the endogenous antioxidant system including glutathione peroxidase, catalase and superoxide dismutase. This study examined the possible protective effects of probucol, a lipid-lowering compound with strong antioxidant properties, against CPinduced cardiotoxicity. This objective could be achieved through studying the gene expression-based on the possible protective effects of probucol against CP-induced cardiac failure in rats. Adult male Wistar albino rats were assigned into four treatment groups: Animals in the first (control and second (probucol groups were injected intraperitoneally with corn oil and probucol (61 mg/kg/day, respectively, for two weeks. Animals in the third (CP and fourth (probucol plus CP groups were injected with the same doses of corn oil and probucol (61 mg/kg/day, respectively, for one week before and one week after a single dose of CP (200 mg/kg, I.P.. The p53, Bax, Bcl2 and oxidative genes signal expression were measured by real time PCR. CP-induced cardiotoxicity was clearly observed by a significant increase in serum creatine phosphokinase isoenzyme (CK-MB (117%, lactate dehydrogenase (LDH (64%, free (69% and esterified cholesterol (42% and triglyceride (69% compared to control group. In cardiac tissues, CP significantly increases the mRNA expression levels of apoptotic genes, p53 with two-fold and Bax with 1.6-fold, and decreases the anti-apoptotic gene Bcl2 with 0.5-fold. Moreover, CP caused downregulation of antioxidant genes, glutathione peroxidase, catalase, and superoxide dismutase and increased the lipid peroxidation and decreased adenosine triphosphate (ATP (40% and ATP/ADP (44% in cardiac

  5. Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression

    Directory of Open Access Journals (Sweden)

    Shang-Jui Wang

    2016-10-01

    Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.

  6. Individual variation in p53 and Cip1 expression profiles in normal human fibroblast strains following exposure to high-let radiation

    Energy Technology Data Exchange (ETDEWEB)

    Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D. [Univ. of New Mexico, Albuquerque, NM (United States)] [and others

    1995-12-01

    Exposure to {alpha}-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of {alpha}-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to {alpha}-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G{sub 1} portion of the cell cycle. Arrest in G{sub 1} portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following {alpha}-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following {alpha}-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant.

  7. Individual variation in p53 and Cip1 expression profiles in normal human fibroblast strains following exposure to high-let radiation

    International Nuclear Information System (INIS)

    Carpenter, T.R.; Johnson, N.F.; Gilliland, F.D.

    1995-01-01

    Exposure to α-particles emitted by radon progeny appears to be the second-leading cause of lung cancer mortality. However, individual susceptibility to the carcinogenic effects of α-particles remains poorly characterized. Variation in susceptibility to cancer produced by certian classes of DNA-damaging chemicals is suspected to involve differences in metabolic activation and detoxication. Susceptibility to α-particle-induced cancer may involve variations in capacity or opportunity to repair DNA damage. Subtle variations in DNA repair capacity would more likely explain radon-related lung cancer susceptibility. The p53 tumor suppressor protein accumulates as a cellular response to DNA damage from ionizing radiation and regulates arrest in the G 1 portion of the cell cycle. Arrest in G 1 portion of the cell cycle. While upstream regulation of p53 protein stability is poorly understood, variations in the ability to accumulate p53 following DNA damage represent potential variations in lung cancer susceptibility related to radon progeny. Further, transcription of the cell-cycle regulatory gene Cip1 is regulated by p53 and increases following ionizing radiation. Therefore, variations in the expression of Cip1 following α-particle exposure may also be a susceptibility factor in radon-related lung cancers. The purpose of the present investigation was to measure p53 and Cip1 protein induction following α-particle exposure of fibroblast lines from nine individuals to determine if there were significant variations. The expression of Cip1 protein indicates the differences in response are biologically relevant

  8. p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

    Directory of Open Access Journals (Sweden)

    Sally Hopkins-Donaldson

    2006-07-01

    Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

  9. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  10. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  11. Luteolin Prevents H2O2-Induced Apoptosis in H9C2 Cells through Modulating Akt-P53/Mdm2 Signaling Pathway

    Directory of Open Access Journals (Sweden)

    Hong Chang

    2016-01-01

    Full Text Available Introduction. Luteolin, a falconoid compound in many Chinese herbs and formula, plays important roles in cardiovascular diseases. The underlying mechanism of luteolin remains to be further elaborated. Methods. A model of hydrogen peroxide- (H2O2- induced H9C2 cells apoptosis was established. Cell viabilities were examined with an MTT assay. 2′,7′-Dichlorofluorescin diacetate (DCFH-DA and flow cytometry were used to detect ROS level and apoptosis rate, respectively. The expressions of signaling proteins related to apoptosis were analyzed by western blot and mRNA levels were detected by real-time polymerase chain reaction (PCR. Quercetin was applied as positive drug. Results. Incubation with various concentrations of H2O2 (0, 50, 100, and 200 μM for 1 h caused dose-dependent loss of cell viability and 100 μM H2O2 reduced the cell viability to approximately 50%. Treatments with luteolin and quercetin protected cells from H2O2-induced cytotoxicity and reduced cellular ROS level and apoptosis rate. Moreover, luteolin could downregulate the expressions of Bax, caspase-8, cleaved-caspase-3, and p53 in apoptotic signaling pathway. Further study showed that the expressions of Akt, Bcl-2, and Mdm2 were upregulated by luteolin. Conclusion. Luteolin protects H9C2 cells from H2O2-induced apoptosis. The protective and antiapoptotic effects of luteolin could be mediated by regulating the Akt-P53/Mdm2 apoptotic pathway.

  12. Family matters: sibling rivalry and bonding between p53 and p63 in cancer.

    Science.gov (United States)

    Romano, Rose-Anne; Sinha, Satrajit

    2014-04-01

    The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. p53 tumor suppressor gene: significance in neoplasia - a review

    International Nuclear Information System (INIS)

    Alam, J.M.

    2000-01-01

    p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

  14. 1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

    Directory of Open Access Journals (Sweden)

    Fuqiang Xing

    Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

  15. Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

    Directory of Open Access Journals (Sweden)

    Lu Xin

    2009-06-01

    Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

  16. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  17. Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

    International Nuclear Information System (INIS)

    Frey, L. M.; Houben, R.; Brocker, E. B.

    2011-01-01

    Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

  18. The human T-cell leukemia virus type-1 p30II protein activates p53 and induces the TIGAR and suppresses oncogene-induced oxidative stress during viral carcinogenesis.

    Science.gov (United States)

    Romeo, Megan; Hutchison, Tetiana; Malu, Aditi; White, Averi; Kim, Janice; Gardner, Rachel; Smith, Katie; Nelson, Katherine; Bergeson, Rachel; McKee, Ryan; Harrod, Carolyn; Ratner, Lee; Lüscher, Bernhard; Martinez, Ernest; Harrod, Robert

    2018-05-01

    In normal cells, aberrant oncogene expression leads to the accumulation of cytotoxic metabolites, including reactive oxygen species (ROS), which can cause oxidative DNA-damage and apoptosis as an intrinsic barrier against neoplastic disease. The c-Myc oncoprotein is overexpressed in many lymphoid cancers due to c-myc gene amplification and/or 8q24 chromosomal translocations. Intriguingly, p53 is a downstream target of c-Myc and hematological malignancies, such as adult T-cell leukemia/lymphoma (ATL), frequently contain wildtype p53 and c-Myc overexpression. We therefore hypothesized that p53-regulated pro-survival signals may thwart the cell's metabolic anticancer defenses to support oncogene-activation in lymphoid cancers. Here we show that the Tp53-induced glycolysis and apoptosis regulator (TIGAR) promotes c-myc oncogene-activation by the human T-cell leukemia virus type-1 (HTLV-1) latency-maintenance factor p30 II , associated with c-Myc deregulation in ATL clinical isolates. TIGAR prevents the intracellular accumulation of c-Myc-induced ROS and inhibits oncogene-induced cellular senescence in ATL, acute lymphoblastic leukemia, and multiple myeloma cells with elevated c-Myc expression. Our results allude to a pivotal role for p53-regulated antioxidant signals as mediators of c-Myc oncogenic functions in viral and non-viral lymphoid tumors. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    Science.gov (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  20. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  1. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  2. Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

    Directory of Open Access Journals (Sweden)

    Ravshan Burikhanov

    2014-01-01

    Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

  3. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  4. Apoptosis in spermatogonia irradiated P53 null mice

    International Nuclear Information System (INIS)

    Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.

    2007-01-01

    Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after

  5. Pax3 stimulates p53 ubiquitination and degradation independent of transcription.

    Directory of Open Access Journals (Sweden)

    Xiao Dan Wang

    Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.

  6. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  7. p63 expression confers significantly better survival outcomes in high-risk diffuse large B-cell lymphoma and demonstrates p53-like and p53-independent tumor suppressor function

    DEFF Research Database (Denmark)

    Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin

    2016-01-01

    with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...

  8. REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO

    Science.gov (United States)

    XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.

    2015-01-01

    The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern

  9. p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

    NARCIS (Netherlands)

    Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.

    2015-01-01

    Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

  10. Characterisation of the p53 pathway in cell lines established from TH-MYCN transgenic mouse tumours.

    Science.gov (United States)

    Chen, Lindi; Esfandiari, Arman; Reaves, William; Vu, Annette; Hogarty, Michael D; Lunec, John; Tweddle, Deborah A

    2018-03-01

    Cell lines established from the TH-MYCN transgenic murine model of neuroblastoma are a valuable preclinical, immunocompetent, syngeneic model of neuroblastoma, for which knowledge of their p53 pathway status is important. In this study, the Trp53 status and functional response to Nutlin-3 and ionising radiation (IR) were determined in 6 adherent TH-MYCN transgenic cell lines using Sanger sequencing, western blot analysis and flow cytometry. Sensitivity to structurally diverse MDM2 inhibitors (Nutlin-3, MI-63, RG7388 and NDD0005) was determined using XTT proliferation assays. In total, 2/6 cell lines were Trp53 homozygous mutant (NHO2A and 844MYCN+/+) and 1/6 (282MYCN+/-) was Trp53 heterozygous mutant. For 1/6 cell lines (NHO2A), DNA from the corresponding primary tumour was found to be Trp53 wt. In all cases, the presence of a mutation was consistent with aberrant p53 signalling in response to Nutlin-3 and IR. In comparison to TP53 wt human neuroblastoma cells, Trp53 wt murine control and TH-MYCN cell lines were significantly less sensitive to growth inhibition mediated by MI-63 and RG7388. These murine Trp53 wt and mutant TH-MYCN cell lines are useful syngeneic, immunocompetent neuroblastoma models, the former to test p53-dependent therapies in combination with immunotherapies, such as anti-GD2, and the latter as models of chemoresistant relapsed neuroblastoma when aberrations in the p53 pathway are more common. The spontaneous development of Trp53 mutations in 3 cell lines from TH-MYCN mice may have arisen from MYCN oncogenic driven and/or ex vivo selection. The identified species-dependent selectivity of MI-63 and RG7388 should be considered when interpreting in vivo toxicity studies of MDM2 inhibitors.

  11. Increased toll-like receptors and p53 levels regulate apoptosis and angiogenesis in non-muscle invasive bladder cancer: mechanism of action of P-MAPA biological response modifier

    International Nuclear Information System (INIS)

    Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; Mello Júnior, Wilson de; Duran, Nelson; Macedo, Alda Maria; Oliveira, Alexandre Gabarra de; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José

    2016-01-01

    The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic

  12. Thymocyte apoptosis induced by p53-dependent and independent pathways

    International Nuclear Information System (INIS)

    Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

    1993-01-01

    The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

  13. Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.

    Science.gov (United States)

    Yeung, S J; Pan, J; Lee, M-H

    2008-12-01

    Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.

  14. Cholesterol Perturbation in Mice Results in p53 Degradation and Axonal Pathology through p38 MAPK and Mdm2 Activation.

    Directory of Open Access Journals (Sweden)

    Qingyu Qin

    Full Text Available Perturbation of lipid metabolism, especially of cholesterol homeostasis, can be catastrophic to mammalian brain, as it has the highest level of cholesterol in the body. This notion is best illustrated by the severe progressive neurodegeneration in Niemann-Pick Type C (NPC disease, one of the lysosomal storage diseases, caused by mutations in the NPC1 or NPC2 gene. In this study, we found that growth cone collapse induced by genetic or pharmacological disruption of cholesterol egress from late endosomes/lysosomes was directly related to a decrease in axonal and growth cone levels of the phosphorylated form of the tumor suppressor factor p53. Cholesterol perturbation-induced growth cone collapse and decrease in phosphorylated p53 were reduced by inhibition of p38 mitogen-activated protein kinase (MAPK and murine double minute (Mdm2 E3 ligase. Growth cone collapse induced by genetic (npc1-/- or pharmacological modification of cholesterol metabolism was Rho kinase (ROCK-dependent and associated with increased RhoA protein synthesis; both processes were significantly reduced by P38 MAPK or Mdm2 inhibition. Finally, in vivo ROCK inhibition significantly increased phosphorylated p53 levels and neurofilaments in axons, and axonal bundle size in npc1-/- mice. These results indicate that NPC-related and cholesterol perturbation-induced axonal pathology is associated with an abnormal signaling pathway consisting in p38 MAPK activation leading to Mdm2-mediated p53 degradation, followed by ROCK activation. These results also suggest new targets for pharmacological treatment of NPC disease and other diseases associated with disruption of cholesterol metabolism.

  15. 3-MCPD 1-Palmitate Induced Tubular Cell Apoptosis In Vivo via JNK/p53 Pathways

    Science.gov (United States)

    Liu, Man; Huang, Guoren; Wang, Thomas T.Y.; Sun, Xiangjun; Yu, Liangli (Lucy)

    2016-01-01

    Fatty acid esters of 3-chloro-1, 2-propanediol (3-MCPD esters) are a group of processing induced food contaminants with nephrotoxicity but the molecular mechanism(s) remains unclear. This study investigated whether and how the JNK/p53 pathway may play a role in the nephrotoxic effect of 3-MCPD esters using 3-MCPD 1-palmitate (MPE) as a probe compound in Sprague Dawley rats. Microarray analysis of the kidney from the Sprague Dawley rats treated with MPE, using Gene Ontology categories and KEGG pathways, revealed that MPE altered mRNA expressions of the genes involved in the mitogen-activated protein kinase (JNK and ERK), p53, and apoptotic signal transduction pathways. The changes in the mRNA expressions were confirmed by qRT-PCR and Western blot analyses and were consistent with the induction of tubular cell apoptosis as determined by histopathological, TUNEL, and immunohistochemistry analyses in the kidneys of the Sprague Dawley rats. Additionally, p53 knockout attenuated the apoptosis, and the apoptosis-related protein bax expression and cleaved caspase-3 activation induced by MPE in the p53 knockout C57BL/6 mice, whereas JNK inhibitor SP600125 but not ERK inhibitor U0126 inhibited MPE-induced apoptosis, supporting the conclusion that JNK/p53 might play a critical role in the tubular cell apoptosis induced by MPE and other 3-MCPD fatty acid esters. PMID:27008853

  16. HEXIM1, a New Player in the p53 Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

    2013-07-04

    Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

  17. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik

    2006-01-01

    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  18. p53 expression in biopsies from children with Langerhans cell histiocytosis

    DEFF Research Database (Denmark)

    Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik

    2002-01-01

    based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

  19. Morphological Heterogeneity of p53 Positive and p53 Negative Nuclei in Breast Cancers Stratified by Clinicopathological Variables

    Directory of Open Access Journals (Sweden)

    Katrin Friedrich

    1997-01-01

    Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.

  20. Mutual interactions between P53 and growth factors in cancer

    NARCIS (Netherlands)

    Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

    1998-01-01

    The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

  1. Transcriptional regulation of the p73 gene, a member of the p53 family, by early growth response-1 (Egr-1)

    International Nuclear Information System (INIS)

    Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong

    2007-01-01

    To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression

  2. Activation of p53 by nutlin-3a induces apoptosis and cellular senescence in human glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Ruth Villalonga-Planells

    2011-04-01

    Full Text Available Glioblastoma multiforme (GBM is the most common and aggressive primary brain tumor in adults. Despite concerted efforts to improve current therapies and develop novel clinical approaches, patient survival remains poor. As such, increasing attention has focused on developing new therapeutic strategies that specifically target the apoptotic pathway in order to improve treatment responses. Recently, nutlins, small-molecule antagonists of MDM2, have been developed to inhibit p53-MDM2 interaction and activate p53 signaling in cancer cells. Glioma cell lines and primary cultured glioblastoma cells were treated with nutlin-3a. Nutlin-3a induced p53-dependent G1- and G2-M cell cycle arrest and apoptosis in glioma cell lines with normal TP53 status. In addition, nutlin-arrested glioma cells show morphological features of senescence and persistent induction of p21 protein. Furthermore, senescence induced by nutlin-3a might be depending on mTOR pathway activity. In wild-type TP53 primary cultured cells, exposure to nutlin-3a resulted in variable degrees of apoptosis as well as cellular features of senescence. Nutlin-3a-induced apoptosis and senescence were firmly dependent on the presence of functional p53, as revealed by the fact that glioblastoma cells with knockdown p53 with specific siRNA, or cells with mutated or functionally impaired p53 pathway, were completely insensitive to the drug. Finally, we also found that nutlin-3a increased response of glioma cells to radiation therapy. The results provide a basis for the rational use of MDM2 antagonists as a novel treatment option for glioblastoma patients.

  3. ATF3 activates Stat3 phosphorylation through inhibition of p53 expression in skin cancer cells.

    Science.gov (United States)

    Hao, Zhen-Feng; Ao, Jun-Hong; Zhang, Jie; Su, You-Ming; Yang, Rong-Ya

    2013-01-01

    ATF3, a member of the ATF/CREB family of transcription factors, has been found to be selectively induced by calcineurin/NFAT inhibition and to enhance keratinocyte tumor formation, although the precise role of ATF3 in human skin cancer and possible mechanisms remain unknown. In this study, clinical analysis of 30 skin cancer patients and 30 normal donors revealed that ATF3 was accumulated in skin cancer tissues. Functional assays demonstrated that ATF3 significantly promoted skin cancer cell proliferation. Mechanically, ATF3 activated Stat3 phosphorylation in skin cancer cell through regulation of p53 expression. Moreover, the promotion effect of ATF3 on skin cancer cell proliferation was dependent on the p53-Stat3 signaling cascade. Together, the results indicate that ATF3 might promote skin cancer cell proliferation and enhance skin keratinocyte tumor development through inhibiting p53 expression and then activating Stat3 phosphorylation.

  4. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  5. Restriction of human herpesvirus 6B replication by p53

    DEFF Research Database (Denmark)

    Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina

    2008-01-01

    Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

  6. A systematic review of p53 regulation of oxidative stress in skeletal muscle.

    Science.gov (United States)

    Beyfuss, Kaitlyn; Hood, David A

    2018-12-01

    p53 is a tumor suppressor protein involved in regulating a wide array of signaling pathways. The role of p53 in the cell is determined by the type of imposed oxidative stress, its intensity and duration. The last decade of research has unravelled a dual nature in the function of p53 in mediating the oxidative stress burden. However, this is dependent on the specific properties of the applied stress and thus requires further analysis. A systematic review was performed following an electronic search of Pubmed, Google Scholar, and ScienceDirect databases. Articles published in the English language between January 1, 1990 and March 1, 2017 were identified and isolated based on the analysis of p53 in skeletal muscle in both animal and cell culture models. Literature was categorized according to the modality of imposed oxidative stress including exercise, diet modification, exogenous oxidizing agents, tissue manipulation, irradiation, and hypoxia. With low to moderate levels of oxidative stress, p53 is involved in activating pathways that increase time for cell repair, such as cell cycle arrest and autophagy, to enhance cell survival. However, with greater levels of stress intensity and duration, such as with irradiation, hypoxia, and oxidizing agents, the role of p53 switches to facilitate increased cellular stress levels by initiating DNA fragmentation to induce apoptosis, thereby preventing aberrant cell proliferation. Current evidence confirms that p53 acts as a threshold regulator of cellular homeostasis. Therefore, within each modality, the intensity and duration are parameters of the oxidative stressor that must be analyzed to determine the role p53 plays in regulating signaling pathways to maintain cellular health and function in skeletal muscle. Acadl: acyl-CoA dehydrogenase, long chain; Acadm: acyl-CoA dehydrogenase, C-4 to C-12 straight chain; AIF: apoptosis-inducing factor; Akt: protein kinase B (PKB); AMPK: AMP-activated protein kinase; ATF-4: activating

  7. Increased p53 and decreased p21 accompany apoptosis induced by ultraviolet radiation in the nervous system of a crustacean

    International Nuclear Information System (INIS)

    Hollmann, Gabriela; Linden, Rafael; Giangrande, Angela; Allodi, Silvana

    2016-01-01

    Highlights: • The paper characterizes molecular pathways of cell responses to environmental doses of UV in brain tissue of a crab species. • The UV radiation changes levels of proteins which trigger apoptotic or cell cycle arrest pathways and also it changes neurotrophins which lead to apoptosis of neural cell in the central nervous system (CNS) of the crab Ucides cordatus. • The UVB wavelengths in the solar simulator damaged the DNA, either directly or indirectly, by increasing ROS, and induced the increase of p53 and AKT, which blocked p21 and increased the expression of activated caspase-3, triggering apoptosis. The signs of death increased the expression of neurotrophins (BDNF and GDNF), which continued to stimulate the apoptosis signaling mediated by caspase-3. • In the brain of the crab U. cordatus, p53/p21 relationship in response to UV radiation is different from that of most mammals. - Abstract: Ultraviolet (UV) radiation can produce biological damage, leading the cell to apoptosis by the p53 pathway. This study evaluated some molecular markers of the apoptosis pathway induced by UVA, UVB and UVA+ UVB (Solar Simulator, SIM) in environmental doses, during five consecutive days of exposure, in the brain of the crab Ucides cordatus. We evaluated the central nervous system (CNS) by immunoblotting the content of proteins p53, p21, phosphorylated AKT, BDNF, GDNF, activated caspase-3 (C3) and phosphohistone H3 (PH3); and by immunohistochemical tests of the cells labeled for PH3 and C3. After the fifth day of exposure, UVB radiation and SIM increased the protein content of p53, increasing the content of AKT and, somehow, blocking p21, increasing the content of activated caspase-3, which led the cells to apoptosis. The signs of death affected the increase in neurotrophins, such as BDNF and GDNF, stimulating the apoptotic cascade of events. Immunohistochemical assays and immunoblotting showed that apoptosis was present in the brains of all UV groups, while

  8. Increased p53 and decreased p21 accompany apoptosis induced by ultraviolet radiation in the nervous system of a crustacean

    Energy Technology Data Exchange (ETDEWEB)

    Hollmann, Gabriela, E-mail: gabrielahollmann@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil); Linden, Rafael, E-mail: rlinden@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil); Giangrande, Angela, E-mail: angela.giangrande@igbmc.fr [Institut de Génétique et de Biologie Moléculaire et Cellulaire-IGBMC, INSERM, Strasbourg (France); Allodi, Silvana, E-mail: sallodi@biof.ufrj.br [Programa de Pós Graduação em Ciências Biológicas-Fisiologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro-UFRJ, Rio de Janeiro, RJ 21941-590 (Brazil)

    2016-04-15

    Highlights: • The paper characterizes molecular pathways of cell responses to environmental doses of UV in brain tissue of a crab species. • The UV radiation changes levels of proteins which trigger apoptotic or cell cycle arrest pathways and also it changes neurotrophins which lead to apoptosis of neural cell in the central nervous system (CNS) of the crab Ucides cordatus. • The UVB wavelengths in the solar simulator damaged the DNA, either directly or indirectly, by increasing ROS, and induced the increase of p53 and AKT, which blocked p21 and increased the expression of activated caspase-3, triggering apoptosis. The signs of death increased the expression of neurotrophins (BDNF and GDNF), which continued to stimulate the apoptosis signaling mediated by caspase-3. • In the brain of the crab U. cordatus, p53/p21 relationship in response to UV radiation is different from that of most mammals. - Abstract: Ultraviolet (UV) radiation can produce biological damage, leading the cell to apoptosis by the p53 pathway. This study evaluated some molecular markers of the apoptosis pathway induced by UVA, UVB and UVA+ UVB (Solar Simulator, SIM) in environmental doses, during five consecutive days of exposure, in the brain of the crab Ucides cordatus. We evaluated the central nervous system (CNS) by immunoblotting the content of proteins p53, p21, phosphorylated AKT, BDNF, GDNF, activated caspase-3 (C3) and phosphohistone H3 (PH3); and by immunohistochemical tests of the cells labeled for PH3 and C3. After the fifth day of exposure, UVB radiation and SIM increased the protein content of p53, increasing the content of AKT and, somehow, blocking p21, increasing the content of activated caspase-3, which led the cells to apoptosis. The signs of death affected the increase in neurotrophins, such as BDNF and GDNF, stimulating the apoptotic cascade of events. Immunohistochemical assays and immunoblotting showed that apoptosis was present in the brains of all UV groups, while

  9. p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation

    International Nuclear Information System (INIS)

    Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y.; Chiu, S.K.; Yu, K.N.

    2011-01-01

    Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.

  10. Loss of p19(Arf facilitates the angiogenic switch and tumor initiation in a multi-stage cancer model via p53-dependent and independent mechanisms.

    Directory of Open Access Journals (Sweden)

    Danielle B Ulanet

    2010-08-01

    Full Text Available The Arf tumor suppressor acts as a sensor of oncogenic signals, countering aberrant proliferation in large part via activation of the p53 transcriptional program, though a number of p53-independent functions have been described. Mounting evidence suggests that, in addition to promoting tumorigenesis via disruptions in the homeostatic balance between cell proliferation and apoptosis of overt cancer cells, genetic alterations leading to tumor suppressor loss of function or oncogene gain of function can also incite tumor development via effects on the tumor microenvironment. In a transgenic mouse model of multi-stage pancreatic neuroendocrine carcinogenesis (PNET driven by inhibition of the canonical p53 and Rb tumor suppressors with SV40 large T-antigen (Tag, stochastic progression to tumors is limited in part by a requirement for initiation of an angiogenic switch. Despite inhibition of p53 by Tag in this mouse PNET model, concomitant disruption of Arf via genetic knockout resulted in a significantly accelerated pathway to tumor formation that was surprisingly not driven by alterations in tumor cell proliferation or apoptosis, but rather via earlier activation of the angiogenic switch. In the setting of a constitutional p53 gene knockout, loss of Arf also accelerated tumor development, albeit to a lesser degree. These findings demonstrate that Arf loss of function can promote tumorigenesis via facilitating angiogenesis, at least in part, through p53-independent mechanisms.

  11. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    Science.gov (United States)

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  12. Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

    Science.gov (United States)

    Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

    2014-06-10

    The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

  13. Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans.

    NARCIS (Netherlands)

    Bokhoven, J.H.L.M. van; McKeon, F.

    2002-01-01

    p63 is the most recently discovered but most ancient member of the p53 family. In marked contrast to p53, p63 is highly expressed in embryonic ectoderm and in the basal, regenerative layers of many epithelial tissues in the adult. The p63-knockout mouse dies at birth and lacks limbs, epidermis,

  14. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  15. The pro-survival function of p53 in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

    2014-11-15

    The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

  16. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    Directory of Open Access Journals (Sweden)

    Iva Simeonova

    2013-06-01

    Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

  17. Structural Basis of Competitive Recognition of p53 and MDM2 by HAUSP/USP7: Implications for the Regulation of the p53-MDM2 Pathway.

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Herpesvirus-associated ubiquitin-specific protease (HAUSP, also known as USP7, a deubiquitylating enzyme of the ubiquitin-specific processing protease family, specifically deubiquitylates both p53 and MDM2, hence playing an important yet enigmatic role in the p53-MDM2 pathway. Here we demonstrate that both p53 and MDM2 specifically recognize the N-terminal tumor necrosis factor-receptor associated factor (TRAF-like domain of HAUSP in a mutually exclusive manner. HAUSP preferentially forms a stable HAUSP-MDM2 complex even in the presence of excess p53. The HAUSP-binding elements were mapped to a peptide fragment in the carboxy-terminus of p53 and to a short-peptide region preceding the acidic domain of MDM2. The crystal structures of the HAUSP TRAF-like domain in complex with p53 and MDM2 peptides, determined at 2.3-A and 1.7-A resolutions, respectively, reveal that the MDM2 peptide recognizes the same surface groove in HAUSP as that recognized by p53 but mediates more extensive interactions. Structural comparison led to the identification of a consensus peptide-recognition sequence by HAUSP. These results, together with the structure of a combined substrate-binding-and-deubiquitylation domain of HAUSP, provide important insights into regulation of the p53-MDM2 pathway by HAUSP.

  18. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  19. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    Science.gov (United States)

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  20. The critical role of catalase in prooxidant and antioxidant function of p53

    Science.gov (United States)

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  1. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    Science.gov (United States)

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  2. P53 function influences the effect of fractionated radiotherapy on glioblastoma tumors

    International Nuclear Information System (INIS)

    Haas-Kogan, Daphne A.; Kogan, Scott S.; Yount, Garret; Hsu, Jennie; Haas, Martin; Deen, Dennis F.; Israel, Mark A.

    1999-01-01

    Purpose: Glioblastoma multiforme brain tumors (GM) are treated with a spectrum of fractionation regimens based on the clinical and anatomical characteristics of the tumor but rarely based on the molecular characteristics of the individual neoplasm. This study tests the hypothesis that the response of cell lines derived from GM to fractionated radiotherapy depends on the function of wild-type p53 (wt p53), a tumor suppressor gene frequently mutated in GM tumors. Methods and Materials: Isogenic derivatives of glioblastoma cells differing only in p53 function were prepared using a retroviral vector expressing a dominant negative mutant of p53 (mt p53). Radiation survival in vitro was quantitated using linear quadratic and repair-saturation mathematical models. Apoptosis was assayed by a terminal deoxynucleotide transferase-labeling technique and chromatin morphology. Results: We have previously reported the generation of isogenic GM cell lines differing only in p53 function. U87-175.4, lacking wt p53 function, had a significantly lower α/β value than U87-LUX.8, expressing functional wt p53, leading us to hypothesize that fractionated irradiation would preferentially spare GM cells harboring mt p53 compared with those expressing functional, wt p53. Survival curves following either 2.0 Gy or 3.5 Gy/fraction demonstrated that lack of functional wt p53 was associated with resistance to fractionated irradiation. Radiation-induced apoptosis could not account for the observed differences in clonogenic survival. Rather, our data suggested that a deficit in the G1-checkpoint contributed to increased resistance to fractionated irradiation of cells expressing mutant p53. Conclusions: The effect of fractionated radiotherapy in GM may depend on the function of the tumor suppressor gene p53. A potential clinical consequence of these findings is that hyperfractionation regimens may provide a therapeutic advantage specifically for tumors expressing wt p53 whereas a radiotherapy

  3. Essential roles of caspases and their upstream regulators in rotenone-induced apoptosis

    International Nuclear Information System (INIS)

    Lee Jihjong; Huang, M.-S.; Yang, I-C.; Lai, T.-C.; Wang, J.-L.; Pang, V.F.; Hsiao, M.; Kuo, M.Y.P.

    2008-01-01

    In the present study, we examined whether caspases and their upstream regulators are involved in rotenone-induced cytotoxicity. Rotenone significantly inhibited the proliferation of oral cancer cell lines in a dose-dependent manner compared to normal oral mucosal fibroblasts. Flow cytometric analysis of DNA content showed that rotenone treatment induced apoptosis following G2/M arrest. Western blotting showed activation of both the caspase-8 and caspase-9 pathways, which differed from previous studies conducted in other cell types. Furthermore, p53 protein and its downstream pro-apoptotic target, Bax, were induced in SAS cells after treatment with rotenone. Rotenone-induced apoptosis was inhibited by antioxidants (glutathione, N-acetylcysteine, and tiron). In conclusion, our results demonstrate significant involvement of caspases and their upstream regulators in rotenone-induced cytotoxicity

  4. Chronology of p53 protein accumulation in gastric carcinogenesis

    NARCIS (Netherlands)

    Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1995-01-01

    p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

  5. A nanobody modulates the p53 transcriptional program without perturbing its functional architecture

    Science.gov (United States)

    Bethuyne, Jonas; De Gieter, Steven; Zwaenepoel, Olivier; Garcia-Pino, Abel; Durinck, Kaat; Verhelle, Adriaan; Hassanzadeh-Ghassabeh, Gholamreza; Speleman, Frank; Loris, Remy; Gettemans, Jan

    2014-01-01

    The p53 transcription factor plays an important role in genome integrity. To perform this task, p53 regulates the transcription of genes promoting various cellular outcomes including cell cycle arrest, apoptosis or senescence. The precise regulation of this activity remains elusive as numerous mechanisms, e.g. posttranslational modifications of p53 and (non-)covalent p53 binding partners, influence the p53 transcriptional program. We developed a novel, non-invasive tool to manipulate endogenous p53. Nanobodies (Nb), raised against the DNA-binding domain of p53, allow us to distinctively target both wild type and mutant p53 with great specificity. Nb3 preferentially binds ‘structural’ mutant p53, i.e. R175H and R282W, while a second but distinct nanobody, Nb139, binds both mutant and wild type p53. The co-crystal structure of the p53 DNA-binding domain in complex with Nb139 (1.9 Å resolution) reveals that Nb139 binds opposite the DNA-binding surface. Furthermore, we demonstrate that Nb139 does not disturb the functional architecture of the p53 DNA-binding domain using conformation-specific p53 antibody immunoprecipitations, glutaraldehyde crosslinking assays and chromatin immunoprecipitation. Functionally, the binding of Nb139 to p53 allows us to perturb the transactivation of p53 target genes. We propose that reduced recruitment of transcriptional co-activators or modulation of selected post-transcriptional modifications account for these observations. PMID:25324313

  6. The prognostic value of p53 mutation in pediatric marrow hypoplasia

    Directory of Open Access Journals (Sweden)

    Sharaf Alzahraa EA

    2011-06-01

    Full Text Available Abstract Background The tumor suppressor gene p53 is involved in the control of cell proliferation, particularly in stressed cells. p 53 gene mutations are the most frequent genetic event found in human cancers. Fanconi Anemia (FA is the most common representative of inherited bone marrow failure syndromes (IBMFS with a leukemic propensity. P 53 DNA alteration has not been studied before in Egyptian children with FA. Patients and methods we investigated p53 mutation in the bone marrow and peripheral blood of forty children, FA (n = 10, acquired aplastic anemia (AAA (n = 10, and immune thrombocytopenia (ITP as a control (n = 20, using real-time PCR by TaqMan probe assay Results Mutation of p53 gene was demonstrated in the BM of 90% (9/10 of children with FA, compared to 10% (1/10 in AAA (p Conclusion mutation of p53 gene in hypoplastic marrow especially FA may represent an early indicator of significant DNA genetic alteration with cancer propensity.

  7. Correlation between p53 expression and clinical-pathological characteristics of gastric cancer

    Directory of Open Access Journals (Sweden)

    Radovanović Dragče

    2011-01-01

    Full Text Available Backgraund/Aim. Gene p53, or “cell genome keeper”, has a preventive effect on the occurrence of genetic aberrations and prevents abnormal expansion of (tumor cells. In gastric cancer cells in most cases we register high expression of mutated p53 gene, which correlates with prognosis and specific clinicalpathological characteristics of gastric cancer. Methods. Using the imunohistochemical method we determined the level of expression of p53 protein in 62 gastric cancers and 30 precancerous conditions (intestinal metaplasia of the stomach. We analyzed the relationship of the level of p53 expression and clinical pathological characteristics of gastric cancer. Results. Expression of p53 was positive in 42 (67.7% tumor cases and in 7 (14.3% cases of intestinal metaplasia. Expression of P53 and stomach cancer were in direct correlation (p = 0.000. Sensitivity for p53 in stomach cancer cases was 67.7% (42/62, and specifility was 76.7% (23/30. Expression of mutated p53 protein was in direct correlation with the invasion of lymph nodes (p = 0.034 and with invasion of blood vessels by carcinoma cells (p = 0.042. Conclusion. There is a direct correlation between p53 expression and gastric cancer and it indicates the ability of carcinoma cells to invade blood vessels.

  8. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  9. p53 Maintains Genomic Stability by Preventing Interference between Transcription and Replication

    Directory of Open Access Journals (Sweden)

    Constance Qiao Xin Yeo

    2016-04-01

    Full Text Available p53 tumor suppressor maintains genomic stability, typically acting through cell-cycle arrest, senescence, and apoptosis. We discovered a function of p53 in preventing conflicts between transcription and replication, independent of its canonical roles. p53 deficiency sensitizes cells to Topoisomerase (Topo II inhibitors, resulting in DNA damage arising spontaneously during replication. Topoisomerase IIα (TOP2A-DNA complexes preferentially accumulate in isogenic p53 mutant or knockout cells, reflecting an increased recruitment of TOP2A to regulate DNA topology. We propose that p53 acts to prevent DNA topological stress originating from transcription during the S phase and, therefore, promotes normal replication fork progression. Consequently, replication fork progression is impaired in the absence of p53, which is reversed by transcription inhibition. Pharmacologic inhibition of transcription also attenuates DNA damage and decreases Topo-II-DNA complexes, restoring cell viability in p53-deficient cells. Together, our results demonstrate a function of p53 that may underlie its role in tumor suppression.

  10. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  11. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    NARCIS (Netherlands)

    Leszczynska, K.B.; Foskolou, I.P.; Abraham, A.G.; Anbalagan, S.; Tellier, C.; Haider, S.; Span, P.N.; O'Neill, E.E.; Buffa, F.M.; Hammond, E.M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent

  12. P53 suppresses expression of the 14-3-3gamma oncogene

    Directory of Open Access Journals (Sweden)

    Qi Wenqing

    2011-08-01

    Full Text Available Abstract Background 14-3-3 proteins are a family of highly conserved proteins that are involved in a wide range of cellular processes. Recent evidence indicates that some of these proteins have oncogenic activity and that they may promote tumorigenesis. We previously showed that one of the 14-3-3 family members, 14-3-3gamma, is over expressed in human lung cancers and that it can induce transformation of rodent cells in vitro. Methods qRTPCR and Western blot analysis were performed to examine 14-3-3gamma expression in non-small cell lung cancers (NSCLC. Gene copy number was analyzed by qPCR. P53 mutations were detected by direct sequencing and also by western blot. CHIP and yeast one hybrid assays were used to detect p53 binding to 14-3-3gamma promoter. Results Quantitative rtPCR results showed that the expression level of 14-3-3gamma was elevated in the majority of NSCLC that we examined which was also consistent with protein expression. Further analysis of the expression pattern of 14-3-3gamma in lung tumors showed a correlation with p53 mutations suggesting that p53 might suppress 14-3-3 gamma expression. Analysis of the gamma promoter sequence revealed the presence of a p53 consensus binding motif and in vitro assays demonstrated that wild-type p53 bound to this motif when activated by ionizing radiation. Deletion of the p53 binding motif eliminated p53's ability to suppress 14-3-3gamma expression. Conclusion Increased expression of 14-3-3gamma in lung cancer coincides with loss of functional p53. Hence, we propose that 14-3-3gamma's oncogenic activities cooperate with loss of p53 to promote lung tumorigenesis.

  13. Biological activity and safety of adenoviral vector-expressed wild-type p53 after intratumoral injection in melanoma and breast cancer patients with p53-overexpressing tumors

    NARCIS (Netherlands)

    Dummer, R; Bergh, J; Karlsson, Y; Horovitz, JA; Mulder, NH; Huinin, DT; Burg, G; Hofbauer, G; Osanto, S

    p53 mutations are common genetic alterations in human cancer. Gene transfer of a wild-type (wt) p53 gene reverses the loss of normal p53 function in vitro and in vivo. A phase I dose escalation study of single intratumoral (i.t.) injection of a replication-defective adenoviral expression vector

  14. ATM signaling and 53BP1

    International Nuclear Information System (INIS)

    Zgheib, Omar; Huyen, Yentram; DiTullio, Richard A.; Snyder, Andrew; Venere, Monica; Stavridi, Elena S.; Halazonetis, Thanos D.

    2005-01-01

    The ATM (mutated in Ataxia-Telangiectasia) protein kinase is an important player in signaling the presence of DNA double strand breaks (DSBs) in higher eukaryotes. Recent studies suggest that ATM monitors the presence of DNA DSBs indirectly, through DNA DSB-induced changes in chromatin structure. One of the proteins that sense these chromatin structure changes is 53BP1, a DNA damage checkpoint protein conserved in all eukaryotes and the putative ortholog of the S. cerevisiae RAD9 protein. We review here the mechanisms by which ATM is activated in response to DNA DSBs, as well as key ATM substrates that control cell cycle progression, apoptosis and DNA repair

  15. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    Science.gov (United States)

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

    International Nuclear Information System (INIS)

    Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi

    2006-01-01

    PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK

  17. P53 autoantibodies in 1006 patients followed up for breast cancer

    International Nuclear Information System (INIS)

    Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A

    2000-01-01

    Serial plasma samples from 1006 patients with breast cancer revealed: (i) no correlation of p53 autoantibody status with disease status at the time of sample collection, or with menopausal status at time of primary diagnosis of breast cancer; (ii) 155 out of 1006 (15%) of patients were positive for p53 autoantibodies, and these patients tended to have a persistent autoantibody status throughout follow up, irrespective of disease behaviour; and (iii) where a negative autoantibody status was found at primary diagnosis of breast cancer, this negative status persisted throughout follow up, irrespective of later disease behaviour. We conclude that screening for p53 autoantibody status is not informative on residual tumour activity nor on therapeutic responsiveness. Dysfunction of the tumour-suppressor protein, p53, may be due to either mutational or epigenetic factors, each of which may lead to accumulation of cytoplasmic p53. Abnormal accumulation of p53 in breast cancer tissue is predictive of poor prognosis [1,2]. Humoral studies [3,4] have shown that cancer patients may develop immunity to abnormally expressed p53, as revealed by p53 autoantibodies in the blood. Again, prognostic correlates have been noted, with presence of circulating p53 autoantibodies at diagnosis of breast cancer being associated with reduced overall survival [5,6] and with poor prognostic factors such as high histological grade and the absence of hormone receptors [5,7,8]. Little is known of the potential value of p53 autoantibody in follow up of cancer. In lung cancer there is evidence that autoantibodies to p53 may provide a useful tool to monitor response to therapy [9,10], whereas serial measurements of autoantibodies to p53 in 40 patients with advanced ovarian cancer were not found to be clinically useful [11]. In breast cancer some 30% of node-negative patients will relapse within 5 years, but there is no current means to predict those who are at risk. We performed the present study to

  18. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    NARCIS (Netherlands)

    Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.

    2013-01-01

    Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

  19. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX

    Science.gov (United States)

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

    2011-01-01

    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 – HdmX and Wip1, leading to efficient elimination of tumour cells. PMID:21546907

  20. Abrogation of Wip1 expression by RITA-activated p53 potentiates apoptosis induction via activation of ATM and inhibition of HdmX.

    Science.gov (United States)

    Spinnler, C; Hedström, E; Li, H; de Lange, J; Nikulenkov, F; Teunisse, A F A S; Verlaan-de Vries, M; Grinkevich, V; Jochemsen, A G; Selivanova, G

    2011-11-01

    Inactivation of the p53 tumour suppressor, either by mutation or by overexpression of its inhibitors Hdm2 and HdmX is the most frequent event in cancer. Reactivation of p53 by targeting Hdm2 and HdmX is therefore a promising strategy for therapy. However, Hdm2 inhibitors do not prevent inhibition of p53 by HdmX, which impedes p53-mediated apoptosis. Here, we show that p53 reactivation by the small molecule RITA leads to efficient HdmX degradation in tumour cell lines of different origin and in xenograft tumours in vivo. Notably, HdmX degradation occurs selectively in cancer cells, but not in non-transformed cells. We identified the inhibition of the wild-type p53-induced phosphatase 1 (Wip1) as the major mechanism important for full engagement of p53 activity accomplished by restoration of the ataxia telangiectasia mutated (ATM) kinase-signalling cascade, which leads to HdmX degradation. In contrast to previously reported transactivation of Wip1 by p53, we observed p53-dependent repression of Wip1 expression, which disrupts the negative feedback loop conferred by Wip1. Our study reveals that the depletion of both HdmX and Wip1 potentiates cell death due to sustained activation of p53. Thus, RITA is an example of a p53-reactivating drug that not only blocks Hdm2, but also inhibits two important negative regulators of p53 - HdmX and Wip1, leading to efficient elimination of tumour cells.

  1. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  2. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  3. Functions of MDMX in the Modulation of the p53-Response

    Directory of Open Access Journals (Sweden)

    Kristiaan Lenos

    2011-01-01

    Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.

  4. Increased Arf/p53 activity in stem cells, aging and cancer.

    Science.gov (United States)

    Carrasco-Garcia, Estefania; Moreno, Manuel; Moreno-Cugnon, Leire; Matheu, Ander

    2017-04-01

    Arf/p53 pathway protects the cells against DNA damage induced by acute stress. This characteristic is the responsible for its tumor suppressor activity. Moreover, it regulates the chronic type of stress associated with aging. This is the basis of its anti-aging activity. Indeed, increased gene dosage of Arf/p53 displays elongated longevity and delayed aging. At a cellular level, it has been recently shown that increased dosage of Arf/p53 delays age-associated stem cell exhaustion and the subsequent decline in tissue homeostasis and regeneration. However, p53 can also promote aging if constitutively activated. In this context, p53 reduces tissue regeneration, which correlates with premature exhaustion of stem cells. We discuss here the current evidence linking the Arf/p53 pathway to the processes of aging and cancer through stem cell regulation. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  5. Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

    Directory of Open Access Journals (Sweden)

    Monica M Horvath

    2007-07-01

    Full Text Available The p53 tumor suppressor is a sequence-specific pleiotropic transcription factor that coordinates cellular responses to DNA damage and stress, initiating cell-cycle arrest or triggering apoptosis. Although the human p53 binding site sequence (or response element [RE] is well characterized, some genes have consensus-poor REs that are nevertheless both necessary and sufficient for transactivation by p53. Identification of new functional gene regulatory elements under these conditions is problematic, and evolutionary conservation is often employed. We evaluated the comparative genomics approach for assessing evolutionary conservation of putative binding sites by examining conservation of 83 experimentally validated human p53 REs against mouse, rat, rabbit, and dog genomes and detected pronounced conservation differences among p53 REs and p53-regulated pathways. Bona fide NRF2 (nuclear factor [erythroid-derived 2]-like 2 nuclear factor and NFkappaB (nuclear factor of kappa light chain gene enhancer in B cells binding sites, which direct oxidative stress and innate immunity responses, were used as controls, and both exhibited high interspecific conservation. Surprisingly, the average p53 RE was not significantly more conserved than background genomic sequence, and p53 REs in apoptosis genes as a group showed very little conservation. The common bioinformatics practice of filtering RE predictions by 80% rodent sequence identity would not only give a false positive rate of approximately 19%, but miss up to 57% of true p53 REs. Examination of interspecific DNA base substitutions as a function of position in the p53 consensus sequence reveals an unexpected excess of diversity in apoptosis-regulating REs versus cell-cycle controlling REs (rodent comparisons: p < 1.0 e-12. While some p53 REs show relatively high levels of conservation, REs in many genes such as BAX, FAS, PCNA, CASP6, SIVA1, and P53AIP1 show little if any homology to rodent sequences. This

  6. The expression of p53 protein in patients with multiple myeloma

    Directory of Open Access Journals (Sweden)

    Marković Olivera

    2007-01-01

    Full Text Available Introduction: Although mutations of p53 are one of the most often acquired genetic changes in malignant tumors, these mutations are rare events in patients with newly diagnosed multiple myeloma (MM. Moreover, there are a few literature data about clinical significance of p53 overexpression in multiple myeloma. Objective The aim of our study was to evaluate the clinical significance of p53 immunoexpression in multiple myeloma. Method A total of 58 patients with newly diagnosed MM (26 females and 32 males, mean age 62 years were enrolled in the study. The diagnosis of MM was made according to criteria of Chronic Leukemia-Myeloma Task Force. Clinical staging was done according to Durie and Salmon classification (4 patients had disease stage I, 15 patients stage II and 39 patients stage III. The histological grade and histological stage were determined according to predominant plasma cell morphology and volume of myeloma infiltration, respectively. Standard immunohistochemical analysis with p53 antibody in B5-fixed and paraffin- embedded bone marrow specimens was used to evaluate the expression of p53 in myeloma cells. The specimens were considered positive when ≥5% of plasma cells exhibited clear nuclear positivity. Results Out of 58 patients, p53 expression was detected in 9 (15.52%. No significant correlation was found between p53 expression and clinical stage (I+II vs. III, Я2-microglobulin level (≤6 mg/L vs. >6mg/L, histological grade (I vs. II+III, histological stage (<20% vs. 21-50% vs. >50% and the extent of osteolytic lesions (≤3 vs. >3 lesions. Median survival of patients with p53 immunoreactivity in =>5% of plasma cells was 10 months, whilst median survival of patients with p53 immunoreactivity in <5% of plasma cells was 36 months. However, such difference was not significant (p=0.2. Conclusion The frequency of p53 immunoexpression in our group of newly diagnosed MM was relatively low. Although p53 immunoexpression was not

  7. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2004-01-01

    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  8. Robustness of the p53 network and biological hackers.

    Science.gov (United States)

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  9. Stabilization and activation of p53 are regulated independently by different phosphorylation events

    Science.gov (United States)

    Chernov, Mikhail V.; Ramana, Chilakamarti V.; Adler, Victor V.; Stark, George R.

    1998-01-01

    Treatment of mouse or human cells with the protein kinase C (PKC) inhibitors H7 or bisindolylmaleimide I induced an increase in the lifetime of p53, leading to its accumulation. In inhibitor-treated cells, p53 translocated to the nuclei and bound to DNA but was not competent to induce transcription. However, transactivation could be induced by subsequent DNA damage. Phorbol ester, a potent activator of PKC, significantly inhibited the accumulation of p53 after DNA damage. Therefore, constitutive PKC-dependent phosphorylation of p53 itself, or of a protein that interacts with p53, is required for the rapid degradation of p53 in untreated cells. Furthermore, an increase in the lifetime of p53 is not accompanied necessarily by its activation. Treatment with the PKC inhibitors decreased the overall level of p53 phosphorylation but led to the appearance of a phosphopeptide not seen in tryptic digests of p53 from untreated cells. Therefore, the lifetime and activities of p53 are likely to be regulated by distinct alterations of the phosphorylation pattern of p53, probably caused by the actions of different kinases. PMID:9482877

  10. [Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

    Science.gov (United States)

    Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

    2017-01-01

    PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I

  11. Role of wild-type p53 in apoptotic and non-apoptotic cell death induced by X-irradiation and heat treatment in p53-mutated mouse M10 cells

    International Nuclear Information System (INIS)

    Ito, Atsushi; Nakano, Hisako; Shinohara, Kunio

    2010-01-01

    The sensitizing effects of wild-type p53 on X-ray-induced cell death and on heat-induced apoptosis in M10, a radiosensitive and Trp53 (mouse p53 gene)-mutated lymphoma cell line which dies through necrosis by X-irradiation, were investigated using three M10 derived transfectants with wild-type TP53 (human p53 gene). Cell death was determined by colony formation and/or dye exclusion test, and apoptosis was detected as the changes in nuclear morphology by Giemsa staining. Expression of wild-type p53 protein increased radiosensitivity of cell death as determined by both clonogenic and dye exclusion assays. This increase in radiosensitivity was attributable largely to apoptosis induction in addition to a small enhancement of necrosis. Interestingly neither pathway to cell death was accompanied by caspase-3 activation. On the other hand, heat-induced caspase-3 dependent apoptotic cell death without transfection was further increased by the transfection of wild-type p53. In conclusion, the introduction of wild-type p53 enhanced apoptotic cell death by X-rays or heat via different mechanisms that do or do not activate caspase-3, respectively. In addition, p53 also enhanced the X-ray-induced necrosis in M10 cells. (author)

  12. Doxycyclin induces p53 expression in SaOs (osteosarcoma) cell line ...

    African Journals Online (AJOL)

    The p53 tumour suppressor gene plays an important role in preventing cancer development. This study determined if p53 can be induced in osteosarcoma cell line upon treatment ... represent an important component of the p53 tumor suppressor pathway. Keywords: Tumor suppressor, oncogene, mdm2, cyclinE, apoptosis ...

  13. Epothilones Suppress Neointimal Thickening in the Rat Carotid Balloon-Injury Model by Inducing Vascular Smooth Muscle Cell Apoptosis through p53-Dependent Signaling Pathway.

    Science.gov (United States)

    Son, Dong Ju; Jung, Jae Chul; Hong, Jin Tae

    2016-01-01

    Microtubule stabilizing agents (MTSA) are known to inhibit vascular smooth muscle cell (VSMC) proliferation and migration, and effectively reduce neointimal hyperplasia and restenosis. Epothilones (EPOs), non-taxane MTSA, have been found to be effective in the inhibition of VSMC proliferation and neointimal formation by cell cycle arrest. However, effect of EPOs on apoptosis in hyper-proliferated VSMCs as a possible way to reduce neointimal formation and its action mechanism related to VSMC viability has not been suited yet. Thus, the purposes of the present study was to investigate whether EPOs are able to inhibit neointimal formation by inducing apoptosis within the region of neointimal hyperplasia in balloon-injured rat carotid artery, as well as underlying action mechanism. Treatment of EPO-B and EPO-D significantly induced apoptotic cell death and mitotic catastrophe in hyper-proliferated VSMCs, resulting in cell growth inhibition. Further, EPOs significantly suppressed VSMC proliferation and induced apoptosis by activation of p53-dependent apoptotic signaling pathway, Bax/cytochrome c/caspase-3. We further demonstrated that the local treatment of carotid arteries with EPOs potently inhibited neointimal lesion formation by induction of apoptosis in rat carotid injury model. Our findings demonstrate a potent anti-neointimal hyperplasia property of EPOs by inducing p53-depedent apoptosis in hyper-proliferated VSMCs.

  14. NGF-mediated transcriptional targets of p53 in PC12 neuronal differentiation

    Directory of Open Access Journals (Sweden)

    Labhart Paul

    2007-05-01

    Full Text Available Abstract Background p53 is recognized as a critical regulator of the cell cycle and apoptosis. Mounting evidence also suggests a role for p53 in differentiation of cells including neuronal precursors. We studied the transcriptional role of p53 during nerve growth factor-induced differentiation of the PC12 line into neuron-like cells. We hypothesized that p53 contributed to PC12 differentiation through the regulation of gene targets distinct from its known transcriptional targets for apoptosis or DNA repair. Results Using a genome-wide chromatin immunoprecipitation cloning technique, we identified and validated 14 novel p53-regulated genes following NGF treatment. The data show p53 protein was transcriptionally activated and contributed to NGF-mediated neurite outgrowth during differentiation of PC12 cells. Furthermore, we describe stimulus-specific regulation of a subset of these target genes by p53. The most salient differentiation-relevant target genes included wnt7b involved in dendritic extension and the tfcp2l4/grhl3 grainyhead homolog implicated in ectodermal development. Additional targets included brk, sdk2, sesn3, txnl2, dusp5, pon3, lect1, pkcbpb15 and other genes. Conclusion Within the PC12 neuronal context, putative p53-occupied genomic loci spanned the entire Rattus norvegicus genome upon NGF treatment. We conclude that receptor-mediated p53 transcriptional activity is involved in PC12 differentiation and may suggest a contributory role for p53 in neuronal development.

  15. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  16. 2-Sulfonylpyrimidines: Mild alkylating agents with anticancer activity toward p53-compromised cells.

    Science.gov (United States)

    Bauer, Matthias R; Joerger, Andreas C; Fersht, Alan R

    2016-09-06

    The tumor suppressor p53 has the most frequently mutated gene in human cancers. Many of p53's oncogenic mutants are just destabilized and rapidly aggregate, and are targets for stabilization by drugs. We found certain 2-sulfonylpyrimidines, including one named PK11007, to be mild thiol alkylators with anticancer activity in several cell lines, especially those with mutationally compromised p53. PK11007 acted by two routes: p53 dependent and p53 independent. PK11007 stabilized p53 in vitro via selective alkylation of two surface-exposed cysteines without compromising its DNA binding activity. Unstable p53 was reactivated by PK11007 in some cancer cell lines, leading to up-regulation of p53 target genes such as p21 and PUMA. More generally, there was cell death that was independent of p53 but dependent on glutathione depletion and associated with highly elevated levels of reactive oxygen species and induction of endoplasmic reticulum (ER) stress, as also found for the anticancer agent PRIMA-1(MET)(APR-246). PK11007 may be a lead for anticancer drugs that target cells with nonfunctional p53 or impaired reactive oxygen species (ROS) detoxification in a wide variety of mutant p53 cells.

  17. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    Science.gov (United States)

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  18. Metabolic oxidative stress elicited by the copper(II) complex [Cu(isaepy)2] triggers apoptosis in SH-SY5Y cells through the induction of the AMP-activated protein kinase/p38MAPK/p53 signalling axis: evidence for a combined use with 3-bromopyruvate in neuroblastoma treatment.

    Science.gov (United States)

    Filomeni, Giuseppe; Cardaci, Simone; Da Costa Ferreira, Ana Maria; Rotilio, Giuseppe; Ciriolo, Maria Rosa

    2011-08-01

    We have demonstrated previously that the complex bis[(2-oxindol-3-ylimino)-2-(2-aminoethyl)pyridine-N,N']copper(II), named [Cu(isaepy)(2)], induces AMPK (AMP-activated protein kinase)-dependent/p53-mediated apoptosis in tumour cells by targeting mitochondria. In the present study, we found that p38(MAPK) (p38 mitogen-activated protein kinase) is the molecular link in the phosphorylation cascade connecting AMPK to p53. Transfection of SH-SY5Y cells with a dominant-negative mutant of AMPK resulted in a decrease in apoptosis and a significant reduction in phospho-active p38(MAPK) and p53. Similarly, reverse genetics of p38(MAPK) yielded a reduction in p53 and a decrease in the extent of apoptosis, confirming an exclusive hierarchy of activation that proceeds via AMPK/p38(MAPK)/p53. Fuel supplies counteracted [Cu(isaepy)(2)]-induced apoptosis and AMPK/p38(MAPK)/p53 activation, with glucose being the most effective, suggesting a role for energetic imbalance in [Cu(isaepy)(2)] toxicity. Co-administration of 3BrPA (3-bromopyruvate), a well-known inhibitor of glycolysis, and succinate dehydrogenase, enhanced apoptosis and AMPK/p38(MAPK)/p53 signalling pathway activation. Under these conditions, no toxic effect was observed in SOD (superoxide dismutase)-overexpressing SH-SY5Y cells or in PCNs (primary cortical neurons), which are, conversely, sensitized to the combined treatment with [Cu(isaepy)(2)] and 3BrPA only if grown in low-glucose medium or incubated with the glucose-6-phosphate dehydrogenase inhibitor dehydroepiandrosterone. Overall, the results suggest that NADPH deriving from the pentose phosphate pathway contributes to PCN resistance to [Cu(isaepy)(2)] toxicity and propose its employment in combination with 3BrPA as possible tool for cancer treatment. © The Authors Journal compilation © 2011 Biochemical Society

  19. Assessment of the DNA damaging potential of environmental chemicals using a quantitative high-throughput screening approach to measure p53 activation.

    Science.gov (United States)

    Witt, Kristine L; Hsieh, Jui-Hua; Smith-Roe, Stephanie L; Xia, Menghang; Huang, Ruili; Zhao, Jinghua; Auerbach, Scott S; Hur, Junguk; Tice, Raymond R

    2017-08-01

    Genotoxicity potential is a critical component of any comprehensive toxicological profile. Compounds that induce DNA or chromosomal damage often activate p53, a transcription factor essential to cell cycle regulation. Thus, within the US Tox21 Program, we screened a library of ∼10,000 (∼8,300 unique) environmental compounds and drugs for activation of the p53-signaling pathway using a quantitative high-throughput screening assay employing HCT-116 cells (p53 +/+ ) containing a stably integrated β-lactamase reporter gene under control of the p53 response element (p53RE). Cells were exposed (-S9) for 16 hr at 15 concentrations (generally 1.2 nM to 92 μM) three times, independently. Excluding compounds that failed analytical chemistry analysis or were suspected of inducing assay interference, 365 (4.7%) of 7,849 unique compounds were concluded to activate p53. As part of an in-depth characterization of our results, we first compared them with results from traditional in vitro genotoxicity assays (bacterial mutation, chromosomal aberration); ∼15% of known, direct-acting genotoxicants in our library activated the p53RE. Mining the Comparative Toxicogenomics Database revealed that these p53 actives were significantly associated with increased expression of p53 downstream genes involved in DNA damage responses. Furthermore, 53 chemical substructures associated with genotoxicity were enriched in certain classes of p53 actives, for example, anthracyclines (antineoplastics) and vinca alkaloids (tubulin disruptors). Interestingly, the tubulin disruptors manifested unusual nonmonotonic concentration response curves suggesting activity through a unique p53 regulatory mechanism. Through the analysis of our results, we aim to define a role for this assay as one component of a comprehensive toxicological characterization of large compound libraries. Environ. Mol. Mutagen. 58:494-507, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  1. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  2. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  3. P53 and Rb tumor suppressor gene alterations in gastric cancer Alterações dos genes supressores tumorais p53 e Rb no câncer gástrico

    Directory of Open Access Journals (Sweden)

    Rejane Mattar

    2004-01-01

    Full Text Available Inactivation of tumor suppressor genes has been frequently observed in gastric carcinogenesis. Our purpose was to study the involvement of p53, APC, DCC, and Rb genes in gastric carcinoma. METHOD: Loss of heterozygosity of the p53, APC, DCC and Rb genes was studied in 22 gastric cancer tissues using polymerase chain reaction; single-strand conformation polymorphism of the p53 gene exons 5-6 and exons 7-8 was studied using 35S-dATP, and p53 expression was detected using a histological immunoperoxidase method with an anti-p53 clone. RESULTS AND DISCUSSION: No loss of heterozygosity was observed in any of these tumor suppressor genes; homozygous deletion was detected in the Rb gene in 23% (3/13 of the cases of intestinal-type gastric carcinoma. Eighteen (81.8% cases showed band mobility shifts in exons 5-6 and/or 7-8 of the p53 gene. The presence of the p53 protein was positive in gastric cancer cells in 14 cases (63.6%. Normal gastric mucosa showed negative staining for p53; thus, the immunoreactivity was likely to represent mutant forms. The correlation of band mobility shift and the immunoreactivity to anti-p53 was not significant (P = .90. There was no correlation of gene alterations with the disease severity. CONCLUSIONS: The inactivation of Rb and p53 genes is involved in gastric carcinogenesis in our environment. Loss of the Rb gene observed only in the intestinal-type gastric cancer should be further evaluated in association with Helicobacter pylori infection. The p53 gene was affected in both intestinal and diffuse histological types of gastric cancer.A inativação de genes supressores tumorais tem sido freqüentemente observada na carcinogênese gástrica. O nosso objetivo foi estudar o envolvimento dos genes p53, APC, DCC e Rb no câncer gástrico. MÉTODO: Vinte e dois casos de câncer gástrico foram estudados por PCR-LOH (reação de polimerase em cadeia- perda de alelo heterozigoto dos genes p53, APC, DCC e Rb; e por PCR-SSCP (rea

  4. Super p53 for Treatment of Ovarian Cancer

    Science.gov (United States)

    2017-09-01

    System 3, Clontech) containing wt-p53, p53-CC, and ZsGreen (control) were made. Ad-ZsGreen was tested in ID8 cells, which showed very high expression...views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army...MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14

  5. Chk1 inhibition activates p53 through p38 MAPK in tetraploid cancer cells.

    Science.gov (United States)

    Vitale, Ilio; Senovilla, Laura; Galluzzi, Lorenzo; Criollo, Alfredo; Vivet, Sonia; Castedo, Maria; Kroemer, Guido

    2008-07-01

    We have previously shown that tetraploid cancer cells succumb through a p53-dependent apoptotic pathway when checkpoint kinase 1 (Chk1) is depleted by small interfering RNAs (siRNAs) or inhibited with 7-hydroxystaurosporine (UCN-01). Here, we demonstrate that Chk1 inhibition results in the activating phosphorylation of p38 mitogen-activated protein kinase (p38 MAPK). Depletion of p38 MAPK by transfection with a siRNA targeting the alpha isoform of p38 MAPK (p38alpha MAPK) abolishes the phosphorylation of p53 on serines 15 and 46 that is induced by Chk1 knockdown. The siRNA-mediated downregulation and pharmacological inhibition of p38alpha MAPK (with SB 203580) also reduces cell death induced by Chk1 knockdown or UCN-01. These results underscore the role of p38 MAPK as a pro-apoptotic kinase in the p53-dependant pathway for the therapeutic elimination of polyploidy cells.

  6. Inhibition of Endothelial p53 Improves Metabolic Abnormalities Related to Dietary Obesity

    Directory of Open Access Journals (Sweden)

    Masataka Yokoyama

    2014-06-01

    Full Text Available Accumulating evidence has suggested a role for p53 activation in various age-associated conditions. Here, we identified a crucial role of endothelial p53 activation in the regulation of glucose homeostasis. Endothelial expression of p53 was markedly upregulated when mice were fed a high-calorie diet. Disruption of endothelial p53 activation improved dietary inactivation of endothelial nitric oxide synthase that upregulated the expression of peroxisome proliferator-activated receptor-γ coactivator-1α in skeletal muscle, thereby increasing mitochondrial biogenesis and oxygen consumption. Mice with endothelial cell-specific p53 deficiency fed a high-calorie diet showed improvement of insulin sensitivity and less fat accumulation, compared with control littermates. Conversely, upregulation of endothelial p53 caused metabolic abnormalities. These results indicate that inhibition of endothelial p53 could be a novel therapeutic target to block the vicious cycle of cardiovascular and metabolic abnormalities associated with obesity.

  7. The WW domain protein Kibra acts upstream of Hippo in Drosophila

    DEFF Research Database (Denmark)

    Baumgartner, Roland; Poernbacher, Ingrid; Buser, Nathalie

    2010-01-01

    inactivating the transcriptional coactivator Yorkie is well established, much less is known about the upstream events that regulate Hippo signaling activity. The FERM domain proteins Expanded and Merlin appear to represent two different signaling branches that feed into the Hippo pathway. Signaling...... by the atypical cadherin Fat may act via Expanded, but how Merlin is regulated has remained elusive. Here, we show that the WW domain protein Kibra is a Hippo signaling component upstream of Hippo and Merlin. Kibra acts synergistically with Expanded, and it physically interacts with Merlin. Thus, Kibra...

  8. The tumor suppressors pRB and p53 as regulators of adipocyte differentiation and function

    DEFF Research Database (Denmark)

    Hallenborg, Philip; Feddersen, Søren; Madsen, Lise

    2009-01-01

    BACKGROUND: The retinoblastoma protein (pRB) and p53 are crucial members of regulatory networks controlling the cell cycle and apoptosis, and a hallmark of virtually all cancers is dysregulation of expression or function of pRB or p53. Although they are best known for their role in cancer...

  9. P53 overexpression in head and neck carcinoma and radiotherapy results

    International Nuclear Information System (INIS)

    Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John

    1996-01-01

    Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a

  10. Association of p53 protein expression with clinical outcome in advanced supraglottic cancer

    International Nuclear Information System (INIS)

    Kang, Jin Oh; Hong, Seong Eon

    1998-01-01

    To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression

  11. Suppression of p53 by Notch3 is mediated by Cyclin G1 and sustained by MDM2 and miR-221 axis in hepatocellular carcinoma

    Science.gov (United States)

    Baglioni, Michele; Fornari, Francesca; Giannone, Ferdinando; Ravaioli, Matteo; Cescon, Matteo; Chieco, Pasquale; Bolondi, Luigi; Gramantieri, Laura

    2014-01-01

    To successfully target Notch receptors as part of a multidrug anticancer strategy, it will be essential to fully characterize the factors that are modulated by Notch signaling. We recently reported that Notch3 silencing in HCC results in p53 up-regulation in vitro and, therefore, we focused on the mechanisms that associate Notch3 to p53 protein expression. We explored the regulation of p53 by Notch3 signalling in three HCC cell lines HepG2, SNU398 and Hep3B.We found that Notch3 regulates p53 at post-transcriptional level controlling both Cyclin G1 expression and the feed-forward circuit involving p53, miR-221 and MDM2. Moreover, our results were validated in human HCCs and in a rat model of HCC treated with Notch3 siRNAs. Our findings are becoming an exciting area for further in-depth research toward targeted inactivation of Notch3 receptor as a novel therapeutic approach for increasing the drug-sensitivity, and thereby improving the treatment outcome of patients affected by HCC. Indeed, we proved that Notch3 silencing strongly increases the effects of Nutilin-3. With regard to therapeutic implications, Notch3-specific drugs could represent a valuable strategy to limit Notch signaling in the context of hepatocellular carcinoma over-expressing this receptor. PMID:25431954

  12. Inactivation and inducible oncogenic mutation of p53 in gene targeted pigs.

    Directory of Open Access Journals (Sweden)

    Simon Leuchs

    Full Text Available Mutation of the tumor suppressor p53 plays a major role in human carcinogenesis. Here we describe gene-targeted porcine mesenchymal stem cells (MSCs and live pigs carrying a latent TP53(R167H mutant allele, orthologous to oncogenic human mutant TP53(R175H and mouse Trp53(R172H, that can be activated by Cre recombination. MSCs carrying the latent TP53(R167H mutant allele were analyzed in vitro. Homozygous cells were p53 deficient, and on continued culture exhibited more rapid proliferation, anchorage independent growth, and resistance to the apoptosis-inducing chemotherapeutic drug doxorubicin, all characteristic of cellular transformation. Cre mediated recombination activated the latent TP53(R167H allele as predicted, and in homozygous cells expressed mutant p53-R167H protein at a level ten-fold greater than wild-type MSCs, consistent with the elevated levels found in human cancer cells. Gene targeted MSCs were used for nuclear transfer and fifteen viable piglets were produced carrying the latent TP53(R167H mutant allele in heterozygous form. These animals will allow study of p53 deficiency and expression of mutant p53-R167H to model human germline, or spontaneous somatic p53 mutation. This work represents the first inactivation and mutation of the gatekeeper tumor suppressor gene TP53 in a non-rodent mammal.

  13. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    OpenAIRE

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...

  14. p21-LacZ reporter mice reflect p53-dependent toxic insult

    International Nuclear Information System (INIS)

    Vasey, Douglas B.; Wolf, C. Roland; MacArtney, Thomas; Brown, Ken; Whitelaw, C. Bruce A.

    2008-01-01

    There is an urgent need to discover less toxic and more selective drugs to treat disease. The use of transgenic mice that report on toxic insult-induced transcription can provide a valuable tool in this regard. To exemplify this strategy, we have generated transgenic mice carrying a p21-LacZ transgene. Transgene activity reflected endogenous p21 gene activation in various tissues, displayed compound-specific spatial expression signatures in the brain and immune tissues and enabled p53-dependent and p53-independent responses to be identified. We discuss the application of these mice in delineating the molecular events in normal cellular growth and disease and for the evaluation of drug toxicity

  15. The yeast Sks1p kinase signaling network regulates pseudohyphal growth and glucose response.

    Directory of Open Access Journals (Sweden)

    Cole Johnson

    2014-03-01

    Full Text Available The yeast Saccharomyces cerevisiae undergoes a dramatic growth transition from its unicellular form to a filamentous state, marked by the formation of pseudohyphal filaments of elongated and connected cells. Yeast pseudohyphal growth is regulated by signaling pathways responsive to reductions in the availability of nitrogen and glucose, but the molecular link between pseudohyphal filamentation and glucose signaling is not fully understood. Here, we identify the glucose-responsive Sks1p kinase as a signaling protein required for pseudohyphal growth induced by nitrogen limitation and coupled nitrogen/glucose limitation. To identify the Sks1p signaling network, we applied mass spectrometry-based quantitative phosphoproteomics, profiling over 900 phosphosites for phosphorylation changes dependent upon Sks1p kinase activity. From this analysis, we report a set of novel phosphorylation sites and highlight Sks1p-dependent phosphorylation in Bud6p, Itr1p, Lrg1p, Npr3p, and Pda1p. In particular, we analyzed the Y309 and S313 phosphosites in the pyruvate dehydrogenase subunit Pda1p; these residues are required for pseudohyphal growth, and Y309A mutants exhibit phenotypes indicative of impaired aerobic respiration and decreased mitochondrial number. Epistasis studies place SKS1 downstream of the G-protein coupled receptor GPR1 and the G-protein RAS2 but upstream of or at the level of cAMP-dependent PKA. The pseudohyphal growth and glucose signaling transcription factors Flo8p, Mss11p, and Rgt1p are required to achieve wild-type SKS1 transcript levels. SKS1 is conserved, and deletion of the SKS1 ortholog SHA3 in the pathogenic fungus Candida albicans results in abnormal colony morphology. Collectively, these results identify Sks1p as an important regulator of filamentation and glucose signaling, with additional relevance towards understanding stress-responsive signaling in C. albicans.

  16. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae

    1999-01-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  17. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)

    1999-03-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  18. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  19. Discrimination of p53 immunohistochemistry-positive tumors by its staining pattern in gastric cancer

    International Nuclear Information System (INIS)

    Ando, Koji; Oki, Eiji; Saeki, Hiroshi; Yan, Zhao; Tsuda, Yasuo; Hidaka, Gen; Kasagi, Yuta; Otsu, Hajime; Kawano, Hiroyuki; Kitao, Hiroyuki; Morita, Masaru; Maehara, Yoshihiko

    2015-01-01

    Immunohistochemistry staining of p53 is a cheap and simple method to detect aberrant function of p53. However, there are some discrepancies between the result of immunohistochemistry staining and mutation analysis. This study attempted to find a new definition of p53 staining by its staining pattern. Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients. Also SNP-CGH array analysis was conducted to four cases. Positive staining of p53 was observed in 88 (59.5%) tumors. Tumors with positive p53 staining showed malignant features compared to negative tumors. Mutation of TP53 gene was observed in 29 (19.6%) tumors with higher age and differentiated type. In positive p53 tumors, two types could be distinguished; aberrant type and scattered type. With comparison to TP53 gene mutation analysis, all the scattered type had wild-type TP53 gene (P = 0.0003). SNP-CGH array showed that scattered-type tumors had no change in the structure of chromosome 17. P53-scattered-type staining tumors may reflect a functionally active nonmutated TP53 gene. In interpretation of p53 immunohistochemistry staining, distinguishing p53-positive tumors by their staining pattern may be important in gastric cancer

  20. Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients

    DEFF Research Database (Denmark)

    Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune

    2011-01-01

    patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...

  1. Retention of the In Vitro Radiosensitizing Potential of Gemcitabine Under Anoxic Conditions, in p53 Wild-Type and p53-Deficient Non-Small-Cell Lung Carcinoma Cells

    International Nuclear Information System (INIS)

    Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip

    2011-01-01

    Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G 0/1 arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.

  2. AAVPG: A vigilant vector where transgene expression is induced by p53

    Energy Technology Data Exchange (ETDEWEB)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.; Strauss, Bryan E., E-mail: bstrauss@usp.br

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 fold increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.

  3. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    International Nuclear Information System (INIS)

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen

    2015-01-01

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection

  4. Porcine parvovirus infection induces apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated pathway

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Hongling; Huang, Yong; Du, Qian; Luo, Xiaomao; Zhang, Liang; Zhao, Xiaomin; Tong, Dewen, E-mail: dwtong@nwsuaf.edu.cn

    2015-01-09

    Highlights: • PPV reduces PK-15 cells viability by inducing apoptosis. • PPV infection induces apoptosis through mitochondria-mediated pathway. • PPV infection activates p53 to regulate the mitochondria apoptotic signaling. - Abstract: Porcine parvovirus (PPV) infection has been reported to induce the cytopathic effects (CPE) in some special host cells and contribute the occurrence of porcine parvovirus disease, but the molecular mechanisms underlying PPV-induced CPE are not clear. In this study, we investigated the morphological and molecular changes of porcine kidney cell line (PK-15 cells) infected with PPV. The results showed that PPV infection inhibited the viability of PK-15 cells in a time and concentration dependent manner. PPV infection induced typical apoptotic features including chromatin condensation, apoptotic body formation, nuclear fragmentation, and Annexin V-binding activity. Further studies showed that Bax was increased and translocated to mitochondria, whereas Bcl-2 was decreased in PPV-infected cells, which caused mitochondrial outer-membrane permeabilization, resulting in the release of mitochondrial cytochrome c, followed by caspase-9 and caspase-3 activation. However, the expression of Fas and Fas ligand (FasL) did not appear significant changes in the process of PPV-induced apoptosis. Moreover, PPV infection activated p53 signaling, which was involved in the activation of apoptotic signaling induced by PPV infection via regulation of Bax and Bcl-2. Taken together, our results demonstrated that PPV infection induced apoptosis in PK-15 cells through activation of p53 and mitochondria-mediated apoptosis pathway. This study may contribute to shed light on the molecular pathogenesis of PPV infection.

  5. Oncogenic c-Myc-induced lymphomagenesis is inhibited non-redundantly by the p19Arf–Mdm2–p53 and RP–Mdm2–p53 pathways

    OpenAIRE

    Meng, X; Carlson, NR; Dong, J; Zhang, Y

    2015-01-01

    The multifaceted oncogene c-Myc plays important roles in the development and progression of human cancer. Recent in vitro and in vivo studies have shown that the p19Arf–Mdm2–p53 and the ribosomal protein (RP)–Mdm2–p53 pathways are both essential in preventing oncogenic c-Myc-induced tumorigenesis. Disruption of each pathway individually by p19Arf deletion or by Mdm2C305F mutation, which disrupts RP-Mdm2 binding, accelerates Eμ-myc transgene-induced pre-B/B-cell lymphoma in mice at seemingly s...

  6. The 52Cr(p, γ)53Mn reaction

    NARCIS (Netherlands)

    Vuister, P.H.

    The 52Cr(p, γ)53Mn reaction was investigated in the energy region Ep = 1.36–2.26 MeV. The resonance energies, the corresponding 53Mn excitation energies and the resonance strengths of 199 resonances, assigned to this reaction, are reported. The excitation energies and gamma-ray branchings of 13

  7. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    Directory of Open Access Journals (Sweden)

    Liang Y

    2018-03-01

    Full Text Available Yayun Liang,1 Benford Mafuvadze,1 Cynthia Besch-Williford,2 Salman M Hyder1 1Deparment of Biomedical Sciences and Dalton Cardiovascular Research Center, Columbia, MO, USA; 2IDEXX BioResearch, Columbia, MO, USA Background: Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53 lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods: In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results: APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood

  8. The role of p53 in the response to mitotic spindle damage

    International Nuclear Information System (INIS)

    Meek, D.W.

    2000-01-01

    The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)

  9. Relationship between P53 and bystander effect induced by radiated hepatoma cells

    International Nuclear Information System (INIS)

    Zhao Meijia; Shen Bo; Yuan Dexiao; Cheng Honghong; Shao Chunlin

    2009-01-01

    The role of p53 in bystander responses on normal liver cells were investigated by co-culturing irradiated hepatoma cells with non-irradiated bystander Chang liver cells. It was found that radiosensitivity of the hepatoma cells was relative to p53. HepG2 cells with wtp53 had the highest radiosensitivity followed by PLC/PRF/5 cells with mtp53 and Hep3B cells with null-p53. The induction of bystander micronucleus(MN) was observed only in the Chang liver cells that had been co-cultured with HepG2 cells but not co-cultured with PLC/PRF/5 or Hep3B. Also, this bystander MN was relative to the irradiation dose and the cell co-culture rime. When the hepatoma cells were treated with pifithrin-α, a p53 inhibitor, their radiosensitivities were reduced, and the bystander effect was diminished. The results indicate that p53 could regulate not only the radiosensitivity but also the bystander response. (authors)

  10. Palmitate induces VSMC apoptosis via toll like receptor (TLR)4/ROS/p53 pathway.

    Science.gov (United States)

    Zhang, Yuanjun; Xia, Guanghao; Zhang, Yaqiong; Liu, Juxiang; Liu, Xiaowei; Li, Weihua; Lv, Yaya; Wei, Suhong; Liu, Jing; Quan, Jinxing

    2017-08-01

    Toll-like receptor 4 (TLR4) has been implicated in vascular inflammation, as well as in the pathogenesis of atherosclerosis and diabetes. Vascular smooth muscle cell (VSMC) apoptosis has been shown to induce plaque vulnerability in atherosclerosis. Previous studies reported that palmitate induced apoptosis in VSMCs; however, the role of TLR4 in palmitate-induced apoptosis in VSMCs has not yet been defined. In this study, we investigated whether or not palmitate-induced apoptosis depended on the activation of the TLR4 pathway. VSMCs were treated with or without palmitate, CRISPR/Cas9z-mediated genome editing methods were used to deplete TLR4 expression, while NADPH oxidase inhibitors were used to inhibit reactive oxygen species (ROS) generation. Cell apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, ROS was measured using the 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) method, the mRNA and protein expression levels of caspase 3, caspase 9, BCL-2 and p53 were studied by real-time polymerase chain reaction (RT-PCR) and ELISA. Palmitate significantly promotes VSMC apoptosis, ROS generation, and expression of caspase 3, caspase 9 and p53; while NADPH oxidase inhibitor pretreatment markedly attenuated these effects. Moreover, knockdown of TLR4 significantly blocked palmitate-induced ROS generation and VSMC apoptosis accompanied by inhibition of caspase 3, caspase 9, p53 expression and restoration of BCL-2 expression. Our results suggest that palmitate-induced apoptosis depends on the activation of the TLR4/ROS/p53 signaling pathway, and that TLR4 may be a potential therapeutic target for the prevention and treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. p53-Dependent suppression of genome instability in germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Otozai, Shinji [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Ishikawa-Fujiwara, Tomoko [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Oda, Shoji [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Kamei, Yasuhiro [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Ryo, Haruko [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Sato, Ayuko [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Nomura, Taisei [Nomura Project, National Institute of Biomedical Innovation, Osaka 565-0085 (Japan); Mitani, Hiroshi [Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba 277-8562 (Japan); Tsujimura, Tohru [Department of Pathology, Hyogo College of Medicine, Hyogo 663-8501 (Japan); Inohara, Hidenori [Department of Otorhinolaryngology and Head and Neck Surgery, Osaka University School of Medicine, Osaka 565-0871 (Japan); Todo, Takeshi, E-mail: todo@radbio.med.osaka-u.ac.jp [Department of Radiation Biology and Medical Genetics, Graduate School of Medicine, Osaka University, B4, 2-2 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2014-02-15

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2{sup −/−} fish had a high frequency of spontaneous MSI. • p53{sup −/−} fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2{sup −/−} males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2{sup −/−} and wild-type fish. By contrast, irradiated p53{sup −/−} fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2{sup −/−} fish, but negligible levels in p53{sup −/−} fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells.

  12. p53-Dependent suppression of genome instability in germ cells

    International Nuclear Information System (INIS)

    Otozai, Shinji; Ishikawa-Fujiwara, Tomoko; Oda, Shoji; Kamei, Yasuhiro; Ryo, Haruko; Sato, Ayuko; Nomura, Taisei; Mitani, Hiroshi; Tsujimura, Tohru; Inohara, Hidenori; Todo, Takeshi

    2014-01-01

    Highlights: • Radiation-induced microsatellite instability (MSI) was investigated in medaka fish. • msh2 −/− fish had a high frequency of spontaneous MSI. • p53 −/− fish had a high frequency of radiation-induced MSI. • p53 and msh2 suppress MSI by different pathways: mismatch removal and apoptosis. - Abstract: Radiation increases mutation frequencies at tandem repeat loci. Germline mutations in γ-ray-irradiated medaka fish (Oryzias latipes) were studied, focusing on the microsatellite loci. Mismatch-repair genes suppress microsatellite mutation by directly removing altered sequences at the nucleotide level, whereas the p53 gene suppresses genetic alterations by eliminating damaged cells. The contribution of these two defense mechanisms to radiation-induced microsatellite instability was addressed. The spontaneous mutation frequency was significantly higher in msh2 −/− males than in wild-type fish, whereas there was no difference in the frequency of radiation-induced mutations between msh2 −/− and wild-type fish. By contrast, irradiated p53 −/− fish exhibited markedly increased mutation frequencies, whereas their spontaneous mutation frequency was the same as that of wild-type fish. In the spermatogonia of the testis, radiation induced a high level of apoptosis both in wild-type and msh2 −/− fish, but negligible levels in p53 −/− fish. The results demonstrate that the msh2 and p53 genes protect genome integrity against spontaneous and radiation-induced mutation by two different pathways: direct removal of mismatches and elimination of damaged cells

  13. A STUDY OF P53 EXPRESSION IN UROTHELIAL NEOPLASMS OF URINARY BLADDER

    Directory of Open Access Journals (Sweden)

    G. Sathish Kumar

    2017-07-01

    Full Text Available BACKGROUND Urothelial Cell Carcinoma (UCC of urinary bladder is the seventh commonest cancer wordwide.1 At initial diagnosis, 30% of UCC display solid and invasive growth patterns and are locally advanced or metastatic at the time of diagnosis. 70% of tumours are noninvasive papillary UCC confined to the epithelium and subepithelial connective tissue,2 which can be managed by endoscopic resection. A significant number of post-resected cases, progress for recurrence of tumour and infiltration to muscle layers. Invasive bladder cancer has high morbidity and uniform mortality when it is metastatic. There are no effective tools to predict aggressiveness of tumour, so that these cases can be managed more successfully. Mutated Tp53/p53 is the genetic abnormality most frequently associated with UCC and related to cell transformation, malignancy and high recurrence rates.2 MATERIALS AND METHODS This is a descriptive study conducted in the departments of urology and pathology and during the period of March 2014 to February 2015. All consecutive cystoscopic biopsies, Trans urethral resection of bladder tumour (TURBT and radical cystectomy specimens histopathologically diagnosed as UCC were included in the study. p53 expression was assessed by immunohistochemistry. Positive and negative controls were used. Bivariate analysis was done using Chi-square test in all cases. RESULTS A total of 80 cases were analysed. Significant association of p53 expression was found in higher grades of tumour. Also, noted relation of p53 mutation with tumour size, multifocality, multiplicity, muscle invasion and tumour stage, which were statistically not significant. CONCLUSION Bladder tumour grade shows significant association to p53 expression. Papillary neoplasm of low malignant potential (PUNLMP tumours are negative for p53, and in the present study, there was significant difference in p53 over expression low-grade papillary UCC compared with PUNLMP. 90% of low

  14. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  15. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  16. Changes in protein expression in p53 deleted spontaneous thymic lymphomas

    DEFF Research Database (Denmark)

    Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm

    2004-01-01

    with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....

  17. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

    2017-01-01

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  18. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya

    2017-07-15

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  19. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    International Nuclear Information System (INIS)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna

    2015-01-01

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  20. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)

    2015-08-15

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  1. Modulation of Cyclins, p53 and Mitogen-Activated Protein Kinases Signaling in Breast Cancer Cell Lines by 4-(3,4,5-Trimethoxyphenoxybenzoic Acid

    Directory of Open Access Journals (Sweden)

    Kuan-Han Lee

    2014-01-01

    Full Text Available Despite the advances in cancer therapy and early detection, breast cancer remains a leading cause of cancer-related deaths among females worldwide. The aim of the current study was to investigate the antitumor activity of a novel compound, 4-(3,4,5-trimethoxyphenoxybenzoic acid (TMPBA and its mechanism of action, in breast cancer. Results indicated the relatively high sensitivity of human breast cancer cell-7 and MDA-468 cells towards TMPBA with IC50 values of 5.9 and 7.9 µM, respectively compared to hepatocarcinoma cell line Huh-7, hepatocarcinoma cell line HepG2, and cervical cancer cell line Hela cells. Mechanistically, TMPBA induced apoptotic cell death in MCF-7 cells as indicated by 4',6-diamidino-2-phenylindole (DAPI nuclear staining, cell cycle analysis and the activation of caspase-3. Western blot analysis revealed the ability of TMPBA to target pathways mediated by mitogen-activated protein (MAP kinases, 5' adenosine monophosphate-activated protein kinase (AMPK, and p53, of which the concerted action underlined its antitumor efficacy. In addition, TMPBA induced alteration of cyclin proteins’ expression and consequently modulated the cell cycle. Taken together, the current study underscores evidence that TMPBA induces apoptosis in breast cancer cells via the modulation of cyclins and p53 expression as well as the modulation of AMPK and mitogen-activated protein kinases (MAPK signaling. These findings support TMPBA’s clinical promise as a potential candidate for breast cancer therapy.

  2. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  3. Mutant p53 drives cancer by subverting multiple tumour suppression pathways

    Directory of Open Access Journals (Sweden)

    Sue eHaupt

    2016-01-01

    Full Text Available The tumour suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counter-productively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins (including many transcription factors, which normally partner with its wild type, tumour-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism and corrupt them to become cancer promoting.

  4. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  5. Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression

    Directory of Open Access Journals (Sweden)

    Takahiro Ebata

    2017-01-01

    Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.

  6. Tumor suppressor WWOX and p53 alterations and drug resistance in glioblastomas

    Directory of Open Access Journals (Sweden)

    Ming-Fu eChiang

    2013-03-01

    Full Text Available Tumor suppressor p53 are frequently mutated in glioblastomas (GBMs and appears to contribute, in part, to resistance to temozolomide and therapeutic drugs. WW domain-containing oxidoreductase WWOX (FOR or WOX1 is a proapoptotic protein and is considered as a tumor suppressor. Loss of WWOX gene expression is frequently seen in malignant cancer cells due to promoter hypermethylation, genetic alterations, and translational blockade. Intriguingly, ectopic expression of wild type WWOX preferentially induces apoptosis in human glioblastoma cells harboring mutant p53. WWOX is known to physically bind and stabilize wild type p53. Here, we provide an overview for the updated knowledge in p53 and WWOX, and postulate a potential scenarios that wild type and mutant p53, or isoforms, modulate the apoptotic function of WWOX. We propose that triggering WWOX activation by therapeutic drugs under p53 functional deficiency is needed to overcome TMZ resistance and induce GBM cell death.

  7. p53 expression and mutation analysis of odontogenic cysts with and without dysplasia.

    Science.gov (United States)

    Cox, Darren P

    2012-01-01

    Overexpression of p53 protein is well described in odontogenic cystic lesions (OCLs), including those with epithelial dysplasia; however, most p53 antibodies stain both wild-type and mutated p53 protein and may not reflect genotype. Direct sequencing of the p53 gene has not identified mutations in OCLs with dysplasia. The purpose of this study was to determine the molecular basis of p53 expression in several types of OCLs with and without dysplasia. The study material comprised 13 OCLs: odontogenic keratocyst (n = 5), orthokeratinized odontogenic cyst (n = 5), dentigerous cyst (n = 2), lateral periodontal cyst (n = 1), and unspecified developmental odontogenic cyst (UDOC) (n = 1). Five of these had features of mild or moderate epithelial dysplasia. One intraosseous squamous cell carcinoma (SCC) that was believed to have arisen from an antecedent dysplastic orthokeratinized OC was also included. Immunohistochemistry was performed using the DO7 monoclonal antibody that recognizes wild-type and mutated p53. DNA was extracted from microdissected tissue for all samples and exons 4 to 8 of the p53 gene direct sequenced. In 4 of 5 OCLs with dysplasia there was strong nuclear staining of basal and suprabasal cells. In all cases without dysplasia, nuclear expression in basal cells was either negative or weak and was absent in suprabasal cell nuclei. A mutation in exon 6 of the p53 gene (E224D) was identified in both the dysplastic orthokeratinized OC and the subsequent intraosseous SCC. OCLs with features of dysplasia show increased expression of p53 protein that does not reflect p53 mutational status. One dysplastic OC shared the same p53 mutation with a subsequent intraosseous SCC, indicating that p53 mutation may be associated with malignant transformation in this case. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. FATS is a transcriptional target of p53 and associated with antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhang Xifeng

    2010-09-01

    Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.

  9. Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

    Science.gov (United States)

    Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

    2009-06-19

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

  10. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elemen