P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

Energy Technology Data Exchange (ETDEWEB)

Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

2002-03-01

The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

Directory of Open Access Journals (Sweden)

Alnawaz Rehemtulla

2004-01-01

Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

International Nuclear Information System (INIS)

Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

2005-01-01

The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding.

Science.gov (United States)

Samanta, Sudipta; Mukherjee, Sanchita

2017-10-01

The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

Science.gov (United States)

Samanta, Sudipta; Mukherjee, Sanchita

2017-10-01

The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

Energy Technology Data Exchange (ETDEWEB)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4�

RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response

Directory of Open Access Journals (Sweden)

Toshinori Ozaki

2013-01-01

Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.

The Role of Tumor Protein 53 Mutations in Common Human Cancers and Targeting the Murine Double Minute 2–P53 Interaction for Cancer Therapy

Directory of Open Access Journals (Sweden)

Tayebeh Hamzehloie

2012-03-01

Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.

Cellular response to DNA damage. Link between p53 and DNA-PK

International Nuclear Information System (INIS)

Salles-Passador, I.; Fotedar, R.; Fotedar, A.

1999-01-01

Cells which lack DNA-activated protein kinase (DNA-PK) are very susceptible to ionizing radiation and display an inability to repair double-strand DNA breaks. DNA-PK is a member of a protein kinase family that includes ATR and ATM which have strong homology in their carboxy-terminal kinase domain with Pl-3 kinase. ATM has been proposed to act upstream of p53 in cellular response to ionizing radiation. DNA-PK may similarly interact with p53 in cellular growth control and in mediation of the response to ionizing radiation. (author)

Chronology of p53 protein accumulation in gastric carcinogenesis

NARCIS (Netherlands)

Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

1995-01-01

p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients

DEFF Research Database (Denmark)

Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune

2011-01-01

patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...

Expression of p53 and p21 in primary glioblastomas

International Nuclear Information System (INIS)

Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

2005-01-01

Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

Expression of p53 protein in high-grade gastroenteropancreatic neuroendocrine carcinoma

DEFF Research Database (Denmark)

Ali, Abir Salwa; Grönberg, Malin; Federspiel, Birgitte

2017-01-01

of immunoreactive p53 protein in GEP-NEC. Materials and methods Tumor tissues from 124 GEP-NEC patients with locally advanced or metastatic disease treated with platinum-based chemotherapy were collected from Nordic centers and clinical data were obtained from the Nordic NEC register. Tumor proliferation rate...... In this cohort of GEP-NEC patients, p53 expression could not be correlated with clinical outcome. However, in patients with colorectal NECs, p53 expression was correlated with shorter PFS and OS. Further studies are needed to establish the role of immunoreactive p53 as a prognostic marker for GEP-NEC patients.......Background Gastroenteropancreatic neuroendocrine carcinomas (GEP-NECs) are aggressive, rapidly proliferating tumors. Therapeutic response to current chemotherapy regimens is usually short lasting. The aim of this study was to examine the expression and potential clinical importance...

Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

Energy Technology Data Exchange (ETDEWEB)

Dai, Jiawen [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg [Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School (Singapore); Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Department of Radiation Oncology, National Cancer Centre (Singapore)

2015-02-27

Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its

Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

International Nuclear Information System (INIS)

Dai, Jiawen; Itahana, Koji; Baskar, Rajamanickam

2015-01-01

Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G 1 /S or G 2 /M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G 0 , therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in

A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation

Directory of Open Access Journals (Sweden)

Kumar Sonia

2011-02-01

Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.

Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

Science.gov (United States)

Llanos, Susana; Serrano, Manuel

2010-10-01

Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

Electrophoretic detection of protein p53 in human leukocytes

International Nuclear Information System (INIS)

Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.

1986-01-01

The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients

Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

OpenAIRE

Rani, Reena; Li, Jie; Pang, Qishen

2008-01-01

Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the ...

Changes in protein expression in p53 deleted spontaneous thymic lymphomas

DEFF Research Database (Denmark)

Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm

2004-01-01

with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....

Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

Science.gov (United States)

Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

2009-01-01

Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

International Nuclear Information System (INIS)

Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi

2006-01-01

Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer

Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

Directory of Open Access Journals (Sweden)

Nishizaki Takashi

2006-07-01

Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.

The prognostic significance of accumulation of p53 protein in stage III non-small cell lung cancer treated by radiotherapy

International Nuclear Information System (INIS)

Langendijk, J.A.; Thunnissen, F.B.J.M.; Lamers, R.J.S.; Jong, J.M.A. de; Velde, G.P.M. ten; Wouters, E.F.M.

1995-01-01

In the present study the prognostic significance of accumulation of nuclear p53 protein on survival and freedom from local progression was investigated. Formalin-fixed, paraffin-embedded sections obtained by bronchoscopy or mediastinoscopy were used to examine the expression of nuclear p53 protein using immunohistochemistry. In 37 cases (57%), overexpression of the p53 protein was detected. No relation was found between p53 expression and other pretreatment variables. Response to radiotherapy was found in 11 p53-negative cases (65%) versus 10 p53-positive cases (42%). Freedom from local progression was significantly better in the p53-negative cases as compared with the p53-positive cases. The p53-negative cases who responded to radiotherapy showed an excellent freedom from local progression rate after 2 years of 100%, whereas all p53-positive cases without response to radiotherapy showed local progression within 24 months. Overall survival between p53-negative and -positive cases did not differ, however the disease-specific survival was found to be worse in the p53-positive cases as compared to the negative cases (median survival 8.4 vs. 14.4 months (P < 0.05)). No correlation was found between p53 expression and the frequency of distant metastases. In conclusion, the results of this study suggest that p53 protein expression may be of prognostic value on freedom from local progression in non-small cell lung carcinoma

Pre-irradiation at a low dose-rate blunted p53 response

International Nuclear Information System (INIS)

Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.

2003-01-01

Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation

Characterisation of the p53-mediated cellular responses evoked in primary mouse cells following exposure to ultraviolet radiation.

Directory of Open Access Journals (Sweden)

Gillian D McFeat

Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.

p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

Science.gov (United States)

Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

2004-06-01

The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

International Nuclear Information System (INIS)

Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko

2012-01-01

The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

Science.gov (United States)

White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

2014-08-01

The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

The role of p53 in the response to mitotic spindle damage

International Nuclear Information System (INIS)

Meek, D.W.

2000-01-01

The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)

Mitochondrial localization of the low level p53 protein in proliferative cells

Energy Technology Data Exchange (ETDEWEB)

Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

2009-10-02

p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

Mitochondrial localization of the low level p53 protein in proliferative cells

International Nuclear Information System (INIS)

Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

2009-01-01

p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

TRIM65 negatively regulates p53 through ubiquitination

Energy Technology Data Exchange (ETDEWEB)

Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

2016-04-22

Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

International Nuclear Information System (INIS)

Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

2011-01-01

eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

Directory of Open Access Journals (Sweden)

Karolyn J Forget

Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

Science.gov (United States)

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

Science.gov (United States)

Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

2017-10-15

Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

Immunohistochemical positive stained p53 protein in bladder transitional cell carcinoma

Directory of Open Access Journals (Sweden)

Halimi Monireh

2009-04-01

Full Text Available Background: Molecular genetics and immunopathologic analysis of bladder cancer have shown some abnormalities in a number of genes and proteins that have been implicated in the development and progression of such tumors, mainly in the p53 pathway. Aims: To investigate the rate of positively stained p53 protein in patients with urothelial papillary carcinoma of the bladder (UCB by immunohistochemistry and its relationship with tumor grade, gender and age of the patients. Settings and Design: During the present cross-sectional study, 100 paraffin-embedded specimens of UCB, which were provided from biopsies of the bladder by transurethral access, were immunohistochemically stained and studied for p53 protein from May 2006 to May 2007 in our referral center pathology laboratory. Materials and Methods: First, 4 µm slices of paraffin sections were provided and then stained by the avidin-biotin peroxidase method. The rate of positively stained p53 protein (defined as positive nuclear staining in over 10% of the cells was assessed. This rate was also estimated and compared between grades, genders and age-related groups (< 70 years, ≥70 years. Statistical Analysis: The χ2 , Fisher′s exact test and Mann-Whitney U test were used for comparing. Results: The overall rate of positively stained specimens was 11% for nuclear p53 protein. This rate was significantly higher in females (10/29 vs. 1/71; P < 0.001; odds ratio [OR]: 0.23; 95% confidence interval [CI]: 4.43-306.08, patients with 70 or older than 70 years (8/42 vs. 3/58; P = 0.04; OR: 0.55; 95% CI: 1.07-17.39 and in high-grade tumors (10/58 vs. 1/42; P = 0.02; OR: 0.59; 95% CI: 0.01-0.95. Conclusions: The rate of positively stained p53 protein for UCB was lower in our population. This rate was also higher in females, patients with 70 or older than 70 years and high grade of UCB.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

Science.gov (United States)

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Influence of P53 on the radiotherapy response of hepatocellular carcinoma

Science.gov (United States)

Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

2015-01-01

Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

Stress-specific response of the p53-Mdm2 feedback loop

Directory of Open Access Journals (Sweden)

Jensen Mogens H

2010-07-01

Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.

53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

Science.gov (United States)

Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

2016-07-02

Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

International Nuclear Information System (INIS)

Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A

2012-01-01

A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology

Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

Directory of Open Access Journals (Sweden)

Kousparou Christina A

2012-08-01

Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.

Significant difference in p53 and p21 protein immunoreactivity in HPV 16 positive and HPV negative breast carcinomas

International Nuclear Information System (INIS)

Hennig, E.M.; Norwegian Radium Hospital, Oslo; Kvinnsland, S.; Holm, R.; Nesland, J.M.

1999-01-01

Human papillomavirus (HPV) 16 has previously been found in 19/41 breast carcinomas (46%) in women with a history of HPV 16 positive CIN III lesions. There was no significant difference in distribution of histological subtypes, mean or median tumour diameter or number of regional lymph node metastases in the HPV positive and HPV negative breast carcinoma groups. P53, p21 and c-erbB-2 proteins were analyzed by immunohistochemistry in the HPV 16 positive and HPV negative breast carcinomas. There was a significant difference in p53 and p21 protein immunoreactivity between HPV 16 positive and HPV negative breast carcinomas (p=0.0091 and p=0.0040), with a significant less detectable p53 and p21 protein immunoreactivity in the HPV 16 positive cases. There was also a significant difference in the coexpression of p53/p21 between the HPV 16 positive and HPV 16 negative breast carcinomas (p=0.002). No significant difference in immunostaining for c-erbB-2 protein in the two groups was found (p=0.15), or for the coexpression of p53/c-erbB-2 (p=0.19). The significantly lower expression of p53 and p21 proteins in HPV 16 positive than in HPV 16 negative breast carcinomas supports the hypothesis of inactivation and degradation of wild-type p53 proteins by HPV 16 E6 and that p53 mutation is not necessary for transformation in the HPV 16 positive cases. (orig.)

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

Directory of Open Access Journals (Sweden)

Asita Elengoe

2015-01-01

Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

Science.gov (United States)

De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

2017-05-01

Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

International Nuclear Information System (INIS)

Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

2014-01-01

Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

p53 protein expression in corneal squamous cell carcinomas of dogs

Directory of Open Access Journals (Sweden)

Lucas Bahdour Cossi

2015-06-01

Full Text Available Ocular tumors play an increasing concern in veterinary ophthalmology. Corneal squamous cell carcinoma is unfrequent in dogs, and by this way it has little studies. Studies that investigated the carcinogenesis mechanisms wich could help to the development of ocular squamous cell carcinoma (SCC in dog are rare. The aim of this work was to identify by immunohistochemical techniques, the p53 protein expression in the spontaneous dog corneal SCC. For this work, were used five cases of corneal SCC and one case of actinic keratitis. The sections were obtained from paraffin-wax blocks and submitted to histopathological and immunohistochemical analysis. All the six samples showed immunolabeling to cytokeratin and p53 protein. These results support the conclusions that the immunoreactivity of p53 protein by immunohistochemistry is present in canine corneal SCC suppporting its role in carcinogenesis of this tumor, but not provides prognostic indicators in cases of SCC corneal in dog; and can be a association of exposure to solar radiation with the possible mutation of the TP53 gene.

Microbial Regulation of p53 Tumor Suppressor.

Directory of Open Access Journals (Sweden)

Alexander I Zaika

2015-09-01

Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

Predictive effect of p53 and p21 alteration on chemotherapy response and survival in locally advanced adenocarcinoma of the esophagus

NARCIS (Netherlands)

Heeren, PAM; Kloppenberg, FWH; Hollema, H; Mulder, NH; Nap, RE; Plukker, JTM

2004-01-01

Background: Cell cycle regulating proteins (p53/p21) and proliferation index Ki-67 have been associated with prognosis and response to chemotherapy. The aim of this study was to determine the significance of these molecular markers on tumor response and prognostic effect in a group of esophageal

Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

Science.gov (United States)

Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

2014-07-01

Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

Autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

Science.gov (United States)

Xie, Xiaolei; Le, Li; Fan, Yanxin; Lv, Lin; Zhang, Junjie

2012-07-01

Mitoribosome in mammalian cells is responsible for synthesis of 13 mtDNA-encoded proteins, which are integral parts of four mitochondrial respiratory chain complexes (I, III, IV and V). ERAL1 is a nuclear-encoded GTPase important for the formation of the 28S small mitoribosomal subunit. Here, we demonstrate that knockdown of ERAL1 by RNA interference inhibits mitochondrial protein synthesis and promotes reactive oxygen species (ROS) generation, leading to autophagic vacuolization in HeLa cells. Cells that lack ERAL1 expression showed a significant conversion of LC3-I to LC3-II and an enhanced accumulation of autophagic vacuoles carrying the LC3 marker, all of which were blocked by the autophagy inhibitor 3-MA as well as by the ROS scavenger NAC. Inhibition of mitochondrial protein synthesis either by ERAL1 siRNA or chloramphenicol (CAP), a specific inhibitor of mitoribosomes, induced autophagy in HTC-116 TP53 (+/+) cells, but not in HTC-116 TP53 (-/-) cells, indicating that tumor protein 53 (TP53) is essential for the autophagy induction. The ROS elevation resulting from mitochondrial protein synthesis inhibition induced TP53 expression at transcriptional levels by enhancing TP53 promoter activity, and increased TP53 protein stability by suppressing TP53 ubiquitination through MAPK14/p38 MAPK-mediated TP53 phosphorylation. Upregulation of TP53 and its downstream target gene DRAM1, but not CDKN1A/p21, was required for the autophagy induction in ERAL1 siRNA or CAP-treated cells. Altogether, these data indicate that autophagy is induced through the ROS-TP53-DRAM1 pathway in response to mitochondrial protein synthesis inhibition.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

OpenAIRE

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins

International Nuclear Information System (INIS)

Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg

2006-01-01

Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro

Mitofusin-2 is a novel direct target of p53

International Nuclear Information System (INIS)

Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

2010-01-01

Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry

International Nuclear Information System (INIS)

Cavalcanti, M.B.; Fernandes, T.S.; Melo, J.A.; Neves, M.A.B.; Machado, C.G.F

2005-01-01

Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10 6 /mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO 2 at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results obtained

Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry

Energy Technology Data Exchange (ETDEWEB)

Cavalcanti, M.B.; Fernandes, T.S. [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear; Amaral, A. [Universite Paris XII (UPXII) (France); Melo, J.A. [Centro de Radioterapia de Pernambuco (CERAPE), PE (Brazil); Neves, M.A.B.; Machado, C.G.F, E-mail: maribrayner@yahoo.com.br [Fundacao de Hematologia e Hemoterapia de Pernambuco, PE (Brazil)

2005-07-01

Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10{sub 6}/mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO{sub 2} at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results

Arecoline-induced phosphorylated p53 and p21(WAF1) protein expression is dependent on ATM/ATR and phosphatidylinositol-3-kinase in clone-9 cells.

Science.gov (United States)

Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea

2009-06-01

Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.

The p53 serology is predictive of the response to the pre surgery radio chemotherapy in the oesophagus cancers

International Nuclear Information System (INIS)

Metges, J.P.; Giroux, M.A.; Volant, A.; Morin, J.F.; Malhaire, J.P.; Gouerou, H.; Ferec, C.; Robaskiewicz, M.; Labat, J.P.

1997-01-01

The mutations of the TP 53 and MTS1 (p16) gene have been described in numerous neoplasms but their relation with a response to the treatment is still little described. The aim of this work was to evaluate the value of the p53 status(serology, immunohistochemistry and molecular biology) and of the MTS1 gene( protein p16) for the response to the pre surgery radio chemotherapy in a troop of patients suffering from esophagus epidermoid cancer. The p53 serology is positive in 40% of cases and is statistically associated to a bad response. The lost of alleles for MTS1 has been found in 20% of cases but non predictive to the response. A prospective study would be interesting. (N.C.)

Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.

Science.gov (United States)

Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M

2009-10-01

The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.

Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

Science.gov (United States)

Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

2018-05-05

The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

The p53/HSP70 inhibitor, 2-phenylethynesulfonamide, causes oxidative stress, unfolded protein response and apoptosis in rainbow trout cells

Energy Technology Data Exchange (ETDEWEB)

Zeng, Fanxing; Tee, Catherine; Liu, Michelle [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); Sherry, James P. [Aquatic Contaminants Research Division, Environment Canada, Burlington, Ontario L7R 4A6 (Canada); Dixon, Brian; Duncker, Bernard P. [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); Bols, Niels C., E-mail: ncbols@uwaterloo.ca [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada)

2014-01-15

Highlights: •2-Phenylethynesulfonamide (PES) is an inhibitor of p53 and HSP 70 in mammals. •In the fish epithelial cell line, RTgill-W1, PES enhanced ROS generation and was cytotoxic. •RTgill-W1 death was by apoptosis and blocked by the anti-oxidant N-acetylcysteine. •This is the first report linking PES-induced cell death to ROS. •With this background PES should be useful for studying fish cell survival pathways. -- Abstract: The effect of 2-phenylethynesulfonamide (PES), which is a p53 and HSP70 inhibitor in mammalian cells, was studied on the rainbow trout (Oncorhynchus mykiss) gill epithelial cell line, RTgill-W1, in order to evaluate PES as a tool for understanding the cellular survival pathways operating in fish. As judged by three viability assays, fish cells were killed by 24 h exposures to PES, but cell death was blocked by the anti-oxidant N-acetylcysteine (NAC). Cell death had several hallmarks of apoptosis: DNA laddering, nuclear fragmentation, Annexin V staining, mitochondrial membrane potential decline, and caspases activation. Reactive oxygen species (ROS) production peaked in several hours after the addition of PES and before cell death. HSP70 and BiP levels were higher in cultures treated with PES for 24 h, but this was blocked by NAC. As well, PES treatment caused HSP70, BiP and p53 to accumulate in the detergent-insoluble fraction, and this too was prevented by NAC. Of several possible scenarios to explain the results, the following one is the simplest. PES enhances the generation of ROS, possibly by inhibiting the anti-oxidant actions of p53 and HSP70. ER stress arises from the ROS and from PES inhibiting the chaperone activities of HSP70. The ER stress in turn initiates the unfolded protein response (UPR), but this fails to restore ER homeostasis so proteins aggregate and cells die. Despite these multiple actions, PES should be useful for studying fish cellular survival pathways.

Immunohistochemical Expression of P53 Protein in Cutaneous Basal Cell Carcinoma: A Clinicopathological Study of 66 Cases

Directory of Open Access Journals (Sweden)

Vladim and iacute;r Barto and scaron;

2016-12-01

Full Text Available Objective: Nuclear expression of p53 protein is associated with a biological behavior in a variety of human malignancies. In cutaneous basal cell carcinoma (BCC, however, many studies have provided conflicting results in this regard. We aimed to determine whether there is relationship between p53 expression and different histologic subtypes of BCC, and whether it may indicate tumor aggressiveness. Materials and Methods: Biopsy samples from 66 cutaneous BCCs from 57 patients were collected. P53 expression was demonstrated by immunohistochemical staining using the anti-p53 antibody. Among them, 52 cases were also evaluated for Ki-67 antigen. Results: Immunoreactivity of p53 protein varied in the range of 0 to 100% of total tumor tissue (mean value 46.0%. The expression exceeding 5% of cancer tissue (positive staining was found in 54 BCCs (81.8%. Within this group, there were 25 cases (37.9% with low and 29 cases (43.9% with high expression. In superficial, superficial-nodular, nodular, nodular-infiltrative and infiltrative BCCs, p53 protein positivity was found in 100% (8/8, 80% (8/10, 70.4% (19/27, 88.2% (15/17 and 100% (4/4, respectively. We did not reveal a significant correlation between the extent of p53 protein expression and BCC subtypes except for nodular BCC, in which a number of negative cases (8/27, 29.6% were just above the threshold of statistical significance (P = 0.04. After merging cancers into non-aggressive and aggressive growth phenotype, no association with expression of p53 protein was found. There was no relationship between p53 protein expression and topographical sites after they have been gathered into sun-exposed and sun-protected locations. We did not observe any association between expression of p53 protein and Ki-67 antigen. Conclusion: In cutaneous BCC, the expression of p53 protein does not seem to reflect a biological behavior and tumor aggressiveness. Therefore, in a routine dermatopathological practice

Expression of P-glycoprotein, multidrug resistance-associated protein, glutathione-S-transferase pi and p53 in canine transmissible venereal tumor

Directory of Open Access Journals (Sweden)

Daniel G. Gerardi

2014-01-01

Full Text Available The overexpression of proteins P-glycoprotein (P-gp, multidrug resistance-associated protein (MRP1, mutant p53, and the enzyme glutathione-S-transferase (GSTpi are related to resistance to chemotherapy in neoplasms. This study evaluated the expression of these markers by immunohistochemistry in two groups of canine TVT, without history of prior chemotherapy (TVT1, n=9 and in TVTs presented unsatisfactory clinical response to vincristine sulfate (TVT2, n=5. The percentage of specimens positively stained for P-gp, MRP1, GSTpi and p53 were, respectively 88.8%, 0%, 44.5% and 22.2% in TVT1 and 80%, 0%, 80% and 0% in TVT2. In TVT1, one specimen presented positive expression for three markers and four specimens for two markers. In TVT2, three specimens expressed P-gp and GSTpi. In conclusion, the canine TVTs studied expressed the four markers evaluated, but just P-gp and GSTpi were significantly expressed, mainly at cytoplasm and cytoplasm and nuclei, respectively, either before chemotherapy as after vincristine sulfate exposure. Future studies are needed to demonstrate the function of these two markers in conferring multidrug resistance (MDR or predict the response to chemotherapy in canine TVT.

Overexpression of p53, MDM2 proteins in some atr radiation-induced skin ulcers

International Nuclear Information System (INIS)

Gu Qingyang; Gao Yabing; Wang Dewen; Cui Yufang; Zhao Po; Yang Zhixiang; Zhou Jie

2000-01-01

An animal model of radiation-induced skin ulcer was set up with 140 rats, which were locally irradiated with 35-55 Gy γ-rays. The pathological changes were observed for 1 year. Immunohistochemical studies were performed in 72 rat radiation skin ulcer specimens using anti-p53 and anti-MDM2 proteins polyclonal antibodies. The results showed that the positive rate for overexpression of p53 protein was 9.7%, and for that of MDM2 was 19.4%. The overexpression of p53 was mainly seen in the nuclei of activated squamous epithelial cells, and in fibroblasts, endotheliocytes in deeper part of the skin ulcers. The overexpression of MDM2 had the same localizations. It is suggested that the changes of p53 and MDM2, genes and proteins, may be related to the cancer transformation and poor healing of radiation-induced skin ulcers

Disposable Amperometric Immunosensor for the Determination of Human P53 Protein in Cell Lysates Using Magnetic Micro-Carriers

Directory of Open Access Journals (Sweden)

María Pedrero

2016-11-01

Full Text Available An amperometric magnetoimmunosensor for the determination of human p53 protein is described in this work using a sandwich configuration involving the covalent immobilization of a specific capture antibody onto activated carboxylic-modified magnetic beads (HOOC-MBs and incubation of the modified MBs with a mixture of the target protein and horseradish peroxidase-labeled antibody (HRP-anti-p53. The resulting modified MBs are captured by a magnet placed under the surface of a disposable carbon screen-printed electrode (SPCE and the amperometric responses are measured at −0.20 V (vs. an Ag pseudo-reference electrode, upon addition of hydroquinone (HQ as a redox mediator and H2O2 as the enzyme substrate. The magnetoimmunosensing platform was successfully applied for the detection of p53 protein in different cell lysates without any matrix effect after a simple sample dilution. The results correlated accurately with those provided by a commercial ELISA kit, thus confirming the immunosensor as an attractive alternative for rapid and simple determination of this protein using portable and affordable instrumentation.

Pre-irradiation at a low dose-rate blunted p53 response

International Nuclear Information System (INIS)

Takahashi, Akihisa

2002-01-01

We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)

Magnetic Particle-Based Immunoassay of Phosphorylated p53 Using Protein-Cage Templated Lead Phosphate and Carbon Nanospheres for Signal Amplification

Energy Technology Data Exchange (ETDEWEB)

Chen, Aiqiong; Bao, Yuanwu; Ge, Xiaoxiao; Shin, Yongsoon; Du, Dan; Lin, Yuehe

2012-11-20

Phosphorylated p53 at serin 15 (phospho-p53-15) is a potential biomarker of Gamma-radiation exposure. In this paper, we described a new magnetic particles (MPs)-based electrochemical immunoassay of human phospho-p53-15 using carbon nanospheres (CNS) and protein-cage templated lead phosphate nanoparticles for signal amplification. Greatly enhanced sensitivity was achieved by three aspects: 1) The protein-cage nanoparticle (PCN) and p53-15 signal antibody (p53-15 Ab2) are linked to CNS (PCNof each apoferritin; 3) MPs capture a large amount of primary antibodies. Using apoferritin templated metallic phosphate instead of enzyme as label has the advantage of eliminating the addition of mediator or immunoreagents and thus makes the immunoassay system simpler. The subsequent stripping voltammetric analysis of the released lead ions were detected on a disposable screen printed electrode. The response current was proportional to the phospho-p53-15 concentration in the range of 0.02 to 20 ng mL-1 with detection limit of 0.01 ng mL-1. This method shows a good stability, reproducibility and recovery.

S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

Science.gov (United States)

Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

2013-12-05

S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

Science.gov (United States)

Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

2018-05-23

PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

Science.gov (United States)

Zhou, Zhigang; Li, Yumin

2009-10-01

As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

The p53 gene with emphasis on its paralogues in mosquitoes

Directory of Open Access Journals (Sweden)

Tien-Huang Chen

2017-12-01

Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

Science.gov (United States)

Stępiński, Dariusz

2016-08-01

Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

Science.gov (United States)

Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

2014-07-23

The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The p53 gene as a modifier of intrinsic radiosensitivity: implications for radiotherapy

International Nuclear Information System (INIS)

Bristow, Robert G.; Benchimol, Samuel; Hill, Richard P.

1996-01-01

Background and purpose: Experimental studies have implicated the normal or 'wild type' p53 protein (i.e. WTp53) in the cellular response to ionizing radiation and other DNA damaging agents. Whether altered WTp53 protein function can lead to changes in cellular radiosensitivity and/or clinical radiocurability remains an area of ongoing study. In this review, we describe the potential implications of altered WTp53 protein function in normal and tumour cells as it relates to clinical radiotherapy, and describe novel treatment strategies designed to re-institute WTp53 protein function as a means of sensitizing cells to ionizing radiation. Methods and Materials: A number of experimental and clinical studies are critically reviewed with respect to the role of the p53 protein as a determinant of cellular oncogenesis, genomic stability, apoptosis, DNA repair and radioresponse in normal and transformed mammalian cells. Results: In normal fibroblasts, exposure to ionizing radiation leads to a G1 cell cycle delay (i.e. a 'G1 checkpoint') as a result of WTp53-mediated inhibition of G1-cyclin-kinase and retinoblastoma (pRb) protein function. The G1 checkpoint response is absent in tumour cells which express a mutant form of the p53 protein (i.e. MTp53), leading to acquired radioresistance in vitro. Depending on the cell type studied, this increase in cellular radiation survival can be mediated through decreased radiation-induced apoptosis, or altered kinetics of the radiation-induced G1 checkpoint. Recent biochemical studies support an indirect role for the p53 protein in both nucleotide excision and recombinational DNA repair pathways. However, based on clinicopathologic data, it remains unclear as to whether WTp53 protein function can predict for human tumour radiocurability and normal tissue radioresponse. Conclusions: Alterations in cell cycle control secondary to aberrant WTp53 protein function may be clinically significant if they lead to the acquisition of mutant

Phosphorylation Regulates the Bound Structure of an Intrinsically Disordered Protein: The p53-TAZ2 Case.

Directory of Open Access Journals (Sweden)

Raúl Esteban Ithuralde

Full Text Available Disordered regions and Intrinsically Disordered Proteins (IDPs are involved in critical cellular processes and may acquire a stable three-dimensional structure only upon binding to their partners. IDPs may follow a folding-after-binding process, known as induced folding, or a folding-before-binding process, known as conformational selection. The transcription factor p53 is involved in the regulation of cellular events that arise upon stress or DNA damage. The p53 domain structure is composed of an N-terminal transactivation domain (p53TAD, a DNA Binding Domain and a tetramerization domain. The activity of TAD is tightly regulated by interactions with cofactors, inhibitors and phosphorylation. To initiate transcription, p53TAD binds to the TAZ2 domain of CBP, a co-transcription factor, and undergoes a folding and binding process, as revealed by the recent NMR structure of the complex. The activity of p53 is regulated by phosphorylation at multiple sites on the TAD domain and recent studies have shown that modifications at three residues affect the binding towards TAZ2. However, we still do not know how these phosphorylations affect the structure of the bound state and, therefore, how they regulate the p53 function. In this work, we have used computational simulations to understand how phosphorylation affects the structure of the p53TAD:TAZ2 complex and regulates the recognition mechanism. Phosphorylation has been proposed to enhance binding by direct interaction with the folded protein or by changing the unbound conformation of IDPs, for example by pre-folding the protein favoring the recognition mechanism. Here, we show an interesting turn in the p53 case: phosphorylation mainly affects the bound structure of p53TAD, highlighting the complexity of IDP protein-protein interactions. Our results are in agreement with previous experimental studies, allowing a clear picture of how p53 is regulated by phosphorylation and giving new insights into how

Battle Against Cancer: An Everlasting Saga of p53

Directory of Open Access Journals (Sweden)

Qian Hao

2014-12-01

Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

International Nuclear Information System (INIS)

Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen

2014-01-01

Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence

Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

Directory of Open Access Journals (Sweden)

Villiard Éric

2007-09-01

Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

Mathematical Modeling of E6-p53 interactions in Cervical Cancer

Science.gov (United States)

Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

2017-04-01

Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

Isolation and identification of the human homolog of a new p53-binding protein, Mdmx

NARCIS (Netherlands)

Shvarts, A.; Bazuine, M.; Dekker, P.; Ramos, Y. F.; Steegenga, W. T.; Merckx, G.; van Ham, R. C.; van der Houven van Oordt, W.; van der Eb, A. J.; Jochemsen, A. G.

1997-01-01

We recently reported the identification of a mouse cDNA encoding a new p53-associating protein that we called Mdmx because of its structural similarity to Mdm2, a well-known p53-binding protein. Here we report the isolation of a cDNA encoding the human homolog of Mdmx. The ORF of the cDNA encodes a

[Expression of Ki-67 and P53 protein in oral squamous cell carcinoma and its clinical significance].

Science.gov (United States)

He, Wei; Xiao, Yan; Chen, Wei-min

2015-04-01

To investigate the clinical and pathological features and its relationship with the expression of Ki-67 and p53 protein in oral squamous cell carcinoma. Immunohistochemical SP staining method was used to quantify the protein expression levels of Ki-67 and p53 protein in 10 cases of normal oral mucosa, 16 cases of oral leukoplakia (OLK) tissue, and 48 cases of oral squamous cell carcinoma. The relationship of the expression of Ki-67 and p53 protein to clinical and pathological data was analyzed, and SPSS17.0 software package was used for statistical analysis. The positive expression rate of Ki-67 protein in normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma was 30%, 56.3% and 79.2%, respectively; The positive expression rate of p53 was 0%, 43.8%, and 70.8%, respectively; Ki-67 and p53 expression had significant difference among normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma (Poral squamous cell carcinoma (Poral squamous cell carcinoma tissues may play an important role in the development of oral squamous cell carcinoma.

SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

International Nuclear Information System (INIS)

Milner, J.; Gamble, J.

1985-01-01

The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

Science.gov (United States)

Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

2009-06-17

P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

International Nuclear Information System (INIS)

Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

1994-01-01

Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

Science.gov (United States)

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

Science.gov (United States)

Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

2018-01-01

Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

Directory of Open Access Journals (Sweden)

Lu Xin

2009-06-01

Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

S(+)-ibuprofen destabilizes MYC/MYCN and AKT, increases p53 expression, and induces unfolded protein response and favorable phenotype in neuroblastoma cell lines.

Science.gov (United States)

Ikegaki, Naohiko; Hicks, Sakeenah L; Regan, Paul L; Jacobs, Joshua; Jumbo, Amina S; Leonhardt, Payton; Rappaport, Eric F; Tang, Xao X

2014-01-01

Neuroblastoma is a common pediatric solid tumor that exhibits a striking clinical bipolarity: favorable and unfavorable. The survival rate of children with unfavorable neuroblastoma remains low among all childhood cancers. MYCN and MYC play a crucial role in determining the malignancy of unfavorable neuroblastomas, whereas high-level expression of the favorable neuroblastoma genes is associated with a good disease outcome and confers growth suppression of neuroblastoma cells. A small fraction of neuroblastomas harbors TP53 mutations at diagnosis, but a higher proportion of the relapse cases acquire TP53 mutations. In this study, we investigated the effect of S(+)-ibuprofen on neuroblastoma cell lines, focusing on the expression of the MYCN, MYC, AKT, p53 proteins and the favorable neuroblastoma genes in vitro as biomarkers of malignancy. Treatment of neuroblastoma cell lines with S(+)-ibuprofen resulted in a significant growth suppression. This growth effect was accompanied by a marked decrease in the expression of MYC, MYCN, AKT and an increase in p53 expression in neuroblastoma cell lines without TP53 mutation. In addition, S(+)-ibuprofen enhanced the expression of some favorable neuroblastoma genes (EPHB6, CD44) and genes involved in growth suppression and differentiation (EGR1, EPHA2, NRG1 and SEL1L). Gene expression profile and Ingenuity pathway analyses using TP53-mutated SKNAS cells further revealed that S(+)-ibuprofen suppressed molecular pathways associated with cell growth and conversely enhanced those of cell cycle arrest and the unfolded protein response. Collectively, these results suggest that S(+)-ibuprofen or its related compounds may have the potential for therapeutic and/or palliative use for unfavorable neuroblastoma.

hSSB1 regulates both the stability and the transcriptional activity of p53

OpenAIRE

Xu, Shuangbing; Wu, Yuanzhong; Chen, Qiong; Cao, Jingying; Hu, Kaishun; Tang, Jianjun; Sang, Yi; Lai, Fenju; Wang, Li; Zhang, Ruhua; Li, Sheng-Ping; Zeng, Yi-Xin; Yin, Yuxin; Kang, Tiebang

2012-01-01

The tumor suppressor p53 is essential for several cellular processes that are involved in the response to diverse genotoxic stress, including cell cycle arrest, DNA repair, apoptosis and senescence. Studies of the regulation of p53 have mostly focused on its stability and transactivation; however, new regulatory molecules for p53 have also been frequently identified. Here, we report that human ssDNA binding protein SSB1 (hSSB1), a novel DNA damage-associated protein, can interact with p53 and...

Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma

Directory of Open Access Journals (Sweden)

Fu Jia

2009-12-01

Full Text Available Abstract Background Tumor Protein p53 (p53, cyclin-dependent kinase inhibitor 1A (p21/WAF1, and murine double minute 2 (MDM2 participate in the regulation of cell growth. Altered expression of these gene products has been found in malignant tumors and has been associated with poor prognosis. Our aim was to investigate the expression of the 3 proteins in hepatocellular carcinoma (HCC and their prognostic significance. Methods We examined p53, p21/WAF1, and MDM2 expression in 181 pairs of HCC tissues and the adjacent hepatic tissues by performing immunohistochemistry and examined the expression of the 3 proteins in 7 pairs of HCC tissues and the adjacent hepatic tissues by using western blot analysis. Results The expression of p53, p21/WAF1, and MDM2 in the HCC tissues was significantly higher than those in the adjacent hepatic tissues (P P = 0.008. A statistical correlation was observed between expression of p53 and p21/WAF1 (R = 0.380, P = 0.000, p53 and MDM2 (R = 0.299, P = 0.000, p21/WAF1 and MDM2 (R = 0.285, P = 0.000 in 181 liver tissues adjacent to the tumor. Patients with a low pathologic grade HCC (I+II had a higher tendency to express p53 on tumor cells than the patients with high pathologic grade HCC (III+IV (P = 0.007. Survival analysis showed that positive p21/WAF1 expression or/and negative MDM2 expression in HCC was a predictor of better survival of patients after tumor resection (P Conclusions The proteins p53, p21/WAF1, and MDM2 were overexpressed in all the HCC cases in this study, and p53 and p21/WAF1 overexpression were positively correlated. The expression of p21/WAF1 and MDM2 can be considered as 2 useful indicators for predicting the prognosis of HCC.

p53 protein expression versus micronucleus induction as an indicator of DNA damage

International Nuclear Information System (INIS)

Hickman, A.W.; Carpenter, T.R.; Johnson, N.F.

1994-01-01

In vitro assays for detecting DNA damage play an important role in evaluating the possible adverse health effects of chemical compounds. Exposure to many DNA-damaging agents in vitro has been shown to cause elevated levels of the tumor-suppressor protein p53. Work in our laboratory has shown that induction of the p53 protein is useful as a biodosimeter for determining the radiation dose to cells. The purpose of this investigation was to compare the sensitivity of this assay to that of micronucleus induction, which is commonly used as a marker of radiation-induced damage

The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

DEFF Research Database (Denmark)

Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

2014-01-01

linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

Directory of Open Access Journals (Sweden)

Rolletschek Alexandra

2009-06-01

Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

Reactivating p53 and Inducing Tumor Apoptosis (RITA Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin

Directory of Open Access Journals (Sweden)

Armin Wiegering

2017-04-01

Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number

INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

Science.gov (United States)

2003-01-01

Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

Science.gov (United States)

Hale, T K; Braithwaite, A W

1999-08-20

Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

The expressions of P53 protein and proliferating cell nuclear antigen in specimens by CT-guidance percutaneous lung biopsy

International Nuclear Information System (INIS)

Zhuang Yiping; Shen Zongli; Zhang Jin; Kang Zheng; Zhu Yueqing; Feng Yong; Shen Wenrong; Wang Yaping

2004-01-01

Objective: To evaluate relations between lung cancer and the expressions of P53 protein together with proliferating cell nuclear antigen (PCNA) in specimens of lung lesions by needle biopsy. Methods: CT-guidance percutaneous biopsy of lung lesions were performed in 66 patients with the determination of expressions of p53 protein and PCNA by flow cytometer (FCM). Results: 1. The sensitivity of CT-guidance percutaneous biopsy was 94.3% in 53 cases of lung cancer with the diagnostic accuracy of 90.9% totally. The complication rate of pneumothorax was 4.6%. 2. The expression of P53 protein was (29.9 ± 2.7)% in lung cancer (53 cases), while (17.9 ± 2.8)% in benign lesions (13 cases) (t=2.0, P 2 =6.10, P 2 =9.71, P 0.05). Conclusions: FCM plays and valuable role in determining the expression of P53 protein and PCNA in the specimen of lung cancer by CT-guided percutaneous biopsy. The expression of p53 and PCNA may be useful in the diagnosis of lung cancer by providing the relation between imaging of lung cancer and the molecular mechanism, and furthermore revealing the characteristics of molecular biology of lung cancer at protein level. (authors)

Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

Directory of Open Access Journals (Sweden)

Paola De Feudis

2000-05-01

Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

Science.gov (United States)

Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

2015-01-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

No evidence for functional inactivation of wild-type p53 protein by MDM2 overexpression in gastric carcinogenesis

NARCIS (Netherlands)

Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

1998-01-01

Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result

Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

Science.gov (United States)

Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

2015-10-01

The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

Science.gov (United States)

Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

2006-04-01

p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

Science.gov (United States)

Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

2017-04-01

Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or

Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

Science.gov (United States)

Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

2005-01-01

p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

Science.gov (United States)

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

Science.gov (United States)

Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

1996-09-01

Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

Interaction between the Cockayne syndrome B and p53 proteins: implications for aging.

Science.gov (United States)

Frontini, Mattia; Proietti-De-Santis, Luca

2012-02-01

The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53’s levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis.

The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

Directory of Open Access Journals (Sweden)

Lin Tai-Du

2010-12-01

Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein

Czech Academy of Sciences Publication Activity Database

Brázda, Václav; Čechová, Jana; Battistin, M.; Coufal, Jan; Jagelská, Eva; Raimondi, I.; Inga, A.

2017-01-01

Roč. 483, č. 1 (2017), s. 516-521 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor p53 * cruciform structures * dna-conformation Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.466, year: 2016

Mutant p53 protein localized in the cytoplasm inhibits autophagy.

Science.gov (United States)

Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

2008-10-01

The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

Expression of p53 protein in Barrett’s adenocarcinoma and adenocarcinoma of the gastric cardia and antrum

Directory of Open Access Journals (Sweden)

Jovanović Ivan

2005-01-01

Full Text Available Background/Aim. Most studies of esophageal and gastric adenocarcinomas have shown a very high rate of p53 gene mutation and/or protein overexpression, but the influence of the tumor site upon the frequency of p53 protein expression has not been evaluated (gastroesophageal junction, Barret's esophagus, and antrum. The aim of our study was to analyze the correlation between the selected clinico-pthological parameters, and p53 protein overexpression in regards to the particular tumor location. Methods. The material comprised 66 surgical specimens; 10 were Barrett’s carcinomas, 25 adenocarcinomas of the gastric cardia (type II adenocarcinoma of the esophagogastric junction - EGJ, and 31 adenocarcinomas of the antrum. Immunostaining for p53 protein was performed on formalin-fixed, paraffin-embedded tissue sections, using the alkaline phosphatase - antialkaline phosphatase (APAAP method. The cases were considered positive for p53 if at least 5% of the tumor cells expressed this protein by immunostaining. Results. There was no significant difference observed between the studied groups in regards to age, sex, Lauren’s classification and tumor differentiation. There was, however, a significant difference observed in the depth of tumor invasion between Barrrett’s adenocarcinoma and adenocarcinoma of the cardia compared with the adenocarcinoma of the antrum. Namely, at the time of surgery, both Barrett’s adenocarcinomas and adenocarcinomas of the cardia, were significantly more advanced comparing with the adenocarcinomas of the antrum. Overexpression of p53 was found in 40% (4/10 of Barrett’s adenocarcinomas, 72% (18/25 of adenocarcinoma of the cardia and 65% (20/31 of adenocarcinoma of the antrum. No significant differences in p53 expression in relation to sex, type (Lauren of tumor, depth of invasion, lymph node involvement, or tumor differentiation were observed in any of the analyzed groups of tumors. Patients with more advanced Barrett�

p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research

Science.gov (United States)

When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53.  This protein can activate or shut down gene activity in response to DNA damage.  But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.   

Pure versus combined Merkel cell carcinomas: immunohistochemical evaluation of cellular proteins (p53, Bcl-2, and c-kit) reveals significant overexpression of p53 in combined tumors.

Science.gov (United States)

Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M

2015-09-01

Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.

Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

Science.gov (United States)

Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

2017-09-29

p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways

Directory of Open Access Journals (Sweden)

Lisa Wiesmüller

2001-01-01

Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.

Mutual interactions between P53 and growth factors in cancer

NARCIS (Netherlands)

Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

1998-01-01

The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

Restoration of mp53 to wtp53 by chemical chaperones restores p53-dependent apoptosis after radiotherapy

International Nuclear Information System (INIS)

Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.

2003-01-01

The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future

Therapeutic Response to Non-genotoxic Activation of p53 by Nutlin3a Is Driven by PUMA-Mediated Apoptosis in Lymphoma Cells

Directory of Open Access Journals (Sweden)

Liz J. Valente

2016-03-01

Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.

Characterization of protein kinase CK2 protein subunits and p53 in F9 teratocarcinoma cells in the absence and presence of cisplatin

DEFF Research Database (Denmark)

Küpper, M; Köster, M; Schmidt-Spaniol, I

1994-01-01

cell extracts treated with and without cisplatin were analyzed by ion exchange chromatography for protein kinase CK2 alpha/beta subunits and p53 distribution. The following results were obtained: (a) in crude extracts of cisplatin-treated cells, CK2 activity was sometimes reduced by as much as 50%; (b......The effect of cis-diaminedichloroplatinum(II) (cisplatin) on the induction of p53 and protein kinase CK2 activity was studied in the mouse teratocarcinoma cell line F9. Treatment of the cells with the chemotherapeutic agent cisplatin led to the detection of p53 3 h after addition of the drug. F9...... by immunostaining, we have detected, at a concentration of approximately 200 mM NaCl, a protein of approximately 46 kDa which reacted with the CK2 alpha-specific antibody. This fraction was devoid of CK2 activity; and (d) cisplatin-treated cells exhibited p53 protein, which was mostly eluting ahead but also partly...

miR-34 and p53: New Insights into a Complex Functional Relationship.

Directory of Open Access Journals (Sweden)

Francisco Navarro

Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

Expression of p53 in oligodendrogliomas

NARCIS (Netherlands)

J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

1993-01-01

textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

Expression of p53 in oligodendrogliomas

NARCIS (Netherlands)

Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

1993-01-01

The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

Science.gov (United States)

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-12-13

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

Mutations in p53, p53 protein overexpression and breast cancer survival

Czech Academy of Sciences Publication Activity Database

Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

2009-01-01

Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

Science.gov (United States)

Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

2017-01-01

Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent

International Nuclear Information System (INIS)

Dbaibo, G.; El-Assaad, W.

2000-01-01

Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation

Basal p53 expression is indispensable for mesenchymal stem cell integrity.

Science.gov (United States)

Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

2018-03-01

Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

Ser46 phosphorylation and prolyl-isomerase Pin1-mediated isomerization of p53 are key events in p53-dependent apoptosis induced by mutant huntingtin.

Science.gov (United States)

Grison, Alice; Mantovani, Fiamma; Comel, Anna; Agostoni, Elena; Gustincich, Stefano; Persichetti, Francesca; Del Sal, Giannino

2011-11-01

Huntington disease (HD) is a neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for huntingtin protein. Several mechanisms have been proposed by which mutant huntingtin (mHtt) may trigger striatal neurodegeneration, including mitochondrial dysfunction, oxidative stress, and apoptosis. Furthermore, mHtt induces DNA damage and activates a stress response. In this context, p53 plays a crucial role in mediating mHtt toxic effects. Here we have dissected the pathway of p53 activation by mHtt in human neuronal cells and in HD mice, with the aim of highlighting critical nodes that may be pharmacologically manipulated for therapeutic intervention. We demonstrate that expression of mHtt causes increased phosphorylation of p53 on Ser46, leading to its interaction with phosphorylation-dependent prolyl isomerase Pin1 and consequent dissociation from the apoptosis inhibitor iASPP, thereby inducing the expression of apoptotic target genes. Inhibition of Ser46 phosphorylation by targeting homeodomain-interacting protein kinase 2 (HIPK2), PKCδ, or ataxia telangiectasia mutated kinase, as well as inhibition of the prolyl isomerase Pin1, prevents mHtt-dependent apoptosis of neuronal cells. These results provide a rationale for the use of small-molecule inhibitors of stress-responsive protein kinases and Pin1 as a potential therapeutic strategy for HD treatment.

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

Science.gov (United States)

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

Narrowband image and the p53 protein immunoexpression in patients with ulcerative colitis and dysplasia

International Nuclear Information System (INIS)

Chao González, Lissette

2012-01-01

Patients with pancolitis and long-standing ulcerative colitis are at increased risk of developing colorectal cancer, so it is advisable to colonoscopic surveillance. The objective of this study was to identify the endoscopic visualization system of imaging with narrowband and overexpression of the p53 protein as procedures useful for the research of Dysplasia in patients with ulcerative colitis and pancolitis, of eight or more years of evolution. A prospective, descriptive study was performed on 50 patients. The Fisher exact probability test was used for the statistical study and of square Chi, with a level of significance α = 0.05. Shown with narrow-band image increases the likelihood of finding suggestive areas of Dysplasia, reduces the amount of biopsy and gets a higher proportion of diagnoses of Dysplasia in fewer samples (70.4%). The overexpression of the p53 protein was associated with the presence of dysplasia (80.0%) p < 0.001 and is immunoexpress in samples with a high degree of severity of dysplasia and the low grade. Concluded that imaging with narrowband system and overexpression of the p53 protein are procedures useful for the research of Dysplasia in these patients. (author)

Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest

Directory of Open Access Journals (Sweden)

Clarke Alan R

2002-11-01

Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.

Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

International Nuclear Information System (INIS)

Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

2005-01-01

p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein

Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

Directory of Open Access Journals (Sweden)

Shah Keerti V

2005-02-01

Full Text Available Abstract Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT, and 8 supratentorial primitive neuroectodermal tumors (sPNET using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3 was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein.

Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

Science.gov (United States)

Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

2005-01-01

Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein. PMID:15717928

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

The dynamics of p53 in single cells: physiologically based ODE and reaction–diffusion PDE models

International Nuclear Information System (INIS)

Eliaš, Ján; Clairambault, Jean; Dimitrio, Luna; Natalini, Roberto

2014-01-01

The intracellular signalling network of the p53 protein plays important roles in genome protection and the control of cell cycle phase transitions. Recently observed oscillatory behaviour in single cells under stress conditions has inspired several research groups to simulate and study the dynamics of the protein with the aim of gaining a proper understanding of the physiological meanings of the oscillations. We propose compartmental ODE and PDE models of p53 activation and regulation in single cells following DNA damage and we show that the p53 oscillations can be retrieved by plainly involving p53–Mdm2 and ATM–p53–Wip1 negative feedbacks, which are sufficient for oscillations experimentally, with no further need to introduce any delays into the protein responses and without considering additional positive feedback. (paper)

p53 and ARF: Unexpected players in autophagy

OpenAIRE

Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

2010-01-01

p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

MG132 plus apoptosis antigen-1 (APO-1) antibody cooperate to restore p53 activity inducing autophagy and p53-dependent apoptosis in HPV16 E6-expressing keratinocytes.

Science.gov (United States)

Lagunas-Martínez, Alfredo; García-Villa, Enrique; Arellano-Gaytán, Magaly; Contreras-Ochoa, Carla O; Dimas-González, Jisela; López-Arellano, María E; Madrid-Marina, Vicente; Gariglio, Patricio

2017-01-01

The E6 oncoprotein can interfere with the ability of infected cells to undergo programmed cell death through the proteolytic degradation of proapoptotic proteins such as p53, employing the proteasome pathway. Therefore, inactivation of the proteasome through MG132 should restore the activity of several proapoptotic proteins. We investigated whether in HPV16 E6-expressing keratinocytes (KE6 cells), the restoration of p53 levels mediated by MG132 and/or activation of the CD95 pathway through apoptosis antigen-1 (APO-1) antibody are responsible for the induction of apoptosis. We found that KE6 cells underwent apoptosis mainly after incubation for 24 h with MG132 alone or APO-1 plus MG132. Both treatments activated the extrinsic and intrinsic apoptosis pathways. Autophagy was also activated, principally by APO-1 plus MG132. Inhibition of E6-mediated p53 proteasomal degradation by MG132 resulted in the elevation of p53 protein levels and its phosphorylation in Ser46 and Ser20; the p53 protein was localized mainly at nucleus after treatment with MG132 or APO-1 plus MG132. In addition, induction of its transcriptional target genes such as p21, Bax and TP53INP was observed 3 and 6 h after treatment. Also, LC3 mRNA was induced after 3 and 6 h, which correlates with lipidation of LC3B protein and induction of autophagy. Finally, using pifithrin alpha we observed a decrease in apoptosis induced by MG132, and by APO-1 plus MG132, suggesting that restoration of APO-1 sensitivity occurs in part through an increase in both the levels and the activity of p53. The use of small molecules to inhibit the proteasome pathway might permit the activation of cell death, providing new opportunities for CC treatment.

MDM2, p53 and pRb Expression Prior to Definitive Chemoradiotherapy in Esophageal Carcinoma

International Nuclear Information System (INIS)

Yoon, Mee Sun; Nam, Taek Keun; Lee, Jae Hyuk; Cho, Sang Hee; Song, Ju Young; Ahn, Sung Ja; Chung, Ik Joo; Chung, Woong Ki; Nah, Byung Sik

2007-01-01

Purpose: This study evaluated the pretreatment expression patterns of MDM2, p53, and pRb proteins to determine if the expression patterns could predict the outcome of concurrent chemoradiotherapy (CCRT) for esophageal squamous cell carcinoma and aid in the decisions for the selection of treatment modalities. Materials and Methods: Fifty-one patients that were treated with definitive hemoradiotherapy for stage I∼ IVa esohageal squamous cell carcinoma were selected for this study. Radiotherapy was administered with daily 1.8∼2 Gy fractions up to a median dose of 54 Gy for primary tumors, and with four cycles of cisplatin/5-fluorouracil chemotherapy that was administered every 4 weeks, the first two cycles of which were administered concurrently with radiotherapy. Expression of MDM2, p53, and pRb was investigated by immunohistochemical analysis using pretreatment biopsy specimens. Results: MDM2, p53, and pRb were detected with high immunoreactivity in 19.6%, 27.5%, and 66.7% of the patients, respectively. However, there was no significant correlation between expression of these factors and clinical outcome. By the use of multivariate analysis with nine covariates-age, tumor location, tumor length, stage, pathological response, clinical response, MDM2 expression, p53 expression, and pRb expression, only pathological response and stage were significant factors for cause-specific survival. Conclusion: Expression of MDM2, p53, and pRb was not found to be clinically significant for predicting outcomes after CCRT in this study. Further studies with a larger patient population and longer follow-up periods are needed to re-evaluate the expression pattern and to identify new predictors for CCRT response

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

Energy Technology Data Exchange (ETDEWEB)

Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)

2015-11-01

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.

Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

International Nuclear Information System (INIS)

Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.

2015-01-01

Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.

Positive expression of p53, c-erbB2 and MRP proteins is correlated with survival rates of NSCLC patients.

Science.gov (United States)

Xu, Yujin; Wang, Liancong; Zheng, Xiao; Liu, Guan; Wang, Yuezhen; Lai, Xiaojing; Li, Jianqiang

2013-05-01

The incidence of lung cancer is one of the leading causes of mortality. This study aimed to investigate the prognostic and predictive importance of p53, c-erbB2 and multidrug resistance proteins (MRP) expression and its correlation with clinicopathological characteristics of patients with non-small cell lung cancer (NSCLC). Expression of p53, c-erbB2 and MRP proteins in 152 tumor samples from resected primary NSCLCs was detected by immunohistochemical staining. The correlation of proteins, survival and clinicopathological characteristics was investigated in 152 patients undergoing potentially curative surgery. The positive rates of p53, c-erbB2 and MRP expression were 53.9 (82/152), 44.1 (67/152) and 43.4% (66/152), respectively. Overall survival rates of patients were markedly correlated with the overexpression of p53, c-erbB2 and MRP proteins. One, 2- and 3-year survival rates of patients exhibiting a positive expression of these proteins were 72.6, 54.8 and 32.2%, respectively. These rates were lower compared with those of patients with a negative expression of these proteins (92.1, 78.5 and 63.4%) (P=0.02, 0.01 or 0.00, respectively). Results of Cox's regression analysis showed that c-erbB2 expression and cell differentiation were independent prognostic factors in patients with NSCLC. These findings suggest that the positive expression of p53, c-erbB2 and MRP proteins is correlated with the survival rates of NSCLC patients. Detection of positive p53, c-erbB2 and MRP expression may be a useful predictive indicator of prognosis. Positive c-erbB2 expression is an independent prognostic factor, with a potential to be used as a predictive indicator of chemotherapy efficacy in NSCLC patients.

p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

Science.gov (United States)

Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

1996-12-20

In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

Mutant p53 - heat shock response oncogenic cooperation: a new mechanism of cancer cell survival

Directory of Open Access Journals (Sweden)

Evguenia eAlexandrova

2015-04-01

Full Text Available The main tumor suppressor function of p53 as a ‘guardian of the genome’ is to respond to cellular stress by transcriptional activation of apoptosis, growth arrest or senescence in damaged cells. Not surprisingly, mutations in the p53 gene are the most frequent genetic alteration in human cancers. Importantly, mutant p53 (mutp53 proteins not only lose their wild-type tumor suppressor activity, but also can actively promote tumor development. Two main mechanisms accounting for mutp53 proto-oncogenic activity are inhibition of the wild-type p53 in a dominant-negative fashion and gain of additional oncogenic activities known as gain-of-function (GOF. Here we discuss a novel mechanism of mutp53 GOF, which relies on its oncogenic cooperation with the heat shock machinery. This coordinated adaptive mechanism renders cancer cells more resistant to proteotoxic stress and provides both, a strong survival advantage to cancer cells and a promising means for therapeutic intervention.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

The role of p53 in lung macrophages following exposure to a panel of manufactured nanomaterials

DEFF Research Database (Denmark)

Belade, Esther; Chrusciel, Sandra; Armand, Lucie

2015-01-01

is a key transcription factor implicated in cellular defence and reparative responses to various stress factors. Additionally, p53 has been implicated in cellular responses following exposure to some MNMs. Here, the role of the MNM mediated p53 induction and activation and its downstream effects following...... exposure to five well-characterised materials [namely two types of TiO2, two carbon black (CB), and one single-walled carbon nanotube (SWCNT)] were investigated. MNM internalisation, cellular viability, p53 protein induction and activation, oxidative stress, inflammation and apoptosis were measured...... in murine cell line and primary pulmonary macrophage models. It was observed that p53 was implicated in the biological responses to MNMs, with oxidative stress associated with p53 activation (only following exposure to the SWCNT). We demonstrate that p53 acted as an antioxidant and anti...

Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation

International Nuclear Information System (INIS)

Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli

2004-01-01

Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)

Simplified approaches for the development of an ELISA to detect circulating autoantibodies to p53 in cancer patients

Directory of Open Access Journals (Sweden)

Tayapiwatana Chatchai

2008-02-01

Full Text Available Abstract Background The recognition that human tumors stimulate the production of autoantibodies has initiated the use of this immune response as serological markers for the early diagnosis and management of cancer. The enzyme-linked immunosorbent assay (ELISA is the most common method used in detecting autoantibodies, which involves coating the microtiter plate with the tumor associated antigen (TAA of interest and allowing serum antibodies to bind. The patient's sample is directly in contact with the coating antigen so the protein used for coating must be pure to avoid non-specific binding. In this study, a simplified method to selectively and specifically immobilize TAAs onto microtiter plates in order to detect circulating autoantibodies in cancer patients without prior purification process was described. Wild type full-length p53 protein was produced in fusion with biotin carboxyl carrier peptide (BCCP or hexahistidine [(His6] using pAK400 and pET15b(+ vectors, respectively. The recombinant p53 fusion protein produced was then subjected to react with either a commercial p53 monoclonal antibody (mAb or sera from lung cancer patients and healthy volunteers in an enzyme-linked immunosorbent assay (ELISA format. Results Both of the immobilized p53 fusion proteins as well as the purified (His6-p53 fusion protein had a similar dose response of detection to a commercial p53 mAb (DO7. When the biotinylated p53-BCCP fusion protein was used as an antigen to detect p53 autoantibodies in clinical samples, the result showed that human serum reacted strongly to avidin-coated microwell even in the absence of the biotinylated p53-BCCP fusion protein, thus compromised its ability to differentiate weakly positive sera from those that were negative. In contrast, the (His6-p53 protein immobilized directly onto Ni+ coated microplate was able to identify the p53 autoantibody positive serum. In addition, its reactivity to clinical serum samples highly correlated

Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

Science.gov (United States)

Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

2014-06-10

The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.

Science.gov (United States)

Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles

2006-10-16

The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.

Regulation of Mdmx and its role in the p53 pathway

NARCIS (Netherlands)

Meulmeester, Erik

2006-01-01

The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

Energy Technology Data Exchange (ETDEWEB)

Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing

2009-09-07

The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.

HEXIM1, a New Player in the p53 Pathway

Energy Technology Data Exchange (ETDEWEB)

Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

2013-07-04

Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

Microrna-31 mediates radiation induced apoptosis selectively in malignant tumour cells with dysfunctional P53

International Nuclear Information System (INIS)

Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir

2016-01-01

The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression

p53 regulates cytoskeleton remodeling to suppress tumor progression.

Science.gov (United States)

Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

2015-11-01

Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

Correlation between Expression of MVP, Index of p53 and AgNOR Value with Chemoradiotherapy Clinical Response of Cervical Cancer

Directory of Open Access Journals (Sweden)

I. Kurnia

2014-12-01

Full Text Available Cervical cancer is the most frequent cancer found in Indonesia. The primary treatment of cervical cancer at the locally advanced stage is usually performed by using radiotherapy and chemotherapy. The combination of the two techniques is often called chemoradioherapy. The response to chemoradiotherapy is influenced by biological and physical factors. Major vault protein (MVP is a ribonucleoprotein which contributes to drug resistance in some cancers. The purposes of this research were: (1 to determine the correlation between the expression of MVP and the index of p53, including AgNOR values and index of MIB-1; and (2 between MVP and chemoradiotherapy clinical response of cervical cancer. Twenty-one microscopic slides taken from biopsy tissues of cervical cancer patients before undergoing treatment were stained to identify MVP, p53, and MIB-1 by means of immunohistochemistry techniques and AgNORs staining. After undergoing chemoradiotherapy treatment, the patients’ clinical responses were observed by pelvic control method. Experimental results showed that there was a correlation between MVP and AgNOR value (P=0.05, but no correlation between MVP and index of p53 (P=0.729, including MIB-1 LI (P=0.63, in untreated cervical cancer. In addition, there was no association between MVP and chemoradioterapy response. In conclusion, MVP expression correlates with the process of cell proliferation before the G2 phase of cell cycle in untreated cancer cells. Those have no association with clinical responses after the completion of treatment.

Correlation between expression of MVP, index of p53 and AgNOR value with chemoradiotherapy clinical response of cervical cancer

International Nuclear Information System (INIS)

Kurnia, I.; Tetriana, D.; Siregar, B.; Ramli, I.; Andrijono, A.; Soetopo, S.; Kurjana, T.; Hernowo, B.S.; Tobing, M.D.M.

2014-01-01

Cervical cancer is the most frequent cancer found in Indonesia. The primary treatment of cervical cancer at the locally advanced stage is usually performed by using radiotherapy and chemotherapy. The combination of the two techniques is often called chemoradiotherapy. The response to chemoradiotherapy is influenced by biological and physical factors. Major vault protein (MVP) is a ribonucleoprotein which contributes to drug resistance in some cancers. The purposes of this research were: (1) to determine the correlation between the expression of MVP and the index of p53, including AgNOR values and index of MIB-1; and (2) between MVP and chemoradiotherapy clinical response of cervical cancer. Twenty-one microscopic slides taken from biopsy tissues of cervical cancer patients before undergoing treatment were stained to identify MVP, p53, and MIB-1 by means of immunohistochemistry techniques and AgNORs staining. After undergoing chemoradiotherapy treatment, the patients’ clinical responses were observed by pelvic control method. Experimental results showed that there was a correlation between MVP and AgNOR value (P=0.05), but no correlation between MVP and index of p53 (P=0.729), including MIB-1 LI (P=0.63), in untreated cervical cancer. In addition, there was no association between MVP and chemoradiotherapy response. In conclusion, MVP expression correlates with the process of cell proliferation before the G2 phase of cell cycle in untreated cancer cells. Those have no association with clinical responses after the completion of treatment. (author)

p53 Acetylation: Regulation and Consequences

International Nuclear Information System (INIS)

Reed, Sara M.; Quelle, Dawn E.

2014-01-01

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

p53 Acetylation: Regulation and Consequences

Energy Technology Data Exchange (ETDEWEB)

Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

2014-12-23

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

Tumor hypoxia, p53, and prognosis in cervical cancers

International Nuclear Information System (INIS)

Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

2001-01-01

Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

Alcohol alters hepatic FoxO1, p53, and mitochondrial SIRT5 deacetylation function

International Nuclear Information System (INIS)

Lieber, Charles S.; Leo, Maria Anna; Wang, Xiaolei; DeCarli, Leonore M.

2008-01-01

Chronic alcohol consumption affects the gene expression of a NAD-dependent deacetylase Sirtuis 1 (SIRT1) and the peroxisome proliferator-activated receptor-γ coactivator1α (PGC-1α). Our aim was to verify that it also alters the forkhead (FoxO1) and p53 transcription factor proteins, critical in the hepatic response to oxidative stress and regulated by SIRT1 through its deacetylating capacity. Accordingly, rats were pair-fed the Lieber-DeCarli alcohol-containing liquid diets for 28 days. Alcohol increased hepatic mRNA expression of FoxO1 (p = 0.003) and p53 (p = 0.001) while corresponding protein levels remained unchanged. However phospho-FoxO1 and phospho-Akt (protein kinase) were both decreased by alcohol consumption (p = 0.04 and p = 0.02, respectively) while hepatic p53 was found hyperacetylated (p = 0.017). Furthermore, mitochondrial SIRT5 was reduced (p = 0.0025), and PGC-1α hyperacetylated (p = 0.027), establishing their role in protein modification. Thus, alcohol consumption disrupts nuclear-mitochondrial interactions by post-translation protein modifications, which contribute to alteration of mitochondrial biogenesis through the newly discovered reduction of SIRT5

Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

Science.gov (United States)

Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

2014-06-01

Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

Science.gov (United States)

Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

2013-01-01

Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

International Nuclear Information System (INIS)

Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu

2014-01-01

Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells

Deficiency of G1 regulators P53, P21Cip1 and/or pRb decreases hepatocyte sensitivity to TGFβ cell cycle arrest

Directory of Open Access Journals (Sweden)

Harrison David J

2007-11-01

Full Text Available Abstract Background TGFβ is critical to control hepatocyte proliferation by inducing G1-growth arrest through multiple pathways leading to inhibition of E2F transcription activity. The retinoblastoma protein pRb is a key controller of E2F activity and G1/S transition which can be inhibited in viral hepatitis. It is not known whether the impairment of pRb would alter the growth inhibitory potential of TGFβ in disease. We asked how Rb-deficiency would affect responses to TGFβ-induced cell cycle arrest. Results Primary hepatocytes isolated from Rb-floxed mice were infected with an adenovirus expressing CRE-recombinase to delete the Rb gene. In control cells treatment with TGFβ prevented cells to enter S phase via decreased cMYC activity, activation of P16INK4A and P21Cip and reduction of E2F activity. In Rb-null hepatocytes, cMYC activity decreased slightly but P16INK4A was not activated and the great majority of cells continued cycling. Rb is therefore central to TGFβ-induced cell cycle arrest in hepatocytes. However some Rb-null hepatocytes remained sensitive to TGFβ-induced cell cycle arrest. As these hepatocytes expressed very high levels of P21Cip1 and P53 we investigated whether these proteins regulate pRb-independent signaling to cell cycle arrest by evaluating the consequences of disruption of p53 and p21Cip1. Hepatocytes deficient in p53 or p21Cip1 showed diminished growth inhibition by TGFβ. Double deficiency had a similar impact showing that in cells containing functional pRb; P21Cip and P53 work through the same pathway to regulate G1/S in response to TGFβ. In Rb-deficient cells however, p53 but not p21Cip deficiency had an additive effect highlighting a pRb-independent-P53-dependent effector pathway of inhibition of E2F activity. Conclusion The present results show that otherwise genetically normal hepatocytes with disabled p53, p21Cip1 or Rb genes respond less well to the antiproliferative effects of TGFβ. As the function of

P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation

International Nuclear Information System (INIS)

Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.

2006-01-01

Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells

P53 and heat shock protein 70 expressions in colorectal adenocarcinoma

International Nuclear Information System (INIS)

Shotar, Ali M.

2005-01-01

To examine the localization and over expression of heat shock protein 70 (HSP70) and p53 in patients with colorectal cancer and compared it with control tissue (including normal colon tissue). This was a retrospective study of 60 patients with colorectal adenocarcinoma at the Jordan University of Science and Technology (JUST), Irbid, Jordan from 1997 to 2000. The Pathology Department at JUST is the chief provider of surgical pathology services in the north of Jordan. It receives specimens from both government and private hospitals. Immunohistochemistry was the technique of choice. The HSP70 was over expressed more highly in colorectal cancers than in the control tissue. Immuno-histochemistry showed that over expression of HSP70 had no statistically significant difference with any of the different prognostic factors assessed, mainly the grade and the stage. The p53 was over expressed in 60% of the cases. Control tissue (normal colon) was negative, p53, cell-cycle-related oncogene product, was strongly over expressed in the nuclei of the cancer cells of the cancer tissue. We found no significant difference in terms of size, patient age, lymph node state, and stage. The rate of expression was significantly less in high grade tumors than in intermediate and low grade ones. The strong expression however, may be valuable in estimating a prognosis for patients with colo-rectal carcinoma. (author)

P53 at the start of the 21st century: lessons from elephants [version 1; referees: 3 approved

Directory of Open Access Journals (Sweden)

Sue Haupt

2017-11-01

Full Text Available Crucial, natural protection against tumour onset in humans is orchestrated by the dynamic protein p53. The best-characterised functions of p53 relate to its cellular stress responses. In this review, we explore emerging insights into p53 activities and their functional consequences. We compare p53 in humans and elephants, in search of salient features of cancer protection.

Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression

Directory of Open Access Journals (Sweden)

Takahiro Ebata

2017-01-01

Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.

[Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

Science.gov (United States)

Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

2017-01-01

PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I

Degradation of p53 by human Alphapapillomavirus E6 proteins shows a stronger correlation with phylogeny than oncogenicity.

Directory of Open Access Journals (Sweden)

Leiping Fu

2010-09-01

Full Text Available Human Papillomavirus (HPV E6 induced p53 degradation is thought to be an essential activity by which high-risk human Alphapapillomaviruses (alpha-HPVs contribute to cervical cancer development. However, most of our understanding is derived from the comparison of HPV16 and HPV11. These two viruses are relatively distinct viruses, making the extrapolation of these results difficult. In the present study, we expand the tested strains (types to include members of all known HPV species groups within the Alphapapillomavirus genus.We report the biochemical activity of E6 proteins from 27 HPV types representing all alpha-HPV species groups to degrade p53 in human cells. Expression of E6 from all HPV types epidemiologically classified as group 1 carcinogens significantly reduced p53 levels. However, several types not associated with cancer (e.g., HPV53, HPV70 and HPV71 were equally active in degrading p53. HPV types within species groups alpha 5, 6, 7, 9 and 11 share a most recent common ancestor (MRCA and all contain E6 ORFs that degrade p53. A unique exception, HPV71 E6 ORF that degraded p53 was outside this clade and is one of the most prevalent HPV types infecting the cervix in a population-based study of 10,000 women. Alignment of E6 ORFs identified an amino acid site that was highly correlated with the biochemical ability to degrade p53. Alteration of this amino acid in HPV71 E6 abrogated its ability to degrade p53, while alteration of this site in HPV71-related HPV90 and HPV106 E6s enhanced their capacity to degrade p53.These data suggest that the alpha-HPV E6 proteins' ability to degrade p53 is an evolved phenotype inherited from a most recent common ancestor of the high-risk species that does not always segregate with carcinogenicity. In addition, we identified an amino-acid residue strongly correlated with viral p53 degrading potential.

p53 is involved in clearance of ionizing radiation-induced RAD51 foci in a human colon cancer cell line

International Nuclear Information System (INIS)

Orre, Lukas M.; Stenerloew, Bo; Dhar, Sumeer; Larsson, Rolf; Lewensohn, Rolf; Lehtioe, Janne

2006-01-01

We have investigated p53-related differences in cellular response to DNA damaging agents, focusing on p53s effects on RAD51 protein level and sub-cellular localization post exposure to ionizing radiation. In a human colon cancer cell line, HCT116 and its isogenic p53-/- subcell line we show here p53-independent RAD51 foci formation but interestingly the resolution of RAD51 foci showed clear p53 dependence. In p53 wt cells, but not in p53-/- cells, RAD51 protein level decreased 48 h post irradiation and fluorescence immunostaining showed resolution of RAD51 foci and relocalization of RAD51 to nucleoli at time points corresponding to the decrease in RAD51 protein level. Both cell lines rejoined DNA double strand breaks efficiently with similar kinetics and p53 status did not influence sensitivity to DNA damaging agents. We suggest that p53 has a role in RAD51 clearance post DSB repair and that nucleoli might be sites of RAD51 protein degradation

The combined status of ATM and p53 link tumor development with therapeutic response

DEFF Research Database (Denmark)

Jiang, Hai; Reinhardt, H Christian; Bartkova, Jirina

2009-01-01

commonly used by tumors to bypass early neoplastic checkpoints ultimately determine chemotherapeutic response and generate tumor-specific vulnerabilities that can be exploited with targeted therapies. Specifically, evaluation of the combined status of ATM and p53, two commonly mutated tumor suppressor...... genes, can help to predict the clinical response to genotoxic chemotherapies. We show that in p53-deficient settings, suppression of ATM dramatically sensitizes tumors to DNA-damaging chemotherapy, whereas, conversely, in the presence of functional p53, suppression of ATM or its downstream target Chk2...... actually protects tumors from being killed by genotoxic agents. Furthermore, ATM-deficient cancer cells display strong nononcogene addiction to DNA-PKcs for survival after DNA damage, such that suppression of DNA-PKcs in vivo resensitizes inherently chemoresistant ATM-deficient tumors to genotoxic...

Targeting the p53 Pathway in Ewing Sarcoma

Science.gov (United States)

Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

2011-01-01

The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

p53/Surviving Ratio as a Parameter for Chemotherapy Induction Response in Children with Acute Myeloid Leukemia

Directory of Open Access Journals (Sweden)

Rinaldi Lenggana

2016-11-01

Full Text Available Acute myeloid leukemia (AML is a malignancy that is often found in children. Many studies into the failure of apoptosis function, or programmed cell death, is one of the most important regulatory mechanisms of cellular hemostasis which is closely linked to the development of cancer, are important. Also, regulation of the apoptotic (p53 and anti-apoptotic (surviving proteins influence treatment outcome. One role of p53 is to monitor cellular stress necessary to induce apoptosis. Surviving (BIRC5 is a group of proteins in the apoptosis inhibitor which works by inhibiting caspase-3. The role of surviving is considered very important in oncogenesis proliferation and cell growth regulation. Chemotherapy in childhood AML can inhibit cell growth and induce slowing as well as stopping the cell cycle. Thus, the aim of this study was to compare p53 and surviving before and after receiving induction chemotherapy in children with AML and also to determine the p53/surviving ratio. Peripheral blood mononuclear cells were collected from AML children before treatment and three months after starting their induction therapy. p53 and surviving were measured by flowcytometry using monoclonal antibodies. Data were analyzed by t-test for comparison between groups and Spearman’s test to find out the correlation between variables with a significant value of p < 0.05. A total of 8 children were evaluated. The intensity of p53 expression was not significantly increased after induction phase chemotherapy (p = 0.224, but surviving expression and the ratio of p53/surviving were significantly increased in the treatment group compared with the levels prior to chemotherapy (p = 0.002, p = 0.034, and there was a strong negative correlation between p53 and surviving after chemotherapy (r = −0.63, p = 0.049.

The role of p53 and pRB in apoptosis and cancer

DEFF Research Database (Denmark)

Hickman, Emma S; Moroni, M Cristina; Helin, Kristian

2002-01-01

Loss of function of both the p53 pathway and the retinoblastoma protein (pRB) pathway plays a significant role in the development of most human cancers. Loss of pRB results in deregulated cell proliferation and apoptosis, whereas loss of p53 desensitizes cells to checkpoint signals, including...

An N-terminal Region of Mot-2 Binds to p53 In Vitro

Directory of Open Access Journals (Sweden)

Sunil C. Kaul

2001-01-01

Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

Cancer Chemoprevention by Resveratrol: The p53 Tumor Suppressor Protein as a Promising Molecular Target

Directory of Open Access Journals (Sweden)

Danielly C. Ferraz da Costa

2017-06-01

Full Text Available Increasing epidemiological and experimental evidence has demonstrated an inverse relationship between the consumption of plant foods and the incidence of chronic diseases, including cancer. Microcomponents that are naturally present in such foods, especially polyphenols, are responsible for the benefits to human health. Resveratrol is a diet-derived cancer chemopreventive agent with high therapeutic potential, as demonstrated by different authors. The aim of this review is to collect and present recent evidence from the literature regarding resveratrol and its effects on cancer prevention, molecular signaling (especially regarding the involvement of p53 protein, and therapeutic perspectives with an emphasis on clinical trial results to date.

Robustness of the p53 network and biological hackers.

Science.gov (United States)

Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

2005-06-06

The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

Science.gov (United States)

El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

2016-08-01

Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

Directory of Open Access Journals (Sweden)

Giovanna Damia

2001-01-01

Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.

Science.gov (United States)

Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei

2016-11-01

Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.

Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

International Nuclear Information System (INIS)

Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung; Song, Jie Young; Yun, Yeon Sook

2009-01-01

The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference

Small Molecule Modulator of p53 Signaling Pathway: Application for Radiosensitizing or Radioprotection Agents

Energy Technology Data Exchange (ETDEWEB)

Oh, Sang Taek; Cho, Mun Ju; Gwak, Jung Sug; Ryu, Min Jung [PharmacoGenomics Research Center, Inje University, Busan (Korea, Republic of); Song, Jie Young; Yun, Yeon Sook [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

2009-05-15

The tumor suppressor p53 is key molecule to protect the cell against genotoxic stress and..the most frequently mutated..protein..in cancer cells. Lack of functional p53..is accompanied by high rate of genomic instability, rapid tumor progression, resistance to anticancer therapy, and increased angiogenesis. In response to DNA damage, p53 protein rapidly accumulated through attenuated proteolysis and is also activated as transcription factor. Activated p53 up-regulates target genes involved in cell cycle arrest and/or apoptosis and then lead to suppression of malignant transformation and the maintenance of genomic integrity. Chemical genetics is a new technology to uncover the signaling networks that regulated biological phenotype using exogenous reagents such as small molecules. Analogous to classical forward genetic screens in model organism, this approach makes use of high throughput, phenotypic assay to identify small molecules that disrupt gene product function in a way that alters a phenotype of interest. Recently, interesting small molecules were identified from cell based high throughput screening and its target protein or mechanism of action were identified by various methods including affinity chromatography, protein array profiling, mRNA or phage display, transcription profiling, and RNA interference.

The nucleolus as a fundamental regulator of the p53 response and a new target for cancer therapy.

Science.gov (United States)

Woods, Simone J; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D

2015-07-01

Recent studies have highlighted the fundamental role that key oncogenes such as MYC, RAS and PI3K occupy in driving RNA Polymerase I transcription in the nucleolus. In addition to maintaining essential levels of protein synthesis, hyperactivated ribosome biogenesis and nucleolar function plays a central role in suppressing p53 activation in response to oncogenic stress. Consequently, disruption of ribosome biogenesis by agents such as the small molecule inhibitor of RNA Polymerase I transcription, CX-5461, has shown unexpected, potent, and selective effects in killing tumour cells via disruption of nucleolar function leading to activation of p53, independent of DNA damage. This review will explore the mechanism of DNA damage-independent activation of p53 via the nucleolar surveillance pathway and how this can be utilised to design novel cancer therapies. Non-genotoxic targeting of nucleolar function may provide a new paradigm for treatment of a broad range of oncogene-driven malignancies with improved therapeutic windows. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

Energy Technology Data Exchange (ETDEWEB)

Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

2015-02-01

Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

Interactions of Chromatin Context, Binding Site Sequence Content, and Sequence Evolution in Stress-Induced p53 Occupancy and Transactivation

OpenAIRE

Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.

2015-01-01

Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...

Identification of differentially expressed proteins in spontaneous thymic lymphomas from knockout mice with deletion of p53

DEFF Research Database (Denmark)

Honoré, Bent; Buus, Søren; Claësson, Mogens H

2008-01-01

ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two-dimensiona......ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two...... alpha type 3, transforming acidic coiled-coil containing protein 3, mitochondrial ornithine aminotransferase and epidermal fatty acid binding protein and down-regulation of adenylosuccinate synthetase, tubulin beta-3 chain, a 25 kDa actin fragment, proteasome subunit beta type 9, cofilin-1 and glia...

Molecular mechanism of X-ray-induced p53-dependent apoptosis

Energy Technology Data Exchange (ETDEWEB)

Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

1999-03-01

Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

Analysis of p53- immunoreactivity in astrocytic brain tumors

Directory of Open Access Journals (Sweden)

Shinkarenko T.V.

2016-12-01

Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

International Nuclear Information System (INIS)

Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi

2006-01-01

PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK

p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

Science.gov (United States)

Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

2011-01-01

The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514

The expanding regulatory universe of p53 in gastrointestinal cancer.

Science.gov (United States)

Fesler, Andrew; Zhang, Ning; Ju, Jingfang

2016-01-01

Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation

Science.gov (United States)

Armitage, Mark

Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

International Nuclear Information System (INIS)

Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

1995-01-01

G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined

Ubiquitin specific peptidase 5 mediates Histidine-rich protein Hpn induced cell apoptosis in hepatocellular carcinoma through P14-P53 signaling.

Science.gov (United States)

Liu, Yi; Wang, Wei-Mao; Zou, Li-Yi; Li, Li; Feng, Lu; Pan, Ming-Zhu; Lv, Min-Yi; Cao, Ying; Wang, Hua; Kung, Hsiang-Fu; Pang, Jian-Xin; Fu, Wei-Ming; Zhang, Jin-Fang

2017-06-01

Hpn is a small histidine-rich cytoplasmic protein from Helicobacter pylori and has been recognized as a high-risk factor for several cancers including gastric cancer, colorectal cancer, and MALT lymphoma. However, the relationship between Hpn and cancers remains elusive. In this study, we discovered that Hpn protein effectively suppressed cell growth and induced apoptosis in hepatocellular carcinoma (HCC). A two-dimensional gel electrophoresis and mass spectrometry-based comparative proteomics was performed to find the molecular targets of Hpn in HCC cells. It was identified that twelve proteins were differentially expressed, with USP5 being one of the most significantly downregulated protein. The P14 ARF -P53 signaling was activated by USP5 knockdown in HCC cells. Furthermore, USP5 overexpression significantly rescued the suppressive effect of Hpn on the viability of HCC cells. In conclusion, our study suggests that Hpn plays apoptosis-inducing roles through suppressing USP5 expression and activating the P14 ARF -P53 signaling. Therefore, Hpn may be a potential candidate for developing novel anti-HCC drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Understanding the role of p53 in adaptive response to radiation-induced germline mutations

International Nuclear Information System (INIS)

Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.

2003-01-01

Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline

Regulation of autophagy by cytoplasmic p53.

Science.gov (United States)

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

40 Years of Research Put p53 in Translation

Science.gov (United States)

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

Pharmacological activation of tumor suppressor, wild-type p53 as a promising strategy to fight cancer

Directory of Open Access Journals (Sweden)

Alicja Sznarkowska

2010-08-01

Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.

Protein degradation rate is the dominant mechanism accounting for the differences in protein abundance of basal p53 in a human breast and colorectal cancer cell line.

Directory of Open Access Journals (Sweden)

Eszter Lakatos

Full Text Available We determine p53 protein abundances and cell to cell variation in two human cancer cell lines with single cell resolution, and show that the fractional width of the distributions is the same in both cases despite a large difference in average protein copy number. We developed a computational framework to identify dominant mechanisms controlling the variation of protein abundance in a simple model of gene expression from the summary statistics of single cell steady state protein expression distributions. Our results, based on single cell data analysed in a Bayesian framework, lends strong support to a model in which variation in the basal p53 protein abundance may be best explained by variations in the rate of p53 protein degradation. This is supported by measurements of the relative average levels of mRNA which are very similar despite large variation in the level of protein.

Protein degradation rate is the dominant mechanism accounting for the differences in protein abundance of basal p53 in a human breast and colorectal cancer cell line.

Science.gov (United States)

Lakatos, Eszter; Salehi-Reyhani, Ali; Barclay, Michael; Stumpf, Michael P H; Klug, David R

2017-01-01

We determine p53 protein abundances and cell to cell variation in two human cancer cell lines with single cell resolution, and show that the fractional width of the distributions is the same in both cases despite a large difference in average protein copy number. We developed a computational framework to identify dominant mechanisms controlling the variation of protein abundance in a simple model of gene expression from the summary statistics of single cell steady state protein expression distributions. Our results, based on single cell data analysed in a Bayesian framework, lends strong support to a model in which variation in the basal p53 protein abundance may be best explained by variations in the rate of p53 protein degradation. This is supported by measurements of the relative average levels of mRNA which are very similar despite large variation in the level of protein.

Reactivity of p53 protein in canine transmissible venereal tumor Reatividade da proteína P53 no tumor venéreo transmissível canino

Directory of Open Access Journals (Sweden)

J.V. Moro

2010-04-01

Full Text Available The expression of p53 protein was evaluated in canine transmissible venereal tumor (CTVT, as following: natural occurrence (n=8; resistant to chemotherapy (n=4; and allogeneic transplanted in progression (n=8, stable (n=8, and regression (n=8stages. The collected specimens were submitted to GM1 immunohistochemical reaction. Results showed a mean percentage of immunomarked cells around 18.6% in CTVT of natural occurrence, 23.8% in CTVT resistant to chemotherapy, 22.9% in allogeneic transplanted CTVT in both progression and stable stages, and 35.8% in transplanted CTVT in regression stage. The results suggest that there is a functional abnormality in p53 gene and its products in the studied tumors; although, it is not possible to correlate the percentage of cells marked by p53 and a prognosis.A expressão da proteína p53 foi avaliada em espécimes de tumor venéreo transmissível canino (TVT de ocorrência natural (n=8; resistente à quimioterapia (n=4 e transplantado em cão nas fases de progressão tumoral (n=8, de latência (n=8 e de regressão (n=8. Os espécimes foram submetidos à reação de imunoistoquímica. Os resultados mostraram porcentagem média de células imunomarcadas de 18,6% no TVT de ocorrência natural, de 23,8% no TVT refratário, 22,9% nos TVTs transplantados nas fases de progressão e latência e de 35,8% na fase de regressão. Os resultados sugerem que há uma anormalidade funcional no gene P53 e seus produtos nos tumores estudados, apesar de não ser possível correlacionar a porcentagem de células marcadas pelo p53 ao prognóstico.

Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines