WorldWideScience

Sample records for p53 protein response

  1. The structure formed by inverted repeats in p53 response elements determines the transactivation activity of p53 protein

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Čechová, Jana; Battistin, M.; Coufal, Jan; Jagelská, Eva; Raimondi, I.; Inga, A.

    2017-01-01

    Roč. 483, č. 1 (2017), s. 516-521 ISSN 0006-291X R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor p53 * cruciform structures * dna-conformation Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 2.466, year: 2016

  2. Radiation-induced p53 protein response in the A549 cell line is culture growth-phase dependent

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, N.F.; Gurule, D.M.; Carpenter, T.R.

    1995-12-01

    One role of the p53 tumor suppressor protein has been recently revealed. Kastan, M.B. reported that p53 protein accumulates in cells exposed to ionizing radiation. The accumulation of p53 protein is in response to DNA damage, most importantly double-strand breaks, that results from exposure to ionizing radiation. The rise in cellular p53 levels is necessary for an arrest in the G{sub 1} phase of the cell cycle to provide additional time for DNA repair. The p53 response has also been demonstrated to enhance PCNA-dependent repair. p53 is thus an important regulator of the cellular response to DNA-damaging radiation. From this data, it can be concluded that the magnitude of the p53 response is not dependent on the phase of culture growth.

  3. Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage

    Directory of Open Access Journals (Sweden)

    Marie-Jo Halaby

    2015-01-01

    Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.

  4. Stabilization of alanine substituted p53 protein at Ser15, Thr18, and Ser20 in response to ionizing radiation

    International Nuclear Information System (INIS)

    Yamauchi, Motohiro; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami

    2004-01-01

    Phosphorylation of p53 at Ser15, Thr18, and Ser20 has been thought to be important for p53 stabilization in response to ionizing radiation. In the present study, we examined the X-ray-induced stabilization of Ala-substituted p53 protein at Ser15, Thr18, and Ser20, whose gene expression was controlled under an ecdyson-inducible promoter. We found that all single-, double-, or triple-Ala-substituted p53 at Ser15, Yhr18, and Ser20 were accumulated in the nucleus similarly to wild-type p53 after X-irradiation. These results indicate that the phosphorylation of p53 at Ser15, Thr18, and Ser20 is not necessarily needed for p53 stabilization in response to ionizing radiation

  5. Protein expression of P13K and P53 in prediction of response to radiotherapy in cervical cancer

    International Nuclear Information System (INIS)

    Teja Kisnanto; Devita Tetriana; Iin Kurnia; Sudiono S; Mellova Amir; Budiningsih Siregar; Ramli; Andrijono; Setiawan Soetopo; Irwan; Tjahya Kurjana; Bethy S Hernowo; Maringan DL Tobing

    2015-01-01

    Cervical cancer is a malignant disease that is common in women and is the first order of malignant disease in Indonesia. Radiotherapy is the main treatment on cervical cancer, especially at an advanced stage (IIB-IIB). P13K and P-53 protein plays a role in the regulation of apoptosis (programmed cell death). The purpose of this study was to determine the protein expression of P13K and P-53 in the prediction of response to radiotherapy action in patients with cervical cancer. Microscopic preparations obtained from biopsy tissue cancer (IIB-IIIB) to 20 patients from RSCM and RSHS. The method used is the method of immunohistochemistry using P13K and P-53 protein biomarkers in cervical cancer tissue preparations. P13K protein expression value obtained by the method of immuno reactive Score (IRS). P13K protein positive expression marked in blue on the cell cytoplasm and P-53 protein is characterized by brown or dark colors contained in the cell nucleus. Results showed that IRS value by 10% a negative P13K, P13K IRS weaker by 70%, IRS P13K was at 15%, and the IRS P13K stronger by 5%. While the index positive P-53 was obtained by 75% and negative P-53 index by 5%. Radiotherapy response analysis showed that there were 75% good response and 25% a bad response. The conclusion from this study is the expression of the protein P13K and P-53 for response prediction of radiotherapy IRS P13K values obtained in response to both radiotherapy is higher compared with radiotherapy response is bad, and the P-53 protein is not found differences in response to radiotherapy between positive and negative expressions. (author)

  6. Loss of ribosomal protein L11 affects zebrafish embryonic development through a p53-dependent apoptotic response.

    Directory of Open Access Journals (Sweden)

    Anirban Chakraborty

    Full Text Available Ribosome is responsible for protein synthesis in all organisms and ribosomal proteins (RPs play important roles in the formation of a functional ribosome. L11 was recently shown to regulate p53 activity through a direct binding with MDM2 and abrogating the MDM2-induced p53 degradation in response to ribosomal stress. However, the studies were performed in cell lines and the significance of this tumor suppressor function of L11 has yet to be explored in animal models. To investigate the effects of the deletion of L11 and its physiological relevance to p53 activity, we knocked down the rpl11 gene in zebrafish and analyzed the p53 response. Contrary to the cell line-based results, our data indicate that an L11 deficiency in a model organism activates the p53 pathway. The L11-deficient embryos (morphants displayed developmental abnormalities primarily in the brain, leading to embryonic lethality within 6-7 days post fertilization. Extensive apoptosis was observed in the head region of the morphants, thus correlating the morphological defects with apparent cell death. A decrease in total abundance of genes involved in neural patterning of the brain was observed in the morphants, suggesting a reduction in neural progenitor cells. Upregulation of the genes involved in the p53 pathway were observed in the morphants. Simultaneous knockdown of the p53 gene rescued the developmental defects and apoptosis in the morphants. These results suggest that ribosomal dysfunction due to the loss of L11 activates a p53-dependent checkpoint response to prevent improper embryonic development.

  7. P53 activation, a key event of the cellular response to gamma irradiation; L'activation de la proteine p53, un evenement determinant de la reponse cellulaire aux radiations ionisantes

    Energy Technology Data Exchange (ETDEWEB)

    Drane, P.; Alvarez, S.; Meiller, A.; May, E. [CEA Fontenay-aux-Roses, Dept. de Radiobiologie et de Radiopathologie, Lab. de Cancerogenese Moleculaire, CNRS, UMR 217, 92 (France)

    2002-03-01

    The tumor suppressor gene p53 encodes a protein whose major function is to protect organisms from proliferation of potentially tumorigenic cells. In normal conditions (unstressed cells), the p53 protein is inert and maintained at low level through its association with the Mdm2 oncogene, causing its translocation from the nucleus into the cytoplasm and its degradation through ubiquitin/proteasome pathway. In response to damaged DNA or to a variety of stresses, p53 accumulates in the nucleus and is activated as a transcriptional trans-activator. Posttranslational modifications of p53 including multi-site phosphorylation and acetylation are the major mechanism of p53 regulation. After exposure to ionising radiation, p53 activation implicates ATM, ATR, Chk2 and Chk1 kinases that phosphorylate the N-terminal domain on Ser15 (ATM and/or ATR), and Ser20 (Chk2 and/or Chk1), causing the dissociation of the p53/Mdm2 complex and thereby the stabilisation of p53. The process initiated by {gamma}-irradiation exposure involves also increased interaction of the p53 N-terminal domain with CBP/p300 and P/CAF leading to acetylation of the distant C-terminal domain at Lys 320, 373 and 382. In addition, the ATM-mediated dephosphorylation of Ser376 creates a fixation site for 14-3-3 protein. Taken together, phosphorylation, acetylation and association with co factors induce the stimulation of p53 transcriptional activity resulting in the expression of a set of genes involved, notably, in cell cycle arrest and apoptosis. This stress-induced p53 pathways lead to one of two outcomes: growth arrest or apoptosis and consequently protects the organism from the genotoxic effects of ionising radiation. (author)

  8. The p53-dependent radioadaptive response

    Science.gov (United States)

    Ohnishi, Takeo

    We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

  9. The p53/HSP70 inhibitor, 2-phenylethynesulfonamide, causes oxidative stress, unfolded protein response and apoptosis in rainbow trout cells

    Energy Technology Data Exchange (ETDEWEB)

    Zeng, Fanxing; Tee, Catherine; Liu, Michelle [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); Sherry, James P. [Aquatic Contaminants Research Division, Environment Canada, Burlington, Ontario L7R 4A6 (Canada); Dixon, Brian; Duncker, Bernard P. [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); Bols, Niels C., E-mail: ncbols@uwaterloo.ca [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada)

    2014-01-15

    Highlights: •2-Phenylethynesulfonamide (PES) is an inhibitor of p53 and HSP 70 in mammals. •In the fish epithelial cell line, RTgill-W1, PES enhanced ROS generation and was cytotoxic. •RTgill-W1 death was by apoptosis and blocked by the anti-oxidant N-acetylcysteine. •This is the first report linking PES-induced cell death to ROS. •With this background PES should be useful for studying fish cell survival pathways. -- Abstract: The effect of 2-phenylethynesulfonamide (PES), which is a p53 and HSP70 inhibitor in mammalian cells, was studied on the rainbow trout (Oncorhynchus mykiss) gill epithelial cell line, RTgill-W1, in order to evaluate PES as a tool for understanding the cellular survival pathways operating in fish. As judged by three viability assays, fish cells were killed by 24 h exposures to PES, but cell death was blocked by the anti-oxidant N-acetylcysteine (NAC). Cell death had several hallmarks of apoptosis: DNA laddering, nuclear fragmentation, Annexin V staining, mitochondrial membrane potential decline, and caspases activation. Reactive oxygen species (ROS) production peaked in several hours after the addition of PES and before cell death. HSP70 and BiP levels were higher in cultures treated with PES for 24 h, but this was blocked by NAC. As well, PES treatment caused HSP70, BiP and p53 to accumulate in the detergent-insoluble fraction, and this too was prevented by NAC. Of several possible scenarios to explain the results, the following one is the simplest. PES enhances the generation of ROS, possibly by inhibiting the anti-oxidant actions of p53 and HSP70. ER stress arises from the ROS and from PES inhibiting the chaperone activities of HSP70. The ER stress in turn initiates the unfolded protein response (UPR), but this fails to restore ER homeostasis so proteins aggregate and cells die. Despite these multiple actions, PES should be useful for studying fish cellular survival pathways.

  10. Silencing of ribosomal protein S9 elicits a multitude of cellular responses inhibiting the growth of cancer cells subsequent to p53 activation.

    Directory of Open Access Journals (Sweden)

    Mikael S Lindström

    Full Text Available BACKGROUND: Disruption of the nucleolus often leads to activation of the p53 tumor suppressor pathway through inhibition of MDM2 that is mediated by a limited set of ribosomal proteins including RPL11 and RPL5. The effects of ribosomal protein loss in cultured mammalian cells have not been thoroughly investigated. Here we characterize the cellular stress response caused by depletion of ribosomal protein S9 (RPS9. METHODOLOGY/PRINCIPAL FINDINGS: Depletion of RPS9 impaired production of 18S ribosomal RNA and induced p53 activity. It promoted p53-dependent morphological differentiation of U343MGa Cl2:6 glioma cells as evidenced by intensified expression of glial fibrillary acidic protein and profound changes in cell shape. U2OS osteosarcoma cells displayed a limited senescence response with increased expression of DNA damage response markers, whereas HeLa cervical carcinoma cells underwent cell death by apoptosis. Knockdown of RPL11 impaired p53-dependent phenotypes in the different RPS9 depleted cell cultures. Importantly, knockdown of RPS9 or RPL11 also markedly inhibited cell proliferation through p53-independent mechanisms. RPL11 binding to MDM2 was retained despite decreased levels of RPL11 protein following nucleolar stress. In these settings, RPL11 was critical for maintaining p53 protein stability but was not strictly required for p53 protein synthesis. CONCLUSIONS: p53 plays an important role in the initial restriction of cell proliferation that occurs in response to decreased level of RPS9. Our results do not exclude the possibility that other nucleolar stress sensing molecules act upstream or in parallel to RPL11 to activate p53. Inhibiting the expression of certain ribosomal proteins, such as RPS9, could be one efficient way to reinitiate differentiation processes or to induce senescence or apoptosis in rapidly proliferating tumor cells.

  11. P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

    Directory of Open Access Journals (Sweden)

    Ivan Raimondi

    Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

  12. Depletion of ribosomal protein L37 occurs in response to DNA damage and activates p53 through the L11/MDM2 pathway.

    Science.gov (United States)

    Llanos, Susana; Serrano, Manuel

    2010-10-01

    Perturbation of ribosomal biogenesis has recently emerged as a relevant p53-activating pathway. This pathway can be initiated by depletion of certain ribosomal proteins, which is followed by the binding and inhibition of MDM2 by a different subset of ribosomal proteins that includes L11. Here, we report that depletion of L37 leads to cell cycle arrest in a L11- and p53-dependent manner. DNA damage can initiate ribosomal stress, although little is known about the mechanisms involved. We have found that some genotoxic insults, namely, UV light and cisplatin, lead to proteasomal degradation of L37 in the nucleoplasm and to the ensuing L11-dependent stabilization of p53. Moreover, ectopic L37 overexpression can attenuate the DNA damage response mediated by p53. These results support the concept that DNA damage-induced proteasomal degradation of L37 constitutes a mechanistic link between DNA damage and the ribosomal stress pathway, and is a relevant contributing signaling pathway for the activation of p53 in response to DNA damage.

  13. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding.

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  14. Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding

    Science.gov (United States)

    Samanta, Sudipta; Mukherjee, Sanchita

    2017-10-01

    The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (β1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

  15. Bioluminescence Detection of Cells Having Stabilized p53 in Response to a Genotoxic Event

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2004-01-01

    Full Text Available Inactivation of p53 is one of the most frequent molecular events in neoplastic transformation. Approximately 60% of all human tumors have mutations in both p53 alleles. Wild-type p53 activity is regulated in large part by the proteosome-dependent degradation of p53, resulting in a short p53 half-life in unstressed and untransformed cells. Activation of p53 by a variety of stimuli, including DNA damage induced by genotoxic drugs or radiation, is accomplished by stabilization of wild-type p53. The stabilized and active p53 can result in either cell-cycle arrest or apoptosis. Surprisingly, the majority of tumor-associated, inactivating p53 mutations also result in p53 accumulation. Thus, constitutive elevation of p53 levels in cells is a reliable measure of p53 inactivation, whereas transiently increased p53 levels reflect a recent genotoxic stress. In order to facilitate noninvasive imaging of p53 accumulation, we here describe the construction of a p53-luciferase fusion protein. Induction of DNA damage in cells expressing the fusion protein resulted in a time-dependent accumulation of the fusion that was noninvasively detected using bioluminescence imaging and validated by Western blot analysis. The p53-Luc protein retains p53 function because its expression in HCT116 cells lacking functional p53 resulted in activation of p21 expression as well as induction of apoptosis in response to a DNA damaging event. Employed in a transgenic animal model, the proposed p53-reporter fusion protein will be useful for studying p53 activation in response to exposure to DNA-damaging carcinogenic agents. It could also be used to study p53 stabilization as a result of inactivating p53 mutations. Such studies will further our understanding of p53's role as the “guardian of the genome” and its function in tumorigenesis.

  16. Immunohistochemical analysis of P53 protein in odontogenic cysts

    Science.gov (United States)

    Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

    2010-01-01

    The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

  17. Chronology of p53 protein accumulation in gastric carcinogenesis

    NARCIS (Netherlands)

    Craanen, M. E.; Blok, P.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1995-01-01

    p53 Protein accumulation in early gastric carcinoma was studied in relation to the histological type (Lauren classification) and the type of growth pattern, including the chronology of p53 protein accumulation during carcinogenesis. Forty five, paraffin embedded gastrectomy specimens from early

  18. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. S(+)-ibuprofen destabilizes MYC/MYCN and AKT, increases p53 expression, and induces unfolded protein response and favorable phenotype in neuroblastoma cell lines.

    Science.gov (United States)

    Ikegaki, Naohiko; Hicks, Sakeenah L; Regan, Paul L; Jacobs, Joshua; Jumbo, Amina S; Leonhardt, Payton; Rappaport, Eric F; Tang, Xao X

    2014-01-01

    Neuroblastoma is a common pediatric solid tumor that exhibits a striking clinical bipolarity: favorable and unfavorable. The survival rate of children with unfavorable neuroblastoma remains low among all childhood cancers. MYCN and MYC play a crucial role in determining the malignancy of unfavorable neuroblastomas, whereas high-level expression of the favorable neuroblastoma genes is associated with a good disease outcome and confers growth suppression of neuroblastoma cells. A small fraction of neuroblastomas harbors TP53 mutations at diagnosis, but a higher proportion of the relapse cases acquire TP53 mutations. In this study, we investigated the effect of S(+)-ibuprofen on neuroblastoma cell lines, focusing on the expression of the MYCN, MYC, AKT, p53 proteins and the favorable neuroblastoma genes in vitro as biomarkers of malignancy. Treatment of neuroblastoma cell lines with S(+)-ibuprofen resulted in a significant growth suppression. This growth effect was accompanied by a marked decrease in the expression of MYC, MYCN, AKT and an increase in p53 expression in neuroblastoma cell lines without TP53 mutation. In addition, S(+)-ibuprofen enhanced the expression of some favorable neuroblastoma genes (EPHB6, CD44) and genes involved in growth suppression and differentiation (EGR1, EPHA2, NRG1 and SEL1L). Gene expression profile and Ingenuity pathway analyses using TP53-mutated SKNAS cells further revealed that S(+)-ibuprofen suppressed molecular pathways associated with cell growth and conversely enhanced those of cell cycle arrest and the unfolded protein response. Collectively, these results suggest that S(+)-ibuprofen or its related compounds may have the potential for therapeutic and/or palliative use for unfavorable neuroblastoma.

  20. Functions of MDMX in the Modulation of the p53-Response

    Directory of Open Access Journals (Sweden)

    Kristiaan Lenos

    2011-01-01

    Full Text Available The MDM family proteins MDM2 and MDMX are two critical regulators of the p53 tumor suppressor protein. Expression of both proteins is necessary for allowing the embryonal development by keeping the activity of p53 in check. Upon stresses that need to activate p53 to perform its function as guardian of the genome, p53 has to be liberated from these two inhibitors. In this review, we will discuss the various mechanisms by which MDMX protein levels are downregulated upon various types of stress, including posttranslational modifications of the MDMX protein and the regulation of mdmx mRNA expression, including alternative splicing. In addition, the putative function(s of the described MDMX splice variants, particularly in tumor development, will be discussed. Lastly, in contrast to common belief, we have recently shown the existence of a p53-MDMX feedback loop, which is important for dampening the p53-response at later phases after genotoxic stress.

  1. Electrophoretic detection of protein p53 in human leukocytes

    International Nuclear Information System (INIS)

    Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.

    1986-01-01

    The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients

  2. The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

    Directory of Open Access Journals (Sweden)

    Peiyuan Jia

    Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

  3. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    Science.gov (United States)

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  4. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  5. Mutations in p53, p53 protein overexpression and breast cancer survival

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

    2009-01-01

    Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

  6. Tumor Suppressor p53 Stimulates the Expression of Epstein-Barr Virus Latent Membrane Protein 1.

    Science.gov (United States)

    Wang, Qianli; Lingel, Amy; Geiser, Vicki; Kwapnoski, Zachary; Zhang, Luwen

    2017-10-15

    Epstein-Barr virus (EBV) is associated with multiple human malignancies. EBV latent membrane protein 1 (LMP1) is required for the efficient transformation of primary B lymphocytes in vitro and possibly in vivo The tumor suppressor p53 plays a seminal role in cancer development. In some EBV-associated cancers, p53 tends to be wild type and overly expressed; however, the effects of p53 on LMP1 expression is not clear. We find LMP1 expression to be associated with p53 expression in EBV-transformed cells under physiological and DNA damaging conditions. DNA damage stimulates LMP1 expression, and p53 is required for the stimulation. Ectopic p53 stimulates endogenous LMP1 expression. Moreover, endogenous LMP1 blocks DNA damage-mediated apoptosis. Regarding the mechanism of p53-mediated LMP1 expression, we find that interferon regulatory factor 5 (IRF5), a direct target of p53, is associated with both p53 and LMP1. IRF5 binds to and activates a LMP1 promoter reporter construct. Ectopic IRF5 increases the expression of LMP1, while knockdown of IRF5 leads to reduction of LMP1. Furthermore, LMP1 blocks IRF5-mediated apoptosis in EBV-infected cells. All of the data suggest that cellular p53 stimulates viral LMP1 expression, and IRF5 may be one of the factors for p53-mediated LMP1 stimulation. LMP1 may subsequently block DNA damage- and IRF5-mediated apoptosis for the benefits of EBV. The mutual regulation between p53 and LMP1 may play an important role in EBV infection and latency and its related cancers. IMPORTANCE The tumor suppressor p53 is a critical cellular protein in response to various stresses and dictates cells for various responses, including apoptosis. This work suggests that an Epstein-Bar virus (EBV) principal viral oncogene is activated by cellular p53. The viral oncogene blocks p53-mediated adverse effects during viral infection and transformation. Therefore, the induction of the viral oncogene by p53 provides a means for the virus to cope with infection and

  7. Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

    International Nuclear Information System (INIS)

    Chen Chen; Shimizu, Shigeomi; Tsujimoto, Yoshihide; Motoyama, Noboru

    2005-01-01

    The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR

  8. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  10. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    Science.gov (United States)

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  11. Mutant p53 protein localized in the cytoplasm inhibits autophagy.

    Science.gov (United States)

    Morselli, Eugenia; Tasdemir, Ezgi; Maiuri, Maria Chiara; Galluzzi, Lorenzo; Kepp, Oliver; Criollo, Alfredo; Vicencio, José Miguel; Soussi, Thierry; Kroemer, Guido

    2008-10-01

    The knockout, knockdown or chemical inhibition of p53 stimulates autophagy. Moreover, autophagy-inducing stimuli such as nutrient depletion, rapamycin or lithium cause the depletion of cytoplasmic p53, which in turn is required for the induction of autophagy. Here, we show that retransfection of p53(-/-) HCT 116 colon carcinoma cells with wild type p53 decreases autophagy down to baseline levels. Surprisingly, one third among a panel of 22 cancer-associated p53 single amino acid mutants also inhibited autophagy when transfected into p53(-/-) cells. Those variants of p53 that preferentially localize to the cytoplasm effectively repressed autophagy, whereas p53 mutants that display a prominently nuclear distribution failed to inhibit autophagy. The investigation of a series of deletion mutants revealed that removal of the DNA-binding domain from p53 fails to interfere with its role in the regulation of autophagy. Altogether, these results identify the cytoplasmic localization of p53 as the most important feature for p53-mediated autophagy inhibition. Moreover, the structural requirements for the two biological activities of extranuclear p53, namely induction of apoptosis and inhibition of autophagy, are manifestly different.

  12. Wildtype p53-specific Antibody and T-Cell Responses in Cancer Patients

    DEFF Research Database (Denmark)

    Pedersen, Anders Elm; Stryhn, Anette; Justesen, Sune

    2011-01-01

    patients. Detection of antibodies against wt p53 protein has been used as a diagnostic and prognostic marker and discovery of new T-cell epitopes has enabled design of cancer vaccination protocols with promising results. Here, we identified wt p53-specific antibodies in various cancer patients......(264-272) in breast cancer patients and against HLA-A*01:01 binding peptide wt p53(226-234) and HLA-B*07:02 binding peptide wt p53(74-82) in renal cell cancer and breast cancer patients, respectively. Finally, we analyzed antibody and T-cell responses against wt p53 15-mer peptides in patients with metastatic renal...

  13. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    Directory of Open Access Journals (Sweden)

    Bruno Pagano

    Full Text Available The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  14. The role of p53 in the response to mitotic spindle damage

    International Nuclear Information System (INIS)

    Meek, D.W.

    2000-01-01

    The p53 tumour suppressor protein has defined roles in G1/S and G2/M cell cycle checkpoint in response to a range of cellular stresses including DNA damage, dominant oncogene expression, hypoxia, metabolic changes and viral infection. In addition to these responses, p53 can also be activated when damage occurs to the mitotic spindle. Initially, spindle damage activates a p53-independent checkpoint which functions at the metaphase-anaphase transition and prevents cells from progressing through mitosis until the completion of spindle formation. Cells eventually escape from this block (a process termed 'mitotic slippage'), and an aberrant mitosis ensues in which sister chromatids fail to segregate properly. After a delay period, p53 responds to this mitotic failure by instituting a G1-like growth arrest, with an intact nucleus containing 4N DNA, but without the cells undergoing division. Cells lacking wild-type p53 are still able to arrest transiently at mitosis, and also fail to undergo division, underscoring that the delay in mitosis is p53-independent. However, these cells are not prevented from re-entering the cell cycle and can reduplicate their DNA unchecked, leading to polyploidy. Additionally, p53-null cells which experience spindle failure often show the appearance of micronuclei arising from poorly segregated chromosomes which have de-condensed and been enclosed in a nuclear envelope. The ability of p53 to prevent their formation suggests an additional G2 involvement which prevents nuclear breakdown prior to mitosis. The molecular mechanism by which p53 is able to sense mitotic failure is still unknown, but may be linked to the ability of p53 to regulate duplication of the centrosome, the organelle which nucleates spindle formation. (authors)

  15. Expression of p53 protein in high-grade gastroenteropancreatic neuroendocrine carcinoma

    DEFF Research Database (Denmark)

    Ali, Abir Salwa; Grönberg, Malin; Federspiel, Birgitte

    2017-01-01

    of immunoreactive p53 protein in GEP-NEC. Materials and methods Tumor tissues from 124 GEP-NEC patients with locally advanced or metastatic disease treated with platinum-based chemotherapy were collected from Nordic centers and clinical data were obtained from the Nordic NEC register. Tumor proliferation rate...... In this cohort of GEP-NEC patients, p53 expression could not be correlated with clinical outcome. However, in patients with colorectal NECs, p53 expression was correlated with shorter PFS and OS. Further studies are needed to establish the role of immunoreactive p53 as a prognostic marker for GEP-NEC patients.......Background Gastroenteropancreatic neuroendocrine carcinomas (GEP-NECs) are aggressive, rapidly proliferating tumors. Therapeutic response to current chemotherapy regimens is usually short lasting. The aim of this study was to examine the expression and potential clinical importance...

  16. Heat shock factor-1 modulates p53 activity in the transcriptional response to DNA damage

    Science.gov (United States)

    Logan, Ian R.; McNeill, Hesta V.; Cook, Susan; Lu, Xiaohong; Meek, David W.; Fuller-Pace, Frances V.; Lunec, John; Robson, Craig N.

    2009-01-01

    Here we define an important role for heat shock factor 1 (HSF1) in the cellular response to genotoxic agents. We demonstrate for the first time that HSF1 can complex with nuclear p53 and that both proteins are co-operatively recruited to p53-responsive genes such as p21. Analysis of natural and synthetic cis elements demonstrates that HSF1 can enhance p53-mediated transcription, whilst depletion of HSF1 reduces the expression of p53-responsive transcripts. We find that HSF1 is required for optimal p21 expression and p53-mediated cell-cycle arrest in response to genotoxins while loss of HSF1 attenuates apoptosis in response to these agents. To explain these novel properties of HSF1 we show that HSF1 can complex with DNA damage kinases ATR and Chk1 to effect p53 phosphorylation in response to DNA damage. Our data reveal HSF1 as a key transcriptional regulator in response to genotoxic compounds widely used in the clinical setting, and suggest that HSF1 will contribute to the efficacy of these agents. PMID:19295133

  17. Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeyran eShahbazi

    2013-05-01

    Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

  18. RUNX Family Participates in the Regulation of p53-Dependent DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Toshinori Ozaki

    2013-01-01

    Full Text Available A proper DNA damage response (DDR, which monitors and maintains the genomic integrity, has been considered to be a critical barrier against genetic alterations to prevent tumor initiation and progression. The representative tumor suppressor p53 plays an important role in the regulation of DNA damage response. When cells receive DNA damage, p53 is quickly activated and induces cell cycle arrest and/or apoptotic cell death through transactivating its target genes implicated in the promotion of cell cycle arrest and/or apoptotic cell death such as p21WAF1, BAX, and PUMA. Accumulating evidence strongly suggests that DNA damage-mediated activation as well as induction of p53 is regulated by posttranslational modifications and also by protein-protein interaction. Loss of p53 activity confers growth advantage and ensures survival in cancer cells by inhibiting apoptotic response required for tumor suppression. RUNX family, which is composed of RUNX1, RUNX2, and RUNX3, is a sequence-specific transcription factor and is closely involved in a variety of cellular processes including development, differentiation, and/or tumorigenesis. In this review, we describe a background of p53 and a functional collaboration between p53 and RUNX family in response to DNA damage.

  19. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Jiawen [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Itahana, Koji, E-mail: koji.itahana@duke-nus.edu.sg [Cancer and Stem Cell Biology Program, Duke-NUS Graduate Medical School (Singapore); Baskar, Rajamanickam, E-mail: r.baskar@nccs.com.sg [Molecular Radiobiology Laboratory, Division of Cellular and Molecular Research (Singapore); Department of Radiation Oncology, National Cancer Centre (Singapore)

    2015-02-27

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G{sub 1}/S or G{sub 2}/M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G{sub 0}, therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its

  20. Quiescence does not affect p53 and stress response by irradiation in human lung fibroblasts

    International Nuclear Information System (INIS)

    Dai, Jiawen; Itahana, Koji; Baskar, Rajamanickam

    2015-01-01

    Cells in many organs exist in both proliferating and quiescent states. Proliferating cells are more radio-sensitive, DNA damage pathways including p53 pathway are activated to undergo either G 1 /S or G 2 /M arrest to avoid entering S and M phase with DNA damage. On the other hand, quiescent cells are already arrested in G 0 , therefore there may be fundamental difference of irradiation response between proliferating and quiescent cells, and this difference may affect their radiosensitivity. To understand these differences, proliferating and quiescent human normal lung fibroblasts were exposed to 0.10–1 Gy of γ-radiation. The response of key proteins involved in the cell cycle, cell death, and metabolism as well as histone H2AX phosphorylation were examined. Interestingly, p53 and p53 phosphorylation (Ser-15), as well as the cyclin-dependent kinase inhibitors p21 and p27, were induced similarly in both proliferating and quiescent cells after irradiation. Furthermore, the p53 protein half-life, and expression of cyclin A, cyclin E, proliferating cell nuclear antigen (PCNA), Bax, or cytochrome c expression as well as histone H2AX phosphorylation were comparable after irradiation in both phases of cells. The effect of radioprotection by a glycogen synthase kinase 3β inhibitor on p53 pathway was also similar between proliferating and quiescent cells. Our results showed that quiescence does not affect irradiation response of key proteins involved in stress and DNA damage at least in normal fibroblasts, providing a better understanding of the radiation response in quiescent cells, which is crucial for tissue repair and regeneration. - Highlights: • p53 response by irradiation was similar between proliferating and quiescent cells. • Quiescent cells showed similar profiles of cell cycle proteins after irradiation. • Radioprotection of GSK-3β inhibitor caused similar effects between these cells. • Quiescence did not affect p53 response despite its known role in

  1. Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

    2015-11-15

    Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4

  2. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    OpenAIRE

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the ...

  3. Cellular response to DNA damage. Link between p53 and DNA-PK

    International Nuclear Information System (INIS)

    Salles-Passador, I.; Fotedar, R.; Fotedar, A.

    1999-01-01

    Cells which lack DNA-activated protein kinase (DNA-PK) are very susceptible to ionizing radiation and display an inability to repair double-strand DNA breaks. DNA-PK is a member of a protein kinase family that includes ATR and ATM which have strong homology in their carboxy-terminal kinase domain with Pl-3 kinase. ATM has been proposed to act upstream of p53 in cellular response to ionizing radiation. DNA-PK may similarly interact with p53 in cellular growth control and in mediation of the response to ionizing radiation. (author)

  4. p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

    Science.gov (United States)

    Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

    2007-10-01

    Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

  5. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, A.; Ohnishi, K.; Asakawa, I.; Tamamoto, T.; Yasumoto, J.; Yuki, K.; Ohnishi, T.; Tachibana, A.

    2003-01-01

    Full text: We have studied whether the p53-centered signal transduction pathway induced by acute radiation is interfered with chronic pre-irradiation at a low dose-rate in human cultured cells and whole body of mice. In squamous cell carcinoma cells, we found that a challenge irradiation with X-ray immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge irradiation alone. In addition, the induction of p53-centered apoptosis and the accumulation of its related proteins after the challenge irradiation were strongly correlated with the above-mentioned phenomena. In mouse spleen, the induction of apoptosis and the accumulation of p53 and Bax were observed dose-dependently at 12 h after a challenge irradiation. In contrast, we found significant suppression of them induced by challenge irradiation at a high dose-rate when mice were pre-irradiated with chronic irradiation at a low dose-rate. These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced p53-dependent signal transduction processes. There are numerous papers about p53 functions in apoptosis, radiosensitivity, genomic instability and cancer incidence in cultured cells or animals. According to our data and other findings, since p53 can prevent carcinogenesis, pre-irradiation at a low dose-rate might enhance the predisposition to cancer. Therefore, it is possible that different maximal permissible dose equivalents for the public populations are appropriate. Furthermore, concerning health of human beings, studies of the adaptive responses to radiation are quite important, because the radiation response strongly depends on experience of prior exposure to radiation

  6. Mitochondrial localization of the low level p53 protein in proliferative cells

    Energy Technology Data Exchange (ETDEWEB)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Oliver, Lisa [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Rincheval, Vincent; Renaud, Flore [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vallette, Francois M. [INSERM U601, Universite de Nantes, Faculte de Medecine, Nantes Cedex (France); Mignotte, Bernard [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France); Vayssiere, Jean-Luc, E-mail: jean-luc.vayssiere@uvsq.fr [Laboratoire de Genetique et Biologie Cellulaire - CNRS UMR 8159, Universite de Versailles Saint-Quentin-en-Yvelines, Versailles, France and Laboratoire de Genetique Moleculaire et Physiologique, Ecole Pratique des Hautes Etudes, Versailles (France)

    2009-10-02

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  7. Mitochondrial localization of the low level p53 protein in proliferative cells

    International Nuclear Information System (INIS)

    Ferecatu, Ioana; Bergeaud, Marie; Rodriguez-Enfedaque, Aida; Le Floch, Nathalie; Oliver, Lisa; Rincheval, Vincent; Renaud, Flore; Vallette, Francois M.; Mignotte, Bernard; Vayssiere, Jean-Luc

    2009-01-01

    p53 protein plays a central role in suppressing tumorigenesis by inducing cell cycle arrest or apoptosis through transcription-dependent and -independent mechanisms. Emerging publications suggest that following stress, a fraction of p53 translocates to mitochondria to induce cytochrome c release and apoptosis. However, the localization of p53 under unstressed conditions remains largely unexplored. Here we show that p53 is localized at mitochondria in absence of apoptotic stimuli, when cells are proliferating, localization observed in various cell types (rodent and human). This is also supported by acellular assays in which p53 bind strongly to mitochondria isolated from rat liver. Furthermore, the mitochondria subfractionation study and the alkaline treatment of the mitochondrial p53 revealed that the majority of mitochondrial p53 is present in the membranous compartments. Finally, we identified VDAC, a protein of the mitochondrial outer-membrane, as a putative partner of p53 in unstressed/proliferative cells.

  8. A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation

    Directory of Open Access Journals (Sweden)

    Kumar Sonia

    2011-02-01

    Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.

  9. Changes in protein expression in p53 deleted spontaneous thymic lymphomas

    DEFF Research Database (Denmark)

    Honoré, Bent; Vorum, Henrik; Pedersen, Anders Elm

    2004-01-01

    with the protein expression in p53+/+ and p53-/- thymocytes. Only a minority (13 proteins) of the quantitatively changed proteins were common for the two thymic lymphoma cell lines, suggesting that the p53 deficiency mainly results in genetic dysfunctions which are individual for a given tumor. Two of the detected...... structure containing motifs of the glyoxalase-bleomycin resistance protein family (MDR) as deduced from the cDNA....

  10. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    Science.gov (United States)

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  11. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    OpenAIRE

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

  12. The prognostic significance of accumulation of p53 protein in stage III non-small cell lung cancer treated by radiotherapy

    International Nuclear Information System (INIS)

    Langendijk, J.A.; Thunnissen, F.B.J.M.; Lamers, R.J.S.; Jong, J.M.A. de; Velde, G.P.M. ten; Wouters, E.F.M.

    1995-01-01

    In the present study the prognostic significance of accumulation of nuclear p53 protein on survival and freedom from local progression was investigated. Formalin-fixed, paraffin-embedded sections obtained by bronchoscopy or mediastinoscopy were used to examine the expression of nuclear p53 protein using immunohistochemistry. In 37 cases (57%), overexpression of the p53 protein was detected. No relation was found between p53 expression and other pretreatment variables. Response to radiotherapy was found in 11 p53-negative cases (65%) versus 10 p53-positive cases (42%). Freedom from local progression was significantly better in the p53-negative cases as compared with the p53-positive cases. The p53-negative cases who responded to radiotherapy showed an excellent freedom from local progression rate after 2 years of 100%, whereas all p53-positive cases without response to radiotherapy showed local progression within 24 months. Overall survival between p53-negative and -positive cases did not differ, however the disease-specific survival was found to be worse in the p53-positive cases as compared to the negative cases (median survival 8.4 vs. 14.4 months (P < 0.05)). No correlation was found between p53 expression and the frequency of distant metastases. In conclusion, the results of this study suggest that p53 protein expression may be of prognostic value on freedom from local progression in non-small cell lung carcinoma

  13. A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

    Directory of Open Access Journals (Sweden)

    Asita Elengoe

    2015-01-01

    Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

  14. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    Science.gov (United States)

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  15. Isolation and identification of the human homolog of a new p53-binding protein, Mdmx

    NARCIS (Netherlands)

    Shvarts, A.; Bazuine, M.; Dekker, P.; Ramos, Y. F.; Steegenga, W. T.; Merckx, G.; van Ham, R. C.; van der Houven van Oordt, W.; van der Eb, A. J.; Jochemsen, A. G.

    1997-01-01

    We recently reported the identification of a mouse cDNA encoding a new p53-associating protein that we called Mdmx because of its structural similarity to Mdm2, a well-known p53-binding protein. Here we report the isolation of a cDNA encoding the human homolog of Mdmx. The ORF of the cDNA encodes a

  16. Influence of P53 on the radiotherapy response of hepatocellular carcinoma

    Science.gov (United States)

    Gomes, Ana R.; Abrantes, Ana M.; Brito, Ana F.; Laranjo, Mafalda; Casalta-Lopes, João E.; Gonçalves, Ana C.; Sarmento-Ribeiro, Ana B.; Tralhão, José G.

    2015-01-01

    Background/Aims Hepatocellular carcinoma (HCC) is one of the most common cancers worldwide, and it has a poor prognosis and few therapeutic options. Radiotherapy is one of the most effective forms of cancer treatment, and P53 protein is one of the key molecules determining how a cell responds to radiotherapy. The aim of this study was to determine the therapeutic efficacy of iodine-131 in three human HCC cell lines. Methods Western blotting was used to measure P53 expression. The effects of radiotherapy with iodine-131 were assessed by using the clonogenic assay to evaluate cell survival. Flow cytometry was carried out to examine the effects of iodine-131 on cell death, oxidative stress, reduced intracellular glutathione expression, the mitochondrial membrane potential, and the cell cycle. Results The P53 protein was not expressed in Hep3B2.1-7 cells, was expressed at normal levels in HepG2 cells, and was overexpressed in HuH7 cells. P53 expression in the HuH7 and HepG2 cell lines increased after internal and external irradiation with iodine-131. Irradiation induced a decrease in cell survival and led to a decrease in cell viability in all of the cell lines studied, accompanied by cell death via late apoptosis/necrosis and necrosis. Irradiation with 131-iodine induced mostly cell-cycle arrest in the G0/G1 phase. Conclusions These results suggest that P53 plays a key role in the radiotherapy response of HCC. PMID:26527121

  17. Recognition of Local DNA Structures by p53 Protein

    Czech Academy of Sciences Publication Activity Database

    Brázda, Václav; Coufal, Jan

    2017-01-01

    Roč. 18, č. 2 (2017), č. článku 375. E-ISSN 1422-0067 R&D Projects: GA ČR GA15-21855S Institutional support: RVO:68081707 Keywords : tumor-suppressor protein * c-terminal domain * non-b dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.226, year: 2016

  18. OTUD5 regulates p53 stability by deubiquitinating p53.

    Directory of Open Access Journals (Sweden)

    Judong Luo

    Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

  19. Characterisation of the p53-mediated cellular responses evoked in primary mouse cells following exposure to ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Gillian D McFeat

    Full Text Available Exposure to ultraviolet (UV light can cause significant damage to mammalian cells and, although the spectrum of damage produced varies with the wavelength of UV, all parts of the UV spectrum are recognised as being detrimental to human health. Characterising the cellular response to different wavelengths of UV therefore remains an important aim so that risks and their moderation can be evaluated, in particular in relation to the initiation of skin cancer. The p53 tumour suppressor protein is central to the cellular response that protects the genome from damage by external agents such as UV, thus reducing the risk of tumorigenesis. In response to a variety of DNA damaging agents including UV light, wild-type p53 plays a role in mediating cell-cycle arrest, facilitating apoptosis and stimulating repair processes, all of which prevent the propagation of potentially mutagenic defects. In this study we examined the induction of p53 protein and its influence on the survival of primary mouse fibroblasts exposed to different wavelengths of UV light. UVC was found to elevate p53 protein and its sequence specific DNA binding capacity. Unexpectedly, UVA treatment failed to induce p53 protein accumulation or sequence specific DNA binding. Despite this, UVA exposure of wild-type cells induced a p53 dependent G1 cell cycle arrest followed by a wave of p53 dependent apoptosis, peaking 12 hours post-insult. Thus, it is demonstrated that the elements of the p53 cellular response evoked by exposure to UV radiation are wavelength dependent. Furthermore, the interrelationship between various endpoints is complex and not easily predictable. This has important implications not only for understanding the mode of action of p53 but also for the use of molecular endpoints in quantifying exposure to different wavelengths of UV in the context of human health protection.

  20. Nucleolus-derived mediators in oncogenic stress response and activation of p53-dependent pathways.

    Science.gov (United States)

    Stępiński, Dariusz

    2016-08-01

    Rapid growth and division of cells, including tumor ones, is correlated with intensive protein biosynthesis. The output of nucleoli, organelles where translational machineries are formed, depends on a rate of particular stages of ribosome production and on accessibility of elements crucial for their effective functioning, including substrates, enzymes as well as energy resources. Different factors that induce cellular stress also often lead to nucleolar dysfunction which results in ribosome biogenesis impairment. Such nucleolar disorders, called nucleolar or ribosomal stress, usually affect cellular functioning which in fact is a result of p53-dependent pathway activation, elicited as a response to stress. These pathways direct cells to new destinations such as cell cycle arrest, damage repair, differentiation, autophagy, programmed cell death or aging. In the case of impaired nucleolar functioning, nucleolar and ribosomal proteins mediate activation of the p53 pathways. They are also triggered as a response to oncogenic factor overexpression to protect tissues and organs against extensive proliferation of abnormal cells. Intentional impairment of any step of ribosome biosynthesis which would direct the cells to these destinations could be a strategy used in anticancer therapy. This review presents current knowledge on a nucleolus, mainly in relation to cancer biology, which is an important and extremely sensitive element of the mechanism participating in cellular stress reaction mediating activation of the p53 pathways in order to counteract stress effects, especially cancer development.

  1. Frequency of p53 Gene Mutation and Protein Expression in Oral Squamous Cell Carcinoma

    International Nuclear Information System (INIS)

    Ara, N.; Atique, M.; Ahmed, S.; Bukhari, S. G. A.

    2014-01-01

    Objective: To determine the frequency of p53 gene mutation and protein expression in Oral Squamous Cell Carcinoma (OSCC) and to establish correlation between the two. Study Design: Analytical study. Place and Duration of Study: Histopathology Department and Molecular Biology Laboratory, Armed Forces Institute of Pathology (AFIP), Rawalpindi, from May 2010 to May 2011. Methodology: Thirty diagnosed cases of OSCC were selected by consecutive sampling. Seventeen were retrieved from the record files of the AFIP, and 13 fresh/frozen sections were selected from patients reporting to the Oral Surgery Department, Armed Forces Institute of Dentistry (AFID). Gene p53 mutation was analyzed in all the cases using PCRSSCP analysis. DNA was extracted from the formalin-fixed and paraffin-embedded tissue sections and fresh/frozen sections. DNA thus extracted was amplified by polymerase chain reaction. The amplified products were denatured and finally analyzed by gel electrophoresis. Gene mutation was detected as electrophoretic mobility shift. The immunohistochemical marker p53 was applied to the same 30 cases and overexpression of protein p53 was recorded. Results: Immunohistochemical expression of marker p53 was positive in 67% (95% Confidence Interval (CI) 48.7 - 80.9) of the cases. Mutations of the p53 gene were detected in 23% (95% CI 11.5 - 41.2) of the OSCC. No statistically significant correlation was found between p53 gene mutation and protein p53 expression (rs = - 0.057, p = 0.765). Conclusion: A substantial number of patients have p53 gene mutation (23%) and protein p53 expression (67%) in oral squamous cell carcinoma (OSCC). (author)

  2. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    Science.gov (United States)

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  3. Driving p53 Response to Bax Activation Greatly Enhances Sensitivity to Taxol by Inducing Massive Apoptosis

    Directory of Open Access Journals (Sweden)

    Paola De Feudis

    2000-05-01

    Full Text Available The proapoptotic gene bax is one of the downstream effectors of p53. The p53 binding site in the bax promoter is less responsive to p53 than the one in the growth arrest mediating gene p21. We introduced the bax gene under the control of 13 copies of a strong p53 responsive element into two ovarian cancer cell lines. The clones expressing bax under the control of p53 obtained from the wild-type (wt p53-expressing cell line A2780 were much more sensitive (500- to 1000-fold to the anticancer agent taxol than the parent cell line, with a higher percentage of cells undergoing apoptosis after drug treatment that was clearly p53-dependent and bax-mediated. Xenografts established in nude mice from one selected clone (A2780/C3 were more responsive to taxol than the parental line and the apoptotic response of A2780/C3 tumors was also increased after treatment. Introduction of the same plasmid into the p53 null SKOV3 cell line did not alter the sensitivity to taxol or the induction of apoptosis. In conclusion, driving the p53 response (after taxol treatment by activating the bax gene rather than the p21 gene results in induction of massive apoptosis, in vitro and in vivo, and greatly enhances sensitivity to the drug.

  4. Cancer Chemoprevention by Resveratrol: The p53 Tumor Suppressor Protein as a Promising Molecular Target

    Directory of Open Access Journals (Sweden)

    Danielly C. Ferraz da Costa

    2017-06-01

    Full Text Available Increasing epidemiological and experimental evidence has demonstrated an inverse relationship between the consumption of plant foods and the incidence of chronic diseases, including cancer. Microcomponents that are naturally present in such foods, especially polyphenols, are responsible for the benefits to human health. Resveratrol is a diet-derived cancer chemopreventive agent with high therapeutic potential, as demonstrated by different authors. The aim of this review is to collect and present recent evidence from the literature regarding resveratrol and its effects on cancer prevention, molecular signaling (especially regarding the involvement of p53 protein, and therapeutic perspectives with an emphasis on clinical trial results to date.

  5. Identification of a p53-response element in the promoter of the proline oxidase gene

    International Nuclear Information System (INIS)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-01-01

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

  6. Expression of p53-regulated proteins in human cultured lymphoblastoid TSCE5 and WTK1 cell lines during spaceflight

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Suzuki, Hiromi; Shimazu, Toru; Omori, Katsunori; Ishioka, Noriaki; Ohnishi, Takeo; Seki, Masaya; Hashizume, Toko

    2012-01-01

    The aim of this study was to determine the biological effects of space radiations, microgravity, and the interaction of them on the expression of p53-regulated proteins. Space experiments were performed with two human cultured lymphoblastoid cell lines: one line (TSCE5) bears a wild-type p53 gene status, and another line (WTK1) bears a mutated p53 gene status. Under 1 gravity or microgravity conditions, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples were simultaneously cultured for 8 days in the CBEF on the ground for 8 days. After spaceflight, protein expression was analyzed using a Panorama TM Ab MicroArray protein chips. It was found that p53-dependent up-regulated proteins in response to space radiations and space environment were MeCP2 (methyl CpG binding protein 2), and Notch1 (Notch homolog 1), respectively. On the other hand, p53-dependent down-regulated proteins were TGF-β, TWEAKR (tumor necrosis factor-like weak inducer of apoptosis receptor), phosho-Pyk2 (Proline-rich tyrosine kinase 2), and 14-3-3θ/τ which were affected by microgravity, and DR4 (death receptor 4), PRMT1 (protein arginine methyltransferase 1) and ROCK-2 (Rho-associated, coiled-coil containing protein kinase 2) in response to space radiations. ROCK-2 was also suppressed in response to the space environment. The data provides the p53-dependent regulated proteins by exposure to space radiations and/or microgravity during spaceflight. Our expression data revealed proteins that might help to advance the basic space radiation biology. (author)

  7. Overexpression of p53, MDM2 proteins in some atr radiation-induced skin ulcers

    International Nuclear Information System (INIS)

    Gu Qingyang; Gao Yabing; Wang Dewen; Cui Yufang; Zhao Po; Yang Zhixiang; Zhou Jie

    2000-01-01

    An animal model of radiation-induced skin ulcer was set up with 140 rats, which were locally irradiated with 35-55 Gy γ-rays. The pathological changes were observed for 1 year. Immunohistochemical studies were performed in 72 rat radiation skin ulcer specimens using anti-p53 and anti-MDM2 proteins polyclonal antibodies. The results showed that the positive rate for overexpression of p53 protein was 9.7%, and for that of MDM2 was 19.4%. The overexpression of p53 was mainly seen in the nuclei of activated squamous epithelial cells, and in fibroblasts, endotheliocytes in deeper part of the skin ulcers. The overexpression of MDM2 had the same localizations. It is suggested that the changes of p53 and MDM2, genes and proteins, may be related to the cancer transformation and poor healing of radiation-induced skin ulcers

  8. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  9. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    Science.gov (United States)

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  10. Stress-specific response of the p53-Mdm2 feedback loop

    Directory of Open Access Journals (Sweden)

    Jensen Mogens H

    2010-07-01

    Full Text Available Abstract Background The p53 signalling pathway has hundreds of inputs and outputs. It can trigger cellular senescence, cell-cycle arrest and apoptosis in response to diverse stress conditions, including DNA damage, hypoxia and nutrient deprivation. Signals from all these inputs are channeled through a single node, the transcription factor p53. Yet, the pathway is flexible enough to produce different downstream gene expression patterns in response to different stresses. Results We construct a mathematical model of the negative feedback loop involving p53 and its inhibitor, Mdm2, at the core of this pathway, and use it to examine the effect of different stresses that trigger p53. In response to DNA damage, hypoxia, etc., the model exhibits a wide variety of specific output behaviour - steady states with low or high levels of p53 and Mdm2, as well as spiky oscillations with low or high average p53 levels. Conclusions We show that even a simple negative feedback loop is capable of exhibiting the kind of flexible stress-specific response observed in the p53 system. Further, our model provides a framework for predicting the differences in p53 response to different stresses and single nucleotide polymorphisms.

  11. No evidence for functional inactivation of wild-type p53 protein by MDM2 overexpression in gastric carcinogenesis

    NARCIS (Netherlands)

    Blok, P.; Craanen, M. E.; Dekker, W.; Offerhaus, G. J.; Tytgat, G. N.

    1998-01-01

    Inactivation of wild-type p53 during gastric carcinogenesis is usually caused by mutations within exons 5-8 of the p53 gene leading to mutated, usually immunohistochemically detectable p53 proteins. However, functional inactivation of wild-type p53, mimicking mutational inactivation, may also result

  12. Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.

    Science.gov (United States)

    Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M

    2009-10-01

    The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.

  13. Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

    Science.gov (United States)

    Zhou, Zhigang; Li, Yumin

    2009-10-01

    As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

  14. Genus beta human papillomavirus E6 proteins vary in their effects on the transactivation of p53 target genes.

    Science.gov (United States)

    White, Elizabeth A; Walther, Johanna; Javanbakht, Hassan; Howley, Peter M

    2014-08-01

    The genus beta human papillomaviruses (beta HPVs) cause cutaneous lesions and are thought to be involved in the initiation of some nonmelanoma skin cancers (NMSCs), particularly in patients with the genetic disorder epidermodysplasia verruciformis (EV). We have previously reported that at least two of the genus beta HPV E6 proteins bind to and/or increase the steady-state levels of p53 in squamous epithelial cells. This is in contrast to a well-characterized ability of the E6 proteins of cancer-associated HPVs of genus alpha HPV, which inactivate p53 by targeting its ubiquitin-mediated proteolysis. In this study, we have investigated the ability of genus beta E6 proteins from eight different HPV types to block the transactivation of p53 target genes following DNA damage. We find that the E6 proteins from diverse beta HPV species and types vary in their capacity to block the induction of MDM2, p21, and proapoptotic genes after genotoxic stress. We conclude that some genus beta HPV E6 proteins inhibit at least some p53 target genes, although perhaps not by the same mechanism or to the same degree as the high-risk genus alpha HPV E6 proteins. This study addresses the ability of various human papillomavirus E6 proteins to block the activation of p53-responsive cellular genes following DNA damage in human keratinocytes, the normal host cell for HPVs. The E6 proteins encoded by the high-risk, cancer-associated HPV types of genus alpha HPV have a well-established activity to target p53 degradation and thereby inhibit the response to DNA damage. In this study, we have investigated the ability of genus beta HPV E6 proteins from eight different HPV types to block the ability of p53 to transactivate downstream genes following DNA damage. We find that some, but not all, genus beta HPV E6 proteins can block the transactivation of some p53 target genes. This differential response to DNA damage furthers the understanding of cutaneous HPV biology and may help to explain the

  15. Phosphorylation Regulates the Bound Structure of an Intrinsically Disordered Protein: The p53-TAZ2 Case.

    Directory of Open Access Journals (Sweden)

    Raúl Esteban Ithuralde

    Full Text Available Disordered regions and Intrinsically Disordered Proteins (IDPs are involved in critical cellular processes and may acquire a stable three-dimensional structure only upon binding to their partners. IDPs may follow a folding-after-binding process, known as induced folding, or a folding-before-binding process, known as conformational selection. The transcription factor p53 is involved in the regulation of cellular events that arise upon stress or DNA damage. The p53 domain structure is composed of an N-terminal transactivation domain (p53TAD, a DNA Binding Domain and a tetramerization domain. The activity of TAD is tightly regulated by interactions with cofactors, inhibitors and phosphorylation. To initiate transcription, p53TAD binds to the TAZ2 domain of CBP, a co-transcription factor, and undergoes a folding and binding process, as revealed by the recent NMR structure of the complex. The activity of p53 is regulated by phosphorylation at multiple sites on the TAD domain and recent studies have shown that modifications at three residues affect the binding towards TAZ2. However, we still do not know how these phosphorylations affect the structure of the bound state and, therefore, how they regulate the p53 function. In this work, we have used computational simulations to understand how phosphorylation affects the structure of the p53TAD:TAZ2 complex and regulates the recognition mechanism. Phosphorylation has been proposed to enhance binding by direct interaction with the folded protein or by changing the unbound conformation of IDPs, for example by pre-folding the protein favoring the recognition mechanism. Here, we show an interesting turn in the p53 case: phosphorylation mainly affects the bound structure of p53TAD, highlighting the complexity of IDP protein-protein interactions. Our results are in agreement with previous experimental studies, allowing a clear picture of how p53 is regulated by phosphorylation and giving new insights into how

  16. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    Science.gov (United States)

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  17. Pre-irradiation at a low dose-rate blunted p53 response

    International Nuclear Information System (INIS)

    Takahashi, Akihisa

    2002-01-01

    We investigated whether chronic irradiation at a low dose-rate interferes with the p53-centered signal transduction pathyway induced by radiation in human cultured cells and C57BL/6N mice. In in vitro experiments, we found that a challenge with X-ray irradiation immediately after chronic irradiation resulted in lower levels of p53 than those observed after the challenge alone in glioblastoma cells (A-172). In addition, the levels of p53-centered apoptosis and its related proteins after the challenge were strongly correlated with the above-mentioned phenomena in squamous cell carcinoma cells (SAS/neo). In in vivo experiments, the accumulation of p53 and Bax, and the induction of apoptosis were observed dose-dependently in mouse spleen at 12 h after a challenge with X-rays (3.0 Gy). However, we found significant suppression of p53 and Bax accumulation and the induction of apoptosis 12 h after challenge irradiation at 3.0 Gy with a high doses-rate following chronic pre-irradiation (1.5 Gy, 0.001 Gy/min). These findings suggest that chronic pre-irradiation suppressed the p53 function through radiation-induced signaling and/or p53 stability. (author)

  18. p53 protein expression versus micronucleus induction as an indicator of DNA damage

    International Nuclear Information System (INIS)

    Hickman, A.W.; Carpenter, T.R.; Johnson, N.F.

    1994-01-01

    In vitro assays for detecting DNA damage play an important role in evaluating the possible adverse health effects of chemical compounds. Exposure to many DNA-damaging agents in vitro has been shown to cause elevated levels of the tumor-suppressor protein p53. Work in our laboratory has shown that induction of the p53 protein is useful as a biodosimeter for determining the radiation dose to cells. The purpose of this investigation was to compare the sensitivity of this assay to that of micronucleus induction, which is commonly used as a marker of radiation-induced damage

  19. Cytogenetic damage, oncogenic transformation and p53 induction in human epithelial cells in response to irradiation

    Science.gov (United States)

    Armitage, Mark

    Ionizing radiation can have several different effects on cells, some are almost instantaneous such as the generation of DNA damage, other cellular responses take a matter of minutes or hours - DNA repair protein induction/activation, and others may take months or even years to be manifested - carcinogenesis. Human epithelial cell lines derived from both normal, non-neoplastic tissues and from a malignant source were cultured in order to examine several effects of ionizing radiation on such cell types. Cells not from a malignant source were previously immortalized by viral infection or by transfection with viral sequences. Simian virus 40 immortalised uroepithelial cells (SV-HUC) were found to be approximately a factor of two fold more radioresistant than cells of malignant origin (T24) in terms of unrepaired clastogenic damage i.e. assessment of micronuclei levels following irradiation. SV-HUC lines unlike T24 cells are non-tumourigenic when inoculated into nude athymic mice. SV-HUC lines proved very resistant to full oncogenic transformation using radiation and chemical carcinogens. However, morphological alterations and decreased anchorage dependant growth was observed in post carcinogen treated cells after appropriate cell culture conditions were utilized. The progression from this phenotype to a fully tumourigenic one was not recorded in this study. The ability of ionizing radiation to induce increased levels of the nuclear phosphoprotein p53 was also assessed using several different cell lines. SV- HUC and T24 cell lines failed to exhibit any increased p53 stabilization following irradiation. One cell line, a human papilloma virus transformed line (HPV) did show an approximate two fold increase of the wild type p53 protein after treatment with radiation. Only the cell line HPV showed any cell cycle delay, resulting in accumulation of cells in the G2/M compartment in post irradiation cell cycle analysis. The status of p53 was also assessed i.e. wild type or

  20. Interaction between the Cockayne syndrome B and p53 proteins: implications for aging.

    Science.gov (United States)

    Frontini, Mattia; Proietti-De-Santis, Luca

    2012-02-01

    The CSB protein plays a role in the transcription coupled repair (TCR) branch of the nucleotide excision repair pathway. CSB is very often found mutated in Cockayne syndrome, a segmental progeroid genetic disease characterized by organ degeneration and growth failure. The tumor suppressor p53 plays a pivotal role in triggering senescence and apoptosis and suppressing tumorigenesis. Although p53 is very important to avoid cancer, its excessive activity can be detrimental for the lifespan of the organism. This is why a network of positive and negative feedback loops, which most likely evolved to fine-tune the activity of this tumor suppressor, modulate its induction and activation. Accordingly, an unbalanced p53 activity gives rise to premature aging or cancer. The physical interaction between CSB and p53 proteins has been known for more than a decade but, despite several hypotheses, nobody has been able to show the functional consequences of this interaction. In this review we resume recent advances towards a more comprehensive understanding of the critical role of this interaction in modulating p53’s levels and activity, therefore helping the system find a reasonable equilibrium between the beneficial and the detrimental effects of its activity. This crosstalk re-establishes the physiological balance towards cell proliferation and survival instead of towards cell death, after stressors of a broad nature. Accordingly, cells bearing mutations in the csb gene are unable to re-establish this physiological balance and to properly respond to some stress stimuli and undergo massive apoptosis.

  1. The Role of Tumor Protein 53 Mutations in Common Human Cancers and Targeting the Murine Double Minute 2–P53 Interaction for Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Tayebeh Hamzehloie

    2012-03-01

    Full Text Available The gene TP53 (also known as protein 53 or tumor protein 53, encoding transcription factor P53, is mutated or deleted in half of human cancers, demonstrating the crucial role of P53 in tumor suppression. There are reports of nearly 250 independent germ line TP53 mutations in over 100 publications. The P53 protein has the structure of a transcription factor and, is made up of several domains. The main function of P53 is to organize cell defense against cancerous transformation. P53 is a potent transcription factor that is activated in response to diverse stresses, leading to the induction of cell cycle arrest, apoptosis or senescence. The P53 tumor suppressor is negatively regulated in cells by the murine double minute 2 (MDM2 protein. Murine double minute 2 favors its nuclear export, and stimulates its degradation. Inhibitors of the P53-MDM2 interaction might be attractive new anticancer agents that could be used to activate wild-type P53 in tumors. Down regulation of MDM2 using an small interfering RNA (siRNA approach has recently provided evidence for a new role of MDM2 in the P53 response, by modulating the inhibition of the cyclin dependent kinase 2 (cdk2 by P21/WAF1 (also known as cyclin-dependent kinase inhibitor 1 or CDK-interacting protein 1.

  2. TGEV nucleocapsid protein induces cell cycle arrest and apoptosis through activation of p53 signaling

    International Nuclear Information System (INIS)

    Ding, Li; Huang, Yong; Du, Qian; Dong, Feng; Zhao, Xiaomin; Zhang, Wenlong; Xu, Xingang; Tong, Dewen

    2014-01-01

    Highlights: • TGEV N protein reduces cell viability by inducing cell cycle arrest and apoptosis. • TGEV N protein induces cell cycle arrest and apoptosis by regulating p53 signaling. • TGEV N protein plays important roles in TGEV-induced cell cycle arrest and apoptosis. - Abstract: Our previous studies showed that TGEV infection could induce cell cycle arrest and apoptosis via activation of p53 signaling in cultured host cells. However, it is unclear which viral gene causes these effects. In this study, we investigated the effects of TGEV nucleocapsid (N) protein on PK-15 cells. We found that TGEV N protein suppressed cell proliferation by causing cell cycle arrest at the S and G2/M phases and apoptosis. Characterization of various cellular proteins that are involved in regulating cell cycle progression demonstrated that the expression of N gene resulted in an accumulation of p53 and p21, which suppressed cyclin B1, cdc2 and cdk2 expression. Moreover, the expression of TGEV N gene promoted translocation of Bax to mitochondria, which in turn caused the release of cytochrome c, followed by activation of caspase-3, resulting in cell apoptosis in the transfected PK-15 cells following cell cycle arrest. Further studies showed that p53 inhibitor attenuated TGEV N protein induced cell cycle arrest at S and G2/M phases and apoptosis through reversing the expression changes of cdc2, cdk2 and cyclin B1 and the translocation changes of Bax and cytochrome c induced by TGEV N protein. Taken together, these results demonstrated that TGEV N protein might play an important role in TGEV infection-induced p53 activation and cell cycle arrest at the S and G2/M phases and apoptosis occurrence

  3. Pure versus combined Merkel cell carcinomas: immunohistochemical evaluation of cellular proteins (p53, Bcl-2, and c-kit) reveals significant overexpression of p53 in combined tumors.

    Science.gov (United States)

    Lai, Jonathan H; Fleming, Kirsten E; Ly, Thai Yen; Pasternak, Sylvia; Godlewski, Marek; Doucette, Steve; Walsh, Noreen M

    2015-09-01

    Merkel cell polyomavirus is of oncogenic significance in approximately 80% of Merkel cell carcinomas. Morphological subcategories of the tumor differ in regard to viral status, the rare combined type being uniformly virus negative and the predominant pure type being mainly virus positive. Indications that different biological subsets of the tumor exist led us to explore this diversity. In an Eastern Canadian cohort of cases (75 patients; mean age, 76 years [range, 43-91]; male/female ratio, 43:32; 51 [68%] pure and 24 [34%] combined tumors), we semiquantitatively compared the immunohistochemical expression of 3 cellular proteins (p53, Bcl-2, and c-kit) in pure versus combined groups. Viral status was known in a subset of cases. The significant overexpression of p53 in the combined group (mean [SD], 153.8 [117.8] versus 121.6 [77.9]; P = .01) and the increased epidermal expression of this protein (p53 patches) in the same group lend credence to a primary etiologic role for sun damage in these cases. Expression of Bcl-2 and c-kit did not differ significantly between the 2 morphological groups. A relative increase in c-kit expression was significantly associated with a virus-negative status (median [interquartile range], 100 [60-115] versus 70 [0-100]; P = .03). Emerging data reveal divergent biological pathways in Merkel cell carcinoma, each with a characteristic immunohistochemical profile. Virus-positive tumors (all pure) exhibit high retinoblastoma protein and low p53 expression, whereas virus-negative cases (few pure and all combined) show high p53 and relatively high c-kit expression. The potential biological implications of this dichotomy call for consistent stratification of these tumors in future studies. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry

    International Nuclear Information System (INIS)

    Cavalcanti, M.B.; Fernandes, T.S.; Melo, J.A.; Neves, M.A.B.; Machado, C.G.F

    2005-01-01

    Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10 6 /mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO 2 at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results obtained

  5. Study of p53 protein expression levels from irradiated peripheral blood lymphocytes for biodosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Cavalcanti, M.B.; Fernandes, T.S. [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil). Dept. de Energia Nuclear; Amaral, A. [Universite Paris XII (UPXII) (France); Melo, J.A. [Centro de Radioterapia de Pernambuco (CERAPE), PE (Brazil); Neves, M.A.B.; Machado, C.G.F, E-mail: maribrayner@yahoo.com.br [Fundacao de Hematologia e Hemoterapia de Pernambuco, PE (Brazil)

    2005-07-01

    Biodosimetry can be defined as the investigation of radioinduced biological effects in order to correlate them with the absorbed dose. Scoring of unstable chromosomal aberrations and micronuclei, from in vitro irradiated peripheral blood lymphocytes, is commonly used for biodosimetry based on cytogenetic analysis. However, this method of analysis is time-consuming, which may represent a pitfall when fast investigation of a possible exposure to ionizing radiation (IR) is needed. The interaction of IR with the living cell can cause injuries in the DNA molecules. However, normal cells possess mechanisms of repair that are capable to correct those damages. During the repair process of the DNA various proteins are expressed. Among these proteins, p53 plays an important role. This protein is a transcription factor that helps in the maintenance of the genomic integrity. p53 protein is found into the cytoplasm in reduced concentrations and has a short average life. However, expression of p53 protein can be induced by DNA harmful radioinduced, which increases the concentration and the average life of this protein, making possible its detection. Thus, the correlation between the increasing of p53 expression and the irradiation may constitute a fast and reliable method of individual monitoring in cases of accidental or suspected exposures to IR. In this context, the objective of this research was to evaluate the p53 protein expression levels from lymphocytes of the human peripheral blood after in vitro irradiation. For this, samples of peripheral blood from healthy individuals were irradiated with known doses. Lymphocytes were separated on ficoll gradient by centrifugation and re-suspended at 1x 10{sub 6}/mL in RPMI medium enriched with fetal calf serum. Hence, lymphocytes were incubated in 5% CO{sub 2} at 37 deg C prior to the methodology of flow cytometry, using intranuclear antigens for the quantification of p53. In this report, the methodology performed and the results

  6. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    Science.gov (United States)

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasmic reticulum (ER) protein that is shuttled to the ER via an N-terminal endoplasmic reticulum targeting signal. One important function of the ER is synthesis of neutral lipids that are packaged into lipid droplets whose biogenesis occurs from ER-derived membranes. DHRS3 is enriched at focal points of lipid droplet budding where it also localizes to the phospholipid monolayer of ER-derived lipid droplets. p53 promotes lipid droplet accumulation in a manner consistent with DHRS3 enrichment in the ER. As a p53 target gene, the observations of Dhrs3 location and potential function provide novel insight into an unexpected role for p53 in lipid droplet dynamics with implications in cancer cell metabolism and obesity. PMID:21659514

  7. Influence of anticancer drugs on interactions of tumor suppressor protein p53 with DNA

    Czech Academy of Sciences Publication Activity Database

    Pivoňková, Hana; Němcová, Kateřina; Brázdová, Marie; Kašpárková, Jana; Brabec, Viktor; Fojta, Miroslav

    2005-01-01

    Roč. 272, Suppl. 1 (2005), s. 562 ISSN 1474-3833. [FEBS Congress /30./ and IUBMB Conference /9./. 02.07.2005-07.07.2005, Budapest] R&D Projects: GA MZd(CZ) NC7574 Institutional research plan: CEZ:AV0Z50040507 Keywords : tumour suppressor protein p53 * anticancer drugs * interaction with DNA Subject RIV: BO - Biophysics

  8. Distinct Rayleigh scattering from hot spot mutant p53 proteins reveals cancer cells.

    Science.gov (United States)

    Jun, Ho Joon; Nguyen, Anh H; Kim, Yeul Hong; Park, Kyong Hwa; Kim, Doyoun; Kim, Kyeong Kyu; Sim, Sang Jun

    2014-07-23

    The scattering of light redirects and resonances when an electromagnetic wave interacts with electrons orbits in the hot spot core protein and oscillated electron of the gold nanoparticles (AuNP). This report demonstrates convincingly that resonant Rayleigh scattering generated from hot spot mutant p53 proteins is correspondence to cancer cells. Hot spot mutants have unique local electron density changes that affect specificity of DNA binding affinity compared with wild types. Rayleigh scattering changes introduced by hot-spot mutations were monitored by localized surface plasmon resonance (LSPR) shift changes. The LSPR λmax shift for hot-spot mutants ranged from 1.7 to 4.2 nm for mouse samples and from 0.64 nm to 2.66 nm for human samples, compared to 9.6 nm and 15 nm for wild type and mouse and human proteins, respectively with a detection sensitivity of p53 concentration at 17.9 nM. It is interesting that hot-spot mutants, which affect only interaction with DNA, launches affinitive changes as considerable as wild types. These changes propose that hot-spot mutants p53 proteins can be easily detected by local electron density alterations that disturbs the specificity of DNA binding of p53 core domain on the surface of the DNA probed-nanoplasmonic sensor. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. P53 status influences regulation of HSPs and ribosomal proteins by PDTC and radiation

    International Nuclear Information System (INIS)

    Thompson, John S.; Asmis, Reto; Glass, Judith; Liu Hua; Wilson, Colin; Nelson, Brandy; Brown, Stephen A.; Stromberg, Arnold J.

    2006-01-01

    Pyrrolidine dithiocarbamate (PDTC) is a thiol-containing compound that can act under varying conditions as an anti-oxidant or pro-oxidant. Utilizing microarrays, we determined the effect of PDTC +/- ionizing radiation (IR) on the expression of heat shock protein (HSP) genes in isolated B6/129 wild-type (WT) and p53-/- spleen cells. Extremely significant microarrays demonstrated that PDTC, but not IR, markedly up-regulated the expression of the majority of detectable HSP genes in WT and many to a significantly greater degree in p53-/- deficient cells. Determination of the glutathione/glutathione disulfide ratio indicated that PDTC was acting as a pro-oxidant under these conditions. From these data we conclude that the clinical use of 'antioxidants' with radiotherapy or chemotherapy must be very carefully based on knowledge of the p53 status of their intended normal and tumor target cells

  10. P53-dependent ceramide generation in response ro ionizing irradiation is caspase-dependent

    International Nuclear Information System (INIS)

    Dbaibo, G.; El-Assaad, W.

    2000-01-01

    Full text.We have previously reported that p53-dependent apoptosis is accompanied by ceramide accumulation. Lack of p53 prevents ceramide accumulation in response to induces such as ionizing irradiation. The mechanisms of ceramide accumulation have not been explored. P53 has been reported to function by inducing the death receptors Fas and DR5 both of which function by initiating a caspase cascade that results in apoptosis. We decided to examine the role of caspases in the elevation of cellular ceramide levels. We treated Molt-4 cells with 5Gy of ionizing irradiation and examined the effects of co-treatment with the general caspase inhibitor z-VAD-fmk at concentration of 50 and 100μM. We found that z-VAD blocked apoptosis induced by irradiation without interfering with p53 accumulation indicating that it was not functioning upstream of p53. However, z-VAD treatment resulted in a significant decrease in ceramide accumulation. Additionally, z-VAD partially blocked the loss of glutathione in response to irradiation. This was important since glutathione has been described as an inhibitor of neutral sphindomyelinase, a major source of cellular ceramide via sphingomyelin hydrolysis. These studies indicate that p53 induces ceramide accumulation in a caspase-dependent manner and that the regulation of cellular glutathione by caspases may be a mechanism by which they regulate ceramide accumulation

  11. Activation of SAT1 engages polyamine metabolism with p53-mediated ferroptotic responses.

    Science.gov (United States)

    Ou, Yang; Wang, Shang-Jui; Li, Dawei; Chu, Bo; Gu, Wei

    2016-11-01

    Although p53-mediated cell-cycle arrest, senescence, and apoptosis remain critical barriers to cancer development, the emerging role of p53 in cell metabolism, oxidative responses, and ferroptotic cell death has been a topic of great interest. Nevertheless, it is unclear how p53 orchestrates its activities in multiple metabolic pathways into tumor suppressive effects. Here, we identified the SAT1 (spermidine/spermine N 1 -acetyltransferase 1) gene as a transcription target of p53. SAT1 is a rate-limiting enzyme in polyamine catabolism critically involved in the conversion of spermidine and spermine back to putrescine. Surprisingly, we found that activation of SAT1 expression induces lipid peroxidation and sensitizes cells to undergo ferroptosis upon reactive oxygen species (ROS)-induced stress, which also leads to suppression of tumor growth in xenograft tumor models. Notably, SAT1 expression is down-regulated in human tumors, and CRISPR-cas9-mediated knockout of SAT1 expression partially abrogates p53-mediated ferroptosis. Moreover, SAT1 induction is correlated with the expression levels of arachidonate 15-lipoxygenase (ALOX15), and SAT1-induced ferroptosis is significantly abrogated in the presence of PD146176, a specific inhibitor of ALOX15. Thus, our findings uncover a metabolic target of p53 involved in ferroptotic cell death and provide insight into the regulation of polyamine metabolism and ferroptosis-mediated tumor suppression.

  12. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    International Nuclear Information System (INIS)

    Kousparou, Christina A; Yiacoumi, Efthymia; Deonarain, Mahendra P; Epenetos, Agamemnon A

    2012-01-01

    A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp) and wild-type, full-length p21 (Antp-p21). This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model) with differing p21 or p53 status. Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology

  13. Generation of a selectively cytotoxic fusion protein against p53 mutated cancers

    Directory of Open Access Journals (Sweden)

    Kousparou Christina A

    2012-08-01

    Full Text Available Abstract Background A significant number of cancers are caused by defects in p21 causing functional defects in p21 or p53 tumour-suppressor proteins. This has led to many therapeutic approaches including restoration by gene therapy with wild-type p53 or p21 using viral or liposomal vectors, which have toxicity or side-effect limitations. We set out to develop a safer, novel fusion protein which has the ability to reconstitute cancer cell lines with active p21 by protein transduction. Methods The fusion protein was produced from the cell-translocating peptide Antennapedia (Antp and wild-type, full-length p21 (Antp-p21. This was expressed and refolded from E. coli and tested on a variety of cell lines and tumours (in a BALB/c nude xenograft model with differing p21 or p53 status. Results Antp-p21 penetrated and killed cancer cells that do not express wild type p53 or p21. This included cells that were matched to cogenic parental cell lines. Antp-p21 killed cancer cells selectively that were malignant as a result of mutations or nuclear exclusion of the p53 and p21 genes and over-expression of MDM2. Non-specific toxicity was excluded by showing that Antp-p21 penetrated but did not kill p53- or p21- wild-type cells. Antp-p21 was not immunogenic in normal New Zealand White rabbits. Recombinant Antp peptide alone was not cytotoxic, showing that killing was due to the transduction of the p21 component of Antp-p21. Antp-p21 was shown to penetrate cancer cells engrafted in vivo and resulted in tumour eradication when administered with conventionally-used chemotherapeutic agents, which alone were unable to produce such an effect. Conclusions Antp-p21 may represent a new and promising targeted therapy for patients with p53-associated cancers supporting the concept that rational design of therapies directed against specific cancer mutations will play a part in the future of medical oncology.

  14. Electrochemical sensing of tumor suppressor protein p53-deoxyribonucleic acid complex stability at an electrified interface

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil; Černocká, Hana; Ostatná, Veronika; Navrátilová, Lucie; Brázdová, Marie

    2014-01-01

    Roč. 828, MAY2014 (2014), s. 1-8 ISSN 0003-2670 R&D Projects: GA ČR(CZ) GAP301/11/2055; GA ČR(CZ) GA13-00956S; GA ČR(CZ) GA13-36108S Institutional support: RVO:68081707 Keywords : Deoxyribonucleic acid-protein binding * Tumor suppressor protein p53 * Electrochemical sensing Subject RIV: BO - Biophysics Impact factor: 4.513, year: 2014

  15. Immunohistochemical positive stained p53 protein in bladder transitional cell carcinoma

    Directory of Open Access Journals (Sweden)

    Halimi Monireh

    2009-04-01

    Full Text Available Background: Molecular genetics and immunopathologic analysis of bladder cancer have shown some abnormalities in a number of genes and proteins that have been implicated in the development and progression of such tumors, mainly in the p53 pathway. Aims: To investigate the rate of positively stained p53 protein in patients with urothelial papillary carcinoma of the bladder (UCB by immunohistochemistry and its relationship with tumor grade, gender and age of the patients. Settings and Design: During the present cross-sectional study, 100 paraffin-embedded specimens of UCB, which were provided from biopsies of the bladder by transurethral access, were immunohistochemically stained and studied for p53 protein from May 2006 to May 2007 in our referral center pathology laboratory. Materials and Methods: First, 4 µm slices of paraffin sections were provided and then stained by the avidin-biotin peroxidase method. The rate of positively stained p53 protein (defined as positive nuclear staining in over 10% of the cells was assessed. This rate was also estimated and compared between grades, genders and age-related groups (< 70 years, ≥70 years. Statistical Analysis: The χ2 , Fisher′s exact test and Mann-Whitney U test were used for comparing. Results: The overall rate of positively stained specimens was 11% for nuclear p53 protein. This rate was significantly higher in females (10/29 vs. 1/71; P < 0.001; odds ratio [OR]: 0.23; 95% confidence interval [CI]: 4.43-306.08, patients with 70 or older than 70 years (8/42 vs. 3/58; P = 0.04; OR: 0.55; 95% CI: 1.07-17.39 and in high-grade tumors (10/58 vs. 1/42; P = 0.02; OR: 0.59; 95% CI: 0.01-0.95. Conclusions: The rate of positively stained p53 protein for UCB was lower in our population. This rate was also higher in females, patients with 70 or older than 70 years and high grade of UCB.

  16. The combined status of ATM and p53 link tumor development with therapeutic response

    DEFF Research Database (Denmark)

    Jiang, Hai; Reinhardt, H Christian; Bartkova, Jirina

    2009-01-01

    commonly used by tumors to bypass early neoplastic checkpoints ultimately determine chemotherapeutic response and generate tumor-specific vulnerabilities that can be exploited with targeted therapies. Specifically, evaluation of the combined status of ATM and p53, two commonly mutated tumor suppressor...... genes, can help to predict the clinical response to genotoxic chemotherapies. We show that in p53-deficient settings, suppression of ATM dramatically sensitizes tumors to DNA-damaging chemotherapy, whereas, conversely, in the presence of functional p53, suppression of ATM or its downstream target Chk2...... actually protects tumors from being killed by genotoxic agents. Furthermore, ATM-deficient cancer cells display strong nononcogene addiction to DNA-PKcs for survival after DNA damage, such that suppression of DNA-PKcs in vivo resensitizes inherently chemoresistant ATM-deficient tumors to genotoxic...

  17. Drosophila UTX coordinates with p53 to regulate ku80 expression in response to DNA damage.

    Directory of Open Access Journals (Sweden)

    Chengwan Zhang

    Full Text Available UTX is known as a general factor that activates gene transcription during development. Here, we demonstrate an additional essential role of UTX in the DNA damage response, in which it upregulates the expression of ku80 in Drosophila, both in cultured cells and in third instar larvae. We further showed that UTX mediates the expression of ku80 by the demethylation of H3K27me3 at the ku80 promoter upon exposure to ionizing radiation (IR in a p53-dependent manner. UTX interacts physically with p53, and both UTX and p53 are recruited to the ku80 promoter following IR exposure in an interdependent manner. In contrast, the loss of utx has little impact on the expression of ku70, mre11, hid and reaper, suggesting the specific regulation of ku80 expression by UTX. Thus, our findings further elucidate the molecular function of UTX.

  18. Narrowband image and the p53 protein immunoexpression in patients with ulcerative colitis and dysplasia

    International Nuclear Information System (INIS)

    Chao González, Lissette

    2012-01-01

    Patients with pancolitis and long-standing ulcerative colitis are at increased risk of developing colorectal cancer, so it is advisable to colonoscopic surveillance. The objective of this study was to identify the endoscopic visualization system of imaging with narrowband and overexpression of the p53 protein as procedures useful for the research of Dysplasia in patients with ulcerative colitis and pancolitis, of eight or more years of evolution. A prospective, descriptive study was performed on 50 patients. The Fisher exact probability test was used for the statistical study and of square Chi, with a level of significance α = 0.05. Shown with narrow-band image increases the likelihood of finding suggestive areas of Dysplasia, reduces the amount of biopsy and gets a higher proportion of diagnoses of Dysplasia in fewer samples (70.4%). The overexpression of the p53 protein was associated with the presence of dysplasia (80.0%) p < 0.001 and is immunoexpress in samples with a high degree of severity of dysplasia and the low grade. Concluded that imaging with narrowband system and overexpression of the p53 protein are procedures useful for the research of Dysplasia in these patients. (author)

  19. p53 protein expression in corneal squamous cell carcinomas of dogs

    Directory of Open Access Journals (Sweden)

    Lucas Bahdour Cossi

    2015-06-01

    Full Text Available Ocular tumors play an increasing concern in veterinary ophthalmology. Corneal squamous cell carcinoma is unfrequent in dogs, and by this way it has little studies. Studies that investigated the carcinogenesis mechanisms wich could help to the development of ocular squamous cell carcinoma (SCC in dog are rare. The aim of this work was to identify by immunohistochemical techniques, the p53 protein expression in the spontaneous dog corneal SCC. For this work, were used five cases of corneal SCC and one case of actinic keratitis. The sections were obtained from paraffin-wax blocks and submitted to histopathological and immunohistochemical analysis. All the six samples showed immunolabeling to cytokeratin and p53 protein. These results support the conclusions that the immunoreactivity of p53 protein by immunohistochemistry is present in canine corneal SCC suppporting its role in carcinogenesis of this tumor, but not provides prognostic indicators in cases of SCC corneal in dog; and can be a association of exposure to solar radiation with the possible mutation of the TP53 gene.

  20. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    Science.gov (United States)

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Evaluation of Ki-67 Antigen and Protein P53 Expression in Orthokratinized and Parakratinized Odontogenic Keratocyst

    Directory of Open Access Journals (Sweden)

    F. Baghaei

    2004-06-01

    Full Text Available Statement of Problem: Odontogenic Keratocysts (OKC make up 10-12% of all developmental cysts with dental origin. OKCs are classified into parakeratotic and orthokeratotic types, with completely different clinical features. In order to investigate biological behavior of OKCs, an immunohistochemical study was designed, using Ki-67 antigen as proliferation marker and P53 protein as tumor suppressor gene.Purposes: The aim of the present study was to investigate the expression of P53 and Ki-67 markers in two types of OKCs and to determine their relationship with the biological behaviour of OKC.Materials and Methods: A total of 20 OKCs (parakeratotic n=10, orthokeratotic n=10were stained immunohistochemically for Ki-67 and P53 protein by Biotin – Streptavidine method. Then, slides were studied quantitatively through optical lense (magnification=X10and the number of positively stained cells was counted/mm BM.Results: The average number of Positively stained cells for Ki-67 were 62.30±11.96 cells/mm BM in parakeratotic, and 29.90±4.90 cells/mmBM in orthokeratotic OKCs (P<0.05. Positive cells for Ki-67 were dominantly located in parabasal layer. Mean stainedcells for P53 were 4.30± 2.21cells/mmBM in parakeratinized and 4.80±1.75 cells/mmBM in orthokeratotic types that was not statistically significant. (P<0.58Parakeratotic OKCs mostly occur in the lower jaw (90%, whereas just 50% of orthokeratotic OKCs occur in mandible (P=0.05Conclusion: Regarding other clinical features and the existence of daughter cysts, no significant statistical difference was found between two types of OKCs.

  2. Mutant p53 - heat shock response oncogenic cooperation: a new mechanism of cancer cell survival

    Directory of Open Access Journals (Sweden)

    Evguenia eAlexandrova

    2015-04-01

    Full Text Available The main tumor suppressor function of p53 as a ‘guardian of the genome’ is to respond to cellular stress by transcriptional activation of apoptosis, growth arrest or senescence in damaged cells. Not surprisingly, mutations in the p53 gene are the most frequent genetic alteration in human cancers. Importantly, mutant p53 (mutp53 proteins not only lose their wild-type tumor suppressor activity, but also can actively promote tumor development. Two main mechanisms accounting for mutp53 proto-oncogenic activity are inhibition of the wild-type p53 in a dominant-negative fashion and gain of additional oncogenic activities known as gain-of-function (GOF. Here we discuss a novel mechanism of mutp53 GOF, which relies on its oncogenic cooperation with the heat shock machinery. This coordinated adaptive mechanism renders cancer cells more resistant to proteotoxic stress and provides both, a strong survival advantage to cancer cells and a promising means for therapeutic intervention.

  3. Disposable Amperometric Immunosensor for the Determination of Human P53 Protein in Cell Lysates Using Magnetic Micro-Carriers

    Directory of Open Access Journals (Sweden)

    María Pedrero

    2016-11-01

    Full Text Available An amperometric magnetoimmunosensor for the determination of human p53 protein is described in this work using a sandwich configuration involving the covalent immobilization of a specific capture antibody onto activated carboxylic-modified magnetic beads (HOOC-MBs and incubation of the modified MBs with a mixture of the target protein and horseradish peroxidase-labeled antibody (HRP-anti-p53. The resulting modified MBs are captured by a magnet placed under the surface of a disposable carbon screen-printed electrode (SPCE and the amperometric responses are measured at −0.20 V (vs. an Ag pseudo-reference electrode, upon addition of hydroquinone (HQ as a redox mediator and H2O2 as the enzyme substrate. The magnetoimmunosensing platform was successfully applied for the detection of p53 protein in different cell lysates without any matrix effect after a simple sample dilution. The results correlated accurately with those provided by a commercial ELISA kit, thus confirming the immunosensor as an attractive alternative for rapid and simple determination of this protein using portable and affordable instrumentation.

  4. P53 and heat shock protein 70 expressions in colorectal adenocarcinoma

    International Nuclear Information System (INIS)

    Shotar, Ali M.

    2005-01-01

    To examine the localization and over expression of heat shock protein 70 (HSP70) and p53 in patients with colorectal cancer and compared it with control tissue (including normal colon tissue). This was a retrospective study of 60 patients with colorectal adenocarcinoma at the Jordan University of Science and Technology (JUST), Irbid, Jordan from 1997 to 2000. The Pathology Department at JUST is the chief provider of surgical pathology services in the north of Jordan. It receives specimens from both government and private hospitals. Immunohistochemistry was the technique of choice. The HSP70 was over expressed more highly in colorectal cancers than in the control tissue. Immuno-histochemistry showed that over expression of HSP70 had no statistically significant difference with any of the different prognostic factors assessed, mainly the grade and the stage. The p53 was over expressed in 60% of the cases. Control tissue (normal colon) was negative, p53, cell-cycle-related oncogene product, was strongly over expressed in the nuclei of the cancer cells of the cancer tissue. We found no significant difference in terms of size, patient age, lymph node state, and stage. The rate of expression was significantly less in high grade tumors than in intermediate and low grade ones. The strong expression however, may be valuable in estimating a prognosis for patients with colo-rectal carcinoma. (author)

  5. The p53 serology is predictive of the response to the pre surgery radio chemotherapy in the oesophagus cancers

    International Nuclear Information System (INIS)

    Metges, J.P.; Giroux, M.A.; Volant, A.; Morin, J.F.; Malhaire, J.P.; Gouerou, H.; Ferec, C.; Robaskiewicz, M.; Labat, J.P.

    1997-01-01

    The mutations of the TP 53 and MTS1 (p16) gene have been described in numerous neoplasms but their relation with a response to the treatment is still little described. The aim of this work was to evaluate the value of the p53 status(serology, immunohistochemistry and molecular biology) and of the MTS1 gene( protein p16) for the response to the pre surgery radio chemotherapy in a troop of patients suffering from esophagus epidermoid cancer. The p53 serology is positive in 40% of cases and is statistically associated to a bad response. The lost of alleles for MTS1 has been found in 20% of cases but non predictive to the response. A prospective study would be interesting. (N.C.)

  6. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Ginkel, Paul R. van; Yan, Michael B. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Bhattacharya, Saswati [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Pediatrics, University of Wisconsin, Madison, WI 53792 (United States); Polans, Arthur S., E-mail: aspolans@wisc.edu [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Kenealey, Jason D. [UW Carbone Cancer Center, University of Wisconsin, Madison, WI 53792 (United States); Department of Ophthalmology and Visual Sciences, University of Wisconsin, Madison, WI 53792 (United States); Department of Nutrition, Dietetics and Food Science, Brigham Young University, Provo, UT 84602 (United States)

    2015-11-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP{sub 3} pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca{sup 2+}-dependent pro-apoptotic pathways inhibit cancer cell growth.

  7. Natural products induce a G protein-mediated calcium pathway activating p53 in cancer cells

    International Nuclear Information System (INIS)

    Ginkel, Paul R. van; Yan, Michael B.; Bhattacharya, Saswati; Polans, Arthur S.; Kenealey, Jason D.

    2015-01-01

    Paclitaxel, etoposide, vincristine and doxorubicin are examples of natural products being used as chemotherapeutics but with adverse side effects that limit their therapeutic window. Natural products derived from plants and having low toxicity, such as quercetin, resveratrol, epigallocatechin gallate and piceatannol, have been shown to inhibit tumor cell growth both in vitro and in pre-clinical models of cancer, but their mechanisms of action have not been fully elucidated, thus restricting their use as prototypes for developing synthetic analogs with improved anti-cancer properties. We and others have demonstrated that one of the earliest and consistent events upon exposure of tumor cells to these less toxic natural products is a rise in cytoplasmic calcium, activating several pro-apoptotic pathways. We describe here a G protein/inositol 1,4,5-trisphosphate pathway (InsP3) in MDA-MB-231 human breast cancer cells that mediates between these less toxic natural products and the release of calcium from the endoplasmic reticulum. Further, we demonstrate that this elevation of intracellular calcium modulates p53 activity and the subsequent transcription of several pro-apoptotic genes encoding PIG8, CD95, PIDD, TP53INP, RRM2B, Noxa, p21 and PUMA. We conclude from our findings that less toxic natural products likely bind to a G protein coupled receptor that activates a G protein-mediated and calcium-dependent pathway resulting selectively in tumor cell death. - Highlights: • Natural products having low toxicity increase cytoplasmic calcium in cancer cells. • A G-protein/IP 3 pathway mediates the release of calcium from the ER. • The elevation of intracellular calcium modulates p53 activity. • p53 and other Ca 2+ -dependent pro-apoptotic pathways inhibit cancer cell growth.

  8. P53 tumor suppressor gene and protein expression is altered in cell lines derived from spontaneous and alpha-radiation-induced canine lung tumors

    International Nuclear Information System (INIS)

    Tierney, L.A.; Johnson, N.F.; Lechner, J.F.

    1994-01-01

    Mutations in the p53 tumor suppressor gene are the most frequently occurring gene alterations in malignant human cancers, including lung cancer. In lung cancer, common point mutations within conserved exons of the p53 gene result in a stabilized form of mutant protein which is detectable in most cases by immunohistochemistry. In addition to point mutations, allelic loss, rearrangements, and deletions of the p53 gene have also been detected in both human and rodent tumors. It has been suggested that for at least some epithelial neoplasms, the loss of expression of wild-type p53 protein may be more important for malignant transformation than the acquisition of activating mutations. Mechanisms responsible for the loss of expression of wild-type protein include gene deletion or rearrangement, nonsense or stop mutations, mutations within introns or upstream regulatory regions of the gene, and accelerated rates of degradation of the protein by DNA viral oncoproteins

  9. Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

    Science.gov (United States)

    Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

    2006-04-01

    p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

  10. Arecoline-induced phosphorylated p53 and p21(WAF1) protein expression is dependent on ATM/ATR and phosphatidylinositol-3-kinase in clone-9 cells.

    Science.gov (United States)

    Chou, Wen-Wen; Guh, Jinn-Yuh; Tsai, Jung-Fa; Hwang, Chi-Ching; Chiou, Shean-Jaw; Chuang, Lea-Yea

    2009-06-01

    Betel-quid use is associated with liver cancer whereas its constituent arecoline is cytotoxic, genotoxic, and induces p53-dependent p21(WAF1) protein expression in Clone-9 cells (rat hepatocytes). The ataxia telangiectasia mutated (ATM)/rad3-related (ATR)-p53-p21(WAF1) and the phosphatidylinositol-3-kinase (PI3K)-mammalian target of rapamycin (mTOR) pathways are involved in the DNA damage response and the pathogenesis of cancers. Thus, we studied the role of ATM/ATR and PI3K in arecoline-induced p53 and p21(WAF1) protein expression in Clone-9 cells. We found that arecoline (0.5 mM) activated the ATM/ATR kinase at 30 min. The arecoline-activated ATM/ATR substrate contained p-p53Ser15. Moreover, arecoline only increased the levels of the p-p53Ser6, p-p53Ser15, and p-p53Ser392 phosphorylated p53 isoforms among the known isoforms. ATM shRNA attenuated arecoline-induced p-p53Ser15 and p21(WAF1) at 24 h. Arecoline (0.5 mM) increased phosphorylation levels of p-AktSer473 and p-mTORSer2448 at 30-60 min. Dominant-negative PI3K plasmids attenuated arecoline-induced p21(WAF1), but not p-p53Ser15, at 24 h. Rapamycin attenuated arecoline-induced phosphrylated p-p53Ser15, but not p21(WAF1), at 24 h. ATM shRNA, but not dominant-negative PI3K plasmids, attenuated arecoline-induced p21(WAF1) gene transcription. We conclude that arecoline activates the ATM/ATR-p53-p21(WAF1) and the PI3K/Akt-mTOR-p53 pathways in Clone-9 cells. Arecoline-induced phosphorylated p-p53Ser15 expression is dependent on ATM whereas arecoline-induced p21(WAF1) protein expression is dependent on ATM and PI3K. Moreover, p21(WAF1) gene is transcriptionally induced by arecoline-activated ATM. (c) 2009 Wiley-Liss, Inc.

  11. The absence of Ser389 phosphorylation in p53 affects the basal gene expression level of many p53-dependent genes and alters the biphasic response to UV exposure in mouse embryonic fibroblasts

    NARCIS (Netherlands)

    Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.

    2008-01-01

    Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the

  12. p53- and ERK7-dependent ribosome surveillance response regulates Drosophila insulin-like peptide secretion.

    Directory of Open Access Journals (Sweden)

    Kiran Hasygar

    2014-11-01

    Full Text Available Insulin-like signalling is a conserved mechanism that coordinates animal growth and metabolism with nutrient status. In Drosophila, insulin-producing median neurosecretory cells (IPCs regulate larval growth by secreting insulin-like peptides (dILPs in a diet-dependent manner. Previous studies have shown that nutrition affects dILP secretion through humoral signals derived from the fat body. Here we uncover a novel mechanism that operates cell autonomously in the IPCs to regulate dILP secretion. We observed that impairment of ribosome biogenesis specifically in the IPCs strongly inhibits dILP secretion, which consequently leads to reduced body size and a delay in larval development. This response is dependent on p53, a known surveillance factor for ribosome biogenesis. A downstream effector of this growth inhibitory response is an atypical MAP kinase ERK7 (ERK8/MAPK15, which is upregulated in the IPCs following impaired ribosome biogenesis as well as starvation. We show that ERK7 is sufficient and essential to inhibit dILP secretion upon impaired ribosome biogenesis, and it acts epistatically to p53. Moreover, we provide evidence that p53 and ERK7 contribute to the inhibition of dILP secretion upon starvation. Thus, we conclude that a cell autonomous ribosome surveillance response, which leads to upregulation of ERK7, inhibits dILP secretion to impede tissue growth under limiting dietary conditions.

  13. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    Science.gov (United States)

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  14. p53 and telomerase control rat myocardial tissue response to hypoxia and ageing

    Directory of Open Access Journals (Sweden)

    A. Cataldi

    2009-12-01

    Full Text Available Cellular senescence implies loss of proliferative and tissue regenerative capability. Also hypoxia, producing Reactive Oxygen Species (ROS, can damage cellular components through the oxidation of DNA, proteins and lipids, thus influencing the shortening of telomeres. Since ribonucleoprotein Telomerase (TERT, catalyzing the replication of the ends of eukaryotic chromosomes, promotes cardiac muscle cell proliferation, hypertrophy and survival, here we investigated its role in the events regulating apoptosis occurrence and life span in hearts deriving from young and old rats exposed to hypoxia. TUNEL (terminal-deoxinucleotidyl -transferase- mediated dUTP nick end-labeling analysis reveals an increased apoptotic cell number in both samples after hypoxia exposure, mainly in the young with respect to the old. TERT expression lowers either in the hypoxic young, either in the old in both experimental conditions, with respect to the normoxic young. These events are paralleled by p53 and HIF-1 ? expression dramatic increase and by p53/ HIF-1 ? co-immunoprecipitation in the hypoxic young, evidencing the young subject as the most stressed by such challenge. These effects could be explained by induction of damage to genomic DNA by ROS that accelerates cell senescence through p53 activation. Moreover, by preventing TERT enzyme down-regulation, cell cycle exit and apoptosis occurrence could be delayed and new possibilities for intervention against cell ageing and hypoxia could be opened.

  15. Understanding the role of p53 in adaptive response to radiation-induced germline mutations

    International Nuclear Information System (INIS)

    Langlois, N.L.; Quinn, J.S.; Somers, C.M.; Boreham, D.R.; Mitchel, R.E.J.

    2003-01-01

    Full text: Radiation-induced adaptive response is now a widely studied area of radiation biology. Studies have demonstrated reduced levels of radiation-induced biological damage when an 'adaptive dose' is given before a higher 'challenge dose' compared to when the challenge dose is given alone. It has been shown in some systems to be a result of inducible cellular repair systems. The adaptive response has been clearly demonstrated in many model systems, however its impact on heritable effects in the mammalian germline has never been studied. Expanded Simple Tandem Repeat (ESTR) loci have been used as markers demonstrating that induced heritable mutations in mice follow a dose-response relationship. Recent data in our laboratory show preliminary evidence of radiation-induced adaptive response suppressing germline mutations at ESTR loci in wild type mice. The frequency of heritable mutations was significantly reduced when a priming dose of 0.1 Gy was given 24 hours prior to a 1 Gy acute challenging dose. We are now conducting a follow-up study to attempt to understand the mechanism of this adaptive response. P53 is known to play a significant role in governing apoptosis, DNA repair and cancer induction. In order to determine what function p53 has in the adaptive response for heritable mutations, we have mated radiation treated Trp53+/- male mice (C57Bl) to untreated, normal females (C57Bl). Using DNA fingerprinting, we are investigating the rate of inherited radiation-induced mutations on pre- and post-meiotic radiation-treated gametocytes by examining mutation frequencies in offspring DNA. If p53 is integral in the mechanism of adaptive response, we should not see an adaptive response in radiation-induced heritable mutations in these mice. This research is significant in that it will provide insight to understanding the mechanism behind radiation-induced adaptive response in the mammalian germline

  16. Association of p53 protein expression with clinical outcome in advanced supraglottic cancer

    International Nuclear Information System (INIS)

    Kang, Jin Oh; Hong, Seong Eon

    1998-01-01

    To determine the incidence and prognostic effect of p53 expression in patients with advanced supraglottic cancer. Twenty-one cases of total 48 advanced supraglottic cancer patients who received postoperative adjuvant radiation therapy were evaluated by immunohistochemical staining employing p53 monoclonal antibody. Three out of six stage III patients and four out of fifteen stage IV patients showed p53 expression without statistically significant difference (p=0.608). Five year survival rates are 93% in p53 negative, 86% in p53 positive patients and there was no significant difference(p=0.776). p53 expression does not show statistically significant correlation with primary tumor status(p=0.877), lymph node status(p=0.874) and age(p=0.64). There was no statistically significant correlation between traditionally known risk factors and p53 expression

  17. Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins

    International Nuclear Information System (INIS)

    Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg

    2006-01-01

    Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro

  18. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    Science.gov (United States)

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  19. Immunohistochemical Expression of P53 Protein in Cutaneous Basal Cell Carcinoma: A Clinicopathological Study of 66 Cases

    Directory of Open Access Journals (Sweden)

    Vladim and iacute;r Barto and scaron;

    2016-12-01

    Full Text Available Objective: Nuclear expression of p53 protein is associated with a biological behavior in a variety of human malignancies. In cutaneous basal cell carcinoma (BCC, however, many studies have provided conflicting results in this regard. We aimed to determine whether there is relationship between p53 expression and different histologic subtypes of BCC, and whether it may indicate tumor aggressiveness. Materials and Methods: Biopsy samples from 66 cutaneous BCCs from 57 patients were collected. P53 expression was demonstrated by immunohistochemical staining using the anti-p53 antibody. Among them, 52 cases were also evaluated for Ki-67 antigen. Results: Immunoreactivity of p53 protein varied in the range of 0 to 100% of total tumor tissue (mean value 46.0%. The expression exceeding 5% of cancer tissue (positive staining was found in 54 BCCs (81.8%. Within this group, there were 25 cases (37.9% with low and 29 cases (43.9% with high expression. In superficial, superficial-nodular, nodular, nodular-infiltrative and infiltrative BCCs, p53 protein positivity was found in 100% (8/8, 80% (8/10, 70.4% (19/27, 88.2% (15/17 and 100% (4/4, respectively. We did not reveal a significant correlation between the extent of p53 protein expression and BCC subtypes except for nodular BCC, in which a number of negative cases (8/27, 29.6% were just above the threshold of statistical significance (P = 0.04. After merging cancers into non-aggressive and aggressive growth phenotype, no association with expression of p53 protein was found. There was no relationship between p53 protein expression and topographical sites after they have been gathered into sun-exposed and sun-protected locations. We did not observe any association between expression of p53 protein and Ki-67 antigen. Conclusion: In cutaneous BCC, the expression of p53 protein does not seem to reflect a biological behavior and tumor aggressiveness. Therefore, in a routine dermatopathological practice

  20. Reactivating p53 and Inducing Tumor Apoptosis (RITA Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin

    Directory of Open Access Journals (Sweden)

    Armin Wiegering

    2017-04-01

    Full Text Available Colorectal carcinoma (CRC is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n = 9 including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n = 5 with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC50< 3.0 μmol/l were identified within established (4/9 and primary patient-derived (2/5 CRC cell lines harboring wild-type or mutant p53 protein. Sensitivity to RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number

  1. p53 functions as a cell cycle control protein in osteosarcomas.

    OpenAIRE

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfect...

  2. ATF4 induction through an atypical integrated stress response to ONC201 triggers p53-independent apoptosis in hematological malignancies.

    Science.gov (United States)

    Ishizawa, Jo; Kojima, Kensuke; Chachad, Dhruv; Ruvolo, Peter; Ruvolo, Vivian; Jacamo, Rodrigo O; Borthakur, Gautam; Mu, Hong; Zeng, Zhihong; Tabe, Yoko; Allen, Joshua E; Wang, Zhiqiang; Ma, Wencai; Lee, Hans C; Orlowski, Robert; Sarbassov, Dos D; Lorenzi, Philip L; Huang, Xuelin; Neelapu, Sattva S; McDonnell, Timothy; Miranda, Roberto N; Wang, Michael; Kantarjian, Hagop; Konopleva, Marina; Davis, R Eric; Andreeff, Michael

    2016-02-16

    The clinical challenge posed by p53 abnormalities in hematological malignancies requires therapeutic strategies other than standard genotoxic chemotherapies. ONC201 is a first-in-class small molecule that activates p53-independent apoptosis, has a benign safety profile, and is in early clinical trials. We found that ONC201 caused p53-independent apoptosis and cell cycle arrest in cell lines and in mantle cell lymphoma (MCL) and acute myeloid leukemia (AML) samples from patients; these included samples from patients with genetic abnormalities associated with poor prognosis or cells that had developed resistance to the nongenotoxic agents ibrutinib and bortezomib. Moreover, ONC201 caused apoptosis in stem and progenitor AML cells and abrogated the engraftment of leukemic stem cells in mice while sparing normal bone marrow cells. ONC201 caused changes in gene expression similar to those caused by the unfolded protein response (UPR) and integrated stress responses (ISRs), which increase the translation of the transcription factor ATF4 through an increase in the phosphorylation of the translation initiation factor eIF2α. However, unlike the UPR and ISR, the increase in ATF4 abundance in ONC201-treated hematopoietic cells promoted apoptosis and did not depend on increased phosphorylation of eIF2α. ONC201 also inhibited mammalian target of rapamycin complex 1 (mTORC1) signaling, likely through ATF4-mediated induction of the mTORC1 inhibitor DDIT4. Overexpression of BCL-2 protected against ONC201-induced apoptosis, and the combination of ONC201 and the BCL-2 antagonist ABT-199 synergistically increased apoptosis. Thus, our results suggest that by inducing an atypical ISR and p53-independent apoptosis, ONC201 has clinical potential in hematological malignancies. Copyright © 2016, American Association for the Advancement of Science.

  3. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    Science.gov (United States)

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  4. The nucleolus as a fundamental regulator of the p53 response and a new target for cancer therapy.

    Science.gov (United States)

    Woods, Simone J; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D

    2015-07-01

    Recent studies have highlighted the fundamental role that key oncogenes such as MYC, RAS and PI3K occupy in driving RNA Polymerase I transcription in the nucleolus. In addition to maintaining essential levels of protein synthesis, hyperactivated ribosome biogenesis and nucleolar function plays a central role in suppressing p53 activation in response to oncogenic stress. Consequently, disruption of ribosome biogenesis by agents such as the small molecule inhibitor of RNA Polymerase I transcription, CX-5461, has shown unexpected, potent, and selective effects in killing tumour cells via disruption of nucleolar function leading to activation of p53, independent of DNA damage. This review will explore the mechanism of DNA damage-independent activation of p53 via the nucleolar surveillance pathway and how this can be utilised to design novel cancer therapies. Non-genotoxic targeting of nucleolar function may provide a new paradigm for treatment of a broad range of oncogene-driven malignancies with improved therapeutic windows. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Significant difference in p53 and p21 protein immunoreactivity in HPV 16 positive and HPV negative breast carcinomas

    International Nuclear Information System (INIS)

    Hennig, E.M.; Norwegian Radium Hospital, Oslo; Kvinnsland, S.; Holm, R.; Nesland, J.M.

    1999-01-01

    Human papillomavirus (HPV) 16 has previously been found in 19/41 breast carcinomas (46%) in women with a history of HPV 16 positive CIN III lesions. There was no significant difference in distribution of histological subtypes, mean or median tumour diameter or number of regional lymph node metastases in the HPV positive and HPV negative breast carcinoma groups. P53, p21 and c-erbB-2 proteins were analyzed by immunohistochemistry in the HPV 16 positive and HPV negative breast carcinomas. There was a significant difference in p53 and p21 protein immunoreactivity between HPV 16 positive and HPV negative breast carcinomas (p=0.0091 and p=0.0040), with a significant less detectable p53 and p21 protein immunoreactivity in the HPV 16 positive cases. There was also a significant difference in the coexpression of p53/p21 between the HPV 16 positive and HPV 16 negative breast carcinomas (p=0.002). No significant difference in immunostaining for c-erbB-2 protein in the two groups was found (p=0.15), or for the coexpression of p53/c-erbB-2 (p=0.19). The significantly lower expression of p53 and p21 proteins in HPV 16 positive than in HPV 16 negative breast carcinomas supports the hypothesis of inactivation and degradation of wild-type p53 proteins by HPV 16 E6 and that p53 mutation is not necessary for transformation in the HPV 16 positive cases. (orig.)

  6. Sirtuin 7 promotes cellular survival following genomic stress by attenuation of DNA damage, SAPK activation and p53 response

    Energy Technology Data Exchange (ETDEWEB)

    Kiran, Shashi; Oddi, Vineesha [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Ramakrishna, Gayatri, E-mail: gayatrirama1@gmail.com [Laboratory of Cancer Biology, Centre for DNA Fingerprinting and Diagnostics, Hyderabad, Telangana, 500001 (India); Laboratory of Cancer Cell Biology, Department of Research, Institute of Liver and Biliary Sciences, Delhi 110070 (India)

    2015-02-01

    Maintaining the genomic integrity is a constant challenge in proliferating cells. Amongst various proteins involved in this process, Sirtuins play a key role in DNA damage repair mechanisms in yeast as well as mammals. In the present work we report the role of one of the least explored Sirtuin viz., SIRT7, under conditions of genomic stress when treated with doxorubicin. Knockdown of SIRT7 sensitized osteosarcoma (U2OS) cells to DNA damage induced cell death by doxorubicin. SIRT7 overexpression in NIH3T3 delayed cell cycle progression by causing delay in G1 to S transition. SIRT7 overexpressing cells when treated with low dose of doxorubicin (0.25 µM) showed delayed onset of senescence, lesser accumulation of DNA damage marker γH2AX and lowered levels of growth arrest markers viz., p53 and p21 when compared to doxorubicin treated control GFP expressing cells. Resistance to DNA damage following SIRT7 overexpression was also evident by EdU incorporation studies where cellular growth arrest was significantly delayed. When treated with higher dose of doxorubicin (>1 µM), SIRT7 conferred resistance to apoptosis by attenuating stress activated kinases (SAPK viz., p38 and JNK) and p53 response thereby shifting the cellular fate towards senescence. Interestingly, relocalization of SIRT7 from nucleolus to nucleoplasm together with its co-localization with SAPK was an important feature associated with DNA damage. SIRT7 mediated resistance to doxorubicin induced apoptosis and senescence was lost when p53 level was restored by nutlin treatment. Overall, we propose SIRT7 attenuates DNA damage, SAPK activation and p53 response thereby promoting cellular survival under conditions of genomic stress. - Highlights: • Knockdown of SIRT7 sensitized cells to DNA damage induced apoptosis. • SIRT7 delayed onset of premature senescence by attenuating DNA damage response. • Overexpression of SIRT7 delayed cell cycle progression by delaying G1/S transition. • Upon DNA damage SIRT

  7. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  8. p53 functions as a cell cycle control protein in osteosarcomas.

    Science.gov (United States)

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  9. A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

    Science.gov (United States)

    Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

    2018-05-23

    PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

  10. Magnetic Particle-Based Immunoassay of Phosphorylated p53 Using Protein-Cage Templated Lead Phosphate and Carbon Nanospheres for Signal Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Aiqiong; Bao, Yuanwu; Ge, Xiaoxiao; Shin, Yongsoon; Du, Dan; Lin, Yuehe

    2012-11-20

    Phosphorylated p53 at serin 15 (phospho-p53-15) is a potential biomarker of Gamma-radiation exposure. In this paper, we described a new magnetic particles (MPs)-based electrochemical immunoassay of human phospho-p53-15 using carbon nanospheres (CNS) and protein-cage templated lead phosphate nanoparticles for signal amplification. Greatly enhanced sensitivity was achieved by three aspects: 1) The protein-cage nanoparticle (PCN) and p53-15 signal antibody (p53-15 Ab2) are linked to CNS (PCNof each apoferritin; 3) MPs capture a large amount of primary antibodies. Using apoferritin templated metallic phosphate instead of enzyme as label has the advantage of eliminating the addition of mediator or immunoreagents and thus makes the immunoassay system simpler. The subsequent stripping voltammetric analysis of the released lead ions were detected on a disposable screen printed electrode. The response current was proportional to the phospho-p53-15 concentration in the range of 0.02 to 20 ng mL-1 with detection limit of 0.01 ng mL-1. This method shows a good stability, reproducibility and recovery.

  11. HER-2, p53, p21 and hormonal receptors proteins expression as predictive factors of response and prognosis in locally advanced breast cancer treated with neoadjuvant docetaxel plus epirubicin combination

    International Nuclear Information System (INIS)

    Tiezzi, Daniel G; Andrade, Jurandyr M; Ribeiro-Silva, Alfredo; Zola, Fábio E; Marana, Heitor RC; Tiezzi, Marcelo G

    2007-01-01

    Neoadjuvant chemotherapy has been considered the standard care in locally advanced breast cancer. However, about 20% of the patients do not benefit from this clinical treatment and, predictive factors of response were not defined yet. This study was designed to evaluate the importance of biological markers to predict response and prognosis in stage II and III breast cancer patients treated with taxane and anthracycline combination as neoadjuvant setting. Sixty patients received preoperative docetaxel (75 mg/m 2 ) in combination with epirubicin (50 mg/m 2 ) in i.v. infusion in D1 every 3 weeks after incisional biopsy. They received adjuvant chemotherapy with CMF or FEC, attaining axillary status following definitive breast surgery. Clinical and pathologic response rates were measured after preoperative therapy. We evaluated the response rate to neoadjuvant chemotherapy and the prognostic significance of clinicopathological and immunohistochemical parameters (ER, PR, p51, p21 and HER-2 protein expression). The median patient age was 50.5 years with a median follow up time 48 months after the time of diagnosis. Preoperative treatment achieved clinical response in 76.6% of patients and complete pathologic response in 5%. The clinical, pathological and immunohistochemical parameters were not able to predict response to therapy and, only HER2 protein overexpression was associated with a decrease in disease free and overall survival (P = 0.0007 and P = 0.003) as shown by multivariate analysis. Immunohistochemical phenotypes were not able to predict response to neoadjuvant chemotherapy. Clinical response is inversely correlated with a risk of death in patients submitted to neoadjuvant chemotherapy and HER2 overexpression is the major prognostic factor in stage II and III breast cancer patients treated with a neoadjuvant docetaxel and epirubicin combination

  12. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    OpenAIRE

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus la...

  13. Reactivating p53 and Inducing Tumor Apoptosis (RITA) Enhances the Response of RITA-Sensitive Colorectal Cancer Cells to Chemotherapeutic Agents 5-Fluorouracil and Oxaliplatin.

    Science.gov (United States)

    Wiegering, Armin; Matthes, Niels; Mühling, Bettina; Koospal, Monika; Quenzer, Anne; Peter, Stephanie; Germer, Christoph-Thomas; Linnebacher, Michael; Otto, Christoph

    2017-04-01

    Colorectal carcinoma (CRC) is the most common cancer of the gastrointestinal tract with frequently dysregulated intracellular signaling pathways, including p53 signaling. The mainstay of chemotherapy treatment of CRC is 5-fluorouracil (5FU) and oxaliplatin. The two anticancer drugs mediate their therapeutic effect via DNA damage-triggered signaling. The small molecule reactivating p53 and inducing tumor apoptosis (RITA) is described as an activator of wild-type and reactivator of mutant p53 function, resulting in elevated levels of p53 protein, cell growth arrest, and cell death. Additionally, it has been shown that RITA can induce DNA damage signaling. It is expected that the therapeutic benefits of 5FU and oxaliplatin can be increased by enhancing DNA damage signaling pathways. Therefore, we highlighted the antiproliferative response of RITA alone and in combination with 5FU or oxaliplatin in human CRC cells. A panel of long-term established CRC cell lines (n=9) including p53 wild-type, p53 mutant, and p53 null and primary patient-derived, low-passage cell lines (n=5) with different p53 protein status were used for this study. A substantial number of CRC cells with pronounced sensitivity to RITA (IC 50 RITA appeared independent of p53 status and was associated with an increase in antiproliferative response to 5FU and oxaliplatin, a transcriptional increase of p53 targets p21 and NOXA, and a decrease in MYC mRNA. The effect of RITA as an inducer of DNA damage was shown by a strong elevation of phosphorylated histone variant H2A.X, which was restricted to RITA-sensitive cells. Our data underline the primary effect of RITA, inducing DNA damage, and demonstrate the differential antiproliferative effect of RITA to CRC cells independent of p53 protein status. We found a substantial number of RITA-sensitive CRC cells within both panels of established CRC cell lines and primary patient-derived CRC cell lines (6/14) that provide a rationale for combining RITA with 5FU or

  14. The expression of p53 protein in patients with multiple myeloma

    Directory of Open Access Journals (Sweden)

    Marković Olivera

    2007-01-01

    Full Text Available Introduction: Although mutations of p53 are one of the most often acquired genetic changes in malignant tumors, these mutations are rare events in patients with newly diagnosed multiple myeloma (MM. Moreover, there are a few literature data about clinical significance of p53 overexpression in multiple myeloma. Objective The aim of our study was to evaluate the clinical significance of p53 immunoexpression in multiple myeloma. Method A total of 58 patients with newly diagnosed MM (26 females and 32 males, mean age 62 years were enrolled in the study. The diagnosis of MM was made according to criteria of Chronic Leukemia-Myeloma Task Force. Clinical staging was done according to Durie and Salmon classification (4 patients had disease stage I, 15 patients stage II and 39 patients stage III. The histological grade and histological stage were determined according to predominant plasma cell morphology and volume of myeloma infiltration, respectively. Standard immunohistochemical analysis with p53 antibody in B5-fixed and paraffin- embedded bone marrow specimens was used to evaluate the expression of p53 in myeloma cells. The specimens were considered positive when ≥5% of plasma cells exhibited clear nuclear positivity. Results Out of 58 patients, p53 expression was detected in 9 (15.52%. No significant correlation was found between p53 expression and clinical stage (I+II vs. III, Я2-microglobulin level (≤6 mg/L vs. >6mg/L, histological grade (I vs. II+III, histological stage (<20% vs. 21-50% vs. >50% and the extent of osteolytic lesions (≤3 vs. >3 lesions. Median survival of patients with p53 immunoreactivity in =>5% of plasma cells was 10 months, whilst median survival of patients with p53 immunoreactivity in <5% of plasma cells was 36 months. However, such difference was not significant (p=0.2. Conclusion The frequency of p53 immunoexpression in our group of newly diagnosed MM was relatively low. Although p53 immunoexpression was not

  15. ATR-p53 restricts homologous recombination in response to replicative stress but does not limit DNA interstrand crosslink repair in lung cancer cells.

    Directory of Open Access Journals (Sweden)

    Bianca M Sirbu

    Full Text Available Homologous recombination (HR is required for the restart of collapsed DNA replication forks and error-free repair of DNA double-strand breaks (DSB. However, unscheduled or hyperactive HR may lead to genomic instability and promote cancer development. The cellular factors that restrict HR processes in mammalian cells are only beginning to be elucidated. The tumor suppressor p53 has been implicated in the suppression of HR though it has remained unclear why p53, as the guardian of the genome, would impair an error-free repair process. Here, we show for the first time that p53 downregulates foci formation of the RAD51 recombinase in response to replicative stress in H1299 lung cancer cells in a manner that is independent of its role as a transcription factor. We find that this downregulation of HR is not only completely dependent on the binding site of p53 with replication protein A but also the ATR/ATM serine 15 phosphorylation site. Genetic analysis suggests that ATR but not ATM kinase modulates p53's function in HR. The suppression of HR by p53 can be bypassed under experimental conditions that cause DSB either directly or indirectly, in line with p53's role as a guardian of the genome. As a result, transactivation-inactive p53 does not compromise the resistance of H1299 cells to the interstrand crosslinking agent mitomycin C. Altogether, our data support a model in which p53 plays an anti-recombinogenic role in the ATR-dependent mammalian replication checkpoint but does not impair a cell's ability to use HR for the removal of DSB induced by cytotoxic agents.

  16. [Expression of Ki-67 and P53 protein in oral squamous cell carcinoma and its clinical significance].

    Science.gov (United States)

    He, Wei; Xiao, Yan; Chen, Wei-min

    2015-04-01

    To investigate the clinical and pathological features and its relationship with the expression of Ki-67 and p53 protein in oral squamous cell carcinoma. Immunohistochemical SP staining method was used to quantify the protein expression levels of Ki-67 and p53 protein in 10 cases of normal oral mucosa, 16 cases of oral leukoplakia (OLK) tissue, and 48 cases of oral squamous cell carcinoma. The relationship of the expression of Ki-67 and p53 protein to clinical and pathological data was analyzed, and SPSS17.0 software package was used for statistical analysis. The positive expression rate of Ki-67 protein in normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma was 30%, 56.3% and 79.2%, respectively; The positive expression rate of p53 was 0%, 43.8%, and 70.8%, respectively; Ki-67 and p53 expression had significant difference among normal oral mucosa, oral leukoplakia and oral squamous cell carcinoma (Poral squamous cell carcinoma (Poral squamous cell carcinoma tissues may play an important role in the development of oral squamous cell carcinoma.

  17. The expressions of P53 protein and proliferating cell nuclear antigen in specimens by CT-guidance percutaneous lung biopsy

    International Nuclear Information System (INIS)

    Zhuang Yiping; Shen Zongli; Zhang Jin; Kang Zheng; Zhu Yueqing; Feng Yong; Shen Wenrong; Wang Yaping

    2004-01-01

    Objective: To evaluate relations between lung cancer and the expressions of P53 protein together with proliferating cell nuclear antigen (PCNA) in specimens of lung lesions by needle biopsy. Methods: CT-guidance percutaneous biopsy of lung lesions were performed in 66 patients with the determination of expressions of p53 protein and PCNA by flow cytometer (FCM). Results: 1. The sensitivity of CT-guidance percutaneous biopsy was 94.3% in 53 cases of lung cancer with the diagnostic accuracy of 90.9% totally. The complication rate of pneumothorax was 4.6%. 2. The expression of P53 protein was (29.9 ± 2.7)% in lung cancer (53 cases), while (17.9 ± 2.8)% in benign lesions (13 cases) (t=2.0, P 2 =6.10, P 2 =9.71, P 0.05). Conclusions: FCM plays and valuable role in determining the expression of P53 protein and PCNA in the specimen of lung cancer by CT-guided percutaneous biopsy. The expression of p53 and PCNA may be useful in the diagnosis of lung cancer by providing the relation between imaging of lung cancer and the molecular mechanism, and furthermore revealing the characteristics of molecular biology of lung cancer at protein level. (authors)

  18. Degradation of p53 by human Alphapapillomavirus E6 proteins shows a stronger correlation with phylogeny than oncogenicity.

    Directory of Open Access Journals (Sweden)

    Leiping Fu

    2010-09-01

    Full Text Available Human Papillomavirus (HPV E6 induced p53 degradation is thought to be an essential activity by which high-risk human Alphapapillomaviruses (alpha-HPVs contribute to cervical cancer development. However, most of our understanding is derived from the comparison of HPV16 and HPV11. These two viruses are relatively distinct viruses, making the extrapolation of these results difficult. In the present study, we expand the tested strains (types to include members of all known HPV species groups within the Alphapapillomavirus genus.We report the biochemical activity of E6 proteins from 27 HPV types representing all alpha-HPV species groups to degrade p53 in human cells. Expression of E6 from all HPV types epidemiologically classified as group 1 carcinogens significantly reduced p53 levels. However, several types not associated with cancer (e.g., HPV53, HPV70 and HPV71 were equally active in degrading p53. HPV types within species groups alpha 5, 6, 7, 9 and 11 share a most recent common ancestor (MRCA and all contain E6 ORFs that degrade p53. A unique exception, HPV71 E6 ORF that degraded p53 was outside this clade and is one of the most prevalent HPV types infecting the cervix in a population-based study of 10,000 women. Alignment of E6 ORFs identified an amino acid site that was highly correlated with the biochemical ability to degrade p53. Alteration of this amino acid in HPV71 E6 abrogated its ability to degrade p53, while alteration of this site in HPV71-related HPV90 and HPV106 E6s enhanced their capacity to degrade p53.These data suggest that the alpha-HPV E6 proteins' ability to degrade p53 is an evolved phenotype inherited from a most recent common ancestor of the high-risk species that does not always segregate with carcinogenicity. In addition, we identified an amino-acid residue strongly correlated with viral p53 degrading potential.

  19. p53 and PCNA expression in advanced colorectal cancer: response to chemotherapy and long-term prognosis.

    Science.gov (United States)

    Paradiso, A; Rabinovich, M; Vallejo, C; Machiavelli, M; Romero, A; Perez, J; Lacava, J; Cuevas, M A; Rodriquez, R; Leone, B; Sapia, M G; Simone, G; De Lena, M

    1996-12-20

    In a series of 71 patients with advanced colorectal cancer treated with biochemically modulated 5-fluorouracil (5-FU) and methotrexate (MTX), we investigated the relationship between the proliferating-cell nuclear antigen (PCNA) (PC10) and p53 (Pab1801) primary-tumor immunohistochemical expression with respect to clinical response and long-term prognosis. Nuclear p53 expression was demonstrated in 44% of samples (any number of positive tumor cells) while all tumors showed a certain degree of PCNA immunostaining. PCNA immunostaining was correlated with histopathologic grade and p53 expression, while p53 was not correlated with any of the parameters considered. The probability of clinical response to biochemically modulated 5-FU was independent of p53 and PCNA expression. p53 expression (all cut-off values) was not associated with short- or long-term clinical prognosis, whereas patients with higher PCNA primary-tumor expression showed longer survival from treatment and survival from diagnosis, according to univariate and multivariate analysis, particularly in the sub-set of colon-cancer patients. We conclude that the clinical response of advanced-colorectal-cancer patients to biochemically modulated 5-FU and MTX cannot be predicted by PCNA and p53 primary-tumor expression, but high PCNA expression appears to be independently related to long-term prognosis.

  20. Apoptosis and cell proliferation in the development of gastric carcinomas: associations with c-myc and p53 protein expression.

    Science.gov (United States)

    Ishii, Hideaki H; Gobé, Glenda C; Pan, Wenshen; Yoneyama, Juichi; Ebihara, Yoshiro

    2002-09-01

    Patients with gastric carcinomas have a poor prognosis and low survival rates. The aim of the present paper was to characterize cellular and molecular properties to provide insight into aspects of tumor progression in early compared with advanced gastric cancers. One hundred and nine graded gastric carcinomas (early or advanced stage, undifferentiated or differentiated type) with paired non-cancer tissue were studied to define the correlation between apoptosis (morphology, terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labeling), cell proliferation (Ki-67 expression, morphology) and expression and localization of two proteins frequently having altered expression in cancers, namely p53 and c-myc. Overall, apoptosis was lower in early stage, differentiated and undifferentiated gastric carcinomas compared with advanced-stage cancers. Cell proliferation was comparatively high in all stages. There was a high level of p53 positivity in all stages. Only the early- and advanced-stage undifferentiated cancers that were p53 positive had a significantly higher level of apoptosis (P cancers that had either c-myc or p53-positivity. The results indicate that low apoptosis and high cell proliferation combine to drive gastric cancer development. The molecular controls for high cell proliferation of the early stage undifferentiated gastric cancers involve overexpression of both p53 and c-myc. Overexpression of p53 may also control cancer development in that its expression is associated with higher levels of apoptosis in early and late-stage undifferentiated, cancers. Copyright 2002 Blackwell Publishing Asia Pty Ltd

  1. Predictive effect of p53 and p21 alteration on chemotherapy response and survival in locally advanced adenocarcinoma of the esophagus

    NARCIS (Netherlands)

    Heeren, PAM; Kloppenberg, FWH; Hollema, H; Mulder, NH; Nap, RE; Plukker, JTM

    2004-01-01

    Background: Cell cycle regulating proteins (p53/p21) and proliferation index Ki-67 have been associated with prognosis and response to chemotherapy. The aim of this study was to determine the significance of these molecular markers on tumor response and prognostic effect in a group of esophageal

  2. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    Energy Technology Data Exchange (ETDEWEB)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Monti, Paola; Fronza, Gilberto [Mutagenesis Unit, Istituto di Ricerca e Cura a Carattere Scientifico Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, 16132 Genoa (Italy); Pereira, Clara [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal); Saraiva, Lucília, E-mail: lucilia.saraiva@ff.up.pt [REQUIMTE, Laboratório de Microbiologia, Departamento de Ciências Biológicas, Faculdade de Farmácia, Universidade do Porto, Rua de Jorge Viterbo Ferreira n. 164, 4050-313 Porto (Portugal)

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73.

  3. Studying p53 family proteins in yeast: Induction of autophagic cell death and modulation by interactors and small molecules

    International Nuclear Information System (INIS)

    Leão, Mariana; Gomes, Sara; Bessa, Cláudia; Soares, Joana; Raimundo, Liliana; Monti, Paola; Fronza, Gilberto; Pereira, Clara; Saraiva, Lucília

    2015-01-01

    In this work, the yeast Saccharomyces cerevisiae was used to individually study human p53, p63 (full length and truncated forms) and p73. Using this cell system, the effect of these proteins on cell proliferation and death, and the influence of MDM2 and MDMX on their activities were analyzed. When expressed in yeast, wild-type p53, TAp63, ΔNp63 and TAp73 induced growth inhibition associated with S-phase cell cycle arrest. This growth inhibition was accompanied by reactive oxygen species production and autophagic cell death. Furthermore, they stimulated rapamycin-induced autophagy. On the contrary, none of the tested p53 family members induced apoptosis either per se or after apoptotic stimuli. As previously reported for p53, also TAp63, ΔNp63 and TAp73 increased actin expression levels and its depolarization, suggesting that ACT1 is also a p63 and p73 putative yeast target gene. Additionally, MDM2 and MDMX inhibited the activity of all tested p53 family members in yeast, although the effect was weaker on TAp63. Moreover, Nutlin-3a and SJ-172550 were identified as potential inhibitors of the p73 interaction with MDM2 and MDMX, respectively. Altogether, the yeast-based assays herein developed can be envisaged as a simplified cell system to study the involvement of p53 family members in autophagy, the modulation of their activities by specific interactors (MDM2 and MDMX), and the potential of new small molecules to modulate these interactions. - Highlights: • p53, p63 and p73 are individually studied in the yeast S. cerevisiae. • p53 family members induce ROS production, cell cycle arrest and autophagy in yeast. • p53 family members increase actin depolarization and expression levels in yeast. • MDM2 and MDMX inhibit the activity of p53 family members in yeast. • Yeast can be a useful tool to study the biology and drugability of p53, p63 and p73

  4. P53 Protein Expression in Dental Follicle, Dentigerous Cyst, Odontogenic Keratocyst, and Inflammatory Subtypes of Cysts: An Immunohistochemical Study.

    Science.gov (United States)

    Fatemeh, Mashhadiabbas; Sepideh, Arab; Sara, Bagheri Seyedeh; Nazanin, Mahdavi

    2017-05-01

    An odontogenic keratocyst (OKC) is a developmental odontogenic cyst with aggressive clinical behavior. This cyst shows a different growth mechanism from the more common dentigerous cyst and now has been renamed as a keratocystic odontogenic tumor (KCOT). Inflammation can assist tumor growth via different mechanisms including dysregulation of the p53 gene. This study aims to assess and compare the expression of tumor suppressor gene p53 in inflamed and non-inflamed types of OKC and dentigerous cyst. Immunohistochemical expression of p53 was assessed in 14 cases of dental follicle, 34 cases of OKC (including 18 inflamed OKCs), and 31 cases of dentigerous cyst (including 16 inflamed cysts). The mean percentage of p53 positive cells was 0.7% in dental follicles, 5.4% in non-inflamed OKCs, 17.3% in inflamed OKCs, 1.2% in non-inflamed dentigerous cysts, and 2.2% in inflamed dentigerous cysts. The differences between the groups were statistically significant ( p < 0.050) except for the difference between inflamed and non-inflamed dentigerous cysts, and between dental follicle and non-inflamed dentigerous cyst. The difference in p53 expression in OKC and dentigerous cyst can explain their different growth mechanism and clinical behavior. Inflammation is responsible for the change in behavior of neoplastic epithelium of OKC via p53 overexpression.

  5. P53 Protein Expression in Dental Follicle, Dentigerous Cyst, Odontogenic Keratocyst, and Inflammatory Subtypes of Cysts: An Immunohistochemical Study

    Directory of Open Access Journals (Sweden)

    Mashhadiabbas Fatemeh

    2017-05-01

    Full Text Available Objectives: An odontogenic keratocyst (OKC is a developmental odontogenic cyst with aggressive clinical behavior. This cyst shows a different growth mechanism from the more common dentigerous cyst and now has been renamed as a keratocystic odontogenic tumor (KCOT. Inflammation can assist tumor growth via different mechanisms including dysregulation of the p53 gene. This study aims to assess and compare the expression of tumor suppressor gene p53 in inflamed and non-inflamed types of OKC and dentigerous cyst. Methods: Immunohistochemical expression of p53 was assessed in 14 cases of dental follicle, 34 cases of OKC (including 18 inflamed OKCs, and 31 cases of dentigerous cyst (including 16 inflamed cysts. Results: The mean percentage of p53 positive cells was 0.7% in dental follicles, 5.4% in non-inflamed OKCs, 17.3% in inflamed OKCs, 1.2% in non-inflamed dentigerous cysts, and 2.2% in inflamed dentigerous cysts. The differences between the groups were statistically significant (p < 0.050 except for the difference between inflamed and non-inflamed dentigerous cysts, and between dental follicle and non-inflamed dentigerous cyst. Conclusions: The difference in p53 expression in OKC and dentigerous cyst can explain their different growth mechanism and clinical behavior. Inflammation is responsible for the change in behavior of neoplastic epithelium of OKC via p53 overexpression.

  6. p53-inducible DHRS3 Is an Endoplasmic Reticulum Protein Associated with Lipid Droplet Accumulation*

    OpenAIRE

    Deisenroth, Chad; Itahana, Yoko; Tollini, Laura; Jin, Aiwen; Zhang, Yanping

    2011-01-01

    The transcription factor p53 plays a critical role in maintaining homeostasis as it relates to cellular growth, proliferation, and metabolism. In an effort to identify novel p53 target genes, a microarray approach was utilized to identify DHRS3 (also known as retSDR1) as a robust candidate gene. DHRS3 is a highly conserved member of the short chain alcohol dehydrogenase/reductase superfamily with a reported role in lipid and retinoid metabolism. Here, we demonstrate that DHRS3 is an endoplasm...

  7. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

    International Nuclear Information System (INIS)

    Abe, Yasuhito; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Ogasawara, Masahito; Shigemoto, Kazuhiro; Kito, Katsumi

    2006-01-01

    PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK

  8. p53/Surviving Ratio as a Parameter for Chemotherapy Induction Response in Children with Acute Myeloid Leukemia

    Directory of Open Access Journals (Sweden)

    Rinaldi Lenggana

    2016-11-01

    Full Text Available Acute myeloid leukemia (AML is a malignancy that is often found in children. Many studies into the failure of apoptosis function, or programmed cell death, is one of the most important regulatory mechanisms of cellular hemostasis which is closely linked to the development of cancer, are important. Also, regulation of the apoptotic (p53 and anti-apoptotic (surviving proteins influence treatment outcome. One role of p53 is to monitor cellular stress necessary to induce apoptosis. Surviving (BIRC5 is a group of proteins in the apoptosis inhibitor which works by inhibiting caspase-3. The role of surviving is considered very important in oncogenesis proliferation and cell growth regulation. Chemotherapy in childhood AML can inhibit cell growth and induce slowing as well as stopping the cell cycle. Thus, the aim of this study was to compare p53 and surviving before and after receiving induction chemotherapy in children with AML and also to determine the p53/surviving ratio. Peripheral blood mononuclear cells were collected from AML children before treatment and three months after starting their induction therapy. p53 and surviving were measured by flowcytometry using monoclonal antibodies. Data were analyzed by t-test for comparison between groups and Spearman’s test to find out the correlation between variables with a significant value of p < 0.05. A total of 8 children were evaluated. The intensity of p53 expression was not significantly increased after induction phase chemotherapy (p = 0.224, but surviving expression and the ratio of p53/surviving were significantly increased in the treatment group compared with the levels prior to chemotherapy (p = 0.002, p = 0.034, and there was a strong negative correlation between p53 and surviving after chemotherapy (r = −0.63, p = 0.049.

  9. Radiosensitivity profiles from a panel of ovarian cancer cell lines exhibiting genetic alterations in p53 and disparate DNA-dependent protein kinase activities

    Energy Technology Data Exchange (ETDEWEB)

    Langland, Gregory T.; Yannone, Steven M.; Langland, Rachel A.; Nakao, Aki; Guan, Yinghui; Long, Sydney B.T.; Vonguyen, Lien; Chen, David J.; Gray, Joe W; Chen, Fanqing

    2009-09-07

    The variability of radiation responses in ovarian tumors and tumor-derived cell lines is poorly understood. Since both DNA repair capacity and p53 status can significantly alter radiation sensitivity, we evaluated these factors along with radiation sensitivity in a panel of sporadic human ovarian carcinoma cell lines. We observed a gradation of radiation sensitivity among these sixteen lines, with a five-fold difference in the LD50 between the most radiosensitive and the most radioresistant cells. The DNA-dependent protein kinase (DNA-PK) is essential for the repair of radiation induced DNA double-strand breaks in human somatic cells. Therefore, we measured gene copy number, expression levels, protein abundance, genomic copy and kinase activity for DNA-PK in all of our cell lines. While there were detectable differences in DNA-PK between the cell lines, there was no clear correlation with any of these differences and radiation sensitivity. In contrast, p53 function as determined by two independent methods, correlated well with radiation sensitivity, indicating p53 mutant ovarian cancer cells are typically radioresistant relative to p53 wild-type lines. These data suggest that the activity of regulatory molecules such as p53 may be better indicators of radiation sensitivity than DNA repair enzymes such as DNAPK in ovarian cancer.

  10. Inhibitor of apoptosis-stimulating protein of p53 (iASPP is required for neuronal survival after axonal injury.

    Directory of Open Access Journals (Sweden)

    Ariel M Wilson

    Full Text Available The transcription factor p53 mediates the apoptosis of post-mitotic neurons exposed to a wide range of stress stimuli. The apoptotic activity of p53 is tightly regulated by the apoptosis-stimulating proteins of p53 (ASPP family members: ASPP1, ASPP2 and iASPP. We previously showed that the pro-apoptotic members ASPP1 and ASPP2 contribute to p53-dependent death of retinal ganglion cells (RGCs. However, the role of the p53 inhibitor iASPP in the central nervous system (CNS remains to be elucidated. To address this, we asked whether iASPP contributes to the survival of RGCs in an in vivo model of acute optic nerve damage. We demonstrate that iASPP is expressed by injured RGCs and that iASPP phosphorylation at serine residues, which increase iASPP affinity towards p53, is significantly reduced following axotomy. We show that short interference RNA (siRNA-induced iASPP knockdown exacerbates RGC death, whereas adeno-associated virus (AAV-mediated iASPP expression promotes RGC survival. Importantly, our data also demonstrate that increasing iASPP expression in RGCs downregulates p53 activity and blocks the expression of pro-apoptotic targets PUMA and Fas/CD95. This study demonstrates a novel role for iASPP in the survival of RGCs, and provides further evidence of the importance of the ASPP family in the regulation of neuronal loss after axonal injury.

  11. Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

    Science.gov (United States)

    Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

    2014-06-10

    The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

  12. The effect of CTB on P53 protein acetylation and consequence apoptosis on MCF-7 and MRC-5 cell lines

    Directory of Open Access Journals (Sweden)

    Mehdi Nikbakht Dastjerdi

    2013-01-01

    Conclusion: CTB could induce acetylation of P53 protein through increasing expression of P300 and consequently induce the significant cell death in MCF-7 but it could be well tolerated in MRC-5. Therefore, CTB could be used as an anti-cancer agent.

  13. Expression of p53 protein in Barrett’s adenocarcinoma and adenocarcinoma of the gastric cardia and antrum

    Directory of Open Access Journals (Sweden)

    Jovanović Ivan

    2005-01-01

    Full Text Available Background/Aim. Most studies of esophageal and gastric adenocarcinomas have shown a very high rate of p53 gene mutation and/or protein overexpression, but the influence of the tumor site upon the frequency of p53 protein expression has not been evaluated (gastroesophageal junction, Barret's esophagus, and antrum. The aim of our study was to analyze the correlation between the selected clinico-pthological parameters, and p53 protein overexpression in regards to the particular tumor location. Methods. The material comprised 66 surgical specimens; 10 were Barrett’s carcinomas, 25 adenocarcinomas of the gastric cardia (type II adenocarcinoma of the esophagogastric junction - EGJ, and 31 adenocarcinomas of the antrum. Immunostaining for p53 protein was performed on formalin-fixed, paraffin-embedded tissue sections, using the alkaline phosphatase - antialkaline phosphatase (APAAP method. The cases were considered positive for p53 if at least 5% of the tumor cells expressed this protein by immunostaining. Results. There was no significant difference observed between the studied groups in regards to age, sex, Lauren’s classification and tumor differentiation. There was, however, a significant difference observed in the depth of tumor invasion between Barrrett’s adenocarcinoma and adenocarcinoma of the cardia compared with the adenocarcinoma of the antrum. Namely, at the time of surgery, both Barrett’s adenocarcinomas and adenocarcinomas of the cardia, were significantly more advanced comparing with the adenocarcinomas of the antrum. Overexpression of p53 was found in 40% (4/10 of Barrett’s adenocarcinomas, 72% (18/25 of adenocarcinoma of the cardia and 65% (20/31 of adenocarcinoma of the antrum. No significant differences in p53 expression in relation to sex, type (Lauren of tumor, depth of invasion, lymph node involvement, or tumor differentiation were observed in any of the analyzed groups of tumors. Patients with more advanced Barrett

  14. Therapeutic Response to Non-genotoxic Activation of p53 by Nutlin3a Is Driven by PUMA-Mediated Apoptosis in Lymphoma Cells

    Directory of Open Access Journals (Sweden)

    Liz J. Valente

    2016-03-01

    Full Text Available Nutlin3a is a small-molecule antagonist of MDM2 that promotes non-genotoxic activation of p53 through p53 protein stabilization and transactivation of p53 target genes. Nutlin3a is the forerunner of a class of cancer therapeutics that have reached clinical trials. Using transgenic and gene-targeted mouse models lacking the critical p53 target genes, p21, Puma, and Noxa, we found that only loss of PUMA conferred profound protection against Nutlin3a-induced killing in both non-transformed lymphoid cells and Eμ-Myc lymphomas in vitro and in vivo. CRISPR/Cas9-mediated targeting of the PUMA gene rendered human hematopoietic cancer cell lines markedly resistant to Nutlin3a-induced cell death. These results demonstrate that PUMA-mediated apoptosis, but not p21-mediated cell-cycle arrest or senescence, is a critical determinant of the therapeutic response to non-genotoxic p53 activation by Nutlin3a. Importantly, in human cancer, PUMA expression may predict patient responses to treatment with MDM2 antagonists.

  15. Identification of differentially expressed proteins in spontaneous thymic lymphomas from knockout mice with deletion of p53

    DEFF Research Database (Denmark)

    Honoré, Bent; Buus, Søren; Claësson, Mogens H

    2008-01-01

    ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two-dimensiona......ABSTRACT: BACKGROUND: Knockout mice with a deletion of p53 spontaneously develop thymic lymphomas. Two cell lines (SM5 and SM7), established from two independent tumours, exhibited about fifty to seventy two-fold differentially expressed proteins compared to wild type thymocytes by two...... alpha type 3, transforming acidic coiled-coil containing protein 3, mitochondrial ornithine aminotransferase and epidermal fatty acid binding protein and down-regulation of adenylosuccinate synthetase, tubulin beta-3 chain, a 25 kDa actin fragment, proteasome subunit beta type 9, cofilin-1 and glia...

  16. Immunohistochemical expression of p53 proteins in Wilms' tumour: a possible association with the histological prognostic parameter of anaplasia.

    Science.gov (United States)

    Cheah, P L; Looi, L M; Chan, L L

    1996-01-01

    Wilms' tumour (nephroblastoma) has been associated with chromosomal abnormalities at the 11p13, 11p15 and 16q regions. A study into the possibility of mutations occurring within p53, the ubiquitous adult tumour suppressor gene, in Wilms' tumour was carried out. Thirty-eight cases were studied. Of these 36 were categorised into the favourable histology group and two into the unfavourable histology group based on the National Wilms' Tumour Study criteria. Archival formalin-fixed, paraffin-embedded tissue sections from each case were stained with a polyclonal (AB565:Chemicon) and a monoclonal (DO7:Dako) antibody raised against p53 protein using a peroxidase-labelled streptavidin biotin kit (Dako). 'Cure' (disease-free survival of 60 months or longer) was documented in 39% of cases with favourable histology tumours. Eleven percent in this group succumbed to the disease. Both cases with unfavourable histology died. Four out of 36 (11%) tumours with favourable histology demonstrated weak to moderate staining with both AB565 and DO7 in more than 75% of tumour cells. In contrast, p53 protein expression in unfavourable histology tumours was significantly increased compared with the favourable histology group (P = 0.021) with both cases demonstrating immunopositivity in > 75% of tumour cells when stained with AB565 and DO7. The intensity of staining ranged from moderate to strong in both cases. It appears from this preliminary study that the immunohistochemical expression of p53 protein in Wilms' tumour, presumably a result of mutation in the p53 tumour suppressor gene, correlates with histological classification, histological categorisation being one of the useful features in the prognostic assessment of Wilms' tumours.

  17. Microbial Regulation of p53 Tumor Suppressor.

    Directory of Open Access Journals (Sweden)

    Alexander I Zaika

    2015-09-01

    Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

  18. New ELISA technique for analysis of p53 protein/DNA binding properties

    Czech Academy of Sciences Publication Activity Database

    Jagelská, Eva; Brázda, Václav; Pospíšilová, Š.; Vojtěšek, B.; Paleček, Emil

    2002-01-01

    Roč. 267, č. 2 (2002), s. 227-235 ISSN 0022-1759 R&D Projects: GA ČR GA301/00/D001; GA AV ČR IAB5004203; GA ČR GA301/00/P094; GA ČR GA301/02/0831; GA MZd NC6404; GA MZd NC5343; GA AV ČR IAA4004110 Institutional research plan: CEZ:AV0Z5004920 Keywords : ELISA * p53 * DNA-binding Subject RIV: BO - Biophysics Impact factor: 2.598, year: 2002

  19. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    Science.gov (United States)

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  20. Sirt1 overexpression suppresses fluoride-induced p53 acetylation to alleviate fluoride toxicity in ameloblasts responsible for enamel formation.

    Science.gov (United States)

    Suzuki, Maiko; Ikeda, Atsushi; Bartlett, John D

    2018-03-01

    Low-dose fluoride is an effective caries prophylactic, but high-dose fluoride is an environmental health hazard that causes skeletal and dental fluorosis. Treatments to prevent fluorosis and the molecular pathways responsive to fluoride exposure remain to be elucidated. Previously we showed that fluoride activates SIRT1 as an adaptive response to protect cells. Here, we demonstrate that fluoride induced p53 acetylation (Ac-p53) [Lys379], which is a SIRT1 deacetylation target, in ameloblast-derived LS8 cells in vitro and in enamel organ in vivo. Here we assessed SIRT1 function on fluoride-induced Ac-p53 formation using CRISPR/Cas9-mediated Sirt1 knockout (LS8 Sirt/KO ) cells or CRISPR/dCas9/SAM-mediated Sirt1 overexpressing (LS8 Sirt1/over ) cells. NaF (5 mM) induced Ac-p53 formation and increased cell cycle arrest via Cdkn1a/p21 expression in Wild-type (WT) cells. However, fluoride-induced Ac-p53 was suppressed by the SIRT1 activator resveratrol (50 µM). Without fluoride, Ac-p53 persisted in LS8 Sirt/KO cells, whereas it decreased in LS8 Sirt1/over . Fluoride-induced Ac-p53 formation was also suppressed in LS8 Sirt1/over cells. Compared to WT cells, fluoride-induced Cdkn1a/p21 expression was elevated in LS8 Sirt/KO and these cells were more susceptible to fluoride-induced growth inhibition. In contrast, LS8 Sirt1/over cells were significantly more resistant. In addition, fluoride-induced cytochrome-c release and caspase-3 activation were suppressed in LS8 Sirt1/over cells. Fluoride induced expression of the DNA double strand break marker γH2AX in WT cells and this was augmented in LS8 Sirt1/KO cells, but was attenuated in LS8 Sirt1/over cells. Our results suggest that SIRT1 deacetylates Ac-p53 to mitigate fluoride-induced cell growth inhibition, mitochondrial damage, DNA damage and apoptosis. This is the first report implicating Ac-p53 in fluoride toxicity.

  1. Homologous recombination in mammalian cells: effect of p53 and Bcl-2 proteins, replication inhibition and ionizing radiations

    International Nuclear Information System (INIS)

    Saintigny, Yannick

    1999-01-01

    The control of cell cycle, associated with the mechanisms of replication, DNA repair/recombination allows the cells to maintain their genetic integrity. The p53 protein ensures the control of G1/S transition. Its inactivation would allow to initial replication on damaged matrix and lead to the block of replication forks followed by DNA strand breaks, good substrates for recombination. This work shows that the expression of mutant p53 protein stimulates both spontaneous and radio-induced homologous recombination, independently of the control of cell cycle. Moreover, the use of a set of replication inhibitors show that inhibition of the replication elongation stimulates recombination more strongly than the initiation inhibition. Replication arrest by these inhibitors also significantly increases the number of DNA strand breaks. These results highlighted a point of action of p53 protein on the ultimate stages of the homologous recombination mechanism. Lastly, the expression of Bcl-2 protein inhibits apoptosis and increases survival, but specifically inhibits conservative recombination, after radiation as well as in absence of apoptotic stress. The extinction of this mechanism of DNA repair is associated with an increase of mutagenesis. Taken together, these results allow ta consider the maintenance of the genetic stability as a cellular network involving different pathways. A multiple stages model for tumoral progression can be deduced. (author) [fr

  2. Low ATM protein expression and depletion of p53 correlates with olaparib sensitivity in gastric cancer cell lines

    Science.gov (United States)

    Kubota, Eiji; Williamson, Christopher T; Ye, Ruiqiong; Elegbede, Anifat; Peterson, Lars; Lees-Miller, Susan P; Bebb, D Gwyn

    2014-01-01

    Small-molecule inhibitors of poly (ADP-ribose) polymerase (PARP) have shown considerable promise in the treatment of homologous recombination (HR)-defective tumors, such as BRCA1- and BRCA2-deficient breast and ovarian cancers. We previously reported that mantle cell lymphoma cells with deficiency in ataxia telangiectasia mutated (ATM) are sensitive to PARP-1 inhibitors in vitro and in vivo. Here, we report that PARP inhibitors can potentially target ATM deficiency arising in a solid malignancy. We show that ATM protein expression varies between gastric cancer cell lines, with NUGC4 having significantly reduced protein levels. Significant correlation was found between ATM protein expression and sensitivity to the PARP inhibitor olaparib, with NUGC4 being the most sensitive. Moreover, reducing ATM kinase activity using a small-molecule inhibitor (KU55933) or shRNA-mediated depletion of ATM protein enhanced olaparib sensitivity in gastric cancer cell lines with depletion or inactivation of p53. Our results demonstrate that ATM is a potential predictive biomarker for PARP-1 inhibitor activity in gastric cancer harboring disruption of p53, and that combined inhibition of ATM and PARP-1 is a rational strategy for expanding the utility of PARP-1 inhibitors to gastric cancer with p53 disruption. PMID:24841718

  3. Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

    International Nuclear Information System (INIS)

    Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi

    2006-01-01

    Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer

  4. Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

    Directory of Open Access Journals (Sweden)

    Nishizaki Takashi

    2006-07-01

    Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.

  5. Conserved CPEs in the p53 3' untranslated region influence mRNA stability and protein synthesis

    DEFF Research Database (Denmark)

    Rosenstierne, Maiken W; Vinther, Jeppe; Mittler, Gerhard

    2008-01-01

    CaT skin and MCF-7 breast cancer cell lines were established. Quantitative PCR and an enzymatic assay were used to quantify the reporter mRNA and protein levels, respectively. Proteins binding to the CPEs were identified by RNA-immunoprecipitation (IP) and quantitative mass spectroscopy. RESULTS: The wild...... irradiation. Several proteins (including GAPDH, heterogeneous nuclear ribonucleoprotein (hnRNP) D and A/B) were identified from the MCF-7 cytoplasmic extracts that bound specifically to the CPEs. CONCLUSION: Two conserved CPEs in the p53 3'UTR regulate stability and translation of a reporter mRNA in non...

  6. Neoplasias astrocitárias e correlação com as proteínas p53 mutada e Ki-67 Astrocytic neoplasms and correlation with mutate p53 and Ki-67 proteins

    Directory of Open Access Journals (Sweden)

    Gustavo Rassier Isolan

    2005-12-01

    Full Text Available As neoplasias astrocitárias correspondem a 60% dos tumores do sistema nervoso central, sendo o estudo da biologia molecular um importante passo para a compreensão da gênese e comportamento biológico destas doenças. As proteínas Ki-67, que é um marcador de proliferação celular, e p53, que é o produto do gene supressor de tumor de mesmo nome, são importantes marcadores tumorais. O objetivo deste estudo foi identificar e quantificar as proteínas Ki-67 e produto do gene supressor de tumor TP53 em diferentes graus de malignidade das neoplasias astrocitárias, bem como analisar suas relações com idade e sexo. Foram estudadas por imuno-histoquímica as proteínas Ki-67 e p53 em 47 pacientes com neoplasias astrocitárias ressecadas cirurgicamente, classificadas previamente e revisadas quanto ao grau de malignidade, de acordo com o proposto pela Organização Mundial da Saúde. Os núcleos celulares imunomarcados foram quantificados no programa Imagelab-softium pela razão paramétrica absoluta entre os núcleos de células positivas e o número total de células tumorais, sendo contadas 1000 células. O delineamento utilizado foi transversal não controlado. Para análise estatística as variáveis foram divididas em grupos, que para a Ki-67 foram ausente, 5% e para a p53 foram ausente (0, The astrocytic neoplasms respond by 60% of the central nervous system tumors, being the study of the molecular biology an important step for the understanding of the genesis and biological behavior of these diseases. The Ki-67 proteins, which are markers of the cellular proliferation, and p53, which is the product of the tumor suppressor gene TP53, are both important tumoral markers. This study intends to identify and quantify the Ki-67 and p53 proteins in astrocytic tumors of different grades of malignancy, as well as to analyze their relations with age and gender. Ki-67 and p53 proteins in 47 patients with surgically resected astrocytic neoplasms were

  7. Electron beam irradiation induces abnormal development and the stabilization of p53 protein of American serpentine leafminer, Liriomyza trifolii (Burgess)

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Hyun-Na; Yun, Seung-Hwan; Yoon, Changmann [Department of Plant Medicine, College of Agriculture, Life and Environment Sciences, Chungbuk National University, Cheongju 361-763 (Korea, Republic of); Kim, Gil-Hah, E-mail: khkim@chungbuk.ac.kr [Department of Plant Medicine, College of Agriculture, Life and Environment Sciences, Chungbuk National University, Cheongju 361-763 (Korea, Republic of)

    2012-01-15

    The American serpentine leafminer fly, Liriomyza trifolii (Burgess), is one of the most destructive polyphagous pests worldwide. In this study, we determined electron beam doses for inhibition of normal development of the leaf miner and investigated the effect of electron beam irradiation on DNA damage and p53 stability. Eggs (0-24 h old), larvae (2nd instar), puparia (0-24 h old after pupariation) and adults (24 h after emergence) were irradiated with increasing doses of electron beam irradiation (six levels between 30 and 200 Gy). At 150 Gy, the number of adults that developed from irradiated eggs, larvae and puparia was lower than in the untreated control. Fecundity and egg hatchability decreased depending on the doses applied. Reciprocal crosses between irradiated and unirradiated flies demonstrated that males were more radiotolerant than females. Adult longevity was not affected in all stages. The levels of DNA damage in L. trifolii adults were evaluated using the alkaline comet assay. Our results indicate that electron beam irradiation increased levels of DNA damage in a dose-dependent manner. Moreover, low doses of electron beam irradiation led to the rapid appearance of p53 protein within 6 h; however, it decreased after exposure to high doses (150 Gy and 200 Gy). These results suggest that electron beam irradiation induced not only abnormal development and reproduction but also p53 stability caused by DNA damage in L. trifolii. We conclude that a minimum dose of 150 Gy should be sufficient for female sterilization of L. trifolii. - Highlights: > Electron beam irradiation inhibited normal development of the leaf miner. > Electron beam irradiation inhibited normal reproduction of the leaf miner. > Electron beam irradiation increased levels of DNA damage. > Electron beam irradiation induced p53 stability.

  8. Protein degradation rate is the dominant mechanism accounting for the differences in protein abundance of basal p53 in a human breast and colorectal cancer cell line.

    Directory of Open Access Journals (Sweden)

    Eszter Lakatos

    Full Text Available We determine p53 protein abundances and cell to cell variation in two human cancer cell lines with single cell resolution, and show that the fractional width of the distributions is the same in both cases despite a large difference in average protein copy number. We developed a computational framework to identify dominant mechanisms controlling the variation of protein abundance in a simple model of gene expression from the summary statistics of single cell steady state protein expression distributions. Our results, based on single cell data analysed in a Bayesian framework, lends strong support to a model in which variation in the basal p53 protein abundance may be best explained by variations in the rate of p53 protein degradation. This is supported by measurements of the relative average levels of mRNA which are very similar despite large variation in the level of protein.

  9. Protein degradation rate is the dominant mechanism accounting for the differences in protein abundance of basal p53 in a human breast and colorectal cancer cell line.

    Science.gov (United States)

    Lakatos, Eszter; Salehi-Reyhani, Ali; Barclay, Michael; Stumpf, Michael P H; Klug, David R

    2017-01-01

    We determine p53 protein abundances and cell to cell variation in two human cancer cell lines with single cell resolution, and show that the fractional width of the distributions is the same in both cases despite a large difference in average protein copy number. We developed a computational framework to identify dominant mechanisms controlling the variation of protein abundance in a simple model of gene expression from the summary statistics of single cell steady state protein expression distributions. Our results, based on single cell data analysed in a Bayesian framework, lends strong support to a model in which variation in the basal p53 protein abundance may be best explained by variations in the rate of p53 protein degradation. This is supported by measurements of the relative average levels of mRNA which are very similar despite large variation in the level of protein.

  10. Identification of proteins that regulate radiation-induced apoptosis in murine tumors with wild type p53

    Energy Technology Data Exchange (ETDEWEB)

    Seong, Jinsil; Oh, Hae Jin; Kim, Jiyoung; An, Jeung Hee; Kim, Wonwoo [Dept. of Radiation Oncology, Yonsei Univ. Medical College, Seoul (Korea, Republic of)

    2007-09-15

    In this study, we investigated the molecular factors determining the induction of apoptosis by radiation. Two murine tumors syngeneic to C3H/HeJ mice were used: an ovarian carcinoma OCa-I, and a hepatocarcinoma HCa-I. Both have wild type p53, but display distinctly different radiosensitivity in terms of specific growth delay (12.7 d in OCa-I and 0.3 d in HCa-I) and tumor cure dose 50% (52.6 Gy in OCa-I and >80 Gy in HCa-I). Eight-mm tumors on the thighs of mice were irradiated with 25 Gy and tumor samples were collected at regular time intervals after irradiation. The peak levels of apoptosis were 16.1{+-}0.6% in OCa-I and 0.2{+-}0.0% in HCa-I at 4 h after radiation, and this time point was used for subsequent proteomics analysis. Protein spots were identified by peptide mass fingerprinting with a focus on those related to apoptosis. In OCa-I tumors, radiation increased the expression of cytochrome c oxidase and Bcl2/adenovirus E1B-interacting 2 (Nip 2) protein higher than 3-fold. However in HCa-I, these two proteins showed no significant change. The results suggest that radiosensitivity in tumors with wild type p53 is regulated by a complex mechanism. Furthermore, these proteins could be molecular targets for a novel therapeutic strategy involving the regulation of radiosensitivity. (author)

  11. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    Energy Technology Data Exchange (ETDEWEB)

    Widel, Maria, E-mail: maria.widel@polsl.pl [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Lalik, Anna; Krzywon, Aleksandra [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland); Poleszczuk, Jan [College of Inter-faculty Individual Studies in Mathematics and Natural Sciences, University of Warsaw, 93 Zwirki i Wigury Street, 02-089 Warsaw (Poland); Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center & Research Institute, Tampa, Florida (United States); Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna [Biosystems Group, Institute of Automatic Control, Silesian University of Technology, 16 Akademicka Street, 44-100 Gliwice (Poland)

    2015-08-15

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  12. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status

    International Nuclear Information System (INIS)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna

    2015-01-01

    Highlights: • We tested radiation response and bystander effect on HCT116p53+/+ and p53−/− cells. • The p53+/+ cells developed premature senescence in exposed and bystander neighbors. • Directly exposed and bystander p53−/− cells died profoundly through apoptosis. • Interleukins 6 and 8 were differently generated by both cell lines. • NFκB path was activated mainly in p53+/+ hit cells, in p53 −/− in bystanders only. - Abstract: Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0–8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at

  13. Correlation between Expression of MVP, Index of p53 and AgNOR Value with Chemoradiotherapy Clinical Response of Cervical Cancer

    Directory of Open Access Journals (Sweden)

    I. Kurnia

    2014-12-01

    Full Text Available Cervical cancer is the most frequent cancer found in Indonesia. The primary treatment of cervical cancer at the locally advanced stage is usually performed by using radiotherapy and chemotherapy. The combination of the two techniques is often called chemoradioherapy. The response to chemoradiotherapy is influenced by biological and physical factors. Major vault protein (MVP is a ribonucleoprotein which contributes to drug resistance in some cancers. The purposes of this research were: (1 to determine the correlation between the expression of MVP and the index of p53, including AgNOR values and index of MIB-1; and (2 between MVP and chemoradiotherapy clinical response of cervical cancer. Twenty-one microscopic slides taken from biopsy tissues of cervical cancer patients before undergoing treatment were stained to identify MVP, p53, and MIB-1 by means of immunohistochemistry techniques and AgNORs staining. After undergoing chemoradiotherapy treatment, the patients’ clinical responses were observed by pelvic control method. Experimental results showed that there was a correlation between MVP and AgNOR value (P=0.05, but no correlation between MVP and index of p53 (P=0.729, including MIB-1 LI (P=0.63, in untreated cervical cancer. In addition, there was no association between MVP and chemoradioterapy response. In conclusion, MVP expression correlates with the process of cell proliferation before the G2 phase of cell cycle in untreated cancer cells. Those have no association with clinical responses after the completion of treatment.

  14. Correlation between expression of MVP, index of p53 and AgNOR value with chemoradiotherapy clinical response of cervical cancer

    International Nuclear Information System (INIS)

    Kurnia, I.; Tetriana, D.; Siregar, B.; Ramli, I.; Andrijono, A.; Soetopo, S.; Kurjana, T.; Hernowo, B.S.; Tobing, M.D.M.

    2014-01-01

    Cervical cancer is the most frequent cancer found in Indonesia. The primary treatment of cervical cancer at the locally advanced stage is usually performed by using radiotherapy and chemotherapy. The combination of the two techniques is often called chemoradiotherapy. The response to chemoradiotherapy is influenced by biological and physical factors. Major vault protein (MVP) is a ribonucleoprotein which contributes to drug resistance in some cancers. The purposes of this research were: (1) to determine the correlation between the expression of MVP and the index of p53, including AgNOR values and index of MIB-1; and (2) between MVP and chemoradiotherapy clinical response of cervical cancer. Twenty-one microscopic slides taken from biopsy tissues of cervical cancer patients before undergoing treatment were stained to identify MVP, p53, and MIB-1 by means of immunohistochemistry techniques and AgNORs staining. After undergoing chemoradiotherapy treatment, the patients’ clinical responses were observed by pelvic control method. Experimental results showed that there was a correlation between MVP and AgNOR value (P=0.05), but no correlation between MVP and index of p53 (P=0.729), including MIB-1 LI (P=0.63), in untreated cervical cancer. In addition, there was no association between MVP and chemoradiotherapy response. In conclusion, MVP expression correlates with the process of cell proliferation before the G2 phase of cell cycle in untreated cancer cells. Those have no association with clinical responses after the completion of treatment. (author)

  15. Prognostic Role of Serum Antibody Immunity to p53 Oncogenic Protein in Ovarian Cancer: A Systematic Review and a Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Marica Garziera

    Full Text Available Serum p53 autoantibodies (p53-AAbs are the product of an endogenous immune response against p53 overexpression driven by the ovarian tumour. The p53-AAbs are detectable only in a subset of patients. To date, the evidence of an association between the presence of p53-AAbs and ovarian cancer outcomes has been poorly investigated.A systematic literature search was performed to identify eligible studies investigating the association of serum p53-AAbs and overall survival (OS and disease free survival (DFS. Associations between presence of serum p53-AAbs and baseline tumour characteristics were also evaluated. Pooled hazard ratios (HRs and corresponding 95% confidence intervals (CI were computed to estimate the prognostic impact of serum p53-AAbs. Heterogeneity between studies was assessed.A total of 583 patients (7 studies for OS and 356 patients (4 studies for DFS were included in the meta-analysis. Presence of p53-AAbs was not associated to OS (pooled uni- multivariate HR = 1.09; 95% CI: 0.55-2.16, and a large heterogeneity was found. When only multivariate HRs were pooled together (4 studies, presence of p53-AAbs was significantly associated to a better OS (pooled HR = 0.57; 95% CI: 0.40-0.81, and no significant heterogeneity was observed. A reduced DFS was associated to p53-AAbs (pooled uni- multivariate HR = 1.37; 95% CI: 0.83-2.25, though not significantly and with a moderate heterogeneity.The prognostic significance of serum p53-AAbs in ovarian cancer was diverging according to uni or multivariate models used. Since the results of this work were based on only few investigations, large prospective studies are needed to better define the role of antibody immunity against p53.

  16. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    Science.gov (United States)

    Vadrot, Nathalie; Ghanem, Sarita; Braut, Françoise; Gavrilescu, Laura; Pilard, Nathalie; Mansouri, Abdellah; Moreau, Richard; Reyl-Desmars, Florence

    2012-01-01

    During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α) targets hepatocytes and induces abnormal reactive oxygen species (ROS) production responsible for mitochondrial DNA (mtDNA) alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β) plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR) we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC) was used to measure the rapid (10 min) and transient TNF-α induced increase in ROS production (168±15%). A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM). In addition, mitochondrial D-loop immunoprecipitation (mtDIP) revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15)p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  17. Mitochondrial DNA maintenance is regulated in human hepatoma cells by glycogen synthase kinase 3β and p53 in response to tumor necrosis factor α.

    Directory of Open Access Journals (Sweden)

    Nathalie Vadrot

    Full Text Available During chronic liver inflammation, up-regulated Tumor Necrosis Factor alpha (TNF-α targets hepatocytes and induces abnormal reactive oxygen species (ROS production responsible for mitochondrial DNA (mtDNA alterations. The serine/threonine Glycogen Synthase Kinase 3 beta (GSK3β plays a pivotal role during inflammation but its involvement in the maintenance of mtDNA remains unknown. The aim of this study was to investigate its involvement in TNF-α induced mtDNA depletion and its interrelationship with p53 a protein known to maintain mtDNA copy numbers. Using quantitative polymerase chain reaction (qPCR we found that at 30 min in human hepatoma HepG2 cells TNF-α induced 0.55±0.10 mtDNA lesions per 10 Kb and a 52.4±2.8% decrease in mtDNA content dependent on TNF-R1 receptor and ROS production. Both lesions and depletion returned to baseline from 1 to 6 h after TNF-α exposure. Luminol-amplified chemiluminescence (LAC was used to measure the rapid (10 min and transient TNF-α induced increase in ROS production (168±15%. A transient 8-oxo-dG level of 1.4±0.3 ng/mg DNA and repair of abasic sites were also measured by ELISA assays. Translocation of p53 to mitochondria was observed by Western Blot and co-immunoprecipitations showed that TNF-α induced p53 binding to GSK3β and mitochondrial transcription factor A (TFAM. In addition, mitochondrial D-loop immunoprecipitation (mtDIP revealed that TNF-α induced p53 binding to the regulatory D-loop region of mtDNA. The knockdown of p53 by siRNAs, inhibition by the phosphoSer(15p53 antibody or transfection of human mutant active GSK3βS9A pcDNA3 plasmid inhibited recovery of mtDNA content while blockade of GSK3β activity by SB216763 inhibitor or knockdown by siRNAs suppressed mtDNA depletion. This study is the first to report the involvement of GSK3β in TNF-α induced mtDNA depletion. We suggest that p53 binding to GSK3β, TFAM and D-loop could induce recovery of mtDNA content through mtDNA repair.

  18. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    Science.gov (United States)

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

  19. Reactivity of p53 protein in canine transmissible venereal tumor Reatividade da proteína P53 no tumor venéreo transmissível canino

    Directory of Open Access Journals (Sweden)

    J.V. Moro

    2010-04-01

    Full Text Available The expression of p53 protein was evaluated in canine transmissible venereal tumor (CTVT, as following: natural occurrence (n=8; resistant to chemotherapy (n=4; and allogeneic transplanted in progression (n=8, stable (n=8, and regression (n=8stages. The collected specimens were submitted to GM1 immunohistochemical reaction. Results showed a mean percentage of immunomarked cells around 18.6% in CTVT of natural occurrence, 23.8% in CTVT resistant to chemotherapy, 22.9% in allogeneic transplanted CTVT in both progression and stable stages, and 35.8% in transplanted CTVT in regression stage. The results suggest that there is a functional abnormality in p53 gene and its products in the studied tumors; although, it is not possible to correlate the percentage of cells marked by p53 and a prognosis.A expressão da proteína p53 foi avaliada em espécimes de tumor venéreo transmissível canino (TVT de ocorrência natural (n=8; resistente à quimioterapia (n=4 e transplantado em cão nas fases de progressão tumoral (n=8, de latência (n=8 e de regressão (n=8. Os espécimes foram submetidos à reação de imunoistoquímica. Os resultados mostraram porcentagem média de células imunomarcadas de 18,6% no TVT de ocorrência natural, de 23,8% no TVT refratário, 22,9% nos TVTs transplantados nas fases de progressão e latência e de 35,8% na fase de regressão. Os resultados sugerem que há uma anormalidade funcional no gene P53 e seus produtos nos tumores estudados, apesar de não ser possível correlacionar a porcentagem de células marcadas pelo p53 ao prognóstico.

  20. Functional consequences of inducible genetic elements from the p53 SOS response in a mammalian organ system.

    Science.gov (United States)

    Guthrie, O'neil W

    2017-10-01

    In response to DNA damage from ultraviolet (UV) radiation, bacteria deploy the SOS response in order to limit cell death. This bacterial SOS response is characterized by an increase in the recA gene that transactivates expression of multiple DNA repair genes. The current series of experiments demonstrate that a mammalian organ system (the cochlea) that is not evolutionarily conditioned to UV radiation can elicit SOS responses that are reminiscent of that of bacteria. This mammalian SOS response is characterized by an increase in the p53 gene with activation of multiple DNA repair genes that harbor p53 response elements in their promoters. Furthermore, the experimental results provide support for the notion of a convergent trigger paradox, where independent SOS triggers facilitate disparate physiologic sequelae (loss vs. recovery of function). Therefore, it is proposed that the mammalian SOS response is multifunctional and manipulation of this endogenous response could be exploited in future biomedical interventions. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Mitofusin-2 is a novel direct target of p53

    International Nuclear Information System (INIS)

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-01-01

    Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  2. Identification of proteins that regulate radiation-induced apoptosis in murine tumors with wild type p53

    International Nuclear Information System (INIS)

    Seong, Jinsil; Oh, Hae Jin; Kim, Jiyoung; An, Jeung Hee; Kim, Wonwoo

    2007-01-01

    In this study, we investigated the molecular factors determining the induction of apoptosis by radiation. Two murine tumors syngeneic to C3H/HeJ mice were used: an ovarian carcinoma OCa-I, and a hepatocarcinoma HCa-I. Both have wild type p53, but display distinctly different radiosensitivity in terms of specific growth delay (12.7 d in OCa-I and 0.3 d in HCa-I) and tumor cure dose 50% (52.6 Gy in OCa-I and >80 Gy in HCa-I). Eight-mm tumors on the thighs of mice were irradiated with 25 Gy and tumor samples were collected at regular time intervals after irradiation. The peak levels of apoptosis were 16.1±0.6% in OCa-I and 0.2±0.0% in HCa-I at 4 h after radiation, and this time point was used for subsequent proteomics analysis. Protein spots were identified by peptide mass fingerprinting with a focus on those related to apoptosis. In OCa-I tumors, radiation increased the expression of cytochrome c oxidase and Bcl2/adenovirus E1B-interacting 2 (Nip 2) protein higher than 3-fold. However in HCa-I, these two proteins showed no significant change. The results suggest that radiosensitivity in tumors with wild type p53 is regulated by a complex mechanism. Furthermore, these proteins could be molecular targets for a novel therapeutic strategy involving the regulation of radiosensitivity. (author)

  3. Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription.

    Directory of Open Access Journals (Sweden)

    Goran Periz

    2015-04-01

    Full Text Available Protein quality control is essential for clearing misfolded and aggregated proteins from the cell, and its failure is associated with many neurodegenerative disorders. Here, we identify two genes, ufd-2 and spr-5, that when inactivated, synergistically and robustly suppress neurotoxicity associated with misfolded proteins in Caenorhabditis elegans. Loss of human orthologs ubiquitination factor E4 B (UBE4B and lysine-specific demethylase 1 (LSD1, respectively encoding a ubiquitin ligase and a lysine-specific demethylase, promotes the clearance of misfolded proteins in mammalian cells by activating both proteasomal and autophagic degradation machineries. An unbiased search in this pathway reveals a downstream effector as the transcription factor p53, a shared substrate of UBE4B and LSD1 that functions as a key regulator of protein quality control to protect against proteotoxicity. These studies identify a new protein quality control pathway via regulation of transcription factors and point to the augmentation of protein quality control as a wide-spectrum antiproteotoxicity strategy.

  4. Characterization of protein kinase CK2 protein subunits and p53 in F9 teratocarcinoma cells in the absence and presence of cisplatin

    DEFF Research Database (Denmark)

    Küpper, M; Köster, M; Schmidt-Spaniol, I

    1994-01-01

    cell extracts treated with and without cisplatin were analyzed by ion exchange chromatography for protein kinase CK2 alpha/beta subunits and p53 distribution. The following results were obtained: (a) in crude extracts of cisplatin-treated cells, CK2 activity was sometimes reduced by as much as 50%; (b......The effect of cis-diaminedichloroplatinum(II) (cisplatin) on the induction of p53 and protein kinase CK2 activity was studied in the mouse teratocarcinoma cell line F9. Treatment of the cells with the chemotherapeutic agent cisplatin led to the detection of p53 3 h after addition of the drug. F9...... by immunostaining, we have detected, at a concentration of approximately 200 mM NaCl, a protein of approximately 46 kDa which reacted with the CK2 alpha-specific antibody. This fraction was devoid of CK2 activity; and (d) cisplatin-treated cells exhibited p53 protein, which was mostly eluting ahead but also partly...

  5. Knockdown of hepatoma-derived growth factor-related protein-3 induces apoptosis of H1299 cells via ROS-dependent and p53-independent NF-κB activation

    International Nuclear Information System (INIS)

    Yun, Hong Shik; Baek, Jeong-Hwa; Yim, Ji-Hye; Lee, Su-Jae; Lee, Chang-Woo; Song, Jie-Young; Um, Hong-Duck; Park, Jong Kuk; Park, In-Chul; Hwang, Sang-Gu

    2014-01-01

    Highlights: • HRP-3 is a radiation- and anticancer drug-responsive protein in H1299 cells. • Depletion of HRP-3 induces apoptosis of radio- and chemoresistant H1299 cells. • Depletion of HRP-3 promotes ROS generation via inhibition of the Nrf2/HO-1 pathway. • ROS generation enhances NF-κB activity, which acts as an upstream signal in the c-Myc/Noxa apoptotic pathway. - Abstract: We previously identified hepatoma-derived growth factor-related protein-3 (HRP-3) as a radioresistant biomarker in p53 wild-type A549 cells and found that p53-dependent induction of the PUMA pathway was a critical event in regulating the radioresistant phenotype. Here, we found that HRP-3 knockdown regulates the radioresistance of p53-null H1299 cells through a distinctly different molecular mechanism. HRP-3 depletion was sufficient to cause apoptosis of H1299 cells by generating substantial levels of reactive oxygen species (ROS) through inhibition of the Nrf2/HO-1 antioxidant pathway. Subsequent, ROS-dependent and p53-independent NF-κB activation stimulated expression of c-Myc and Noxa proteins, thereby inducing the apoptotic machinery. Our results thus extend the range of targets for the development of new drugs to treat both p53 wild-type or p53-null radioresistant lung cancer cells

  6. Oncogenic RAS enables DNA damage- and p53-dependent differentiation of acute myeloid leukemia cells in response to chemotherapy.

    Directory of Open Access Journals (Sweden)

    Mona Meyer

    Full Text Available Acute myeloid leukemia (AML is a clonal disease originating from myeloid progenitor cells with a heterogeneous genetic background. High-dose cytarabine is used as the standard consolidation chemotherapy. Oncogenic RAS mutations are frequently observed in AML, and are associated with beneficial response to cytarabine. Why AML-patients with oncogenic RAS benefit most from high-dose cytarabine post-remission therapy is not well understood. Here we used bone marrow cells expressing a conditional MLL-ENL-ER oncogene to investigate the interaction of oncogenic RAS and chemotherapeutic agents. We show that oncogenic RAS synergizes with cytotoxic agents such as cytarabine in activation of DNA damage checkpoints, resulting in a p53-dependent genetic program that reduces clonogenicity and increases myeloid differentiation. Our data can explain the beneficial effects observed for AML patients with oncogenic RAS treated with higher dosages of cytarabine and suggest that induction of p53-dependent differentiation, e.g. by interfering with Mdm2-mediated degradation, may be a rational approach to increase cure rate in response to chemotherapy. The data also support the notion that the therapeutic success of cytotoxic drugs may depend on their ability to promote the differentiation of tumor-initiating cells.

  7. Expression of P-glycoprotein, multidrug resistance-associated protein, glutathione-S-transferase pi and p53 in canine transmissible venereal tumor

    Directory of Open Access Journals (Sweden)

    Daniel G. Gerardi

    2014-01-01

    Full Text Available The overexpression of proteins P-glycoprotein (P-gp, multidrug resistance-associated protein (MRP1, mutant p53, and the enzyme glutathione-S-transferase (GSTpi are related to resistance to chemotherapy in neoplasms. This study evaluated the expression of these markers by immunohistochemistry in two groups of canine TVT, without history of prior chemotherapy (TVT1, n=9 and in TVTs presented unsatisfactory clinical response to vincristine sulfate (TVT2, n=5. The percentage of specimens positively stained for P-gp, MRP1, GSTpi and p53 were, respectively 88.8%, 0%, 44.5% and 22.2% in TVT1 and 80%, 0%, 80% and 0% in TVT2. In TVT1, one specimen presented positive expression for three markers and four specimens for two markers. In TVT2, three specimens expressed P-gp and GSTpi. In conclusion, the canine TVTs studied expressed the four markers evaluated, but just P-gp and GSTpi were significantly expressed, mainly at cytoplasm and cytoplasm and nuclei, respectively, either before chemotherapy as after vincristine sulfate exposure. Future studies are needed to demonstrate the function of these two markers in conferring multidrug resistance (MDR or predict the response to chemotherapy in canine TVT.

  8. Expression of p53 and p21 in primary glioblastomas

    International Nuclear Information System (INIS)

    Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

    2005-01-01

    Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

  9. LRRK2 interacts with ATM and regulates Mdm2-p53 cell proliferation axis in response to genotoxic stress.

    Science.gov (United States)

    Chen, Zhongcan; Cao, Zhen; Zhang, Wei; Gu, Minxia; Zhou, Zhi Dong; Li, Baojie; Li, Jing; Tan, Eng King; Zeng, Li

    2017-11-15

    Pathogenic leucine-rich repeat kinase 2 (LRRK2) mutations are recognized as the most common cause of familial Parkinson's disease in certain populations. Recently, LRRK2 mutations were shown to be associated with a higher risk of hormone-related cancers. However, how LRRK2 itself contributes to cancer risk remains unknown. DNA damage causes cancer, and DNA damage responses are among the most important pathways in cancer biology. To understand the role of LRRK2 in DNA damage response pathway, we induced DNA damage by applying genotoxic stress to the cells with Adriamycin. We found that DNA damage enhances LRRK2 phosphorylation at Serine 910, Serine 935 and Serine 1292. We further showed that LRRK2 phosphorylation is abolished in the absence of ATM, suggesting that LRRK2 phosphorylation requires ATM. It should also be noted that LRRK2 interacts with ATM. In contrast, overexpression or knockdown of LRRK2 does not affect ATM phosphorylation, indicating that LRRK2 is the downstream target of ATM in response to DNA damage. Moreover, we demonstrated that LRRK2 increases the expression of p53 and p21 by increasing the Mdm2 phosphorylation in response to DNA damage. Loss-of-function in LRRK2 has the opposite effect to that of LRRK2. In addition, FACS analysis revealed that LRRK2 enhances cell cycle progression into S phase in response to DNA damage, a finding that was confirmed by 5-bromo-2'-deoxyuridine immunostaining. Taken together, our findings demonstrate that LRRK2 plays an important role in the ATM-Mdm2-p53 pathway that regulates cell proliferation in response to DNA damage. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. The Adaptive Response in p53 Cancer Prone Mice: Loss of heterozygosity and Genomic Instability

    International Nuclear Information System (INIS)

    Lavoie Jose; Dolling Jo-Anna; Mitchel Ron E J; Boreham Douglas R

    2004-01-01

    The Trp53 gene is clearly associated with increased cancer risk. This, coupled with the broad understanding of its mode of action at the molecular level, makes this gene a good candidate for investigating the relationship between genetic risk factors and spontaneous cancer occurring in a mouse model exposed to low dose radiation. We have shown that adaptive response to chronic low dose radiation could increase cancer latency, as well as overall lifespan. To better understand the molecular processes that influence cellular risk, modern tools in molecular biology were used to evaluate the loss of heterozigozity (LOH) at the Trp53 locus, and chromosomal instability in the cells from mice exposed to chronic low dose radiation. Female mice carrying a single defective copy of the Trp53 gene were irradiated with doses of gamma-radiation delivered at a low dose rate of about 0.7 mGy/hr. Groups of mice (5 irradiated and 5 unexposed) were exposed to 0.33 mGy per day for 15, 30, 45, 60, 67 and 75 weeks equaling total body doses of 2.4, 4.7, 7.2, 9.7, 10.9 and 12.1 cGy, respectively. The presence of a single defective copy of the Trp53 gene increases cancer risk in these mice. However, in vivo exposure to low dose radiation increased cancer latency. We hypothesized that: (1) These mice might have spontaneous chromosome instability, and (2) that this low dose adaptive exposure would reduce the chromosomal instability. This instability was investigated using spectral karyotyping (SKY). Bone marrow cells from 5 irradiated mice (doses of 10.9 and 12.1 cGy) and 5 control mice were collected for metaphase harvest. Briefly, the cells were incubated at 37 C for 4 hours in RPMI containing 25% heat-inactivated FBS and 0.1 mg/ml colcemid, and then given a hypotonic treatment of 0.075M KCl for 20 minutes at 37 C. An average of 100 metaphases per mouse were karyotyped. The Trp53 heterozygous mice do not show apparent structural chromosome instability. From both unexposed and irradiated

  11. RITA inhibits multiple myeloma cell growth through induction of p53-mediated caspase-dependent apoptosis and synergistically enhances nutlin-induced cytotoxic responses.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Mukai, Asuka; Chang, Hong

    2010-11-01

    Mutations or deletions of p53 are relatively rare in multiple myeloma (MM), at least in newly diagnosed patients. Thus, restoration of p53 tumor suppressor function in MM by blocking the inhibitory role of murine double minute 2 (MDM2) is a promising and applicable therapeutic strategy. RITA and nutlin are two new classes of small molecule MDM2 inhibitors that prevent the p53-MDM2 interaction. Earlier reports showed p53-dependent activity of RITA in solid tumors as well as in leukemias. We and others recently described nutlin-induced apoptosis in MM cells, but it remains unclear whether RITA exerts antimyeloma activity. Here, we found that RITA activates the p53 pathway and induces apoptosis in MM cell lines and primary MM samples, preferentially killing myeloma cells. The activation of p53 induced by RITA was mediated through modulation of multiple apoptotic regulatory proteins, including upregulation of a proapoptotic protein (NOXA), downregulation of an antiapoptotic protein, Mcl-1, and activation of caspases through extrinsic pathways. Moreover, a number of key p53-mediated apoptotic target genes were identified by gene expression profiling and further validated by quantitative real-time PCR. Importantly, the combination of RITA with nutlin displayed a strong synergism on growth inhibition with the combination index ranging from 0.56 to 0.82 in MM cells. Our data support further clinical evaluation of RITA as a potential novel therapeutic intervention in MM. ©2010 AACR.

  12. Radioadaptive response and radiation-induced teratogenesis in the late period of organogenesis in mice. Involvement of p53-dependent apoptosis

    International Nuclear Information System (INIS)

    Wang, Bing; Ohyama, Harumi; Nose, Masako; Yukawa, Osami; Yamada, Takeshi; Hayata, Isamu

    2003-01-01

    In the past 5 years, a series of study was done at our institute to investigate radiation effects on the embryogenesis in mice with an emphasis on mechanisms involved in the radiation-induced adaptive response and the role of radiation-induced apoptosis played in teratogenesis in the late period of organogenesis. Using the limb bud system, we first found that radiation-induced apoptosis is involved in malformations, namely, radiation-induced apoptosis in the predigital regions of embryonic limb buds is responsible for digital defects in ICR mice. Examination of embryonic C57BL/6J mice with different p53 status led to further finding that susceptibility to the radiation-induced apoptosis and digital defects depends on both the p53 status and the radiation dose. p53 wild-type mice appeared to be the most sensitive, while p53 knockout mice were the most resistant. These results indicate that p53-dependent apoptosis mediates radiation-induced digital defects. The existence of a radioadaptive response in fetuses, i.e., the priming dose significantly decreases the apoptosis induction, prenatal death, and digital defects in the living fetuses induced by the challenging dose, was found first in ICR strain mice and later confirmed again in C57BL/6J mice. p53 heterozygous embryos did not show the radioadaptive response, indicating the involvement of p53 in the radioadaptive response. (author)

  13. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  14. Involvement of p53 Mutation and Mismatch Repair Proteins Dysregulation in NNK-Induced Malignant Transformation of Human Bronchial Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Ying Shen

    2014-01-01

    Full Text Available Genome integrity is essential for normal cellular functions and cell survival. Its instability can cause genetic aberrations and is considered as a hallmark of most cancers. To investigate the carcinogenesis process induced by tobacco-specific carcinogen NNK, we studied the dynamic changes of two important protectors of genome integrity, p53 and MMR system, in malignant transformation of human bronchial epithelial cells after NNK exposure. Our results showed that the expression of MLH1, one of the important MMR proteins, was decreased early and maintained the downregulation during the transformation in a histone modification involved and DNA methylation-independent manner. Another MMR protein PMS2 also displayed a declined expression while being in a later stage of transformation. Moreover, we conducted p53 mutation analysis and revealed a mutation at codon 273 which led to the replacement of arginine by histidine. With the mutation, DNA damage-induced activation of p53 was significantly impaired. We further reintroduced the wild-type p53 into the transformed cells, and the malignant proliferation can be abrogated by inducing cell cycle arrest and apoptosis. These findings indicate that p53 and MMR system play an important role in the initiation and progression of NNK-induced transformation, and p53 could be a potential therapeutic target for tobacco-related cancers.

  15. p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation

    International Nuclear Information System (INIS)

    Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y.; Chiu, S.K.; Yu, K.N.

    2011-01-01

    Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.

  16. Non-linear feedback control of the p53 protein-mdm2 inhibitor system using the derivative-free non-linear Kalman filter.

    Science.gov (United States)

    Rigatos, Gerasimos G

    2016-06-01

    It is proven that the model of the p53-mdm2 protein synthesis loop is a differentially flat one and using a diffeomorphism (change of state variables) that is proposed by differential flatness theory it is shown that the protein synthesis model can be transformed into the canonical (Brunovsky) form. This enables the design of a feedback control law that maintains the concentration of the p53 protein at the desirable levels. To estimate the non-measurable elements of the state vector describing the p53-mdm2 system dynamics, the derivative-free non-linear Kalman filter is used. Moreover, to compensate for modelling uncertainties and external disturbances that affect the p53-mdm2 system, the derivative-free non-linear Kalman filter is re-designed as a disturbance observer. The derivative-free non-linear Kalman filter consists of the Kalman filter recursion applied on the linearised equivalent of the protein synthesis model together with an inverse transformation based on differential flatness theory that enables to retrieve estimates for the state variables of the initial non-linear model. The proposed non-linear feedback control and perturbations compensation method for the p53-mdm2 system can result in more efficient chemotherapy schemes where the infusion of medication will be better administered.

  17. Positive expression of p53, c-erbB2 and MRP proteins is correlated with survival rates of NSCLC patients.

    Science.gov (United States)

    Xu, Yujin; Wang, Liancong; Zheng, Xiao; Liu, Guan; Wang, Yuezhen; Lai, Xiaojing; Li, Jianqiang

    2013-05-01

    The incidence of lung cancer is one of the leading causes of mortality. This study aimed to investigate the prognostic and predictive importance of p53, c-erbB2 and multidrug resistance proteins (MRP) expression and its correlation with clinicopathological characteristics of patients with non-small cell lung cancer (NSCLC). Expression of p53, c-erbB2 and MRP proteins in 152 tumor samples from resected primary NSCLCs was detected by immunohistochemical staining. The correlation of proteins, survival and clinicopathological characteristics was investigated in 152 patients undergoing potentially curative surgery. The positive rates of p53, c-erbB2 and MRP expression were 53.9 (82/152), 44.1 (67/152) and 43.4% (66/152), respectively. Overall survival rates of patients were markedly correlated with the overexpression of p53, c-erbB2 and MRP proteins. One, 2- and 3-year survival rates of patients exhibiting a positive expression of these proteins were 72.6, 54.8 and 32.2%, respectively. These rates were lower compared with those of patients with a negative expression of these proteins (92.1, 78.5 and 63.4%) (P=0.02, 0.01 or 0.00, respectively). Results of Cox's regression analysis showed that c-erbB2 expression and cell differentiation were independent prognostic factors in patients with NSCLC. These findings suggest that the positive expression of p53, c-erbB2 and MRP proteins is correlated with the survival rates of NSCLC patients. Detection of positive p53, c-erbB2 and MRP expression may be a useful predictive indicator of prognosis. Positive c-erbB2 expression is an independent prognostic factor, with a potential to be used as a predictive indicator of chemotherapy efficacy in NSCLC patients.

  18. Study of compatibility of oligo-chitosan and ginkgo bilobal polyprenol influences on micronuclear rates and p53, gadd45 protein expression of radiated mice

    International Nuclear Information System (INIS)

    Guo Jianping; Wang Yongli; Wei Jinping; Yang Zhongtian; Liu Chunhui

    2012-01-01

    Study of compatibility of oligo-chitosan and ginkgo bilobal polyprenol (GP) influences on micronuclear rate and p53, gadd45 protein expression of radiated mice. Survival rate and survival time of 30-day-time of radiated mice was studied with the mixture of compatibility of oligo-chitosan and different density of GP. High survival rate of mixture density was screening. Another study on this mixture density was about micronuclear rates of marrow and p53, gadd45 protein of spleen after mice were radiated 12 h. The mixture of 300 mg/kg oligo-chitosan and 5 mg/kg GP could increase remarkably the survival rate and survival time of 30-day-time of radiated mice and degrade micronuclear rates and p53, gadd45 protein expression. Compatibility of oligo-chitosan and GP effectively raise the survival rate of radiated mice. It could proved initially that the mixture has the function of radiation protection. (authors)

  19. Immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 proteins in nephroblastomas A expressão imuno-histoquímica das proteínas p53, BCL-2, BAX e VEGFR1 em nefroblastomas

    Directory of Open Access Journals (Sweden)

    Ana Paula Percicote

    2013-02-01

    Full Text Available INTRODUCTION: Nephroblastoma or Wilms' tumor is the most frequent renal cancer in children. Although its prognosis is favorable for most patients, it may relapse or have a fatal outcome. The characterization of risk groups by applying immunohistochemical biomarkers aims to adapt the treatment to its corresponding group as well as to reduce relapses and fatal outcome. p53, B-cell lymphoma 2 (BCL-2, BCL-2 associated protein X (BAX and vascular endothelial growth factor receptor 1 (VEGFR1 are among the most widely studied biomarkers, which are related to the apoptotic pathway, DNA repair and neovascularization. OBJECTIVE: The objective of this study is to assess the immunohistochemical expression of p53, BCL-2, BAX and VEGFR1 in samples of human nephroblastoma and to correlate them with clinicopathological prognostic factors. MATERIAL AND METHODS: Twenty-nine surgical specimens of nephroblastoma diagnosed from 1994 to 2007 were selected from the Anatomopathological Service of two hospitals in Curitiba. The immunohistochemical analysis of tissue microarrays was performed through immunoperoxidase staining and the yielded results were compared with clinicopathological prognostic factors. RESULTS: The major immunohistochemical expression of VEGFR1 in blastema and epithelium presented positive association with the risk group. Hence this may be related to higher vascular neoplastic invasion apparently caused by the endothelial growth factor, which maximizes the chances of metastasis and ultimately changes tumor staging, risk group and clinical evolution. CONCLUSIONS: The immunohistochemical expression of VEGFR1 substantiated a directly proportional association with the nephroblastoma risk group.INTRODUÇÃO: O nefroblastoma, ou tumor de Wilms, é a neoplasia renal mais frequente na infância. Embora o prognóstico seja favorável para a maioria dos pacientes, muitos evoluem para recidiva ou óbito. A caracterização de grupos de risco por meio de

  20. Apoptosis, proliferation and p53, cyclin D1, and retinoblastoma gene expression in relation to radiation response in transitional cell carcinoma of the bladder

    International Nuclear Information System (INIS)

    Moonen, Luc; Ong, Francisca; Gallee, Maarten; Verheij, Marcel; Horenblas, Simon; Hart, Augustinus A.M.; Bartelink, Harry

    2001-01-01

    Purpose: To determine whether the apoptotic index, the Ki67 index, and the expression of the p53, cyclin D1, and retinoblastoma genes correlate with local control, overall survival, and time to distant metastases in invasive bladder cancer treated with external beam radiation. Methods and Materials: Paraffin-embedded pretreatment biopsies from 83 patients with invasive transitional cell carcinoma of the bladder were scored morphologically for apoptosis and immunohistochemically for Ki67, p53, cyclin D1, and retinoblastoma gene expression. Survival analysis methods were used to assess overall survival, local control, and freedom from distant metastases. A multiple proportional hazard (PH) regression analysis was performed to study the prognostic value of the above mentioned biologic parameters (all divided into two categories, except Ki67) in addition to classical prognostic factors such as T stage, histologic grade, multifocality of the tumor, and completeness of transurethral resection. All patients were treated with external beam radiation as sole treatment. Median follow-up for the 19 patients still living was 7.5 years. Results: Apoptotic index varied from 0% to 3.4% with a mean of 0.8% and a median of 0.6%. Ki67 index varied from 0% to 60% with a mean of 14% and a median of 12%. P53 protein was detectable in 61% of the tumors. Overexpression of cyclin D1 was observed in 39% of the tumors and loss of retinoblastoma protein in 23% of the tumors. High Ki67 index was found to be significantly associated with p53 expression (p=0.04) and cyclin D1 overexpression (p=0.023). Cyclin D1 overexpression was found more often in Rb-positive tumors than in Rb-negative tumors (p=0.006). Other associations between the markers are less clear. Biologic markers were not correlated with T stage or grade. In the PH analysis local control was found to be significantly better for tumors with wild-type p53 (p=0.028). Also, tumors with an apoptotic index above the median value (0

  1. P53 at the start of the 21st century: lessons from elephants [version 1; referees: 3 approved

    Directory of Open Access Journals (Sweden)

    Sue Haupt

    2017-11-01

    Full Text Available Crucial, natural protection against tumour onset in humans is orchestrated by the dynamic protein p53. The best-characterised functions of p53 relate to its cellular stress responses. In this review, we explore emerging insights into p53 activities and their functional consequences. We compare p53 in humans and elephants, in search of salient features of cancer protection.

  2. p53 shapes genome-wide and cell type-specific changes in microRNA expression during the human DNA damage response.

    Science.gov (United States)

    Hattori, Hiroyoshi; Janky, Rekin's; Nietfeld, Wilfried; Aerts, Stein; Madan Babu, M; Venkitaraman, Ashok R

    2014-01-01

    The human DNA damage response (DDR) triggers profound changes in gene expression, whose nature and regulation remain uncertain. Although certain micro-(mi)RNA species including miR34, miR-18, miR-16 and miR-143 have been implicated in the DDR, there is as yet no comprehensive description of genome-wide changes in the expression of miRNAs triggered by DNA breakage in human cells. We have used next-generation sequencing (NGS), combined with rigorous integrative computational analyses, to describe genome-wide changes in the expression of miRNAs during the human DDR. The changes affect 150 of 1523 miRNAs known in miRBase v18 from 4-24 h after the induction of DNA breakage, in cell-type dependent patterns. The regulatory regions of the most-highly regulated miRNA species are enriched in conserved binding sites for p53. Indeed, genome-wide changes in miRNA expression during the DDR are markedly altered in TP53-/- cells compared to otherwise isogenic controls. The expression levels of certain damage-induced, p53-regulated miRNAs in cancer samples correlate with patient survival. Our work reveals genome-wide and cell type-specific alterations in miRNA expression during the human DDR, which are regulated by the tumor suppressor protein p53. These findings provide a genomic resource to identify new molecules and mechanisms involved in the DDR, and to examine their role in tumor suppression and the clinical outcome of cancer patients.

  3. Correlation between expression of p53, p21/WAF1, and MDM2 proteins and their prognostic significance in primary hepatocellular carcinoma

    Directory of Open Access Journals (Sweden)

    Fu Jia

    2009-12-01

    Full Text Available Abstract Background Tumor Protein p53 (p53, cyclin-dependent kinase inhibitor 1A (p21/WAF1, and murine double minute 2 (MDM2 participate in the regulation of cell growth. Altered expression of these gene products has been found in malignant tumors and has been associated with poor prognosis. Our aim was to investigate the expression of the 3 proteins in hepatocellular carcinoma (HCC and their prognostic significance. Methods We examined p53, p21/WAF1, and MDM2 expression in 181 pairs of HCC tissues and the adjacent hepatic tissues by performing immunohistochemistry and examined the expression of the 3 proteins in 7 pairs of HCC tissues and the adjacent hepatic tissues by using western blot analysis. Results The expression of p53, p21/WAF1, and MDM2 in the HCC tissues was significantly higher than those in the adjacent hepatic tissues (P P = 0.008. A statistical correlation was observed between expression of p53 and p21/WAF1 (R = 0.380, P = 0.000, p53 and MDM2 (R = 0.299, P = 0.000, p21/WAF1 and MDM2 (R = 0.285, P = 0.000 in 181 liver tissues adjacent to the tumor. Patients with a low pathologic grade HCC (I+II had a higher tendency to express p53 on tumor cells than the patients with high pathologic grade HCC (III+IV (P = 0.007. Survival analysis showed that positive p21/WAF1 expression or/and negative MDM2 expression in HCC was a predictor of better survival of patients after tumor resection (P Conclusions The proteins p53, p21/WAF1, and MDM2 were overexpressed in all the HCC cases in this study, and p53 and p21/WAF1 overexpression were positively correlated. The expression of p21/WAF1 and MDM2 can be considered as 2 useful indicators for predicting the prognosis of HCC.

  4. Molecular screening of compounds to the predicted Protein-Protein Interaction site of Rb1-E7 with p53- E6 in HPV

    Science.gov (United States)

    Shaikh, Faraz; Sanehi, Parvish; Rawal, Rakesh

    2012-01-01

    Cervical cancer is malignant neoplasm of the cervix uteri or cervical area. Human Papillomaviruses (HPVs) which are heterogeneous groups of small double stranded DNA viruses are considered as the primary cause of cervical cancer, involved in 90% of all Cervical Cancers. Two early HPV genes, E6 and E7, are known to play crucial role in tumor formation. E6 binds with p53 and prevents its translocation and thereby inhibit the ability of p53 to activate or repress target genes. E7 binds to hypophosphorylated Rb and thereby induces cells to enter into premature S-phase by disrupting Rb-E2F complexes. The strategy of the research work was to target the site of interaction of Rb1 -E7 & p53-E6. A total of 88 compounds were selected for molecular screening, based on comprehensive literature survey for natural compounds with anti-cancer activity. Molecular docking analysis was carried out with Molegro Virtual Docker, to screen the 88 chosen compounds and rank them according to their binding affinity towards the site of interaction of the viral oncoproteins and human tumor suppressor proteins. The docking result revealed that Nicandrenone a member of Withanolides family of chemical compounds as the most likely molecule that can be used as a candidate drug against HPV induced cervical cancer. Abbreviations HPV - Human Papiloma Virus, HTSP - Human Tumor Suppressor Proteins, VOP - Viral oncoproteins. PMID:22829740

  5. High levels of stable p53 protein and the expression of c-myc in cultured human epithelial tissue after cobalt-60 irradiation

    International Nuclear Information System (INIS)

    Mothersill, C.; Seymour, C.B.; Harney, J.; Hennessy, T.P.

    1994-01-01

    When explants of human uroepithelium or esophageal epithelium are exposed to acute doses of radiation (cobalt-60), the cells which grow out to form the primary cultures show a number of abnormal features. These include the development of characteristic nonsenescent foci. These foci have previously been shown to be c-myc positive and to have an abnormal, tumor-like ultrastructure. Expression of c-myc and the level of stable p53 proteins have now been examined in these cultures 2 weeks after irradiation. Both proteins occurred in dividing cells at the growing edge of the explant and in the foci. The expression of c-myc appeared to be correlated with growth. As expected, variation between individual cultures of normal human cells was noted in the expression of stable p53 protein. Most control uroepithelial cell cultures were negative, but a small cohort showed a wide range of values. The control cultures from the esophageal tissues had high expression of p53, and this decreased marginally after irradiation. Cells positive for p53 were always in cycle and were usually positive for c-myc as well. It would appear from these results that the expression of c-myc and the stable form of the p53 protein occur in irradiated primary cultures of normal human cells both in foci which also express a number of abnormalities and in open-quotes edgeclose quotes cells which are dividing. Cultures of unirradiated cells from esophagus and a small number of uroepithelial samples had high levels of p53. Possible reasons for this are discussed. 33 refs., 2 figs., 3 tabs

  6. Battle Against Cancer: An Everlasting Saga of p53

    Directory of Open Access Journals (Sweden)

    Qian Hao

    2014-12-01

    Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  7. p53 Acetylation: Regulation and Consequences

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

    2014-12-23

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

  8. p53 Acetylation: Regulation and Consequences

    International Nuclear Information System (INIS)

    Reed, Sara M.; Quelle, Dawn E.

    2014-01-01

    Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

  9. Feasibility of Breast Conservation after Neoadjuvant Chemotherapy in 58 Patients with Locally Advanced Breast Cancer Using p53 and MDRI Genes as Predictors of Response

    International Nuclear Information System (INIS)

    Elsawy, W.H.; Abdel Kader, M.; Abdulla, M.H.

    2002-01-01

    The aim of this prospective trial was to evaluate the feasibility and outcome of breast conservation therapy for patients with locally advanced breast cancer after neoadjuvant chemotherapy. We studied also the value of p53 and MDR1 as predictors to neoadjuvant chemotherapy. Patients and methods: Bet ween August 1997 and May 2000, 58 patients with locally advanced breast carcinoma (stages IlIA and lllB) completed treatment consisting of 5 fluorouracil 600 mg/m 2 , epirubicin 60 mg/m 2 and cyclophosphamide 600 mg/m 2 (FEC) administered intravenously, at intervals of 3 weeks. The number of cycles of chemotherapy given depended on the clinical tumor response. Surgery (local excision if sufficiently down staged, or mastectomy if not, both with axillary dissection) was performed. Surgery was followed by radiation therapy and 4 more cycles of FEC chemotherapy as an adjuvant therapy. P53 and MDR1 were assessed in the initial tissue biopsy by means of reverse transcriptase-mediated polymerase chain reaction (RT-PCR). p53 and MDR1 findings were correlated with treatment response and linkage between p53 function and cellular response was assessed by terminal deoxynucleotidyl transferase-mediated nick end labeling assay. Results: The overall response (CR+PR) was 87.9%, with a clinical complete response rate of 29.3%. Six patients had a pathological complete response and 10 patients had only minimal residual disease. Median followup from the start of chemotherapy was 24 months (range 6 to 40). Twenty two patients (43%) underwent BCS with actuarial 3-year disease-free and overall survival of 58% and 75% respectively. Cosmetic results were good to excellent in 77.2% of the patients. Modified radical mastectomy was done in 29/51 (56.9%) patients with actuarial 3 year disease-free and overall survival of 60% and 78% respectively.In 13 out of 58 patients (22.4%), p53 mutations could be identified, including eight point mutations, three minor deletions and two complex deletions

  10. Abundant immunohistochemical expression of dopamine D{sub 2} receptor and p53 protein in meningiomas: follow-up, relation to gender, age, tumor grade, and recurrence

    Energy Technology Data Exchange (ETDEWEB)

    Trott, G.; Pereira-Lima, J.F.S.; Leães, C.G.S. [Programa de Graduação em Patologia, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Centro de Neuroendocrinologia, Complexo Hospitalar Santa Casa de Porto Alegre, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Ferreira, N.P. [Centro de Neuroendocrinologia, Complexo Hospitalar Santa Casa de Porto Alegre, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Barbosa-Coutinho, L.M. [Programa de Graduação em Patologia, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Oliveira, M.C. [Programa de Graduação em Patologia, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil); Centro de Neuroendocrinologia, Complexo Hospitalar Santa Casa de Porto Alegre, Universidade Federal de Ciências da Saúde de Porto Alegre, Porto Alegre, RS (Brazil)

    2015-03-03

    Meningiomas are common, usually benign tumors, with a high postoperative recurrence rate. However, the genesis and development of these tumors remain controversial. We aimed to investigate the presence and implications of a mutated p53 protein and dopamine D{sub 2} receptor in a representative series of meningiomas and to correlate these findings with age, gender, tumor grade, and recurrence. Tumor tissue samples of 157 patients diagnosed with meningioma (37 males and 120 females, mean age 53.6±14.3 years) who underwent surgical resection between 2003 and 2012 at our institution were immunohistochemically evaluated for the presence of p53 protein and dopamine D{sub 2} receptor and were followed-up to analyze tumor recurrence or regrowth. Tumors were classified as grades I (n=141, 89.8%), II (n=13, 8.3%), or grade III (n=3, 1.9%). Dopamine D{sub 2} receptor and p53 protein expression were positive in 93.6% and 49.7% of the cases, respectively. Neither of the markers showed significant expression differences among different tumor grades or recurrence or regrowth statuses. Our findings highlight the potential role of p53 protein in meningioma development and/or progression. The high positivity of dopamine D{sub 2} receptor observed in this study warrants further investigation of the therapeutic potential of dopamine agonists in the evolution of meningiomas.

  11. Abundant immunohistochemical expression of dopamine D2 receptor and p53 protein in meningiomas: follow-up, relation to gender, age, tumor grade, and recurrence

    International Nuclear Information System (INIS)

    Trott, G.; Pereira-Lima, J.F.S.; Leães, C.G.S.; Ferreira, N.P.; Barbosa-Coutinho, L.M.; Oliveira, M.C.

    2015-01-01

    Meningiomas are common, usually benign tumors, with a high postoperative recurrence rate. However, the genesis and development of these tumors remain controversial. We aimed to investigate the presence and implications of a mutated p53 protein and dopamine D 2 receptor in a representative series of meningiomas and to correlate these findings with age, gender, tumor grade, and recurrence. Tumor tissue samples of 157 patients diagnosed with meningioma (37 males and 120 females, mean age 53.6±14.3 years) who underwent surgical resection between 2003 and 2012 at our institution were immunohistochemically evaluated for the presence of p53 protein and dopamine D 2 receptor and were followed-up to analyze tumor recurrence or regrowth. Tumors were classified as grades I (n=141, 89.8%), II (n=13, 8.3%), or grade III (n=3, 1.9%). Dopamine D 2 receptor and p53 protein expression were positive in 93.6% and 49.7% of the cases, respectively. Neither of the markers showed significant expression differences among different tumor grades or recurrence or regrowth statuses. Our findings highlight the potential role of p53 protein in meningioma development and/or progression. The high positivity of dopamine D 2 receptor observed in this study warrants further investigation of the therapeutic potential of dopamine agonists in the evolution of meningiomas

  12. Metastasis-associated protein, S100A4 mediates cardiac fibrosis potentially through the modulation of p53 in cardiac fibroblasts

    DEFF Research Database (Denmark)

    Tamaki, Yodo; Iwanaga, Yoshitaka; Niizuma, Shinichiro

    2013-01-01

    Metastasis-associated protein, S100A4 is suggested as a marker for fibrosis in several organs. It also modulates DNA binding of p53 and affects its function. However, the functional role of S100A4 in the myocardium has remained unclear. Therefore, we investigated the role of S100A4 and its relati...

  13. Evaluation of HER2 and p53 expression in predicting response to docetaxel-based first-line chemotherapy in advanced breast cancer

    Directory of Open Access Journals (Sweden)

    Martini Leonardo

    2011-04-01

    Full Text Available Abstract Background The human epidermal growth factor receptor 2 (HER2 and p53 pathways may be involved in chemotherapy sensitivity and/or resistance. We explore the value of HER2 and p53 status to foretell docetaxel sensitivity in advanced breast cancer. Methods HER2 and p53 expression was analysed in 36 (median age 55 yrs; range 37-87 metastatic breast cancer patients receiving docetaxel-based first-line chemotherapy. HER2 was determined by immunohistochemistry (IHC and fluorescence in situ hybridization (FISH, p53 was tested by IHC. We correlate the expression of study parameters with pathologic parameters, RECIST response and survival. The standard cut-off value of 2 was used to determine HER2 overexpression while p53 mean expression level was used to divide low/high expressors tumors. Results Median time to progression and overall survival were 9 (range 2 - 54 and 20 (range 3 - 101 months. Overall response rate was 41.6%. Nine cases showed HER2 overexpression. HER2 was more frequently overexpressed in less differentiated (p = 0.05 and higher stage (p = 0.003 disease. Mean FISH-HER2 values were significantly higher in responder than in non-responder pts (8.53 ± 10.21 vs 2.50 ± 4.12, p = 0.027. Moreover, HER2 overexpression correlates with treatment response at cross-tabulation analysis (p = 0.046. p53 expression was only associated with higher stage disease (p = 0.02 but lack of any significant association with HER status or docetaxel response. No significant relation with survival was observed for any parameter. Conclusion Our data seem to indicate that FISH-determined HER2 status but not p53 is associated with docetaxel sensitivity in metastatic breast cancer.

  14. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    Science.gov (United States)

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Papillary microcarcinomas of the thyroid gland and immunohistochemical analysis of expression of p53 protein in papillary microcarcinomas

    Directory of Open Access Journals (Sweden)

    Uysal Ali R

    2006-07-01

    Full Text Available Abstract Background Thyroid papillary microcarcinoma (TPM is defined according to WHO criteria as a thyroid tumor smaller than 1–1.5 cm. TPMs are encountered in 0.5–35.6 % of autopsies or surgical specimens where carcinoma had been unsuspected. The purpose of the present study was to evaluate patients who had TPMs in terms of clinical findings, histopathological features and immunohistochemical evidence of expression of the tumor suppressor gene p53. Methods A total of 44 patients with TPMs less than 1.0 cm in diameter were included in the study. The patients were evaluated clinically and the tumors were evaluated in terms of their histopathological and immunohistochemical features, including expression of p53. Results The female/male ratio was 2.8/1, and the median age at time of diagnosis was 49 years (range 20–71 years. The maximum diameter of the smallest focus was 0.1 mm, and that of the largest was 10 mm microscopically. The mean diameter of all tumors was 5.7 mm. There was no correlation between tumor size and age or gender. Of the TPMs, 72 % were found in the right lobe, 24 % in the left lobe and 4 % in the isthmus. Fine-needle aspiration biopsy provided the diagnosis of TPM in only 43.2 % of the patients. All patients were treated with surgery, with 20 undergoing conservative surgery, i.e. lobectomy or isthmusectomy, and 24 undergoing total thyroidectomy. Frozen section provided the diagnosis of TPM in only 56.8 % of the patients. We found lymphocytic thyroiditis in 13.6% of patients, follicular variants in 11.9%, capsular invasion in 26.8%, lymph node involvement in 11.9%, soft tissue metastases in the neck in 12.1% and multifocality in 31.7 %, and none of these were related to age or gender (p > 0.05. No distant metastases were observed during approximately 10 years of follow up. We found p53 positivity in 34.5 % of TPM tumors. However, p53 expression was not statistically related to age or gender. Conclusion Our findings imply

  16. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    Directory of Open Access Journals (Sweden)

    Lin Tai-Du

    2010-12-01

    Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

  17. Polychlorinated biphenyl quinone induces oxidative DNA damage and repair responses: The activations of NHEJ, BER and NER via ATM-p53 signaling axis

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Hui; Shi, Qiong; Song, Xiufang; Fu, Juanli; Hu, Lihua; Xu, Demei; Su, Chuanyang; Xia, Xiaomin; Song, Erqun; Song, Yang, E-mail: songyangwenrong@hotmail.com

    2015-07-01

    Our previous studies demonstrated that polychlorinated biphenyl (PCB) quinone induced oxidative DNA damage in HepG2 cells. To promote genomic integrity, DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair and apoptosis. PCB quinone-induced cell cycle arrest and apoptosis have been documented, however, whether PCB quinone insult induce DNA repair signaling is still unknown. In this study, we identified the activation of DDR and corresponding signaling events in HepG2 cells upon the exposure to a synthetic PCB quinone, PCB29-pQ. Our data illustrated that PCB29-pQ induces the phosphorylation of p53, which was mediated by ataxia telangiectasia mutated (ATM) protein kinase. The observed phosphorylated histone H2AX (γ-H2AX) foci and the elevation of 8-hydroxy-2′-deoxyguanosine (8-OHdG) indicated that DDR was stimulated by PCB29-pQ treatment. Additionally, we found PCB29-pQ activates non-homologous end joining (NHEJ), base excision repair (BER) and nucleotide excision repair (NER) signalings. However, these repair pathways are not error-free processes and aberrant repair of DNA damage may cause the potential risk of carcinogenesis and mutagenesis. - Highlights: • Polychlorinated biphenyl quinone induces oxidative DNA damage in HepG2 cells. • The elevation of γ-H2AX and 8-OHdG indicates the activation of DNA damage response. • ATM-p53 signaling acts as the DNA damage sensor and effector. • Polychlorinated biphenyl quinone activates NHEJ, BER and NER signalings.

  18. Air pollution by c-PAHs and plasma levels of p53 and p21WAF1 proteins

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Binková, Blanka; Milcová, Alena; Solanský, I.; Židzik, J.; Lyubomirova, K.; Farmer, P. B.; Šrám, Radim

    2007-01-01

    Roč. 620, - (2007), s. 34-40 ISSN 0027-5107 R&D Projects: GA MŽP SI/340/2/00; GA MŽP SL/740/5/03 Grant - others:EU(GB) 2000 -00091 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : air pollution * p53 and p21WAF1 plasma levels Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.159, year: 2007

  19. Interactions of Chromatin Context, Binding Site Sequence Content, and Sequence Evolution in Stress-Induced p53 Occupancy and Transactivation

    OpenAIRE

    Su, Dan; Wang, Xuting; Campbell, Michelle R.; Song, Lingyun; Safi, Alexias; Crawford, Gregory E.; Bell, Douglas A.

    2015-01-01

    Cellular stresses activate the tumor suppressor p53 protein leading to selective binding to DNA response elements (REs) and gene transactivation from a large pool of potential p53 REs (p53REs). To elucidate how p53RE sequences and local chromatin context interact to affect p53 binding and gene transactivation, we mapped genome-wide binding localizations of p53 and H3K4me3 in untreated and doxorubicin (DXR)-treated human lymphoblastoid cells. We examined the relationships among p53 occupancy, ...

  20. The frequency of p53, Ki67, CD99 and Fli-1 protein expression in paraffin-embedded tissue blocks in Ewing’s sarcoma

    Directory of Open Access Journals (Sweden)

    Bagheri Hossein-Abadi Z

    2011-06-01

    Full Text Available "n Normal 0 false false false EN-US X-NONE AR-SA MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:Arial; mso-bidi-theme-font:minor-bidi;} Background: Ewing sarcoma family tumors (ESFTs are among the most malignant tumors in children and young adults. ESFTs include Ewing sarcoma (ES and peripheral primitive neuroectodermal tumors (pPNETs. As there seemed to be few studies on the molecular biology of ESFTs, we investigated the frequency of CD99, Ki67, p53 and Fli-1 protein expression in 15 Iranian patients with ESFTs. In addition, the correlation between expression rate of these proteins and various clinical factors, including age, sex and survival was computed."n"nMethods: The expression of the aforesaid proteins was studied by immunohisto-chemistry in formalin-fixed and paraffin-embedded blocks of 15 ESFTs specimens. Stained sections were classified according to the percentage of stained tumor cells."n"nResults: The results showed the membrane expression of CD99 protein in all of the specimens. The nuclear expression of Fli-1 protein was observed in 86.7% and the over-expression of p53 nuclear protein was seen in 53.3% of the specimens. The expression rate of Ki67 protein was 60%. Although a significant correlation was not shown between the expression levels of Ki67, p53 or Fli-1 proteins with age, sex or survival of the patients, there was a significant

  1. The Parkinson disease-related protein DJ-1 counteracts mitochondrial impairment induced by the tumour suppressor protein p53 by enhancing endoplasmic reticulum-mitochondria tethering.

    Science.gov (United States)

    Ottolini, Denis; Calì, Tito; Negro, Alessandro; Brini, Marisa

    2013-06-01

    DJ-1 was first identified as an oncogene. More recently, mutations in its gene have been found causative for autosomal recessive familial Parkinson disease. Numerous studies support the DJ-1 role in the protection against oxidative stress and maintenance of mitochondria structure; however, the mechanism of its protective function remains largely unknown. We investigated whether mitochondrial Ca(2+) homeostasis, a key parameter in cell physiology, could be a target for DJ-1 action. Here, we show that DJ-1 modulates mitochondrial Ca(2+) transients induced upon cell stimulation with an 1,4,5-inositol-tris-phosphate agonist by favouring the endoplasmic reticulum (ER)-mitochondria tethering. A reduction of DJ-1 levels results in mitochondria fragmentation and decreased mitochondrial Ca(2+) uptake in stimulated cells. To functionally couple these effects with the well-recognized cytoprotective role of DJ-1, we investigated its action in respect to the tumour suppressor p53. p53 overexpression in HeLa cells impairs their ability to accumulate Ca(2+) in the mitochondrial matrix, causes alteration of the mitochondrial morphology and reduces ER-mitochondria contact sites. Mitochondrial impairments are independent from Drp1 activation, since the co-expression of the dominant negative mutant of Drp1 failed to abolish them. DJ-1 overexpression prevents these alterations by re-establishing the ER-mitochondria tethering. Similarly, the co-expression of the pro-fusion protein Mitofusin 2 blocks the effects induced by p53 on mitochondria, confirming that the modulation of the ER-mitochondria contact sites is critical to mitochondria integrity. Thus, the impairment of ER-mitochondria communication, as a consequence of DJ-1 loss-of-function, may be detrimental for mitochondria-related processes and be at the basis of mitochondrial dysfunction observed in Parkinson disease.

  2. Regulation of p53 tetramerization and nuclear export by ARC.

    Science.gov (United States)

    Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

    2007-12-26

    Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

  3. P53 Mutation Analysis to Predict Tumor Response in Patients Undergoing Neoadjuvant Treatment for Locally Advanced Breast Cancer

    Science.gov (United States)

    2006-10-01

    then sequenced (for GeneChip- positiv SSCP (for GeneChip-negative). We have received a total of 43 core breast biopsy DNA samples from the UNC... quantitative luciferase reporter. Both reporters exploit a “rheostatable” promoter for p53 expression and utilize the “delitto perfetto” in vivo... quantitative luciferase-based assay is also being used to characterize the altered function sistent an tion T mutants in greater detail. Preliminary

  4. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    Czech Academy of Sciences Publication Activity Database

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, M.; Hrstka, R.; Pečinka, Petr; Adámik, Matěj; Vojtěšek, B.; Paleček, Emil; Deppert, W.; Fojta, Miroslav

    2013-01-01

    Roč. 8, č. 3 (2013), e59567 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GAP301/10/2370; GA ČR GA13-36108S; GA ČR(CZ) GP204/06/P369; GA ČR(CZ) GA204/08/1560; GA ČR(CZ) GAP301/11/2055; GA MŠk(CZ) 1K04119 Grant - others:GA ČR(CZ) GAP301/11/1678 Institutional research plan: CEZ:AV0Z50040702 Keywords : TUMOR-SUPPRESSOR P53 * C-TERMINAL DOMAIN * OF-FUNCTION MUTATIONS Subject RIV: BO - Biophysics Impact factor: 3.534, year: 2013

  5. The p53 gene with emphasis on its paralogues in mosquitoes

    Directory of Open Access Journals (Sweden)

    Tien-Huang Chen

    2017-12-01

    Full Text Available The p53 gene is highly important in human cancers, as it serves as a tumor-suppressor gene. Subsequently, two p53 homologues, i.e., p73 and p63, with high identity of amino acids were identified, leading to construction of the p53 family. The p53 gene is highly important in human cancer because it usually transcribes genes that function by causing apoptosis in mammalian cells. In contrast, p63 and p73 tend to be more important in modulating development than inducing cell death, even though they share similar protein structures. Relatively recently, p53 was also identified in mosquitoes and many other insect species. Uniquely, its structure lacks the sterile alpha motif domain which is a putative protein-protein interaction domain and exclusively exists at the C-terminal region in p73 and p63 in mammals. A phylogenetic analysis revealed that the p53 gene derived from mosquitoes is composed of two paralogues, p53-1 and p53-2. Of these, only p53-2 is responsively upregulated by dengue 2 virus (DENV2 in C6/36 cells which usually survive the infection. This indicates that the p53 gene is closely related to DENV infection in mosquito cells. The specific significance of p53-2's involvement in cell survival from virus-induced stress is described and briefly discussed in this report. Keywords: p53 homologue, Paralogue, Mosquitoes, Phylogeny, Cell survival

  6. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    Science.gov (United States)

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  7. Regulation of autophagy by cytoplasmic p53.

    Science.gov (United States)

    Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

    2008-06-01

    Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

  8. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

    1993-01-01

    textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

  9. Expression of p53 in oligodendrogliomas

    NARCIS (Netherlands)

    Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

    1993-01-01

    The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

  10. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage

    Directory of Open Access Journals (Sweden)

    Rolletschek Alexandra

    2009-06-01

    Full Text Available Abstract Background P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. Results In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. Conclusion In embryonic stem cells where (anti-proliferative p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  11. Nuclear accumulation and activation of p53 in embryonic stem cells after DNA damage.

    Science.gov (United States)

    Solozobova, Valeriya; Rolletschek, Alexandra; Blattner, Christine

    2009-06-17

    P53 is a key tumor suppressor protein. In response to DNA damage, p53 accumulates to high levels in differentiated cells and activates target genes that initiate cell cycle arrest and apoptosis. Since stem cells provide the proliferative cell pool within organisms, an efficient DNA damage response is crucial. In proliferating embryonic stem cells, p53 is localized predominantly in the cytoplasm. DNA damage-induced nuclear accumulation of p53 in embryonic stem cells activates transcription of the target genes mdm2, p21, puma and noxa. We observed bi-phasic kinetics for nuclear accumulation of p53 after ionizing radiation. During the first wave of nuclear accumulation, p53 levels were increased and the p53 target genes mdm2, p21 and puma were transcribed. Transcription of noxa correlated with the second wave of nuclear accumulation. Transcriptional activation of p53 target genes resulted in an increased amount of proteins with the exception of p21. While p21 transcripts were efficiently translated in 3T3 cells, we failed to see an increase in p21 protein levels after IR in embryonal stem cells. In embryonic stem cells where (anti-proliferative) p53 activity is not necessary, or even unfavorable, p53 is retained in the cytoplasm and prevented from activating its target genes. However, if its activity is beneficial or required, p53 is allowed to accumulate in the nucleus and activates its target genes, even in embryonic stem cells.

  12. The expanding universe of p53 targets.

    Science.gov (United States)

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  13. PSK, a biological response modifier, modifies p53 expression, mitosis and apoptosis in X-ray irradiated mouse embryos. Possible cellular mechanism of the anti-teratogenic effect

    International Nuclear Information System (INIS)

    Kagohashi, Yukiko; Naora, Hiroyuki; Otani, Hiroki

    2002-01-01

    We previously showed that PSK, a biological response modifier, suppressed X-ray irradiation induced ocular anomalies in mouse embryos. In the present study, in mouse embryos irradiated at E7.5, PSK, when administered immediately after irradiation, suppressed mitosis and increased apoptosis as compared with embryos not treated with PSK at 12 hrs after irradiation. In the irradiated embryos, p53, which is normally expressed at a high level in early embryos, increased at 6 hrs and decreased at 12 hrs after irradiation. In the irradiated and PSK-treated embryos, the p53 level did not change at 6 hrs, increased at 12 hrs and decreased at 24 hrs after irradiation. This timing of PSK-induced delayed increase of p53 coincided with that of the PSK-induced decrease in mitosis and increase in apoptosis. These results suggested that PSK modified the p53 level and affected cell proliferation and apoptosis, which might contribute to the suppression of teratogenesis. (author)

  14. The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle.

    Science.gov (United States)

    1996-08-01

    that my statement of work (SOW) for the current project omitted many of the tasks that had to be carried out in order to get the lab up and running...that we knew that we could stabilize wild-type p53 in ML-1 cells along with the possibility of being able to get an excellent elutriation profile with...nuclear protein extract was immunoprecipitated with PAb421 cross-linked to ProteinA -Sepharose beads and analysed by SDS-PAGE Western blot analysis with

  15. The carboxy terminus of p53 mimics the polylysine effect of protein kinase CK2-catalyzed MDM2 phosphorylation

    DEFF Research Database (Denmark)

    Guerra, B; Götz, C; Wagner, P

    1997-01-01

    The oncogene product MDM2 can be phosphorylated by protein kinase CK2 in vitro 0.5-1 mol of phosphate were incorporated per mol MDM2 protein. The catalytic subunit of protein kinase CK2 (alpha-subunit) catalyzed the incorporation of twice as much phosphate into the MDM2 protein as it was obtained...

  16. Ursodeoxycholic acid protects cardiomyocytes against cobalt chloride induced hypoxia by regulating transcriptional mediator of cells stress hypoxia inducible factor 1α and p53 protein.

    Science.gov (United States)

    Mohamed, Anis Syamimi; Hanafi, Noorul Izzati; Sheikh Abdul Kadir, Siti Hamimah; Md Noor, Julina; Abdul Hamid Hasani, Narimah; Ab Rahim, Sharaniza; Siran, Rosfaiizah

    2017-10-01

    In hepatocytes, ursodeoxycholic acid (UDCA) activates cell signalling pathways such as p53, intracellular calcium ([Ca 2+ ] i ), and sphingosine-1-phosphate (S1P)-receptor via Gα i -coupled-receptor. Recently, UDCA has been shown to protect the heart against hypoxia-reoxygenation injury. However, it is not clear whether UDCA cardioprotection against hypoxia acts through a transcriptional mediator of cells stress, HIF-1α and p53. Therefore, in here, we aimed to investigate whether UDCA could protect cardiomyocytes (CMs) against hypoxia by regulating expression of HIF-1α, p53, [Ca 2+ ] i , and S1P-Gα i -coupled-receptor. Cardiomyocytes were isolated from newborn rats (0-2 days), and hypoxia was induced by using cobalt chloride (CoCl 2 ). Cardiomyocytes were treated with UDCA and cotreated with either FTY720 (S1P-receptor agonist) or pertussis toxin (PTX; Gα i inhibitor). Cells were subjected for proliferation assay, beating frequency, QuantiGene Plex assay, western blot, immunofluorescence, and calcium imaging. Our findings showed that UDCA counteracted the effects of CoCl 2 on cell viability, beating frequency, HIF-1α, and p53 protein expression. We found that these cardioprotection effects of UDCA were similar to FTY720, S1P agonist. Furthermore, we observed that UDCA protects CMs against CoCl 2 -induced [Ca 2+ ] i dynamic alteration. Pharmacological inhibition of the Gα i -sensitive receptor did not abolish the cardioprotection of UDCA against CoCl 2 detrimental effects, except for cell viability and [Ca 2+ ] i . Pertussis toxin is partially effective in inhibiting UDCA protection against CoCl 2 effects on CM cell viability. Interestingly, PTX fully inhibits UDCA cardioprotection on CoCl 2 -induced [Ca 2+ ] i dynamic changes. We conclude that UDCA cardioprotection against CoCl 2 -induced hypoxia is similar to FTY720, and its actions are not fully mediated by the Gα i -coupled protein sensitive pathways. Ursodeoxycholic acid is the most hydrophilic bile

  17. Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

    Directory of Open Access Journals (Sweden)

    Giovanna Damia

    2001-01-01

    Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

  18. An early function of the adenoviral E1B 55 kDa protein is required for the nuclear relocalization of the cellular p53 protein in adenovirus-infected normal human cells

    International Nuclear Information System (INIS)

    Cardoso, F.M.; Kato, Sayuri E.M.; Huang Wenying; Flint, S. Jane; Gonzalez, Ramon A.

    2008-01-01

    It is well established that the human subgroup C adenovirus type 5 (Ad5) E1B 55 kDa protein can regulate the activity and concentration of the cellular tumor suppressor, p53. However, the contribution(s) of these functions of the E1B protein to viral reproduction remains unclear. To investigate this issue, we examined properties of p53 in normal human cells infected by E1B mutant viruses that display defective entry into the late phase or viral late mRNA export. The steady-state concentrations of p53 were significantly higher in cells infected by the E1B 55 kDa null mutant Hr6 or three mutants carrying small insertions in the E1B 55 kDa protein coding sequence than in Ad5-infected cells. Nevertheless, none of the mutants induced apoptosis in infected cells. Rather, the localization of p53 to E1B containing nuclear sites observed during infection by Ad5 was prevented by mutations that impair interaction of the E1B protein with p53 and/or with the E4 Orf6 protein. These results indicate that the E1B protein fulfills an early function that correlates efficient entry into the late phase with the localization of E1B and p53 in the nucleus of Ad5-infected normal human cells

  19. Efficacy and Molecular Mechanisms of Differentiated Response to the Aurora and Angiogenic Kinase Inhibitor ENMD-2076 in Preclinical Models of p53-Mutated Triple-Negative Breast Cancer

    Directory of Open Access Journals (Sweden)

    Anastasia A. Ionkina

    2017-05-01

    Full Text Available PurposeTriple-negative breast cancer (TNBC is a subtype associated with poor prognosis and for which there are limited therapeutic options. The purpose of this study was to evaluate the efficacy of ENMD-2076 in p53-mutated TNBC patient-derived xenograft (PDX models and describe patterns of terminal cell fate in models demonstrating sensitivity, intrinsic resistance, and acquired resistance to ENMD-2076.Experimental designp53-mutated, TNBC PDX models were treated with ENMD-2076 and evaluated for mechanisms of sensitivity or resistance to treatment. Correlative tissue testing was performed on tumor tissue to assess for markers of proliferation, apoptosis, senescence, and pathways of resistance after treatment and at the time of acquired resistance.ResultsSensitivity to ENMD-2076 200 mg/kg daily was associated with induction of apoptosis while models exhibiting intrinsic or acquired resistance to treatment presented with a senescent phenotype. Response to ENMD-2076 was accompanied by an increase in p53 and p73 levels, even within the background of mutant p53. Treatment with ENMD-2076 resulted in a decrease in pAurA and an increase in pHH3. We observed a TNBC subtype switch from the luminal androgen receptor to the basal-like subtype at acquired resistance.ConclusionENMD-2076 has antitumor activity in preclinical models of p53-mutated TNBC. Increased levels of p53 and p73 correlated with sensitivity whereas senescence was associated with resistance to ENMD-2076. The novel finding of a TNBC subtype switch at time of acquired resistance may provide mechanistic insights into the biologic effects of selective pressure of anticancer treatments on TNBC. ENMD-2076 is currently being evaluated in a Phase 2 clinical trial in patients with metastatic, previously treated TNBC where these biologic correlates can be further explored.

  20. INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

    Science.gov (United States)

    2003-01-01

    Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

  1. Transcriptional regulation of the p73 gene, a member of the p53 family, by early growth response-1 (Egr-1)

    International Nuclear Information System (INIS)

    Lee, Sang-Wang; Kim, Eun-Joo; Um, Soo-Jong

    2007-01-01

    To elucidate the regulatory mechanism of p73 gene expression, we analyzed the human p73 promoter and found three putative Egr-1-binding sites located upstream of exon 1 (-1728, -321, and -38). The Egr-1 responsiveness of these sites was analyzed by transient transfection assays using 5'- and 3'-serial truncations of the p73 promoter, subcloned in a CAT reporter vector. The functional significance of the region was further confirmed by an electrophoretic mobility shift assay using the Egr-1 protein synthesized in vitro and a [ 32 P]-labeled middle site sequence, followed by competition with unlabeled wild-type or mutant oligonucleotides and supershift assays using an anti-Egr-1 antibody. When induced by either the nitric oxide donor NOC-18 or the PPARγ agonist troglitazone, Egr-1 bound to the p73 promoter, as assessed by chromatin immunoprecipitation assays, accompanied by increased expression of p73. MTT assays revealed that cell growth was significantly inhibited on treating the cells with troglitazone. Overall, our results provide direct evidence that Egr-1 positively regulated p73 expression by binding to its promoter in vivo, consistent with Egr-1 and p73 being involved in p53-independent tumor suppression

  2. Phosphorylation and nuclear accumulation are distinct events contributing to the activation of p53

    International Nuclear Information System (INIS)

    O'Hagan, Heather M.; Ljungman, Mats

    2004-01-01

    It has been recently shown that ionizing radiation (IR) and the mRNA synthesis inhibitor 5,6-dichloro-1-b-D-ribofuranosylbenzimidazole (DRB) act in synergy to induce p53-mediated transactivation of reporter plasmids in human cells [Oncogene 19 (2000) 3829]. We have extended these studies and show that ionizing radiation and DRB also act in synergy to induce ATM-mediated phosphorylation of the ser15 site of p53 and enhance the expression of endogenous p21 protein. Examination of the localization of p53 revealed that while DRB did not induce phosphorylation of the ser15 site of p53 but efficiently accumulated p53 in the nucleus, ionizing radiation induced phosphorylation of the ser15 site of p53 without prolonged nuclear accumulation. Importantly, the combination of DRB and IR resulted in a strong accumulation of phosphorylated p53 in the nucleus that was more persistent then p53 accumulation after IR alone. Furthermore, the nuclear export inhibitor leptomycin B showed a similar synergy with IR as did DRB regarding ser15 phosphorylation of p53 and p21 induction. These results suggest that the synergistic activation of the p53 response by the combination treatment is due to the activation of two distinct pathways where DRB causes the prolonged nuclear accumulation of p53 while ionizing radiation activates p53 by ATM-mediated phosphorylation

  3. Cyclin G2 is a centrosome-associated nucleocytoplasmic shuttling protein that influences microtubule stability and induces a p53-dependent cell cycle arrest

    International Nuclear Information System (INIS)

    Arachchige Don, Aruni S.; Dallapiazza, Robert F.; Bennin, David A.; Brake, Tiffany; Cowan, Colleen E.; Horne, Mary C.

    2006-01-01

    Cyclin G2 is an atypical cyclin that associates with active protein phosphatase 2A. Cyclin G2 gene expression correlates with cell cycle inhibition; it is significantly upregulated in response to DNA damage and diverse growth inhibitory stimuli, but repressed by mitogenic signals. Ectopic expression of cyclin G2 promotes cell cycle arrest, cyclin dependent kinase 2 inhibition and the formation of aberrant nuclei [Bennin, D. A., Don, A. S., Brake, T., McKenzie, J. L., Rosenbaum, H., Ortiz, L., DePaoli-Roach, A. A., and Horne, M. C. (2002). Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G 1 /S-phase cell cycle arrest. J Biol Chem 277, 27449-67]. Here we report that endogenous cyclin G2 copurifies with centrosomes and microtubules (MT) and that ectopic G2 expression alters microtubule stability. We find exogenous and endogenous cyclin G2 present at microtubule organizing centers (MTOCs) where it colocalizes with centrosomal markers in a variety of cell lines. We previously reported that cyclin G2 forms complexes with active protein phosphatase 2A (PP2A) and colocalizes with PP2A in a detergent-resistant compartment. We now show that cyclin G2 and PP2A colocalize at MTOCs in transfected cells and that the endogenous proteins copurify with isolated centrosomes. Displacement of the endogenous centrosomal scaffolding protein AKAP450 that anchors PP2A at the centrosome resulted in the depletion of centrosomal cyclin G2. We find that ectopic expression of cyclin G2 induces microtubule bundling and resistance to depolymerization, inhibition of polymer regrowth from MTOCs and a p53-dependent cell cycle arrest. Furthermore, we determined that a 100 amino acid carboxy-terminal region of cyclin G2 is sufficient to both direct GFP localization to centrosomes and induce cell cycle inhibition. Colocalization of endogenous cyclin G2 with only one of two GFP-centrin-tagged centrioles, the

  4. Ubiquitin specific peptidase 5 mediates Histidine-rich protein Hpn induced cell apoptosis in hepatocellular carcinoma through P14-P53 signaling.

    Science.gov (United States)

    Liu, Yi; Wang, Wei-Mao; Zou, Li-Yi; Li, Li; Feng, Lu; Pan, Ming-Zhu; Lv, Min-Yi; Cao, Ying; Wang, Hua; Kung, Hsiang-Fu; Pang, Jian-Xin; Fu, Wei-Ming; Zhang, Jin-Fang

    2017-06-01

    Hpn is a small histidine-rich cytoplasmic protein from Helicobacter pylori and has been recognized as a high-risk factor for several cancers including gastric cancer, colorectal cancer, and MALT lymphoma. However, the relationship between Hpn and cancers remains elusive. In this study, we discovered that Hpn protein effectively suppressed cell growth and induced apoptosis in hepatocellular carcinoma (HCC). A two-dimensional gel electrophoresis and mass spectrometry-based comparative proteomics was performed to find the molecular targets of Hpn in HCC cells. It was identified that twelve proteins were differentially expressed, with USP5 being one of the most significantly downregulated protein. The P14 ARF -P53 signaling was activated by USP5 knockdown in HCC cells. Furthermore, USP5 overexpression significantly rescued the suppressive effect of Hpn on the viability of HCC cells. In conclusion, our study suggests that Hpn plays apoptosis-inducing roles through suppressing USP5 expression and activating the P14 ARF -P53 signaling. Therefore, Hpn may be a potential candidate for developing novel anti-HCC drugs. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Inhibition of Glycogen Synthase Kinase or the Apoptotic Protein p53 Lowers the Threshold of Helium Cardioprotection In Vivo: The Role of Mitochondrial Permeability Transition

    Science.gov (United States)

    Pagel, Paul S.; Krolikowski, John G.; Pratt, Phillip F.; Shim, Yon Hee; Amour, Julien; Warltier, David C.; Weihrauch, Dorothee

    2008-01-01

    BACKGROUND Prosurvival signaling kinases inhibit glycogen synthase kinase-3β (GSK-3β) activity and stimulate apoptotic protein p53 degradation. Helium produces cardioprotection by activating prosurvival kinases, but whether GSK and p53 inhibition mediate this process is unknown. We tested the hypothesis that inhibition of GSK or p53 lowers the threshold of helium cardioprotection via a mitochondrial permeability transition pore (mPTP)-dependent mechanism. METHODS Rabbits (n = 85) instrumented for hemodynamic measurement and subjected to a 30 min left anterior descending coronary artery (LAD) occlusion and 3 h reperfusion received 0.9% saline (control), or 1, 3, or 5 cycles of 70% helium-30% oxygen administered for 5 min interspersed with 5 min of an air-oxygen mixture (fraction of inspired oxygen concentration = 0.30) before LAD occlusion. Other rabbits received the GSK inhibitor SB 216763 (SB21; 0.2 or 0.6 mg/kg), the p53 inhibitor pifithrin-α (PIF; 1.5 or 3.0 mg/kg), or SB21 (0.2 mg/kg) or PIF (1.5 mg/kg) plus helium (1 cycle) before LAD occlusion in the presence or absence of the mPTP opener atractyloside (5 mg/kg). RESULTS Helium reduced (P < 0.05) myocardial infarct size (35 ± 6 [n = 7], 25 ± 4 [n = 7], and 20 ± 3% [n = 6] of area at risk, 1, 3, and 5 cycles, respectively) compared with control (44 ± 6% [n = 7]). SB21 (0.6 [n = 7] but not 0.2 mg/kg [n = 6]) and PIF (3.0 [n = 6] but not 1.5 mg/kg [n = 7]) also reduced necrosis. SB21 (0.2 mg/kg) or 1.5 mg/kg PIF (1.5 mg/kg) plus helium (1 cycle; n = 6 per group) decreased infarct size to an equivalent degree as three cycles of helium alone, and this cardioprotection was blocked by atractyloside (n = 7 per group). CONCLUSIONS Inhibition of GSK or p53 lowers the threshold of helium-induced preconditioning via a mPTP-dependent mechanism in vivo. PMID:18713881

  6. A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

    International Nuclear Information System (INIS)

    Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

    2011-01-01

    eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

  7. Modulation of Cyclins, p53 and Mitogen-Activated Protein Kinases Signaling in Breast Cancer Cell Lines by 4-(3,4,5-Trimethoxyphenoxybenzoic Acid

    Directory of Open Access Journals (Sweden)

    Kuan-Han Lee

    2014-01-01

    Full Text Available Despite the advances in cancer therapy and early detection, breast cancer remains a leading cause of cancer-related deaths among females worldwide. The aim of the current study was to investigate the antitumor activity of a novel compound, 4-(3,4,5-trimethoxyphenoxybenzoic acid (TMPBA and its mechanism of action, in breast cancer. Results indicated the relatively high sensitivity of human breast cancer cell-7 and MDA-468 cells towards TMPBA with IC50 values of 5.9 and 7.9 µM, respectively compared to hepatocarcinoma cell line Huh-7, hepatocarcinoma cell line HepG2, and cervical cancer cell line Hela cells. Mechanistically, TMPBA induced apoptotic cell death in MCF-7 cells as indicated by 4',6-diamidino-2-phenylindole (DAPI nuclear staining, cell cycle analysis and the activation of caspase-3. Western blot analysis revealed the ability of TMPBA to target pathways mediated by mitogen-activated protein (MAP kinases, 5' adenosine monophosphate-activated protein kinase (AMPK, and p53, of which the concerted action underlined its antitumor efficacy. In addition, TMPBA induced alteration of cyclin proteins’ expression and consequently modulated the cell cycle. Taken together, the current study underscores evidence that TMPBA induces apoptosis in breast cancer cells via the modulation of cyclins and p53 expression as well as the modulation of AMPK and mitogen-activated protein kinases (MAPK signaling. These findings support TMPBA’s clinical promise as a potential candidate for breast cancer therapy.

  8. The usefulness of cytogenetic parameters, level of p53 protein and endogenous glutathione as intermediate end-points in raw betel-nut genotoxicity.

    Science.gov (United States)

    Kumpawat, K; Chatterjee, A

    2003-07-01

    Betel-nut (BN) chewing related oral mucosal lesions are potential hazards to a large population worldwide. Genotoxicity of betel alkaloids, polyphenol and tannin fractions have been reported. It has been shown earlier that BN ingredients altered the level of endogenous glutathione (GSH) which could modulate the host susceptibility to the action of other chemical carcinogens. The north-east Indian variety of BN, locally known as 'kwai', is raw, wet and consumed unprocessed with betel-leaf and slaked lime and contains higher alkaloids, polyphenol and tannins as compared to the dried one. Therefore, the purpose of this study was to investigate the extent of DNA damage, pattern of cell kinetics, the level of p53-protein and endogenous GSH in kwai chewers in the tribal population of Meghalaya state in the northeastern region of India with an aim to see whether these end-points could serve as biomarkers of genetic damage of relevance for genotoxic/carcinogenic process. The present data show higher DNA damage, delay in cell kinetics, p53 expression and lower GSH-level in heavy chewers (HC) than nonchewers (NC). The influence of bleomycin (BLM) on chromatid break induction in G2-phase of peripheral blood lymphocytes in NC and HC has been analysed to determine individual susceptibility to carcinogenic assaults. HC showed higher induction of chromatid breaks than NC. Risk assessment in this study suggests an interaction between carcinogen exposure and mutagen sensitivity measures, risk estimates being higher in those individuals who both consume kwai and express sensitivity to free radical oxygen damage in vitro. From this study it seems that besides cytogenetical parameters, the level of endogenous GSH and the level of p53 protein could act as effective biomarkers for kwai chewers.

  9. p53, a New Master Regulator of Stem Cell Differentiation | Center for Cancer Research

    Science.gov (United States)

    When the genome is damaged, a key player in stabilizing and maintaining genomic integrity is a protein called p53.  This protein can activate or shut down gene activity in response to DNA damage.  But how exactly does p53 accomplish its task? This question has yet to be answered completely at the molecular level.   

  10. Mutual interactions between P53 and growth factors in cancer

    NARCIS (Netherlands)

    Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

    1998-01-01

    The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

  11. Skp2B overexpression alters a prohibitin-p53 axis and the transcription of PAPP-A, the protease of insulin-like growth factor binding protein 4.

    Directory of Open Access Journals (Sweden)

    Harish Chander

    Full Text Available We previously reported that the degradation of prohibitin by the SCF(Skp2B ubiquitin ligase results in a defect in the activity of p53. We also reported that MMTV-Skp2B transgenic mice develop mammary gland tumors that are characterized by an increased proteolytic cleavage of the insulin-like growth factor binding protein 4 (IGFBP-4, an inhibitor of IGF signaling. However, whether a link exists between a defect in p53 activity and proteolysis of IGFBP-4 was not established.We analyzed the levels of pregnancy-associated plasma protein A (PAPP-A, the protease of IGFBP-4, in MMTV-Skp2B transgenic mice and found that PAPP-A levels are elevated. Further, we found a p53 binding site in intron 1 of the PAPP-A gene and that both wild type and mutant p53 bind to this site. However, binding of wild type p53 results in the transcriptional repression of PAPP-A, while binding of mutant p53 results in the transcriptional activation of PAPP-A. Since MMTV-Skp2B mice express wild type p53 and yet show elevated levels of PAPP-A, at first, these observations appeared contradictory. However, further analysis revealed that the defect in p53 activity in Skp2B overexpressing cells does not only abolish the activity of wild type of p53 but actually mimics that of mutant p53. Our results suggest that in absence of prohibitin, the half-life of p53 is increased and like mutant p53, the conformation of p53 is denatured.These observations revealed a novel function of prohibitin as a chaperone of p53. Further, they suggest that binding of denatured p53 in intron 1 causes an enhancer effect and increases the transcription of PAPP-A. Therefore, these findings indicate that the defect in p53 function and the increased proteolysis of IGFBP-4, we had observed, represent two components of the same pathway, which contributes to the oncogenic function of Skp2B.

  12. Transactivation domain of p53 regulates DNA repair and integrity in human iPS cells.

    Science.gov (United States)

    Kannappan, Ramaswamy; Mattapally, Saidulu; Wagle, Pooja A; Zhang, Jianyi

    2018-05-18

    The role of p53 transactivation domain (p53-TAD), a multifunctional and dynamic domain, on DNA repair and retaining DNA integrity in human iPS cells has never been studied. p53-TAD was knocked out in iPS cells using CRISPR/Cas9 and was confirmed by DNA sequencing. p53-TAD KO cells were characterized by: accelerated proliferation, decreased population doubling time, and unaltered Bcl2, BBC3, IGF1R, Bax and altered Mdm2, p21, and PIDD transcripts expression. In p53-TAD KO cells p53 regulated DNA repair proteins XPA, DNA polH and DDB2 expression were found to be reduced compared to p53-WT cells. Exposure to low dose of doxorubicin (Doxo) induced similar DNA damage and DNA damage response (DDR) measured by RAD50 and MRE11 expression, Checkpoint kinase 2 activation and γH2A.X recruitment at DNA strand breaks in both the cell groups indicating silencing p53-TAD do not affect DDR mechanism upstream of p53. Following removal of Doxo p53-WT hiPS cells underwent DNA repair, corrected their damaged DNA and restored DNA integrity. Conversely, p53-TAD KO hiPS cells did not undergo complete DNA repair and failed to restore DNA integrity. More importantly continuous culture of p53-TAD KO hiPS cells underwent G2/M cell cycle arrest and expressed cellular senescent marker p16 INK4a . Our data clearly shows that silencing transactivation domain of p53 did not affect DDR but affected the DNA repair process implying the crucial role of p53 transactivation domain in maintaining DNA integrity. Therefore, activating p53-TAD domain using small molecules may promote DNA repair and integrity of cells and prevent senescence.

  13. hSSB1 regulates both the stability and the transcriptional activity of p53

    OpenAIRE

    Xu, Shuangbing; Wu, Yuanzhong; Chen, Qiong; Cao, Jingying; Hu, Kaishun; Tang, Jianjun; Sang, Yi; Lai, Fenju; Wang, Li; Zhang, Ruhua; Li, Sheng-Ping; Zeng, Yi-Xin; Yin, Yuxin; Kang, Tiebang

    2012-01-01

    The tumor suppressor p53 is essential for several cellular processes that are involved in the response to diverse genotoxic stress, including cell cycle arrest, DNA repair, apoptosis and senescence. Studies of the regulation of p53 have mostly focused on its stability and transactivation; however, new regulatory molecules for p53 have also been frequently identified. Here, we report that human ssDNA binding protein SSB1 (hSSB1), a novel DNA damage-associated protein, can interact with p53 and...

  14. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    International Nuclear Information System (INIS)

    Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

    2006-01-01

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

  15. Gene expression and apoptosis induction in p53-heterozygous irradiated mice

    Energy Technology Data Exchange (ETDEWEB)

    Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

    2006-02-22

    The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

  16. The role of p53 in lung macrophages following exposure to a panel of manufactured nanomaterials

    DEFF Research Database (Denmark)

    Belade, Esther; Chrusciel, Sandra; Armand, Lucie

    2015-01-01

    is a key transcription factor implicated in cellular defence and reparative responses to various stress factors. Additionally, p53 has been implicated in cellular responses following exposure to some MNMs. Here, the role of the MNM mediated p53 induction and activation and its downstream effects following...... exposure to five well-characterised materials [namely two types of TiO2, two carbon black (CB), and one single-walled carbon nanotube (SWCNT)] were investigated. MNM internalisation, cellular viability, p53 protein induction and activation, oxidative stress, inflammation and apoptosis were measured...... in murine cell line and primary pulmonary macrophage models. It was observed that p53 was implicated in the biological responses to MNMs, with oxidative stress associated with p53 activation (only following exposure to the SWCNT). We demonstrate that p53 acted as an antioxidant and anti...

  17. Phase 1 trial of ALT-801, an interleukin-2/T cell receptor fusion protein targeting p53 (aa264-272)/HLA-A*0201 complex, in patients with advanced malignancies

    Science.gov (United States)

    Fishman, Mayer N.; Thompson, John A.; Pennock, Gregory K.; Gonzalez, Rene; Diez, Luz M.; Daud, Adil I.; Weber, Jeffery S.; Huang, Bee Y.; Tang, Shamay; Rhode, Peter R.; Wong, Hing C.

    2014-01-01

    Purpose ALT-801 is a bifunctional fusion protein comprising interleukin-2 (IL-2) linked to a soluble, single-chain T cell receptor domain that recognizes a peptide epitope (aa264-272) of the human p53 antigen displayed on cancer cells in the context of HLA-A*0201 (p53+/HLA-A*0201). We evaluated the safety, pharmacokinetics and pharmacodynamics of ALT-801 in p53+/HLA-A*0201 patients with metastatic malignancies. Experimental Design p53+/HLA-A*0201 patients were treated with ALT-801 on a schedule of 4 daily 15-minute intravenous infusions, then 10 days rest and 4 more daily infusions. Cohorts of patients were treated at 0.015, 0.040, and 0.080 mg/kg/dose. Results Four, sixteen, and six patients were treated at the 0.015, 0.04 and 0.08 mg/kg cohorts, respectively. Two dose limiting toxicities (a grade 4 transient thrombocytopenia and a myocardial infarction) in the 0.08 mg/kg cohort established the maximum tolerated dose (MTD) at 0.04 mg/kg. Patients treated at the MTD experienced toxicities similar to those associated with high-dose IL-2 but of lesser severity. The serum half-life of ALT-801 was 4 hours and ALT-801 serum recovery was as expected based on the dose administered. ALT-801 treatment induced an increase of serum interferon-γ but not tumor necrosis factor-α. Response assessment showed 10 subjects with stable disease at at least 11 weeks, and in one who had melanoma metastasis, there is an ongoing complete absence of identifiable disease after resection of radiographically identified lesions. Conclusion This first-in-man study defines an ALT-801 regimen that can be administered safely and is associated with immunological changes of potential antitumor relevance. PMID:21994418

  18. P53 overexpression and outcome of radiation therapy in head and neck cancers

    International Nuclear Information System (INIS)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae

    1999-01-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers

  19. P53 overexpression and outcome of radiation therapy in head and neck cancers

    Energy Technology Data Exchange (ETDEWEB)

    Kim, In Ah; Choi, Ihl Bhong; Kang, Ki Mun; Jang, Ji Young; Kim, Kyung Mi; Park, Kyung Shin; Kim, Young Shin; Kang, Chang Suk; Cho, Seung Ho; Kim, Hyung Tae [College of Medicine, The Catholic Univ., Seoul (Korea, Republic of)

    1999-03-01

    Experimental studies have implicated the wild type p53 in cellular response to radiation. Whether altered p53 function can lead to changes in clinical radiocurability remains an area of ongoing study. This study was performed to investigate whether any correlation between change of p53 and outcome of curative radiation therapy in patients with head and neck cancers. Immunohistochemical analysis with a mouse monoclonal antibody (D0-7) specific for human p53 was used to detect to overexpression of protein in formalin fixed, paraffin-embedded tumor sample from 55 head and neck cancer patients treated with curative radiation therapy (median dose of 7020 cGy) from February 1988 to March 1996 at St. Mary's Hospital. Overexpression of p53 was correlated with locoregional control and survival using Kaplan-Meier method. A Cox regression multivariate analysis was performed that included all clinical variables and status of p53 expression. Thirty-seven (67.2%) patients showed overexpression of p53 by immunohistochemical staining in their tumor. One hundred percent of oral cavity, 76% of laryngeal, 66.7% of oropharyngeal, 66.7% of hypopharyngeal cancer showed p53 overexpression (p=0.05). The status of p53 had significant relationship with stage of disease (p=0.03) and history of smoking (p=0.001). The overexpression of p53 was not predictive of response rate to radiation therapy. The locoregional control was not significantly affected by p53 status. Overexpression of p53 didn't have any prognostic implication for disease free survival and overall survival. Primary site and stage of disease were significant prognostic factors for survival. The p53 overexpression as detected by immunohistochemical staining had significant correlation with stage, primary site of disease and smoking habit of patients. The p53 overexpression didn't have any predictive value for outcome of curative radiation therapy in a group of head and neck cancers.

  20. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    International Nuclear Information System (INIS)

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein

  1. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    Directory of Open Access Journals (Sweden)

    Shah Keerti V

    2005-02-01

    Full Text Available Abstract Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT, and 8 supratentorial primitive neuroectodermal tumors (sPNET using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3 was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein.

  2. Increased p53 immunopositivity in anaplastic medulloblastoma and supratentorial PNET is not caused by JC virus

    Science.gov (United States)

    Eberhart, Charles G; Chaudhry, Aneeka; Daniel, Richard W; Khaki, Leila; Shah, Keerti V; Gravitt, Patti E

    2005-01-01

    Background p53 mutations are relatively uncommon in medulloblastoma, but abnormalities in this cell cycle pathway have been associated with anaplasia and worse clinical outcomes. We correlated p53 protein expression with pathological subtype and clinical outcome in 75 embryonal brain tumors. The presence of JC virus, which results in p53 protein accumulation, was also examined. Methods p53 protein levels were evaluated semi-quantitatively in 64 medulloblastomas, 3 atypical teratoid rhabdoid tumors (ATRT), and 8 supratentorial primitive neuroectodermal tumors (sPNET) using immunohistochemistry. JC viral sequences were analyzed in DNA extracted from 33 frozen medulloblastoma and PNET samples using quantitative polymerase chain reaction. Results p53 expression was detected in 18% of non-anaplastic medulloblastomas, 45% of anaplastic medulloblastomas, 67% of ATRT, and 88% of sPNET. The increased p53 immunoreactivity in anaplastic medulloblastoma, ATRT, and sPNET was statistically significant. Log rank analysis of clinical outcome revealed significantly shorter survival in patients with p53 immunopositive embryonal tumors. No JC virus was identified in the embryonal brain tumor samples, while an endogenous human retrovirus (ERV-3) was readily detected. Conclusion Immunoreactivity for p53 protein is more common in anaplastic medulloblastomas, ATRT and sPNET than in non-anaplastic tumors, and is associated with worse clinical outcomes. However, JC virus infection is not responsible for increased levels of p53 protein. PMID:15717928

  3. Inhibition of GSK3B bypass drug resistance of p53-null colon carcinomas by enabling necroptosis in response to chemotherapy

    DEFF Research Database (Denmark)

    Grassilli, Emanuela; Narloch, Robert; Federzoni, Elena

    2013-01-01

    Evasion from chemotherapy-induced apoptosis due to p53 loss strongly contributes to drug resistance. Identification of specific targets for the treatment of drug-resistant p53-null tumors would therefore increase the effectiveness of cancer therapy....

  4. p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

    Directory of Open Access Journals (Sweden)

    Karolyn J Forget

    Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

  5. Patulin causes DNA damage leading to cell cycle arrest and apoptosis through modulation of Bax, p53 and p21/WAF1 proteins in skin of mice

    International Nuclear Information System (INIS)

    Saxena, Neha; Ansari, Kausar M.; Kumar, Rahul; Dhawan, Alok; Dwivedi, Premendra D.; Das, Mukul

    2009-01-01

    Patulin (PAT), a mycotoxin found in apples, grapes, oranges, pear and peaches, is a potent genotoxic compound. WHO has highlighted the need for the study of cutaneous toxicity of PAT as manual labour is employed during pre and post harvest stages, thereby causing direct exposure to skin. In the present study cutaneous toxicity of PAT was evaluated following topical application to Swiss Albino mice. Dermal exposure of PAT, to mice for 4 h resulted in a dose (40-160 μg/animal) and time (up to 6 h) dependent enhancement of ornithine decarboxylase (ODC), a marker enzyme of cell proliferation. The ODC activity was found to be normal after 12 and 24 h treatment of patulin. Topical application of PAT (160 μg/100 μl acetone) for 24-72 h caused (a) DNA damage in skin cells showing significant increase (34-63%) in olive tail moment, a parameter of Comet assay (b) significant G 1 and S-phase arrest along with induction of apoptosis (2.8-10 folds) as shown by annexin V and PI staining assay through flow cytometer. Moreover PAT leads to over expression of p 21/WAF1 (3.6-3.9 fold), pro apoptotic protein Bax (1.3-2.6) and tumor suppressor wild type p 53 (2.8-3.9 fold) protein. It was also shown that PAT induced apoptosis was mediated through mitochondrial intrinsic pathway as revealed through the release of cytochrome C protein in cytosol leading to enhancement of caspase-3 activity in skin cells of mice. These results suggest that PAT has a potential to induce DNA damage leading to p 53 mediated cell cycle arrest along with intrinsic pathway mediated apoptosis that may also be correlated with enhanced polyamine production as evident by induction of ODC activity, which may have dermal toxicological implications

  6. Urodele p53 tolerates amino acid changes found in p53 variants linked to human cancer

    Directory of Open Access Journals (Sweden)

    Villiard Éric

    2007-09-01

    Full Text Available Abstract Background Urodele amphibians like the axolotl are unique among vertebrates in their ability to regenerate and their resistance to develop cancers. It is unknown whether these traits are linked at the molecular level. Results Blocking p53 signaling in axolotls using the p53 inhibitor, pifithrin-α, inhibited limb regeneration and the expression of p53 target genes such as Mdm2 and Gadd45, suggesting a link between tumor suppression and regeneration. To understand this relationship we cloned the p53 gene from axolotl. When comparing its sequence with p53 from other organisms, and more specifically human we observed multiple amino acids changes found in human tumors. Phylogenetic analysis of p53 protein sequences from various species is in general agreement with standard vertebrate phylogeny; however, both mice-like rodents and teleost fishes are fast evolving. This leads to long branch attraction resulting in an artefactual basal emergence of these groups in the phylogenetic tree. It is tempting to assume a correlation between certain life style traits (e.g. lifespan and the evolutionary rate of the corresponding p53 sequences. Functional assays of the axolotl p53 in human or axolotl cells using p53 promoter reporters demonstrated a temperature sensitivity (ts, which was further confirmed by performing colony assays at 37°C. In addition, axolotl p53 was capable of efficient transactivation at the Hmd2 promoter but has moderate activity at the p21 promoter. Endogenous axolotl p53 was activated following UV irradiation (100 j/m2 or treatment with an alkylating agent as measured using serine 15 phosphorylation and the expression of the endogenous p53 target Gadd45. Conclusion Urodele p53 may play a role in regeneration and has evolved to contain multiple amino acid changes predicted to render the human protein defective in tumor suppression. Some of these mutations were probably selected to maintain p53 activity at low temperature. However

  7. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    Science.gov (United States)

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  8. The influence of sleep deprivation on expression of apoptosis regulatory proteins p53, bcl-2 and bax following rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide

    Directory of Open Access Journals (Sweden)

    Juliana Noguti

    2013-01-01

    Full Text Available Background: The aim of this study was to evaluate whether paradoxical sleep deprivation could affects the mechanisms and pathways essentials for cancer cells in tongue cancer induced by 4-nitroquinole 1-oxide in Wistar rats. Materials and Methods: For this purpose, the animals were distributed into 4 groups of 5 animals each treated with 50 ppm 4 nitroquinoline 1 oxide (4 NQO solution through their drinking water for 4 and 12 weeks. The animals were submitted to paradoxical sleep deprivation (PSD for 72 h using the modified multiple platform method, which consisted of placing 5 mice in a cage (41 × 34 × 16 cm containing 10 circular platforms (3.5 cm in diameter with water 1 cm below the upper surface. The investigations were conducted using immunohistochemistry of p53, Bax and Bcl-2 proteins related to apoptosis and its pathways. Statistical analysis was performed by Kruskal-Wallis non-parametric test followed by the Dunn′s test using SPSS software pack (version 1.0. P value < 0.05 was considered for statistic significance. Results: Although no histopathological abnormalities were induced in the epithelium after 4 weeks of carcinogen exposure in all groups, in 12 weeks were observed pre-neoplasic lesions. Data analysis revealed statistically significant differences ( P < 0.05 in 4 weeks group for p53 and for bcl-2 and for all immunomarkers after 12 weeks of 4NQO administration. Conclusion: Our results reveal that sleep deprivation exerted alterations in proteins associated with proliferation and apoptosis in carcinogenesis.

  9. SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

    International Nuclear Information System (INIS)

    Milner, J.; Gamble, J.

    1985-01-01

    The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

  10. S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

    Science.gov (United States)

    Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

    2013-12-05

    S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

  11. Genetic Stabilization by p53 Involves Growth Regulatory and Repair Pathways

    Directory of Open Access Journals (Sweden)

    Lisa Wiesmüller

    2001-01-01

    Full Text Available p53 performs a plethora of activities, which are directed towards the maintenance of the genomic integrity and constitute its universal role as a tumor suppressor. 1000 to 10000 latent p53 molecules are permanently available in order to monitor DNA exchange processes in mitotically growing cells. After the introduction of major DNA injuries the levels of posttranslationally modified p53 proteins rise, which in turn transcriptionally signal transient cell cycle arrest or apoptotic cell death, depending on the extent of damage. Taken together, p53 inhibits the manifestation of genomic instabilities at different control levels both during naturally occurring metabolic processes and in response to genotoxic treatments.

  12. A p53-like transcription factor similar to Ndt80 controls the response to nutrient stress in the filamentous fungus, Aspergillus nidulans [v1; ref status: indexed, http://f1000r.es/y2

    Directory of Open Access Journals (Sweden)

    Margaret E Katz

    2013-03-01

    Full Text Available The Aspergillus nidulans xprG gene encodes a putative transcriptional activator that is a member of the Ndt80 family in the p53-like superfamily of proteins. Previous studies have shown that XprG controls the production of extracellular proteases in response to starvation. We undertook transcriptional profiling to investigate whether XprG has a wider role as a global regulator of the carbon nutrient stress response. Our microarray data showed that the expression of a large number of genes, including genes involved in secondary metabolism, development, high-affinity glucose uptake and autolysis, were altered in an xprGΔ null mutant. Many of these genes are known to be regulated in response to carbon starvation. We confirmed that sterigmatocystin and penicillin production is reduced in xprG- mutants. The loss of fungal mass and secretion of pigments that accompanies fungal autolysis in response to nutrient depletion was accelerated in an xprG1 gain-of-function mutant and decreased or absent in an xprG- mutant. The results support the hypothesis that XprG plays a major role in the response to carbon limitation and that nutrient sensing may represent one of the ancestral roles for the p53-like superfamily. Disruption of the AN6015 gene, which encodes a second Ndt80-like protein, showed that it is required for sexual reproduction in A. nidulans.

  13. Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

    Science.gov (United States)

    Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

    2012-01-01

    The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

  14. The different radiation response and radiation-induced bystander effects in colorectal carcinoma cells differing in p53 status.

    Science.gov (United States)

    Widel, Maria; Lalik, Anna; Krzywon, Aleksandra; Poleszczuk, Jan; Fujarewicz, Krzysztof; Rzeszowska-Wolny, Joanna

    2015-08-01

    Radiation-induced bystander effect, appearing as different biological changes in cells that are not directly exposed to ionizing radiation but are under the influence of molecular signals secreted by irradiated neighbors, have recently attracted considerable interest due to their possible implication for radiotherapy. However, various cells present diverse radiosensitivity and bystander responses that depend, inter alia, on genetic status including TP53, the gene controlling the cell cycle, DNA repair and apoptosis. Here we compared the ionizing radiation and bystander responses of human colorectal carcinoma HCT116 cells with wild type or knockout TP53 using a transwell co-culture system. The viability of exposed to X-rays (0-8 Gy) and bystander cells of both lines showed a roughly comparable decline with increasing dose. The frequency of micronuclei was also comparable at lower doses but at higher increased considerably, especially in bystander TP53-/- cells. Moreover, the TP53-/- cells showed a significantly elevated frequency of apoptosis, while TP53+/+ counterparts expressed high level of senescence. The cross-matched experiments where irradiated cells of one line were co-cultured with non-irradiated cells of opposite line show that both cell lines were also able to induce bystander effects in their counterparts, however different endpoints revealed with different strength. Potential mediators of bystander effects, IL-6 and IL-8, were also generated differently in both lines. The knockout cells secreted IL-6 at lower doses whereas wild type cells only at higher doses. Secretion of IL-8 by TP53-/- control cells was many times lower than that by TP53+/+ but increased significantly after irradiation. Transcription of the NFκBIA was induced in irradiated TP53+/+ mainly, but in bystanders a higher level was observed in TP53-/- cells, suggesting that TP53 is required for induction of NFκB pathway after irradiation but another mechanism of activation must operate in

  15. miR-34 and p53: New Insights into a Complex Functional Relationship.

    Directory of Open Access Journals (Sweden)

    Francisco Navarro

    Full Text Available miR-34, a tumor suppressor miRNA family transcriptionally activated by p53, is considered a critical mediator of p53 function. However, knockout of the mouse miR-34 family has little or no effect on the p53 response. The relative contribution of different miR-34 family members to p53 function or how much p53 relies on miR-34 in human cells is unclear. Here we show that miR-34a has a complex effect on the p53 response in human cells. In HCT116 cells miR-34a overexpression enhances p53 transcriptional activity, but the closely related family members, miR-34b and miR-34c, even when over-expressed, have little effect. Both TP53 itself and MDM4, a strong p53 transactivation inhibitor, are direct targets of miR-34a. The genes regulated by miR-34a also include four other post-translational inhibitors of p53. miR-34a overexpression leads to variable effects on p53 levels in p53-sufficient human cancer cell lines. In HCT116, miR-34a overexpression increases p53 protein levels and stability. About a quarter of all mRNAs that participate in the human p53 network bind to biotinylated miR-34a, suggesting that many are direct miR-34a targets. However, only about a fifth of the mRNAs that bind to miR-34a also bind to miR-34b or miR-34c. Two human cell lines knocked out for miR-34a have unimpaired p53-mediated responses to genotoxic stress, like mouse cells. The complex positive and negative effects of miR-34 on the p53 network suggest that rather than simply promoting the p53 response, miR-34a might act at a systems level to stabilize the robustness of the p53 response to genotoxic stress.

  16. Proinflammatory cytokines and bile acids upregulate ΔNp73 protein, an inhibitor of p53 and p73 tumor suppressors.

    Directory of Open Access Journals (Sweden)

    Elena Zaika

    Full Text Available Gastroesophageal reflux disease (GERD is the main etiological factor behind the recent rapid increase in the incidence of esophageal adenocarcinoma. During reflux, esophageal cells are exposed to bile at low pH resulting in cellular damage and inflammation, which are known to facilitate cancer development. In this study, we investigated the regulation of p73 isoform, ΔNp73α, in the reflux condition. Previous studies have reported that ΔNp73 exhibits anti-apoptotic and oncogenic properties through inhibition of p53 and p73 proteins. We found that direct exposure of esophageal cells to bile acids in an acidic environment alters the phosphorylation of ΔNp73, its subcellular localization and increases ΔNp73 protein levels. Upregulation of ΔNp73 was also observed in esophageal tissues collected from patients with GERD and Barrett's metaplasia, a precancerous lesion in the esophagus associated with gastric reflux. c-Abl, p38 MAPK, and IKK protein kinases were identified to interact in the regulation of ΔNp73. Their inhibition with chemotherapeutic agents and siRNA suppresses ΔNp73. We also found that pro-inflammatory cytokines, IL-1β and TNFα, are potent inducers of ΔNp73α, which further enhance the bile acids/acid effect. Combined, our studies provide evidence that gastroesophageal reflux alters the regulation of oncogenic ΔNp73 isoform that may facilitate tumorigenic transformation of esophageal metaplastic epithelium.

  17. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    Science.gov (United States)

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  18. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    Science.gov (United States)

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  19. Novel histone deacetylase inhibitor CG200745 induces clonogenic cell death by modulating acetylation of p53 in cancer cells.

    Science.gov (United States)

    Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo

    2012-04-01

    Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.

  20. Regulation of p53, nuclear factor κB and cyclooxygenase-2 expression by bromelain through targeting mitogen-activated protein kinase pathway in mouse skin

    International Nuclear Information System (INIS)

    Kalra, Neetu; Bhui, Kulpreet; Roy, Preeti; Srivastava, Smita; George, Jasmine; Prasad, Sahdeo; Shukla, Yogeshwer

    2008-01-01

    Bromelain is a pharmacologically active compound, present in stems and immature fruits of pineapples (Ananas cosmosus), which has been shown to have anti-edematous, anti-inflammatory, anti-thrombotic and anti-metastatic properties. In the present study, antitumorigenic activity of bromelain was recorded in 7,12-dimethylbenz(a)anthracene (DMBA)-initiated and 12-O-tetradecanoylphorbol-13-acetate (TPA)-promoted 2-stage mouse skin model. Results showed that bromelain application delayed the onset of tumorigenesis and reduced the cumulative number of tumors, tumor volume and the average number of tumors/mouse. To establish a cause and effect relationship, we targeted the proteins involved in the cell death pathway. Bromelain treatment resulted in upregulation of p53 and Bax and subsequent activation of caspase 3 and caspase 9 with concomitant decrease in antiapoptotic protein Bcl-2 in mouse skin. Since persistent induction of cyclooxygenase-2 (Cox-2) is frequently implicated in tumorigenesis and is regulated by nuclear factor-kappa B (NF-κB), we also investigated the effect of bromelain on Cox-2 and NF-κB expression. Results showed that bromelain application significantly inhibited Cox-2 and inactivated NF-κB by blocking phosphorylation and subsequent degradation of IκBα. In addition, bromelain treatment attenuated DMBA-TPA-induced phosphorylation of extracellular signal-regulated protein kinase (ERK1/2), mitogen-activated protein kinase (MAPK) and Akt. Taken together, we conclude that bromelain induces apoptosis-related proteins along with inhibition of NF-κB-driven Cox-2 expression by blocking the MAPK and Akt/protein kinase B signaling in DMBA-TPA-induced mouse skin tumors, which may account for its anti-tumorigenic effects

  1. The expanding regulatory universe of p53 in gastrointestinal cancer.

    Science.gov (United States)

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  2. Effects of Polybrominated Diphenyl Ethers on DNA Damage and p53 Protein Expression in Carassius auratus Linn.%多溴联苯醚对鲫鱼组织DNA损伤及p53蛋白表达的影响

    Institute of Scientific and Technical Information of China (English)

    吴伟; 瞿建宏; 陈家长; 聂凤琴

    2011-01-01

    以鲫鱼(Carawsius auratus)为试验材料,研究了经不同浓度的2,2’,4,4’-四溴联苯醚(PBDE-47)和十溴联苯醚(PBDE-209)暴露后,鲫鱼体内DNA损伤产物8-羟基脱氧鸟苷(8-OHdG)的含量及p53蛋白的水平.结果表明,采用浓度为0.10~5.00 mg·L-1的PBDE-47和10.0~50.0mg·L-1的PBDE-209处理鲫鱼20d,除了0.10 mg·L-1 PBDE-47和10.0 mg·L-1 PBDE-209浓度组的8-OHdG和p53蛋白含量与对照组相比无显著差异(P>0.05),其余各浓度组的8-OHdG和p53蛋白含量均随PBDE-47和PBDE-209浓度增加而逐渐上升,呈显著的相关关系(P<0.01),且8-OHdG和p53蛋白之间也呈显著的正相关.说明PBDE-47和PBDE-209对鲫鱼组织的DNA产生了损伤,具有遗传毒性影响.%Persistent organic pollutants(POPs) has a long-term threat to different biota, including aquatic animals, mammals, especially humans, due to their biomagnified effect in food chain, the study on the toxic effect of POPs to aquatic animals was evidently important and concerned. This paper discussed the variation of DNA-damage product 8-Hydroxy-desoxyguanosine(8-OHdG) and p53 protein to Carassius awatus in exposed to poly -brominated diphenyl ethers (PBDE-47 and PBDE-209), where the exposed dose of PBDE-47 and PBDE-209 ranged from 0.10 to 5.00 mg·L-1 and 10.0 to 50.0 mg·L-1, respectively. The results showed that, DNA-damage product 8-OHdC and p53 protein were generated extraordinary in all treatment lasted for 20 days, expectihe 0.1 mg·L-1 in PBDE-47 and 10.0 mg·L-1 in PBDE-209. The variation of 8-OHdC and p53 protein to Carassius awatus when exposed to PBDE-47 and PBDE-209 were significantly dose-depend (P<0.01), respectively, and the variation of 8-OHdC was significantly correlated with the variation of p53 protein as well. The results indicated that, the genotoxic effect, characterized by DNA-damage product, such as 8-OHdC and p53 protein in Carassius awatus when exposed to PBDE-47 and PBDE-209 were produced. The paper provided more

  3. Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

    Science.gov (United States)

    Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

    2015-01-01

    Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

  4. p53 and ARF: Unexpected players in autophagy

    OpenAIRE

    Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

    2010-01-01

    p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

  5. Newly synthesized quinazolinone HMJ-38 suppresses angiogenetic responses and triggers human umbilical vein endothelial cell apoptosis through p53-modulated Fas/death receptor signaling

    Energy Technology Data Exchange (ETDEWEB)

    Chiang, Jo-Hua [Department of Life Sciences, National Chung Hsing University, 250, Kuo-Kuang Road, Taichung 402, Taiwan (China); Yang, Jai-Sing [Department of Pharmacology, China Medical University, Taichung 404, Taiwan (China); Lu, Chi-Cheng [Department of Life Sciences, National Chung Hsing University, 250, Kuo-Kuang Road, Taichung 402, Taiwan (China); Hour, Mann-Jen; Chang, Shu-Jen [School of Pharmacy, China Medical University, Taichung 40402, Taiwan (China); Lee, Tsung-Han, E-mail: thlee@email.nchu.edu.tw [Department of Life Sciences, National Chung Hsing University, 250, Kuo-Kuang Road, Taichung 402, Taiwan (China); Department of Biological Science and Technology, China Medical University, 91, Hsueh-Shih Road, Taichung 404, Taiwan (China); Chung, Jing-Gung, E-mail: jgchung@mail.cmu.edu.tw [Department of Biological Science and Technology, China Medical University, 91, Hsueh-Shih Road, Taichung 404, Taiwan (China); Department of Biotechnology, Asia University, Taichung 413, Taiwan (China)

    2013-06-01

    The current study aims to investigate the antiangiogenic responses and apoptotic death of human umbilical vein endothelial cells (HUVECs) by a newly synthesized compound named 2-(3′-methoxyphenyl)-6-pyrrolidinyl-4-quinazolinone (HMJ-38). This work attempted to not only explore the effects of angiogenesis on in vivo and ex vivo studies but also hypothesize the implications for HUVECs (an ideal cell model for angiogenesis in vitro) and further undermined apoptotic experiments to verify the underlying molecular signaling by HMJ-38. Our results demonstrated that HMJ-38 significantly inhibited blood vessel growth and microvessel formation by the mouse Matrigel plug assay of angiogenesis, and the suppression of microsprouting from the rat aortic ring assay was observed after HMJ-38 exposure. In addition, HMJ-38 disrupted the tube formation and blocked the ability of HUVECs to migrate in response to VEGF. We also found that HMJ-38 triggered cell apoptosis of HUVECs in vitro. HMJ-38 concentration-dependently suppressed viability and induced apoptotic damage in HUVECs. HMJ-38-influenced HUVECs were performed by determining the oxidative stress (ROS production) and ATM/p53-modulated Fas and DR4/DR5 signals that were examined by flow cytometry, Western blotting, siRNA and real-time RT-PCR analyses, respectively. Our findings demonstrate that p53-regulated extrinsic pathway might fully contribute to HMJ-38-provoked apoptotic death in HUVECs. In view of these observations, we conclude that HMJ-38 reduces angiogenesis in vivo and ex vivo as well as induces apoptosis of HUVECs in vitro. Overall, HMJ-38 has a potent anti-neovascularization effect and could warrant being a vascular targeting agent in the future. - Highlights: • HMJ-38 suppresses angiogenic actions in vivo and ex vivo. • Inhibitions of blood vessel and microvessel formation by HMJ-38 are acted. • Cytotoxic effects of HUVECs occur by HMJ-38 challenge. • p53-modulated extrinsic pathway contributes to HMJ-38

  6. Absence of p53 in Clara cells favours multinucleation and loss of cell cycle arrest

    Directory of Open Access Journals (Sweden)

    Clarke Alan R

    2002-11-01

    Full Text Available Abstract Background The p53 oncosuppressor protein is a critical mediator of the response to injury in mammalian cells and is mutationally inactivated in the majority of lung malignancies. In this analysis, the effects of p53-deficiency were investigated in short-term primary cultures of murine bronchiolar Clara cells. Clara cells, isolated from gene-targeted p53-deficient mice, were compared to cells derived from wild type littermates. Results p53 null cultures displayed abnormal morphology; specifically, a high incidence of multinucleation, which increased with time in culture. Multinucleated cells were proficient in S phase DNA synthesis, as determined by BrdU incorporation. However, multinucleation did not reflect altered rates of S phase synthesis, which were similar between wild type and p53-/- cultures. Nucleation defects in p53-/- Clara cells associated with increased centrosome number, as determined by confocal microscopy of pericentrin-stained cultures, and may highlight a novel role of p53 in preserving genomic integrity in lung epithelial cells. Effects of p53-deficiency were also studied following exposure to DNA damage. A p53-dependent reduction in the BrdU index was observed in Clara cells following ionizing radiation. The reduction in BrdU index in wild type cells displayed serum-dependency, and occurred only in the absence of serum. Taken together, these findings demonstrate that in murine primary Clara cell culture, cell cycle arrest is a p53-mediated response to DNA damage, and that extracellular factors, such as serum, influence this response. Conclusion These findings highlight functions of wild type p53 protein in bipolar spindle formation, centrosome regulation, and growth control in bronchiolar Clara cells.

  7. Avian Reovirus Protein p17 Functions as a Nucleoporin Tpr Suppressor Leading to Activation of p53, p21 and PTEN and Inactivation of PI3K/AKT/mTOR and ERK Signaling Pathways.

    Directory of Open Access Journals (Sweden)

    Wei-Ru Huang

    Full Text Available Avian reovirus (ARV protein p17 has been shown to regulate cell cycle and autophagy by activation of p53/PTEN pathway; nevertheless, it is still unclear how p53 and PTEN are activated by p17. Here, we report for the first time that p17 functions as a nucleoporin Tpr suppressor that leads to p53 nuclear accumulation and consequently activates p53, p21, and PTEN. The nuclear localization signal (119IAAKRGRQLD128 of p17 has been identified for Tpr binding. This study has shown that Tpr suppression occurs by p17 interacting with Tpr and by reducing the transcription level of Tpr, which together inhibit Tpr function. In addition to upregulation of PTEN by activation of p53 pathway, this study also suggests that ARV protein p17 acts as a positive regulator of PTEN. ARV p17 stabilizes PTEN by stimulating phosphorylation of cytoplasmic PTEN and by elevating Rak-PTEN association to prevent it from E3 ligase NEDD4-1 targeting. To activate PTEN, p17 is able to promote β-arrestin-mediated PTEN translocation from the cytoplasm to the plasma membrane via a Rock-1-dependent manner. The accumulation of p53 in the nucleus induces the PTEN- and p21-mediated downregulation of cyclin D1 and CDK4. Furthermore, Tpr and CDK4 knockdown increased virus production in contrast to depletion of p53, PTEN, and LC3 reducing virus yield. Taken together, our data suggest that p17-mediated Tpr suppression positively regulates p53, PTEN, and p21 and negatively regulates PI3K/AKT/mTOR and ERK signaling pathways, both of which are beneficial for virus replication.

  8. Gene Expression Profiling Identifies Important Genes Affected by R2 Compound Disrupting FAK and P53 Complex

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M.; Ho, Baotran; Conroy, Jeffrey; Liu, Song; Wang, Dan; Cance, William G.

    2014-01-01

    Focal Adhesion Kinase (FAK) is a non-receptor kinase that plays an important role in many cellular processes: adhesion, proliferation, invasion, angiogenesis, metastasis and survival. Recently, we have shown that Roslin 2 or R2 (1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~]decane) compound disrupts FAK and p53 proteins, activates p53 transcriptional activity, and blocks tumor growth. In this report we performed a microarray gene expression analysis of R2-treated HCT116 p53 +/+ and p53 −/− cells and detected 1484 genes that were significantly up- or down-regulated (p < 0.05) in HCT116 p53 +/+ cells but not in p53 −/− cells. Among up-regulated genes in HCT p53 +/+ cells we detected critical p53 targets: Mdm-2, Noxa-1, and RIP1. Among down-regulated genes, Met, PLK2, KIF14, BIRC2 and other genes were identified. In addition, a combination of R2 compound with M13 compound that disrupts FAK and Mmd-2 complex or R2 and Nutlin-1 that disrupts Mdm-2 and p53 decreased clonogenicity of HCT116 p53 +/+ colon cancer cells more significantly than each agent alone in a p53-dependent manner. Thus, the report detects gene expression profile in response to R2 treatment and demonstrates that the combination of drugs targeting FAK, Mdm-2, and p53 can be a novel therapy approach

  9. Análise comparativa da imunoexpressão da proteína p53 (clones DO-7 e PAb-240 em carcinomas de células escamosas intrabucais e labiais Comparative analysis of p53 protein immunostaining (antibodies DO-7 and PAb-240 in oral cavity and lip squamous cell carcinomas

    Directory of Open Access Journals (Sweden)

    José de Assis Silva Júnior

    2009-08-01

    .BACKGROUND: Carcinogenesis is a multifactorial process and inactivation of p53 protein is a genetic change commonly observed in oral squamous cell carcinomas (OSCC. OBJECTIVES: To analyze and compare the expression of p53 protein through antibodies DO-7 and PAb-240 in OSCC samples located in the oral cavity and lower lip. MATERIAL AND METHODS: Forty cases of OSCC were selected and divided into oral cavity and lower lip groups (20 cases each. Immunohistochemical technique was performed using antibodies DO-7 and PAb-240. Quantification of the cases was performed through digital image analysis and underwent specific statistical treatments. RESULTS: Expression of p53 protein was verified with DO-7 antibody in 13 cases (65% of oral cavity carcinomas and in 19 cases (95% of lower lip carcinoma. PAb-240 positivity was detected in 9 cases (45% of oral cavity lesions and in 15 cases (75% located in the lower lip. According to Mann-Whitney test, there were no statistically significant differences between the expressions of p53 protein in both groups, regardless of the antibody used. According to Wilcoxon test, there were statistically significant differences between the expression of DO-7 antibody and PAb-240 in each of the analyzed groups (p-value = 0.013; lower lip p-value = 0.016 - oral cavity. CONCLUSIONS: The expression of p53 protein was observed both in the oral cavity and lip OSCC, which suggests the occurrence of mutations in TP53 gene. The quantitative differences between the antibodies studied, regardless of the site of the lesions, reflect different specificity between clones DO-7 and PAb-240. Further studies are required to establish the best antibody for p53 protein in oral squamous cell carcinomas.

  10. Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

    Directory of Open Access Journals (Sweden)

    Lu Xin

    2009-06-01

    Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

  11. P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

    International Nuclear Information System (INIS)

    Mukh-Syaifudin

    2006-01-01

    Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

  12. The adenovirus oncoprotein E1a stimulates binding of transcription factor ETF to transcriptionally activate the p53 gene.

    Science.gov (United States)

    Hale, T K; Braithwaite, A W

    1999-08-20

    Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.

  13. Acrylonitrile exposure: the effect on p53 and p21WAF1 protein levels in the blood plasma of occupationally exposed workers and in vitro in human diploid lung fibroblasts

    Czech Academy of Sciences Publication Activity Database

    Rössner ml., Pavel; Binková, Blanka; Chvátalová, Irena; Šrám, Radim

    č. 517 (2002), s. 239-250 ISSN 0027-5107 R&D Projects: GA MŽP SI/340/1/97 Institutional research plan: CEZ:AV0Z5039906 Keywords : Acrylonitrile * p53 protein * p21WAF1 protein Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.158, year: 2002

  14. The Histone Lysine Demethylase JMJD3/KDM6B Is Recruited to p53 Bound Promoters and Enhancer Elements in a p53 Dependent Manner

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Rappsilber, Juri

    2014-01-01

    linked to the regulation of different biological processes such as differentiation of embryonic stem cells, inflammatory responses in macrophages, and induction of cellular senescence via regulation of the INK4A-ARF locus. Here we show here that JMJD3 interacts with the tumour suppressor protein p53. We...... find that the interaction is dependent on the p53 tetramerization domain. Following DNA damage, JMJD3 is transcriptionally upregulated and by performing genome-wide mapping of JMJD3, we demonstrate that it binds genes involved in basic cellular processes, as well as genes regulating cell cycle......, response to stress and apoptosis. Moreover, we find that JMJD3 binding sites show significant overlap with p53 bound promoters and enhancer elements. The binding of JMJD3 to p53 target sites is increased in response to DNA damage, and we demonstrate that the recruitment of JMJD3 to these sites is dependent...

  15. Chemotherapy-Induced Apoptosis in a Transgenic Model of Neuroblastoma Proceeds Through p53 Induction

    Directory of Open Access Journals (Sweden)

    Louis Chesler

    2008-11-01

    Full Text Available Chemoresistance in neuroblastoma is a significant issue complicating treatment of this common pediatric solid tumor. MYCN-amplified neuroblastomas are infrequently mutated at p53 and are chemosensitive at diagnosis but acquire p53 mutations and chemoresistance with relapse. Paradoxically, Myc-driven transformation is thought to require apoptotic blockade. We used the TH-MYCN transgenic murine model to examine the role of p53-driven apoptosis on neuroblastoma tumorigenesis and the response to chemotherapy. Tumors formed with high penetrance and low latency in p53-haploinsufficient TH-MYCN mice. Cyclophosphamide (CPM induced a complete remission in p53 wild type TH-MYCN tumors, mirroring the sensitivity of childhood neuroblastoma to this agent. Treated tumors showed a prominent proliferation block, induction of p53 protein, and massive apoptosis proceeding through induction of the Bcl-2 homology domain-3-only proteins PUMA and Bim, leading to the activation of Bax and cleavage of caspase-3 and -9. Apoptosis induced by CPM was reduced in p53-haploinsufficient tumors. Treatment of MYCN-expressing human neuroblastoma cell lines with CPM induced apoptosis that was suppressible by siRNA to p53. Taken together, the results indicate that the p53 pathway plays a significant role in opposing MYCN-driven oncogenesis in a mouse model of neuroblastoma and that basal inactivation of the pathway is achieved in progressing tumors. This, in part, explains the striking sensitivity of such tumors to chemotoxic agents that induce p53-dependent apoptosis and is consistent with clinical observations that therapy-associated mutations in p53 are a likely contributor to the biology of tumors at relapse and secondarily mediate resistance to therapy.

  16. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    Science.gov (United States)

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  17. Human surfactant protein D alters oxidative stress and HMGA1 expression to induce p53 apoptotic pathway in eosinophil leukemic cell line.

    Directory of Open Access Journals (Sweden)

    Lakshna Mahajan

    Full Text Available Surfactant protein D (SP-D, an innate immune molecule, has an indispensable role in host defense and regulation of inflammation. Immune related functions regulated by SP-D include agglutination of pathogens, phagocytosis, oxidative burst, antigen presentation, T lymphocyte proliferation, cytokine secretion, induction of apoptosis and clearance of apoptotic cells. The present study unravels a novel ability of SP-D to reduce the viability of leukemic cells (eosinophilic leukemic cell line, AML14.3D10; acute myeloid leukemia cell line, THP-1; acute lymphoid leukemia cell lines, Jurkat, Raji; and human breast epithelial cell line, MCF-7, and explains the underlying mechanisms. SP-D and a recombinant fragment of human SP-D (rhSP-D induced G2/M phase cell cycle arrest, and dose and time-dependent apoptosis in the AML14.3D10 eosinophilic leukemia cell line. Levels of various apoptotic markers viz. activated p53, cleaved caspase-9 and PARP, along with G2/M checkpoints (p21 and Tyr15 phosphorylation of cdc2 showed significant increase in these cells. We further attempted to elucidate the underlying mechanisms of rhSP-D induced apoptosis using proteomic analysis. This approach identified large scale molecular changes initiated by SP-D in a human cell for the first time. Among others, the proteomics analysis highlighted a decreased expression of survival related proteins such as HMGA1, overexpression of proteins to protect the cells from oxidative burst, while a drastic decrease in mitochondrial antioxidant defense system. rhSP-D mediated enhanced oxidative burst in AML14.3D10 cells was confirmed, while antioxidant, N-acetyl-L-cysteine, abrogated the rhSP-D induced apoptosis. The rhSP-D mediated reduced viability was specific to the cancer cell lines and viability of human PBMCs from healthy controls was not affected. The study suggests involvement of SP-D in host's immunosurveillance and therapeutic potential of rhSP-D in the eosinophilic leukemia and

  18. Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

    International Nuclear Information System (INIS)

    Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

    2003-01-01

    The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

  19. Molecular markers for diagnostic cytology of neoplasms in the head region of the pancreas: mutation of K-ras and overexpression of the p53 protein product

    NARCIS (Netherlands)

    van Es, J. M.; Polak, M. M.; van den Berg, F. M.; Ramsoekh, T. B.; Craanen, M. E.; Hruban, R. H.; Offerhaus, G. J.

    1995-01-01

    To determine the potential efficiency of molecular markers specific for neoplastic change--mutations of the K-ras oncogene and the p53 tumour suppressor gene--in diagnosing pancreatic carcinoma. Archival cytology samples obtained from 17 patients with established pancreatic carcinoma were assayed

  20. Enzastaurin inhibits ABCB1-mediated drug efflux independently of effects on protein kinase C signalling and the cellular p53 status.

    Science.gov (United States)

    Michaelis, Martin; Rothweiler, Florian; Löschmann, Nadine; Sharifi, Mohsen; Ghafourian, Taravat; Cinatl, Jindrich

    2015-07-10

    The PKCβ inhibitor enzastaurin was tested in parental neuroblastoma and rhabdomyosarcoma cell lines, their vincristine-resistant sub-lines, primary neuroblastoma cells, ABCB1-transduced, ABCG2-transduced, and p53-depleted cells. Enzastaurin IC50s ranged from 3.3 to 9.5 μM in cell lines and primary cells independently of the ABCB1, ABCG2, or p53 status. Enzastaurin 0.3125 μM interfered with ABCB1-mediated drug transport. PKCα and PKCβ may phosphorylate and activate ABCB1 under the control of p53. However, enzastaurin exerted similar effects on ABCB1 in the presence or absence of functional p53. Also, enzastaurin inhibited PKC signalling only in concentrations ≥ 1.25 μM. The investigated cell lines did not express PKCβ. PKCα depletion reduced PKC signalling but did not affect ABCB1 activity. Intracellular levels of the fluorescent ABCB1 substrate rhodamine 123 rapidly decreased after wash-out of extracellular enzastaurin, and enzastaurin induced ABCB1 ATPase activity resembling the ABCB1 substrate verapamil. Computational docking experiments detected a direct interaction of enzastaurin and ABCB1. These data suggest that enzastaurin directly interferes with ABCB1 function. Enzastaurin further inhibited ABCG2-mediated drug transport but by a different mechanism since it reduced ABCG2 ATPase activity. These findings are important for the further development of therapies combining enzastaurin with ABC transporter substrates.

  1. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    Science.gov (United States)

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    Science.gov (United States)

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional

  3. Co-expression of antioxidant enzymes with expression of p53, DNA repair, and heat shock protein genes in the gamma ray-irradiated hermaphroditic fish Kryptolebias marmoratus larvae

    Energy Technology Data Exchange (ETDEWEB)

    Rhee, Jae-Sung [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, Bo-Mi; Kim, Ryeo-Ok [Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Seo, Jung Soo [Pathology Team, National Fisheries Research and Development Institute, Busan 619-902 (Korea, Republic of); Kim, Il-Chan [Division of Life Sciences, Korea Polar Research Institute, Korea Institute of Ocean Science and Technology, Incheon 406-840 (Korea, Republic of); Lee, Young-Mi, E-mail: ymlee70@smu.ac.kr [Department of Green Life Science, College of Convergence, Sangmyung University, Seoul 110-743 (Korea, Republic of); Lee, Jae-Seong, E-mail: jslee2@hanyang.ac.kr [Research Institute for Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of); Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791 (Korea, Republic of)

    2013-09-15

    Highlights: •Novel identification of DNA repair-related genes in fish. •Investigation of whole expression profiling of DNA repair genes upon gamma radiation. •Analysis of effects of gamma radiation on antioxidant system and cell stress proteins. •Usefulness of verification of pathway-based profiling for mechanistic understanding. -- Abstract: To investigate effects of gamma ray irradiation in the hermaphroditic fish, Kryptolebias marmoratus larvae, we checked expression of p53, DNA repair, and heat shock protein genes with several antioxidant enzyme activities by quantitative real-time RT-PCR and biochemical methods in response to different doses of gamma radiation. As a result, the level of gamma radiation-induced DNA damage was initiated after 4 Gy of radiation, and biochemical and molecular damage became substantial from 8 Gy. In particular, several DNA repair mechanism-related genes were significantly modulated in the 6 Gy gamma radiation-exposed fish larvae, suggesting that upregulation of such DNA repair genes was closely associated with cell survival after gamma irradiation. The mRNA expression of p53 and most hsps was also significantly upregulated at high doses of gamma radiation related to cellular damage. This finding indicates that gamma radiation can induce oxidative stress with associated antioxidant enzyme activities, and linked to modulation of the expression of DNA repair-related genes as one of the defense mechanisms against radiation damage. This study provides a better understanding of the molecular mode of action of defense mechanisms upon gamma radiation in fish larvae.

  4. Protosappanin B protects PC12 cells against oxygen-glucose deprivation-induced neuronal death by maintaining mitochondrial homeostasis via induction of ubiquitin-dependent p53 protein degradation.

    Science.gov (United States)

    Zeng, Ke-Wu; Liao, Li-Xi; Zhao, Ming-Bo; Song, Fang-Jiao; Yu, Qian; Jiang, Yong; Tu, Peng-Fei

    2015-03-15

    Protosappanin B (PTB) is a bioactive dibenzoxocin derivative isolated from Caesalpinia sappan L. Here, we investigated the neuroprotective effects and the potential mechanisms of PTB on oxygen-glucose deprivation (OGD)-injured PC12 cells. Results showed that PTB significantly increased cell viability, inhibited cell apoptosis and up-regulated the expression of growth-associated protein 43 (a marker of neural outgrowth). Moreover, our study revealed that PTB effectively maintained mitochondrial homeostasis by up-regulation of mitochondrial membrane potential (MMP), inhibition of cytochrome c release from mitochondria and inactivation of mitochondrial caspase-9/3 apoptosis pathway. Further study showed that PTB significantly promoted cytoplasmic component degradation of p53 protein, a key negative regulator for mitochondrial function, resulting in a release of Bcl-2 from p53-Bcl-2 complex and an enhancing translocation of Bcl-2 to mitochondrial outer membrane. Finally, we found the degradation of p53 protein was induced by PTB via activation of a MDM2-dependent ubiquitination process. Taken together, our findings provided a new viewpoint of neuronal protection strategy for anoxia and ischemic injury with natural small molecular dibenzoxocin derivative by activating ubiquitin-dependent p53 protein degradation as well as increasing mitochondrial function. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Recent progress of the study of p53 control mechanism by ionizing radiation

    International Nuclear Information System (INIS)

    Kawai, Hidehiko

    2004-01-01

    Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)

  6. p53 Activation following Rift Valley fever virus infection contributes to cell death and viral production.

    Directory of Open Access Journals (Sweden)

    Dana Austin

    Full Text Available Rift Valley fever virus (RVFV is an emerging viral zoonosis that is responsible for devastating outbreaks among livestock and is capable of causing potentially fatal disease in humans. Studies have shown that upon infection, certain viruses have the capability of utilizing particular cellular signaling pathways to propagate viral infection. Activation of p53 is important for the DNA damage signaling cascade, initiation of apoptosis, cell cycle arrest and transcriptional regulation of multiple genes. The current study focuses on the role of p53 signaling in RVFV infection and viral replication. These results show an up-regulation of p53 phosphorylation at several serine sites after RVFV MP-12 infection that is highly dependent on the viral protein NSs. qRT-PCR data showed a transcriptional up-regulation of several p53 targeted genes involved in cell cycle and apoptosis regulation following RVFV infection. Cell viability assays demonstrate that loss of p53 results in less RVFV induced cell death. Furthermore, decreased viral titers in p53 null cells indicate that RVFV utilizes p53 to enhance viral production. Collectively, these experiments indicate that the p53 signaling pathway is utilized during RVFV infection to induce cell death and increase viral production.

  7. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    Science.gov (United States)

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  8. Gelsolin negatively regulates the activity of tumor suppressor p53 through their physical interaction in hepatocarcinoma HepG2 cells

    International Nuclear Information System (INIS)

    An, Joo-Hee; Kim, Jung-Woong; Jang, Sang-Min; Kim, Chul-Hong; Kang, Eun-Jin; Choi, Kyung-Hee

    2011-01-01

    Highlights: → The actin binding protein Gelsolin (GSN) interacts with transcription factor p53. → GSN interacts with transactivation- and DNA binding domains of p53. → GSN represses transactivity of p53 via inhibition of nuclear translocation of p53. → GSN inhibits the p53-mediated apoptosis in hepatocarcinoma HepG2 cells. -- Abstract: As a transcription factor, p53 modulates several cellular responses including cell-cycle control, apoptosis, and differentiation. In this study, we have shown that an actin regulatory protein, gelsolin (GSN), can physically interact with p53. The nuclear localization of p53 is inhibited by GSN overexpression in hepatocarcinoma HepG2 cells. Additionally, we demonstrate that GSN negatively regulates p53-dependent transcriptional activity of a reporter construct, driven by the p21-promoter. Furthermore, p53-mediated apoptosis was repressed in GSN-transfected HepG2 cells. Taken together, these results suggest that GSN binds to p53 and this interaction leads to the inhibition of p53-induced apoptosis by anchoring of p53 in the cytoplasm in HepG2 cells.

  9. Low p53 Binding Protein 1 (53BP1) Expression Is Associated With Increased Local Recurrence in Breast Cancer Patients Treated With Breast-Conserving Surgery and Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Neboori, Hanmanth J.R. [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Haffty, Bruce G., E-mail: hafftybg@umdnj.edu [Department of Radiation Oncology, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Wu Hao [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Yang Qifeng [Department of Breast Surgery, Qilu Hospital, Shandong University, Ji' nan (China); Aly, Amal [Division of Medical Oncology, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Goyal, Sharad; Schiff, Devora [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Moran, Meena S. [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT (United States); Golhar, Ryan [Department of Radiation Oncology, Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); Chen Chunxia; Moore, Dirk [Department of Biostatistics, The Cancer Institute of New Jersey and University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, New Brunswick, NJ (United States); and others

    2012-08-01

    Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log-rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence-free survival (IBRFS), distant metastasis-free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survival (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their clinical

  10. Low p53 Binding Protein 1 (53BP1) Expression Is Associated With Increased Local Recurrence in Breast Cancer Patients Treated With Breast-Conserving Surgery and Radiotherapy

    International Nuclear Information System (INIS)

    Neboori, Hanmanth J.R.; Haffty, Bruce G.; Wu Hao; Yang Qifeng; Aly, Amal; Goyal, Sharad; Schiff, Devora; Moran, Meena S.; Golhar, Ryan; Chen Chunxia; Moore, Dirk

    2012-01-01

    Purpose: To investigate whether the expression of p53 binding protein 1 (53BP1) has prognostic significance in a cohort of early-stage breast cancer patients treated with breast-conserving surgery and radiotherapy (BCS+RT). Methods and Materials: A tissue microarray of early-stage breast cancer treated with BCS+RT from a cohort of 514 women was assayed for 53BP1, estrogen receptor, progesterone receptor, and HER2 expression by immunohistochemistry. Through log–rank tests and univariate and multivariate models, the staining profile of each tumor was correlated with clinical endpoints, including ipsilateral breast recurrence–free survival (IBRFS), distant metastasis–free survival (DMFS), cause-specific survival (CSS), recurrence-free survival (RFS), and overall survival (OS). Results: Of the 477 (93%) evaluable tumors, 63 (13%) were scored as low. Low expression of 53BP1 was associated with worse outcomes for all endpoints studied, including 10-year IBRFS (76.8% vs. 90.5%; P=.01), OS (66.4% vs. 81.7%; P=.02), CSS (66.0% vs. 87.4%; P<.01), DMFS (55.9% vs. 87.0%; P<.01), and RFS (45.2% vs. 80.6%; P<.01). Multivariate analysis incorporating various clinico-pathologic markers and 53BP1 expression found that 53BP1 expression was again an independent predictor of all endpoints (IBRFS: P=.0254; OS: P=.0094; CSS: P=.0033; DMFS: P=.0006; RFS: P=.0002). Low 53BP1 expression was also found to correlate with triple-negative (TN) phenotype (P<.01). Furthermore, in subset analysis of all TN breast cancer, negative 53BP1 expression trended for lower IBRFS (72.3% vs. 93.9%; P=.0361) and was significant for worse DMFS (48.2% vs. 86.8%; P=.0035) and RFS (37.8% vs. 83.7%; P=.0014). Conclusion: Our data indicate that low 53BP1 expression is an independent prognostic indicator for local relapse among other endpoints in early-stage breast cancer and TN breast cancer patients treated with BCS+RT. These results should be verified in larger cohorts of patients to validate their

  11. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b and c

    International Nuclear Information System (INIS)

    Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.

    2008-01-01

    Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be

  12. SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease

    Energy Technology Data Exchange (ETDEWEB)

    Wang, P.; Israelian, L.; Xue, Y.; Song, S.; Attisano, L.; Minassian, B.

    2016-07-01

    Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

  13. Differential Salt-Induced Dissociation of the p53 Protein Complexes with Circular and Linear Plasmid DNA Substrates Suggest Involvement of a Sliding Mechanism

    Czech Academy of Sciences Publication Activity Database

    Šebest, Peter; Brázdová, Marie; Fojta, Miroslav; Pivoňková, Hana

    2015-01-01

    Roč. 16, č. 2 (2015), s. 3163-3177 E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional support: RVO:68081707 Keywords : TUMOR-SUPPRESSOR P53 * CISPLATIN -DAMAGED DNA * SUPERCOILED DNA Subject RIV: BO - Biophysics Impact factor: 3.257, year: 2015

  14. SGK1 (glucose transport), dishevelled2 (wnt signaling), LC3/p62 (autophagy) and p53 (apoptosis) proteins are unaltered in Lafora disease

    International Nuclear Information System (INIS)

    Wang, P.; Israelian, L.; Xue, Y.; Song, S.; Attisano, L.; Minassian, B.

    2016-01-01

    Glycogen forms through the concerted actions of glycogen synthase (GS) which elongates glycogen strands, and glycogen branching enzyme (GBE). Lafora disease (LD) is a fatal neurodegenerative epilepsy that results from neuronal accumulation of hyperphosphorylated glycogen with excessively long strands (called polyglucosans). There is no GBE deficiency in LD. Instead, the disease is caused by loss-of-function mutations in the EPM2A or EPM2B genes, encoding, respectively, a phosphatase, laforin, and an E3 ubiquiting ligase, malin. A number of experimentally derived hypotheses have been published to explain LD, including: The SGK1 hypothesis - Phosphorylated SGK1 (pSGK1) raises cellular glucose uptake and levels, which would activate GS. Based on observing increased pSGK1 in LD mice it was proposed that raised pSGK1 leads to polyglucosan generation through GS hyperactivation. The Dishevelled2 hypothesis - Downregulating malin in cell culture was reported to increase levels of dishevelled2, which through the wnt/glycogen synthase kinase-3 pathway would likewise overactivate GS. The Autophagic defect hypothesis - Polyglucosans may be natural byproducts of normal glycogen metabolism. LD mice were reported to be autophagy-defective. LD would arise from failed autophagy leading to failed polyglucosan clearance. Finally, the p53 hypothesis - laforin and malin were reported to downregulate p53, their absence leading to increased p53, which would activate apoptosis, leading to the neurodegeneration of LD. In the present work we repeat key experiments that underlie these four hypotheses. We are unable to confirm increased pSGK1, dishevelled2, or p53 in LD mice, nor the reported autophagic defects. Our work does not support the above hypotheses in understanding this unique and severe form of epilepsy.

  15. Decreased transcription-coupled nucleotide excision repair capacity is associated with increased p53- and MLH1-independent apoptosis in response to cisplatin

    International Nuclear Information System (INIS)

    Stubbert, Lawton J; Smith, Jennifer M; McKay, Bruce C

    2010-01-01

    One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. RNA interference (RNAi) was used to reduce the transcription-coupled nucleotide excision repair (TC-NER) capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B) transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic

  16. Targeting the p53 Pathway in Ewing Sarcoma

    Science.gov (United States)

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  17. Expression of MDM2 mRNA, MDM2, P53 and P16 Proteins in Urothelial Lesions in the View of the WHO 4th Edition Guidelines as A Molecular Insight towards Personalized Medicine

    Directory of Open Access Journals (Sweden)

    Olfat Hammam

    2017-08-01

    Full Text Available AIM: Here we imposed a multimarker molecular panel composed of P53, MDM2 protein & mRNA & P16 with the identification of sensitive and specific cut offs among the Egyptian urothelial carcinomas bilharzial or not emphasize the pathological and molecular classifications, pathways and prognosis as a privilege for adjuvant therapy. METHODS: Three hundred and ten urothelial lesions were pathologically evaluated and grouped as follows: 50 chronic cystitis as benign, 240 urothelial carcinomas and 20 normal bladder tissue as a control. Immunohistochemistry for MDM Protein, P16 & p53 and In Situ Hybridization for MDM2mRNA were done. RESULTS: MDM2mRNA overexpression correlated with low grade low stage non invasive tumors, while P53 > 40% & p16 40% & P16 10% from high grade, high stage invasive urothelial carcinomas (with p53 > 40, p16 40 & p16 < 10%, together with the histopathological features can distinguish in situ urothelial lesions from dysplastic and atypical lesions.

  18. The E7 protein of the cottontail rabbit papillomavirus immortalizes normal rabbit keratinocytes and reduces pRb levels, while E6 cooperates in immortalization but neither degrades p53 nor binds E6AP

    International Nuclear Information System (INIS)

    Ganzenmueller, Tina; Matthaei, Markus; Muench, Peter; Scheible, Michael; Iftner, Angelika; Hiller, Thomas; Leiprecht, Natalie; Probst, Sonja; Stubenrauch, Frank; Iftner, Thomas

    2008-01-01

    Human papillomaviruses (HPVs) cause cervical cancer and are associated with the development of non-melanoma skin cancer. A suitable animal model for papillomavirus-associated skin carcinogenesis is the infection of domestic rabbits with the cottontail rabbit papillomavirus (CRPV). As the immortalizing activity of CRPV genes in the natural target cells remains unknown, we investigated the properties of CRPV E6 and E7 in rabbit keratinocytes (RK) and their influence on the cell cycle. Interestingly, CRPV E7 immortalized RK after a cellular crisis but showed no such activity in human keratinocytes. Co-expressed CRPV E6 prevented cellular crisis. The HPV16 or CRPV E7 protein reduced rabbit pRb levels thereby causing rabbit p19 ARF induction and accumulation of p53 without affecting cellular proliferation. Both CRPV E6 proteins failed to degrade rabbit p53 in vitro or to bind E6AP; however, p53 was still inducible by mitomycin C. In summary, CRPV E7 immortalizes rabbit keratinocytes in a species-specific manner and E6 contributes to immortalization without directly affecting p53

  19. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Ganapathy, Suthakar, E-mail: s.ganapathy@neu.edu [Center for Drug Development, Northeastern University, Boston (United States); Li, Ping [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Fagman, Johan [The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden); Yu, Tianqi; Lafontant, Jean [Center for Drug Development, Northeastern University, Boston (United States); Zhang, Guojun [The First Affiliated Hospital, Zhengzhou University, Zhengzhou (China); Chen, Changyan [Center for Drug Development, Northeastern University, Boston (United States); The Institute of Clinic Sciences, Sahlgrenska Academy, Gothenburg (Sweden)

    2016-09-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  20. Low doses of arsenic, via perturbing p53, promotes tumorigenesis

    International Nuclear Information System (INIS)

    Ganapathy, Suthakar; Li, Ping; Fagman, Johan; Yu, Tianqi; Lafontant, Jean; Zhang, Guojun; Chen, Changyan

    2016-01-01

    In drinking water and in workplace or living environments, low doses of arsenic can exist and operate as a potent carcinogen. Due to insufficient understanding and information on the pervasiveness of environmental exposures to arsenic, there is an urgent need to elucidate the underlying molecular mechanisms of arsenic regarding its carcinogenic effect on human health. In this study, we demonstrate that low doses of arsenic exposure mitigate or mask p53 function and further perturb intracellular redox state, which triggers persistent endoplasmic reticulum (ER) stress and activates UPR (unfolded protein response), leading to transformation or tumorigenesis. Thus, the results suggest that low doses of arsenic exposure, through attenuating p53-regulated tumor suppressive function, change the state of intracellular redox and create a microenvironment for tumorigenesis. Our study also provides the information for designing more effective strategies to prevent or treat human cancers initiated by arsenic exposure.

  1. Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

    International Nuclear Information System (INIS)

    Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

    1995-01-01

    G1/S arrest. Cell cycle checkpoint arrest in response to 4 or 8 Gy X-rays was measured without caffeine and with 0.5 and 2mM caffeine. In (+/+) cells, G1/S and G2/M arrest was seen and there was no demonstrable impact of caffeine at either dose on either checkpoint. By contrast (-/-) cells showed a clear reduction (50%) of the size of G2/M arrest at 0.5mM caffeine and complete override at 2mM caffeine. These data imply that cells which lack p53, are sensitized by low-dose caffeine and their G2/M checkpoint is altered, seen by the different effects of caffeine upon G2/M override. Tumor cells which do and do not have functional p53 have also been evaluated. Preliminary data suggest a similar conclusion can be drawn. MCF-7 cells transfected with control plasmid or plasmids containing the gene for HPV-E6 protein also show sensitization with low dose caffeine only in cells which have E6. Conclusions: The greater caffeine-induced radiosensitization in p53(-) cells suggests that p53, already shown to control the G1/S checkpoint, may also influence aspects of G2/M arrest. These data indicate an opportunity for therapeutic gain by combining DNA damaging agents with compounds that disrupt G2/M arrest in tumors lacking functional p53. The role of p53 in G2/M transition remains to be defined

  2. Interactions between Exosomes from Breast Cancer Cells and Primary Mammary Epithelial Cells Leads to Generation of Reactive Oxygen Species Which Induce DNA Damage Response, Stabilization of p53 and Autophagy in Epithelial Cells

    Science.gov (United States)

    Dutta, Sujoy; Warshall, Case; Bandyopadhyay, Chirosree; Dutta, Dipanjan; Chandran, Bala

    2014-01-01

    Exosomes are nanovesicles originating from multivesicular bodies and are released by all cell types. They contain proteins, lipids, microRNAs, mRNAs and DNA fragments, which act as mediators of intercellular communications by inducing phenotypic changes in recipient cells. Tumor-derived exosomes have been shown to play critical roles in different stages of tumor development and metastasis of almost all types of cancer. One of the ways by which exosomes affect tumorigenesis is to manipulate the tumor microenvironments to create tumor permissive “niches”. Whether breast cancer cell secreted exosomes manipulate epithelial cells of the mammary duct to facilitate tumor development is not known. To address whether and how breast cancer cell secreted exosomes manipulate ductal epithelial cells we studied the interactions between exosomes isolated from conditioned media of 3 different breast cancer cell lines (MDA-MB-231, T47DA18 and MCF7), representing three different types of breast carcinomas, and normal human primary mammary epithelial cells (HMECs). Our studies show that exosomes released by breast cancer cell lines are taken up by HMECs, resulting in the induction of reactive oxygen species (ROS) and autophagy. Inhibition of ROS by N-acetyl-L-cysteine (NAC) led to abrogation of autophagy. HMEC-exosome interactions also induced the phosphorylation of ATM, H2AX and Chk1 indicating the induction of DNA damage repair (DDR) responses. Under these conditions, phosphorylation of p53 at serine 15 was also observed. Both DDR responses and phosphorylation of p53 induced by HMEC-exosome interactions were also inhibited by NAC. Furthermore, exosome induced autophagic HMECs were found to release breast cancer cell growth promoting factors. Taken together, our results suggest novel mechanisms by which breast cancer cell secreted exosomes manipulate HMECs to create a tumor permissive microenvironment. PMID:24831807

  3. Circumvention and reactivation of the p53 oncogene checkpoint in mouse colon tumors.

    Science.gov (United States)

    Aizu, Wataru; Belinsky, Glenn S; Flynn, Christopher; Noonan, Emily J; Boes, Colleen C; Godman, Cassandra A; Doshi, Bindi; Nambiar, Prashant R; Rosenberg, Daniel W; Giardina, Charles

    2006-10-16

    The p53 tumor suppressor protein is sequence-normal in azoxymethane (AOM)-induced mouse colon tumors, making them a good model for human colon cancers that retain a wild type p53 gene. Cellular localization and co-immunoprecipitation experiments using a cell line derived from an AOM-induced colon tumor (AJ02-NM(0) cells) pointed to constitutively expressed Mdm2 as being an important negative regulator of p53 in these cells. Although the Mdm2 inhibitory protein p19/ARF was expressed in AJ02-NM(0) cells, its level of expression was not sufficient for p53 activation. We tested the response of AJ02-NM(0) cells to the recently developed Mdm2 inhibitor, Nutlin-3. Nutlin-3 was found to activate p53 DNA binding in AJ02-NM(0) cells, to a level comparable to doxorubicin and 5-fluorouracil (5-FU). In addition, Nutlin-3 increased expression of the p53 target genes Bax and PERP to a greater extent than doxorubicin or 5-FU, and triggered a G2/M phase arrest in these cells, compared to a G1 arrest triggered by doxorubicin and 5-FU. The differences in the cellular response may be related to differences in the kinetics of p53 activation and/or its post-translational modification status. In an ex vivo experiment, Nutlin-3 was found to activate p53 target gene expression and apoptosis in AOM-induced tumor tissue, but not in normal adjacent mucosa. Our data indicate that Mdm2 inhibitors may be an effective means of selectively targeting colon cancers that retain a sequence-normal p53 gene while sparing normal tissue and that the AOM model is an appropriate model for the preclinical development of these drugs.

  4. Regulation of Mdmx and its role in the p53 pathway

    NARCIS (Netherlands)

    Meulmeester, Erik

    2006-01-01

    The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

  5. [Punish or cherish: p53, metabolism and tumor suppression].

    Science.gov (United States)

    Albagli, Olivier

    2015-10-01

    The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

  6. Analysis of p53- immunoreactivity in astrocytic brain tumors

    Directory of Open Access Journals (Sweden)

    Shinkarenko T.V.

    2016-12-01

    Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

  7. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b&c

    DEFF Research Database (Denmark)

    Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...

  8. Impact of BCL2 and p53 on postmastectomy radiotherapy response in high-risk breast cancer. A subgroup analysis of DBCG82 b

    DEFF Research Database (Denmark)

    Kyndi, M.; Sorensen, F.B.; Alsner, J.

    2008-01-01

    -Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...

  9. Decreased transcription-coupled nucleotide excision repair capacity is associated with increased p53- and MLH1-independent apoptosis in response to cisplatin

    Directory of Open Access Journals (Sweden)

    Smith Jennifer M

    2010-05-01

    Full Text Available Abstract Background One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. Methods RNA interference (RNAi was used to reduce the transcription-coupled nucleotide excision repair (TC-NER capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. Results These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. Conclusion The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic.

  10. Characterization of highly frequent epitope-specific CD45RA+/CCR7+/- T lymphocyte responses against p53-binding domains of the human polyomavirus BK large tumor antigen in HLA-A*0201+ BKV-seropositive donors

    Directory of Open Access Journals (Sweden)

    Zajac Paul

    2006-11-01

    Full Text Available Abstract Human polyomavirus BK (BKV has been implicated in oncogenic transformation. Its ability to replicate is determined by the binding of its large tumor antigen (LTag to products of tumor-suppressor genes regulating cell cycle, as specifically p53. We investigated CD8+ T immune responses to BKV LTag portions involved in p53 binding in HLA-A*0201+ BKV LTag experienced individuals. Peptides selected from either p53-binding region (LTag351–450 and LTag533–626 by current algorithms and capacity to bind HLA-A*0201 molecule were used to stimulate CD8+ T responses, as assessed by IFN-γ gene expression ex vivo and detected by cytotoxicity assays following in vitro culture. We observed epitope-specific immune responses in all HLA-A*0201+ BKV LTag experienced individuals tested. At least one epitope, LTag579–587; LLLIWFRPV, was naturally processed in non professional antigen presenting cells and induced cytotoxic responses with CTL precursor frequencies in the order of 1/20'000. Antigen specific CD8+ T cells were only detectable in the CD45RA+ subset, in both CCR7+ and CCR7- subpopulations. These data indicate that widespread cellular immune responses against epitopes within BKV LTag-p53 binding regions exist and question their roles in immunosurveillance against tumors possibly associated with BKV infection.

  11. The dynamics of p53 in single cells: physiologically based ODE and reaction–diffusion PDE models

    International Nuclear Information System (INIS)

    Eliaš, Ján; Clairambault, Jean; Dimitrio, Luna; Natalini, Roberto

    2014-01-01

    The intracellular signalling network of the p53 protein plays important roles in genome protection and the control of cell cycle phase transitions. Recently observed oscillatory behaviour in single cells under stress conditions has inspired several research groups to simulate and study the dynamics of the protein with the aim of gaining a proper understanding of the physiological meanings of the oscillations. We propose compartmental ODE and PDE models of p53 activation and regulation in single cells following DNA damage and we show that the p53 oscillations can be retrieved by plainly involving p53–Mdm2 and ATM–p53–Wip1 negative feedbacks, which are sufficient for oscillations experimentally, with no further need to introduce any delays into the protein responses and without considering additional positive feedback. (paper)

  12. Impact of Alu repeats on the evolution of human p53 binding sites

    Directory of Open Access Journals (Sweden)

    Sirotin Michael V

    2011-01-01

    Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu

  13. MMP9 but Not EGFR, MET, ERCC1, P16, and P-53 Is Associated with Response to Concomitant Radiotherapy, Cetuximab, and Weekly Cisplatin in Patients with Locally Advanced Head and Neck Cancer

    Directory of Open Access Journals (Sweden)

    George Fountzilas

    2009-01-01

    Full Text Available Concomitant administration of radiotherapy with cisplatin or radiotherapy with cetuximab appear to be the treatment of choice for patients with locally advanced head and neck cancer. In the present retrospective analysis, we investigated the predictive role of several biomarkers in an unselected cohort of patients treated with concomitant radiotherapy, weekly cisplatin, and cetuximab (CCRT. We identified 37 patients treated with this approach, of which 13 (35% achieved a complete response and 10 (27% achieved a partial response. Severe side effects were mainly leucopenia, dysphagia, rash, and anemia. Tumor EGFR, MET, ERCC1, and p-53 protein and/or gene expression were not associated with treatment response. In contrast, high MMP9 mRNA expression was found to be significantly associated with objective response. In conclusion, CCRT is feasible and active. MMP9 was the only biomarker tested that appears to be of predictive value in cetuximab treated patients. However, this is a hypothesis generating study and the results should not be viewed as definitive evidence until they are validated in a larger cohort.

  14. The nucleolus directly regulates p53 export and degradation.

    Science.gov (United States)

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  15. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    Science.gov (United States)

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. CORRELATION BETWEEN PROTEIN-WITH-MOLECULAR-WEIGHT-53 (P53, BURKIT CELL LYMPHOMA 2 (BCL2, AND FAS LIGAND (FASL AND VASCULAR-CELL-ADHESION-MOLECULE-1 (VCAM-1 MRNA EXPRESSION LEVELS IN A PATHOGENESIS STUDY OF PREECLAMPSIA

    Directory of Open Access Journals (Sweden)

    Mintareja Teguh

    2014-06-01

    Full Text Available Objective: To determine the role of protein-with-molecular-weight-53 (p53, burkit cell lymphoma 2 (Bcl2, Fas ligand (FasL mRNA, and vascular cell adhesion molecule 1 (VCAM-1, known as the apoptosis-related molecular pathway, in preeclamptic patients. Methods: Observation on the correlation between the mRNA levels of p53, Bcl2 and FasL and VCAM-1 in 31 subjects at 28-42 weeks gestational age was performed in this study using the real time reverse transcriptase-polymerase chain reaction (RT-PCR. Results: The results showed that p53 mRNA increased (>1.2350 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.010, Bcl2 mRNA was lower (≤0.9271 ng/μL in the preeclampsia group than the control group (p=0.041. There was also a tendency of increased FasL mRNA expression (>0.5509 ng/μL in the preeclampsia group compared to the normal pregnancy group (p=0.300. The level of VCAM-1 elevated (>890.08 ng/mL in the preeclampsia group compared to the normal pregnancy group (p=0.001. In preeclampsia, the correlation between the Bcl2/p53 ratio and VCAM-1 was r=0.541 (p=0.002, whereas the correlation in normal pregnancy was r=0.099 (p=0.595. Conclusions: There are correlations between the mRNA expression levels of p53 and Bcl2 as an intrinsic pathway of apoptosis along with the VCAM-1 levels in the incidence of preeclampsia. However, no correlation is found between FasL mRNA expression and the incidence of preeclampsia.

  17. Robustness of the p53 network and biological hackers.

    Science.gov (United States)

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  18. Insertion of the LINE-1 element in the C-MYC gene and immunoreactivity of C-MYC, p53, p21 and p27 proteins in different morphological patterns of the canine TVT

    Directory of Open Access Journals (Sweden)

    C.R.O. Lima

    2016-06-01

    Full Text Available ABSTRACT The canine transmissible venereal tumor (TVT affects the external genitalia of dogs by the natural transplant of viable tumor cells. Thus, this research aimed to diagnose and characterize TVT morphological patterns, identify the insertion of the LINE-1 element in C-MYC gene, by means of the polymerase chain reaction (PCR, and evaluate the immunohistochemical expression of C-MYC, p53, p21 and p27 proteins. The relationship between C-MYC and p53 proteins and their interference on the expression of p21 and p27 were also studied. For that, 20 samples of naturally occurring TVT were used, subjected to cytopathological, histopathological and immunohistochemical analysis, and to molecular diagnosis of neoplasia. The increased tissue expression and the correlation among C-MYC, p53, p21 and p27 proteins indicate reduction and/or loss of their functionality in the TVT microenvironment, with consequent apoptotic suppression, maintenance of cell growth and progression of neoplasia.

  19. ARF and ATM/ATR cooperate in p53-mediated apoptosis upon oncogenic stress

    International Nuclear Information System (INIS)

    Pauklin, Siim; Kristjuhan, Arnold; Maimets, Toivo; Jaks, Viljar

    2005-01-01

    Induction of apoptosis is pivotal for eliminating cells with damaged DNA or deregulated proliferation. We show that tumor suppressor ARF and ATM/ATR kinase pathways cooperate in the induction of apoptosis in response to elevated expression of c-myc, β-catenin or human papilloma virus E7 oncogenes. Overexpression of oncogenes leads to the formation of phosphorylated H2AX foci, induction of Rad51 protein levels and ATM/ATR-dependent phosphorylation of p53. Inhibition of ATM/ATR kinases abolishes both induction of Rad51 and phosphorylation of p53, and remarkably reduces the level of apoptosis induced by co-expression of oncogenes and ARF. However, the induction of apoptosis is downregulated in p53-/- cells and does not depend on activities of ATM/ATR kinases, indicating that efficient induction of apoptosis by oncogene activation depends on coordinated action of ARF and ATM/ATR pathways in the regulation of p53

  20. The Transcriptional Landscape of p53 Signalling Pathway

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2017-06-01

    Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

  1. HEXIM1, a New Player in the p53 Pathway

    Energy Technology Data Exchange (ETDEWEB)

    Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

    2013-07-04

    Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

  2. The presence of p53 influences the expression of multiple human cytomegalovirus genes at early times postinfection.

    Science.gov (United States)

    Hannemann, Holger; Rosenke, Kyle; O'Dowd, John M; Fortunato, Elizabeth A

    2009-05-01

    Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunocompromised and immunosuppressed individuals. During infection, HCMV is known to employ host transcription factors to facilitate viral gene expression. To further understand the previously observed delay in viral replication and protein expression in p53 knockout cells, we conducted microarray analyses of p53(+/+) and p53(-/-) immortalized fibroblast cell lines. At a multiplicity of infection (MOI) of 1 at 24 h postinfection (p.i.), the expression of 22 viral genes was affected by the absence of p53. Eleven of these 22 genes (group 1) were examined by real-time reverse transcriptase, or quantitative, PCR (q-PCR). Additionally, five genes previously determined to have p53 bound to their nearest p53-responsive elements (group 2) and three control genes without p53 binding sites in their upstream sequences (group 3) were also examined. At an MOI of 1, >3-fold regulation was found for five group 1 genes. The expression of group 2 and 3 genes was not changed. At an MOI of 5, all genes from group 1 and four of five genes from group 2 were found to be regulated. The expression of control genes from group 3 remained unchanged. A q-PCR time course of four genes revealed that p53 influences viral gene expression most at immediate-early and early times p.i., suggesting a mechanism for the reduced and delayed production of virions in p53(-/-) cells.

  3. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    Science.gov (United States)

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  4. Microrna-31 mediates radiation induced apoptosis selectively in malignant tumour cells with dysfunctional P53

    International Nuclear Information System (INIS)

    Kumar, Ashish; Mukherjee, Prabuddho; Babu, Bincy; Chandna, Sudhir

    2016-01-01

    The protein p53 has been recognized as an important radio-responsive protein which functions mainly through transcriptional control of its target genes and microRNAs that target multiple response pathways. In this study, we investigate a putative link between p53 functionality and microRNA-31 expression that largely contributes to cellular transformation/malignancy and also establishes the role of miR-31 in radiation-induced cell death. The expression of miR-31 is found to be attenuated in cells in successive stages of cancer progression

  5. Simplified approaches for the development of an ELISA to detect circulating autoantibodies to p53 in cancer patients

    Directory of Open Access Journals (Sweden)

    Tayapiwatana Chatchai

    2008-02-01

    Full Text Available Abstract Background The recognition that human tumors stimulate the production of autoantibodies has initiated the use of this immune response as serological markers for the early diagnosis and management of cancer. The enzyme-linked immunosorbent assay (ELISA is the most common method used in detecting autoantibodies, which involves coating the microtiter plate with the tumor associated antigen (TAA of interest and allowing serum antibodies to bind. The patient's sample is directly in contact with the coating antigen so the protein used for coating must be pure to avoid non-specific binding. In this study, a simplified method to selectively and specifically immobilize TAAs onto microtiter plates in order to detect circulating autoantibodies in cancer patients without prior purification process was described. Wild type full-length p53 protein was produced in fusion with biotin carboxyl carrier peptide (BCCP or hexahistidine [(His6] using pAK400 and pET15b(+ vectors, respectively. The recombinant p53 fusion protein produced was then subjected to react with either a commercial p53 monoclonal antibody (mAb or sera from lung cancer patients and healthy volunteers in an enzyme-linked immunosorbent assay (ELISA format. Results Both of the immobilized p53 fusion proteins as well as the purified (His6-p53 fusion protein had a similar dose response of detection to a commercial p53 mAb (DO7. When the biotinylated p53-BCCP fusion protein was used as an antigen to detect p53 autoantibodies in clinical samples, the result showed that human serum reacted strongly to avidin-coated microwell even in the absence of the biotinylated p53-BCCP fusion protein, thus compromised its ability to differentiate weakly positive sera from those that were negative. In contrast, the (His6-p53 protein immobilized directly onto Ni+ coated microplate was able to identify the p53 autoantibody positive serum. In addition, its reactivity to clinical serum samples highly correlated

  6. Indicadores de Prognóstico em Câncer de Mama com Axila Negativa: Receptor de Estrógeno e Expressão de P53 e de c-erbB-2 Prognostic Indicators In Lymph Node-Negative Breast Cancer: Estrogen Receptor and P53 and c-erbB-2 Protein Expression

    Directory of Open Access Journals (Sweden)

    Adriana Harter Teixeira Bolaséll

    2000-08-01

    dos linfonodos axilares tem pior prognóstico, em relação ao intervalo livre de doença, quando apresentam associação de tumor pouco diferenciado com RE negativo, p53 positivo e c-erbB-2 positivo.Purpose: to evaluate the prognostic value of estrogen receptor and p53 and c-erbB-2 proteins in lymph node-negative breast cancer. Methods: an immunohistochemical study was made in paraffin-embedded tissues from the file of the Instituto de Pesquisas Cito-Oncológicas of the Fundação Faculdade Federal de Ciências Médicas de Porto Alegre of fifty cases of postmenopausal women, who were treated at the Irmandade da Santa Casa de Misericórdia de Porto Alegre and at the Santa Rita Hospital from 1990 to 1994. For statistical analysis c² with Yates correction, as well as exact Fisher tests were used and Kaplan Meier curves compared with log-rank test. The mean follow-up of the patients was 3.6 years (3.1-4.5. Of the 50 cases, 14 showed recurrence during the period of follow-up. Results: the mean age was 61 years (46-78. Modified radical mastectomy was performed in 35 patients (70% and 15 (30% were submitted to lumpectomy/axillary dissection and postoperative radiation therapy. Fifty percent of the patients who showed recurrence did it in the first three years after the diagnosis. The mean size of the tumor was 2.8 cm (1.98-3.13 and the most frequent histological type was invasive ductal carcinoma of no special type (92%, according to the Bloom and Richardson graduation, 3 being stage I (6.6%, 35 stage II (76% and 8 stage III (17.4%. In the tumors with recurrence, there was no grade I, 9 stage II (25.7% and 3 stage III (37.5%. In relation to the prognosis, the disease-free interval was less when there was association of a poorly differentiated tumor with negative estrogen receptor (p = 0.006, positive p53 (p = 0.006 and positive c-erbB-2 (p = 0.001. Conclusion: postmenopausal women with lymph node-negative breast cancer showed worse prognosis in relation to disease

  7. p53 mutations promote proteasomal activity.

    Science.gov (United States)

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  8. Clinical implications of cytosine deletion of exon 5 of P53 gene in non small cell lung cancer patients

    Directory of Open Access Journals (Sweden)

    Rashid Mir

    2016-01-01

    Full Text Available Aim: Lung cancer is considered to be the most common cancer in the world. In humans, about 50% or more cancers have a mutated tumor suppressor p53 gene thereby resulting in accumulation of p53 protein and losing its function to activate the target genes that regulate the cell cycle and apoptosis. Extensive research conducted in murine cancer models with activated p53, loss of p53, or p53 missense mutations have facilitated researchers to understand the role of this key protein. Our study was aimed to evaluate the frequency of cytosine deletion in nonsmall cell lung cancer (NSCLC patients. Methods: One hundred NSCLC patients were genotyped for P53 (exon5, codon168 cytosine deletion leading to loss of its function and activate the target genes by allele-specific polymerase chain reaction. The P53 cytosine deletion was correlated with all the clinicopathological parameters of the patients. Results and Analysis: 59% cases were carrying P53 cytosine deletion. Similarly, the significantly higher incidence of cytosine deletion was reported in current smokers (75% in comparison to exsmoker and nonsmoker. Significantly higher frequency of cytosine deletion was reported in adenocarcinoma (68.08% than squamous cell carcinoma (52.83%. Also, a significant difference was reported between p53 cytosine deletion and metastasis (64.28%. Further, the majority of the cases assessed for response carrying P53 cytosine deletion were found to show faster disease progression. Conclusion: The data suggests that there is a significant association of the P53 exon 5 deletion of cytosine in codon 168 with metastasis and staging of the disease.

  9. p53-Dependent Nestin Regulation Links Tumor Suppression to Cellular Plasticity in Liver Cancer

    DEFF Research Database (Denmark)

    Tschaharganeh, Darjus F; Xue, Wen; Calvisi, Diego F

    2014-01-01

    The p53 tumor suppressor coordinates a series of antiproliferative responses that restrict the expansion of malignant cells, and as a consequence, p53 is lost or mutated in the majority of human cancers. Here, we show that p53 restricts expression of the stem and progenitor-cell-associated protei...... by p53 restricts cellular plasticity and tumorigenesis in liver cancer....

  10. Pharmacological activation of tumor suppressor, wild-type p53 as a promising strategy to fight cancer

    Directory of Open Access Journals (Sweden)

    Alicja Sznarkowska

    2010-08-01

    Full Text Available A powerful tumor suppressor – p53 protein is a transcription factor which plays a critical role in eliciting cellular responses to a variety of stress signals, including DNA damage, hypoxia and aberrant proliferative signals, such as oncogene activation. Since its discovery thirty one years ago, p53 has been connected to tumorigenesis as it accumulates in the transformed tumor cells. Cellular stress induces stabilization of p53 and promotes, depending on the stress level, cell cycle arrest or apoptosis in the irreversibly damaged cells. The p53 protein is found inactive in more than 50�0of human tumors either by enhanced proteasomal degradation or due to the inactivating point mutations in its gene. Numerous data indicate that low molecular weight compounds, identified by molecular modeling or in the functional, cell-based assays, efficiently activate non-mutated p53 in cancer cells which in consequence leads to their elimination due to p53-dependent apoptosis. In this work we describe the structure and cellular function of p53 as well as the latest discoveries on the compounds with high anti-tumor activities aiming at reactivation of the tumor suppressor function of p53.

  11. A comparison of the effects of tributyltin chloride and triphenyltin chloride on cell proliferation, proapoptotic p53, Bax, and antiapoptotic Bcl-2 protein levels in human breast cancer MCF-7 cell line.

    Science.gov (United States)

    Fickova, Maria; Macho, Ladislav; Brtko, Julius

    2015-06-01

    In recent years it was disclosed, that numerous organotin(IV) derivatives have remarkable cytotoxicity against several types of cancer cells. The property to inhibit cell growth makes these compounds promising for antitumor therapy, as the clinical effectiveness of cisplatin is limited by drug resistance and significant side effects. Tributyltin and triphenyltin are known as endocrine disruptors. Moreover, the compounds exert their toxicity in mammals predominantly through nuclear receptor signaling. Here we present the effects of tributyltin chloride (TBT-Cl) and triphenyltin chloride (TPT-Cl) on cell proliferation, expression of proapoptotic p53, Bax, and antiapoptotic Bcl-2 proteins in human breast cancer MCF-7 cell line. Dose and time dependent (24, 48 and 72 h) cell expositions have demonstrated TBT-Cl as more effective in inhibiting MCF-7 cell proliferation than TPT-Cl. Short time treatment with TBT-Cl displayed marked stimulation of p53 protein expression when compared to TPT-Cl. Both organotin compounds displayed similar mild enhancement of Bax protein expression. The 24h exposition of TPT-Cl induced substantial diminution of Bcl-2 protein expression in comparison with both, untreated cells and TBT-Cl treated cells. Our observations indicate that TBT-Cl and TPT-Cl have different antiproliferative potency and distinct impact on expression of apoptosis marker proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    International Nuclear Information System (INIS)

    Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.

    2009-01-01

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.

  13. Editor's Highlight: Hydroxyurea Exposure Activates the P53 Signaling Pathway in Murine Organogenesis-Stage Embryos.

    Science.gov (United States)

    El Husseini, Nazem; Schlisser, Ava E; Hales, Barbara F

    2016-08-01

    Hydroxyurea, an anticancer agent and potent teratogen, induces oxidative stress and activates a DNA damage response pathway in the gestation day (GD) 9 mouse embryo. To delineate the stress response pathways activated by this drug, we investigated the effect of hydroxyurea exposure on the transcriptome of GD 9 embryos. Timed pregnant CD-1 mice were treated with saline or hydroxyurea (400 mg/kg or 600 mg/kg) on GD 9; embryonic gene and protein expression were examined 3 h later. Microarray analysis revealed that the expression of 1346 probe sets changed significantly in embryos exposed to hydroxyurea compared with controls; the P53 signaling pathway was highly affected. In addition, P53 related family members, P63 and P73, were predicted to be activated and had common and unique downstream targets. Western blot analysis revealed that active phospho-P53 was significantly increased in drug-exposed embryos; confocal microscopy showed that the translocation of phospho-P53 to the nucleus was widespread in the embryo. Furthermore, qRT-PCR showed that the expression of P53-regulated genes (Cdkn1A, Fas, and Trp53inp1) was significantly upregulated in hydroxyurea-exposed embryos; the concentration of the redox sensitive P53INP1 protein was also increased in a hydroxyurea dose-dependent fashion. Thus, hydroxyurea elicits a significant effect on the transcriptome of the organogenesis stage murine embryo, activating several key developmental signaling pathways related to DNA damage and oxidative stress. We propose that the P53 pathway plays a central role in the embryonic stress response and the developmental outcome after teratogen exposure. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Substrate Stiffness Influences Doxorubicin-Induced p53 Activation via ROCK2 Expression

    Directory of Open Access Journals (Sweden)

    Takahiro Ebata

    2017-01-01

    Full Text Available The physical properties of the extracellular matrix (ECM, such as stiffness, are involved in the determination of the characteristics of cancer cells, including chemotherapy sensitivity. Resistance to chemotherapy is often linked to dysfunction of tumor suppressor p53; however, it remains elusive whether the ECM microenvironment interferes with p53 activation in cancer cells. Here, we show that, in MCF-7 breast cancer cells, extracellular stiffness influences p53 activation induced by the antitumor drug doxorubicin. Cell growth inhibition by doxorubicin was increased in response to ECM rigidity in a p53-dependent manner. The expression of Rho-associated coiled coil-containing protein kinase (ROCK 2, which induces the activation of myosin II, was significantly higher when cells were cultured on stiffer ECM substrates. Knockdown of ROCK2 expression or pharmacological inhibition of ROCK decreased doxorubicin-induced p53 activation. Our results suggest that a soft ECM causes downregulation of ROCK2 expression, which drives resistance to chemotherapy by repressing p53 activation.

  15. P53 expression in prostatic cancer: an immunohistochemical study

    International Nuclear Information System (INIS)

    Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

    2011-01-01

    Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

  16. POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    ANDERSON,C.W.APPELLA,E.

    2003-10-23

    The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

  17. Mouse embryonic stem cells undergo charontosis, a novel programmed cell death pathway dependent upon cathepsins, p53, and EndoG, in response to etoposide treatment.

    Science.gov (United States)

    Tichy, Elisia D; Stephan, Zachary A; Osterburg, Andrew; Noel, Greg; Stambrook, Peter J

    2013-05-01

    Embryonic stem cells (ESCs) are hypersensitive to many DNA damaging agents and can rapidly undergo cell death or cell differentiation following exposure. Treatment of mouse ESCs (mESCs) with etoposide (ETO), a topoisomerase II poison, followed by a recovery period resulted in massive cell death with characteristics of a programmed cell death pathway (PCD). While cell death was both caspase- and necroptosis-independent, it was partially dependent on the activity of lysosomal proteases. A role for autophagy in the cell death process was eliminated, suggesting that ETO induces a novel PCD pathway in mESCs. Inhibition of p53 either as a transcription factor by pifithrin α or in its mitochondrial role by pifithrin μ significantly reduced ESC death levels. Finally, EndoG was newly identified as a protease participating in the DNA fragmentation observed during ETO-induced PCD. We coined the term charontosis after Charon, the ferryman of the dead in Greek mythology, to refer to the PCD signaling events induced by ETO in mESCs. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya

    2017-07-15

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  19. Synthesis and evaluation of modified chalcone based p53 stabilizing agents

    KAUST Repository

    Iftikhar, Sunniya; Khan, Sardraz; Bilal, Aishah; Manzoor, Safia; Abdullah, Muhammad; Emwas, Abdul-Hamid M.; Sioud, Salim; Gao, Xin; Chotana, Ghayoor Abbas; Faisal, Amir; Saleem, Rahman Shah Zaib

    2017-01-01

    Tumor suppressor protein p53 induces cell cycle arrest and apoptotic cell death in response to various cellular stresses thereby preventing cancer development. Activation and stabilization of p53 through small organic molecules is, therefore, an attractive approach for the treatment of cancers retaining wild-type p53. In this context, a series of nineteen chalcones with various substitution patterns of functional groups including chloro, fluoro, methoxy, nitro, benzyloxy, 4-methyl benzyloxy was prepared using Claisen-Schmidt condensation. The compounds were characterized using NMR, HRMS, IR and melting points. Evaluation of synthesized compounds against human colorectal (HCT116) and breast (Cal-51) cancer cell lines revealed potent antiproliferative activities. Nine compounds displayed GI50 values in the low micromolar to submicromolar range; for example (E)-1-phenyl-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (SSE14108) showed GI50 of 0.473 ± 0.043 µM against HCT116 cells. Further analysis of these compounds revealed that (E)-3-(4-chlorophenyl)-1-phenylprop-2-en-1-one (SSE14105) and (E)-3-(4-methoxyphenyl)-1-phenylprop-2-en-1-one (SSE14106) caused rapid (4 and 8-hour post-treatment) accumulation of p53 in HCT116 cells similar to its induction by positive control, Nutlin-3. Such activities were absent in 3-(4-methoxyphenyl)propiophenone (SSE14106H2) demonstrating the importance of conjugated ketone for antiproliferative and p53 stabilizing activity of the chalcones. We further evaluated p53 levels in the presence of cycloheximide (CHX) and the results showed that the p53 stabilization was regulated at post-translational level through blockage of its degradation. These chalcones can, therefore, act as fragment leads for further structure optimization to obtain more potent p53 stabilizing agents with enhanced anti-proliferative activities.

  20. p53 Loss Synergizes with Estrogen and Papillomaviral Oncogenes to Induce Cervical and Breast Cancers

    Science.gov (United States)

    Shai, Anny; Pitot, Henry C.; Lambert, Paul F.

    2010-01-01

    Whereas the tumor suppressor p53 gene is frequently mutated in most human cancers, this is not the case in human papillomavirus (HPV)-associated cancers, presumably because the viral E6 oncoprotein inactivates the p53 protein. The ability of E6 to transform cells in tissue culture and induce cancers in mice correlates in part with its ability to inactivate p53. In this study, we compared the expression of the HPV16 E6 oncogene to the conditional genetic disruption of p53 in the context of a mouse model for cervical cancer in which estrogen is a critical cofactor. Nearly all of the K14Crep53f/f mice treated with estrogen developed cervical cancer, a stark contrast to its complete absence in like-treated K14E6WTp53f/f mice, indicating that HPV16 E6 must only partially inactivate p53. p53-independent activities of E6 also contributed to carcinogenesis, but in the female reproductive tract, these activities were manifested only in the presence of the HPV16 E7 oncogene. Interestingly, treatment of K14Crep53f/f mice with estrogen also resulted in mammary tumors after only a short latency, many of which were positive for estrogen receptor α. The majority of these mammary tumors were of mixed cell types, suggestive of their originating from a multipotent progenitor. Furthermore, a subset of mammary tumors arising in the estrogen-treated, p53-deficient mammary glands exhibited evidence of an epithelial to mesenchymal transition. These data show the importance of the synergy between estrogen and p53 insufficiency in determining basic properties of carcinogenesis in hormone-responsive tissues, such as the breast and the reproductive tract. PMID:18413729

  1. P53 autoantibodies in 1006 patients followed up for breast cancer

    International Nuclear Information System (INIS)

    Metcalfe, Su; Wheeler, Terence K; Picken, Sheila; Negus, Susanne; Jo Milner, A

    2000-01-01

    Serial plasma samples from 1006 patients with breast cancer revealed: (i) no correlation of p53 autoantibody status with disease status at the time of sample collection, or with menopausal status at time of primary diagnosis of breast cancer; (ii) 155 out of 1006 (15%) of patients were positive for p53 autoantibodies, and these patients tended to have a persistent autoantibody status throughout follow up, irrespective of disease behaviour; and (iii) where a negative autoantibody status was found at primary diagnosis of breast cancer, this negative status persisted throughout follow up, irrespective of later disease behaviour. We conclude that screening for p53 autoantibody status is not informative on residual tumour activity nor on therapeutic responsiveness. Dysfunction of the tumour-suppressor protein, p53, may be due to either mutational or epigenetic factors, each of which may lead to accumulation of cytoplasmic p53. Abnormal accumulation of p53 in breast cancer tissue is predictive of poor prognosis [1,2]. Humoral studies [3,4] have shown that cancer patients may develop immunity to abnormally expressed p53, as revealed by p53 autoantibodies in the blood. Again, prognostic correlates have been noted, with presence of circulating p53 autoantibodies at diagnosis of breast cancer being associated with reduced overall survival [5,6] and with poor prognostic factors such as high histological grade and the absence of hormone receptors [5,7,8]. Little is known of the potential value of p53 autoantibody in follow up of cancer. In lung cancer there is evidence that autoantibodies to p53 may provide a useful tool to monitor response to therapy [9,10], whereas serial measurements of autoantibodies to p53 in 40 patients with advanced ovarian cancer were not found to be clinically useful [11]. In breast cancer some 30% of node-negative patients will relapse within 5 years, but there is no current means to predict those who are at risk. We performed the present study to

  2. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Science.gov (United States)

    Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

    2012-01-01

    The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

  3. Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

    Directory of Open Access Journals (Sweden)

    Manujendra N Saha

    Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

  4. Cytotoxic T-lymphocyte clones, established by stimulation with the HLA-A2 binding p5365-73 wild type peptide loaded on dendritic cells In vitro, specifically recognize and lyse HLA-A2 tumour cells overexpressing the p53 protein

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Petersen, T R; Kirkin, A F

    2000-01-01

    of recognizing p53 derived wild type (self) peptides. Furthermore, the capacity of R9V specific T cell clones to exert HLA restricted cytotoxicity, argues that the R9V peptide is naturally presented on certain cancer cells. This supports the view that p53 derived wild type peptides might serve as candidate......Mutations in the tumour suppressor gene p53 are among the most frequent genetic alterations in human malignancies, often associated with an accumulation of the p53 protein in the cytoplasm. We have generated a number of cytotoxic T lymphocyte (CTL) clones that specifically recognize the HLA-A*0201...

  5. CLCA2 as a p53-Inducible Senescence Mediator

    Directory of Open Access Journals (Sweden)

    Chizu Tanikawa

    2012-02-01

    Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

  6. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    Science.gov (United States)

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  7. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

    Science.gov (United States)

    Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

    2001-01-01

    The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

  8. Increased toll-like receptors and p53 levels regulate apoptosis and angiogenesis in non-muscle invasive bladder cancer: mechanism of action of P-MAPA biological response modifier

    International Nuclear Information System (INIS)

    Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; Mello Júnior, Wilson de; Duran, Nelson; Macedo, Alda Maria; Oliveira, Alexandre Gabarra de; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José

    2016-01-01

    The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic

  9. Increased toll-like receptors and p53 levels regulate apoptosis and angiogenesis in non-muscle invasive bladder cancer: mechanism of action of P-MAPA biological response modifier.

    Science.gov (United States)

    Garcia, Patrick Vianna; Seiva, Fábio Rodrigues Ferreira; Carniato, Amanda Pocol; de Mello Júnior, Wilson; Duran, Nelson; Macedo, Alda Maria; de Oliveira, Alexandre Gabarra; Romih, Rok; Nunes, Iseu da Silva; Nunes, Odilon da Silva; Fávaro, Wagner José

    2016-07-07

    The new modalities for treating patients with non-muscle invasive bladder cancer (NMIBC) for whom BCG (Bacillus Calmette-Guerin) has failed or is contraindicated are recently increasing due to the development of new drugs. Although agents like mitomycin C and BCG are routinely used, there is a need for more potent and/or less-toxic agents. In this scenario, a new perspective is represented by P-MAPA (Protein Aggregate Magnesium-Ammonium Phospholinoleate-Palmitoleate Anhydride), developed by Farmabrasilis (non-profit research network). This study detailed and characterized the mechanisms of action of P-MAPA based on activation of mediators of Toll-like Receptors (TLRs) 2 and 4 signaling pathways and p53 in regulating angiogenesis and apoptosis in an animal model of NMIBC, as well as, compared these mechanisms with BCG treatment. Our results demonstrated the activation of the immune system by BCG (MyD88-dependent pathway) resulted in increased inflammatory cytokines. However, P-MAPA intravesical immunotherapy led to distinct activation of TLRs 2 and 4-mediated innate immune system, resulting in increased interferons signaling pathway (TRIF-dependent pathway), which was more effective in the NMIBC treatment. Interferon signaling pathway activation induced by P-MAPA led to increase of iNOS protein levels, resulting in apoptosis and histopathological recovery. Additionally, P-MAPA immunotherapy increased wild-type p53 protein levels. The increased wild-type p53 protein levels were fundamental to NO-induced apoptosis and the up-regulation of BAX. Furthermore, interferon signaling pathway induction and increased p53 protein levels by P-MAPA led to important antitumor effects, not only suppressing abnormal cell proliferation, but also by preventing continuous expansion of tumor mass through suppression of angiogenesis, which was characterized by decreased VEGF and increased endostatin protein levels. Thus, P-MAPA immunotherapy could be considered an important therapeutic

  10. Expression of p53, MDM2 in a mice hydradecarcinoma model induced by γ-ray irradiation

    International Nuclear Information System (INIS)

    Huang Yuecheng; Cai Jianming; Han Ling; Gao Fu; Sun Ding; Dong Zhitao; Zhe Wanli

    2004-01-01

    Objective: To investigate the role of the p53, MDM2 in carcinogenesis of mice hydradecarcinoma induced by γ-rays. Methods: A radiation-induced mice hydradecarcinoma model was established by γ-ray irradiation. Expression of MDM2 protein in hydradecarcinoma tissue, paracancerous tissue and normal control tissue was detected with Western blot. Immunoprecipitation (IP) was conducted to examine the phosphorylation level of MDM2 protein. PCR-SSCP was performed to detect p53 gene mutation. Results: Compared with the normal control tissue, the MDM2 protein expression and its phosphorylation level were significantly higher in hydradecarcinoma tissue. SSCP showed there were p53 gene mutations in hydradecarcinoma samples. Conclusion: p53/MDM2 pathway may be involved in the development and progression of hydradecarcinoma induced by γ-ray irradiation. The over-expression of MDM2 and hyperphosphorylation may be responsible for malignant transformation induced by irradiation by a possible mechanism of p53 inactivation. The gene mutation of p53 further supported the hypothesis that p53/MDM2 pathway played a central role in carcinogenesis of γray induced hydradecarcinoma. (authors)

  11. Exercise Activates p53 and Negatively Regulates IGF-1 Pathway in Epidermis within a Skin Cancer Model.

    Science.gov (United States)

    Yu, Miao; King, Brenee; Ewert, Emily; Su, Xiaoyu; Mardiyati, Nur; Zhao, Zhihui; Wang, Weiqun

    2016-01-01

    Exercise has been previously reported to lower cancer risk through reducing circulating IGF-1 and IGF-1-dependent signaling in a mouse skin cancer model. This study aims to investigate the underlying mechanisms by which exercise may down-regulate the IGF-1 pathway via p53 and p53-related regulators in the skin epidermis. Female SENCAR mice were pair-fed an AIN-93 diet with or without 10-week treadmill exercise at 20 m/min, 60 min/day and 5 days/week. Animals were topically treated with TPA 2 hours before sacrifice and the target proteins in the epidermis were analyzed by both immunohistochemistry and Western blot. Under TPA or vehicle treatment, MDM2 expression was significantly reduced in exercised mice when compared with sedentary control. Meanwhile, p53 was significantly elevated. In addition, p53-transcriptioned proteins, i.e., p21, IGFBP-3, and PTEN, increased in response to exercise. There was a synergy effect between exercise and TPA on the decreased MDM2 and increased p53, but not p53-transcripted proteins. Taken together, exercise appeared to activate p53, resulting in enhanced expression of p21, IGFBP-3, and PTEN that might induce a negative regulation of IGF-1 pathway and thus contribute to the observed cancer prevention by exercise in this skin cancer model.

  12. Sequence specific DNA binding by P53 is enhanced by ionizing radiation and is mediated via DNA-PK activity

    International Nuclear Information System (INIS)

    Kachnic, L.A.; Wunsch, H.; Mekeel, K.L.; De Frank, J.S.; Powell, S.N.

    1996-01-01

    Purpose: P53 is known to be involved in the cellular response to DNA damage. It mediates many of its effects by acting as a transcription factor via sequence-specific DNA binding. The half-life of p53 is prolonged following DNA damage, and this results in elevated levels of p53 for a period of 2-8 hours. The increase in p53 is often relatively small, but this produces significant stimulation of a downstream gene such as p21(WAF1/cip1). We investigated post-translational modification of p53 following ionizing radiation damage. Materials and Methods: The response of normal Balb-C mouse fibroblasts (FC) to ionizing radiation (IR, 8 Gy) was measured at 0,3,6,9 and 24 hours, by the levels of p53, p21, flow cytometry and the electrophoretic mobility shift assay (EMSA). EMSA utilized a 26 bp consensus sequence end-labeled oligonucleotide to measure sequence-specific p53 binding. P53 specificity was confirmed by an enhanced mobility shift (retardation) when using p53 antibody. Comparison was made with scid fibroblasts (FS) and FC cells transfected with a plasmid (CX3) containing mutant p53 (alanine-143) or infected with a retrovirus containing the E6 protein of human papilloma virus type 16. Results: The response of p53 to DNA damage shows a 3-fold increase at 3-6 hours, and was not significantly different between FC and FS. FC-CX3 showed detectable basal levels of p53, and a 2-fold further induction of p53 after IR. FC-E6 showed no detectable levels of p53 before or after IR. No induction of p21 or G1/S arrest was seen in FC-CX3 or FC-E6, as has been observed previously. The induction of p21 in FS cells was attenuated and delayed: a 2-3-fold increase seen maximally at 9 hours, compared with a 5-fold increase seen maximally at 3-6 hours in FC cells. The accumulation of cells at the G1/S junction after IR showed the same kinetics as p21 induction: the peak of cells in G1 occurs at 3-6 hours in FC, but not until 9-24 hours in FS. The response is reminiscent of that seen in

  13. p53 is involved in clearance of ionizing radiation-induced RAD51 foci in a human colon cancer cell line

    International Nuclear Information System (INIS)

    Orre, Lukas M.; Stenerloew, Bo; Dhar, Sumeer; Larsson, Rolf; Lewensohn, Rolf; Lehtioe, Janne

    2006-01-01

    We have investigated p53-related differences in cellular response to DNA damaging agents, focusing on p53s effects on RAD51 protein level and sub-cellular localization post exposure to ionizing radiation. In a human colon cancer cell line, HCT116 and its isogenic p53-/- subcell line we show here p53-independent RAD51 foci formation but interestingly the resolution of RAD51 foci showed clear p53 dependence. In p53 wt cells, but not in p53-/- cells, RAD51 protein level decreased 48 h post irradiation and fluorescence immunostaining showed resolution of RAD51 foci and relocalization of RAD51 to nucleoli at time points corresponding to the decrease in RAD51 protein level. Both cell lines rejoined DNA double strand breaks efficiently with similar kinetics and p53 status did not influence sensitivity to DNA damaging agents. We suggest that p53 has a role in RAD51 clearance post DSB repair and that nucleoli might be sites of RAD51 protein degradation

  14. Relationship among mismatch repair deficiency, CDX2 loss, p53 and E-cadherin in colon carcinoma and suitability of using a double panel of mismatch repair proteins by immunohistochemistry.

    Science.gov (United States)

    Sayar, Ilyas; Akbas, Emin Murat; Isik, Arda; Gokce, Aysun; Peker, Kemal; Demirtas, Levent; Gürbüzel, Mehmet

    2015-09-01

    Biomarkers such as mismatch repair proteins, CDX2, p53, and E-cadherin are blamed for colon cancers, but the relationships of these biomarkers with each other and with pathological risk factors in colon carcinoma are still not clear. The aim of this study was to evaluate the association of these biomarkers with each other by using immunohistochemical staining and to compare their expression with pathological risk factors for colonic adenocarcinoma. We also aimed to study the usability of a double panel of mismatch repair proteins. One hundred and eleven cases with colonic adenocarcinoma were examined. There was a statistically significant relationship between tumor histological differentiation and perineural invasion, vascular invasion, mismatch repair deficiency, p53, CDX2, and E-cadherin (p < 0.05). PMS2 and MSH6 loss covered 100% of cases with mismatch repair deficiency. Mismatch repair deficiency was correlated with CDX2 loss and E-cadherin expression (p < 0.05). It was also observed that cases with PMS2 loss covered all the cases with CDX2 loss. In conclusion, this double panel may be used instead of a quadruple panel for detecting mismatch repair deficiency. Association of CDX2 and PMS2 in the present study is necessary to conduct further genetic and pathological studies focusing on these two markers together.

  15. RBP-J-interacting and tubulin-associated protein induces apoptosis and cell cycle arrest in human hepatocellular carcinoma by activating the p53–Fbxw7 pathway

    International Nuclear Information System (INIS)

    Wang, Haihe; Yang, Zhanchun; Liu, Chunbo; Huang, Shishun; Wang, Hongzhi; Chen, Yingli; Chen, Guofu

    2014-01-01

    Highlights: • RITA overexpression increased protein expression of p53 and Fbxw7 and downregulated the expression of cyclin D1, cyclin E, CDK2, Hes-1 and NF-κB p65. • RITA can significantly inhibit the in vitro growth of SMMC7721 and HepG2 cells. • RITA exerts tumor-suppressive effects in hepatocarcinogenesis through induction of G0/G1 cell cycle arrest and apoptosis and suggest a therapeutic application of RITA in HCC. - Abstract: Aberrant Notch signaling is observed in human hepatocellular carcinoma (HCC) and has been associated with the modulation of cell growth. However, the role of Notch signaling in HCC and its underlying mechanism remain elusive. RBP-J-interacting and tubulin-associated (RITA) mediates the nuclear export of RBP-J to tubulin fibers and downregulates Notch-mediated transcription. In this study, we found that RITA overexpression increased protein expression of p53 and Fbxw7 and downregulated the expression of cyclin D1, cyclin E, CDK2, Hes-1 and NF-κB p65. These changes led to growth inhibition and induced G0/G1 cell cycle arrest and apoptosis in SMMC7721 and HepG2 cells. Our findings indicate that RITA exerts tumor-suppressive effects in hepatocarcinogenesis through induction of G0/G1 cell cycle arrest and apoptosis and suggest a therapeutic application of RITA in HCC

  16. 40 Years of Research Put p53 in Translation

    Science.gov (United States)

    Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

    2018-01-01

    Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

  17. Protein tyrosine kinases p53/56lyn and p72syk in MHC class I-mediated signal transduction in B lymphoma cells

    DEFF Research Database (Denmark)

    Pedersen, Anders Elm; Bregenholt, S; Skov, S

    1998-01-01

    syk are among the tyrosine-phosphorylated proteins. The kinetics of phosphorylation of these kinases after MHC-I crosslinking differ from the kinetics observed after crosslinking of the B cell antigen receptor (BCR). Additional experiments were performed with chicken lyn- and syk-negative DT40 B cells...... mobilization of intracellular free calcium compared with MHC-I crosslinking of wild-type DT40 cells. Thus, expression of BCR at the cell surface is likely to be important for the signal cascade initiated by MHC-I crosslinking. Our data suggest that signal transduction initiated through ligation of the MHC...

  18. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Shi-Wei [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Wu, Chun-Ying [Division of Gastroenterology and Hepatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Wang, Yen-Ting [Department of Medical Research and Education, Cheng Hsin General Hospital, Taipei, Taiwan (China); Kao, Jun-Kai [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Pediatrics, Children' s Hospital, Changhua Christian Hospital, Changhua, Taiwan (China); Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Chiu, Husan-Wen [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chang, Chuan-Hsun [Department of Surgical Oncology, Cheng Hsin General Hospital, Taipei, Taiwan (China); Department of Nutrition Therapy, Cheng Hsin General Hospital, Taipei, Taiwan (China); School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan (China); Liang, Shu-Mei [Institute of Biotechnology, National Cheng-Kung University, Tainan, Taiwan (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei, Taiwan (China); Chen, Yi-Ju [Department of Dermatology, Taichung Veterans General Hospital, Taichung, Taiwan (China); Huang, Jau-Ling [Department of Bioscience Technology, Chang Jung Christian University, Tainan, Taiwan (China); Shieh, Jeng-Jer, E-mail: shiehjj@vghtc.gov.tw [Institute of Biomedical Sciences, National Chung Hsing University, Taichung, Taiwan (China); Department of Education and Research, Taichung Veterans General Hospital, Taichung, Taiwan (China)

    2013-02-15

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status.

  19. p53 modulates the AMPK inhibitor compound C induced apoptosis in human skin cancer cells

    International Nuclear Information System (INIS)

    Huang, Shi-Wei; Wu, Chun-Ying; Wang, Yen-Ting; Kao, Jun-Kai; Lin, Chi-Chen; Chang, Chia-Che; Mu, Szu-Wei; Chen, Yu-Yu; Chiu, Husan-Wen; Chang, Chuan-Hsun; Liang, Shu-Mei; Chen, Yi-Ju; Huang, Jau-Ling; Shieh, Jeng-Jer

    2013-01-01

    Compound C, a well-known inhibitor of the intracellular energy sensor AMP-activated protein kinase (AMPK), has been reported to cause apoptotic cell death in myeloma, breast cancer cells and glioma cells. In this study, we have demonstrated that compound C not only induced autophagy in all tested skin cancer cell lines but also caused more apoptosis in p53 wildtype skin cancer cells than in p53-mutant skin cancer cells. Compound C can induce upregulation, phosphorylation and nuclear translocalization of the p53 protein and upregulate expression of p53 target genes in wildtype p53-expressing skin basal cell carcinoma (BCC) cells. The changes of p53 status were dependent on DNA damage which was caused by compound C induced reactive oxygen species (ROS) generation and associated with activated ataxia-telangiectasia mutated (ATM) protein. Using the wildtype p53-expressing BCC cells versus stable p53-knockdown BCC sublines, we present evidence that p53-knockdown cancer cells were much less sensitive to compound C treatment with significant G2/M cell cycle arrest and attenuated the compound C-induced apoptosis but not autophagy. The compound C induced G2/M arrest in p53-knockdown BCC cells was associated with the sustained inactive Tyr15 phosphor-Cdc2 expression. Overall, our results established that compound C-induced apoptosis in skin cancer cells was dependent on the cell's p53 status. - Highlights: ► Compound C caused more apoptosis in p53 wildtype than p53-mutant skin cancer cells. ► Compound C can upregulate p53 expression and induce p53 activation. ► Compound C induced p53 effects were dependent on ROS induced DNA damage pathway. ► p53-knockdown attenuated compound C-induced apoptosis but not autophagy. ► Compound C-induced apoptosis in skin cancer cells was dependent on p53 status

  20. Characterisation in vivo of ways of induced deaths by p53, in the male germinal cells

    International Nuclear Information System (INIS)

    Coureuil, M.

    2006-10-01

    The male germinal cells constitute a heterogeneous cell population including pre-meiotic proliferating cells (spermatogonia) and meiotic cells and post meiotic cells in differentiation (spermatocytes and spermatids). We study the involvement in vivo of the p53 protein in the death of these cells with the help of two models, (1) a transgenic model of infertility, MTp53, in which the p53 is over expressed in the differentiated cells and induced their death, (2) the response of these cells to gamma irradiation, where only the spermatogonia die by apoptosis dependent of p53. We showed that the caspases (cysteine-aspartic proteases) are involved in the terminal differentiation of normal germinal cells. But in the MTp53 model, the p53 induces the death of differentiated cells via the activation of calpains and not of caspases. We studied the response of spermatogonia, to gamma irradiation by a transcriptomic approach, by DNA chips and semi-quantitative RT-PCR. we showed that the puma and dr5 genes are induced by the p53 after irradiation. more, the study of mice invalidated for trail ( the dr5 ligand) or for puma, allowed to demonstrate that the two effectors are essential to the activation of intrinsic and extrinsic ways of apoptosis. (N.C.)

  1. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    Science.gov (United States)

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  2. Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

    International Nuclear Information System (INIS)

    Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G

    2013-01-01

    Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

  3. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    OpenAIRE

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine ...

  4. Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

    International Nuclear Information System (INIS)

    Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

    2007-01-01

    Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

  5. Effect of p53 genotype on gene expression profiles in murine liver

    International Nuclear Information System (INIS)

    Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

    2008-01-01

    The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

  6. A dynamic P53-MDM2 model with time delay

    Energy Technology Data Exchange (ETDEWEB)

    Mihalas, Gh.I. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: mihalas@medinfo.umft.ro; Neamtu, M. [Department of Forecasting, Economic Analysis, Mathematics and Statistics, West University of Timisoara, Str. Pestalozzi, nr. 14A, 300115 Timisoara (Romania)]. E-mail: mihaela.neamtu@fse.uvt.ro; Opris, D. [Department of Applied Mathematics, West University of Timisoara, Bd. V. Parvan, nr. 4, 300223 Timisoara (Romania)]. E-mail: opris@math.uvt.ro; Horhat, R.F. [Department of Biophysics and Medical Informatics, University of Medicine and Pharmacy, Piata Eftimie Murgu, nr. 3, 300041 Timisoara (Romania)]. E-mail: rhorhat@yahoo.com

    2006-11-15

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results.

  7. A dynamic P53-MDM2 model with time delay

    International Nuclear Information System (INIS)

    Mihalas, Gh.I.; Neamtu, M.; Opris, D.; Horhat, R.F.

    2006-01-01

    Specific activator and repressor transcription factors which bind to specific regulator DNA sequences, play an important role in gene activity control. Interactions between genes coding such transcription factors should explain the different stable or sometimes oscillatory gene activities characteristic for different tissues. Starting with the model P53-MDM2 described into [Mihalas GI, Simon Z, Balea G, Popa E. Possible oscillatory behaviour in P53-MDM2 interaction computer simulation. J Biol Syst 2000;8(1):21-9] and the process described into [Kohn KW, Pommier Y. Molecular interaction map of P53 and MDM2 logic elements, which control the off-on switch of P53 in response to DNA damage. Biochem Biophys Res Commun 2005;331:816-27] we enveloped a new model of this interaction. Choosing the delay as a bifurcation parameter we study the direction and stability of the bifurcating periodic solutions. Some numerical examples are finally given for justifying the theoretical results

  8. Post-translational regulation enables robust p53 regulation.

    Science.gov (United States)

    Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

    2013-08-30

    The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

  9. Overexpression of p53 in Nigerian