Expression and purification of antimicrobial peptide adenoregulin with C-amidated terminus in Escherichia coli.

Science.gov (United States)

Cao, Wei; Zhou, Yuxun; Ma, Yushu; Luo, Qingping; Wei, Dongzhi

2005-04-01

Adenoregulin is a 33 amino acid antimicrobial peptide isolated from the skin of the arboreal frog Phyllomedusa bicolor. Natural adenoregulin is synthesized with an amidated valine residue at C-terminus and shows lethal effects against filamentous fungi, as well as a broad spectrum of pathogenic microorganisms. A synthetic gene for adenoregulin (ADR) with an additional amino acid glutamine at C-terminus was cloned into pET32a vector to allow expression of ADR as a Trx fusion protein in Escherichia coli BL21(DE3). The resulting expression level of the fusion protein could reach up to 20% of the total cell proteins. The fusion protein could be purified effectively by Ni2+-chelating chromatography. Released from the fusion protein by enterokinase cleavage and purified to homogeneity, the recombinant ADR displayed antimicrobial activity similar to that of the synthetic ADR reported earlier. Comparing the antimicrobial activities of the recombinant adenoregulin with C-amidated terminus to that without an amidated C-terminus, we found that the amide of glutamine at C-terminus of ADR improved its potency on certain microorganisms such as Tritirachium album and Saccharomyces cerevisiae.

Anticandida Activity Is Retained in P-113, a 12-Amino-Acid Fragment of Histatin 5

OpenAIRE

Rothstein, David M.; Spacciapoli, Peter; Tran, Linh T.; Xu, Tao; Roberts, F. Donald; Dalla Serra, Mauro; Buxton, Deborah K.; Oppenheim, Frank G.; Friden, Phillip

2001-01-01

Through the analysis of a series of 25 peptides composed of various portions of the histatin 5 sequence, we have identified P-113, a 12-amino-acid fragment of histatin 5, as the smallest fragment that retains anticandidal activity comparable to that of the parent compound. Amidation of the P-113 C terminus increased the anticandidal activity of P-113 approximately twofold. The three histidine residues could be exchanged for three hydrophobic residues, with the fragment retaining anticandidal ...

OTUD5 regulates p53 stability by deubiquitinating p53.

Directory of Open Access Journals (Sweden)

Judong Luo

Full Text Available The p53 tumour suppressor protein is a transcription factor that prevents oncogenic progression by activating the expression of apoptosis and cell-cycle arrest genes in stressed cells. The stability of p53 is tightly regulated by ubiquitin-dependent degradation, driven mainly by its negative regulators ubiquitin ligase MDM2.In this study, we have identified OTUD5 as a DUB that interacts with and deubiquitinates p53. OTUD5 forms a direct complex with p53 and controls level of ubiquitination. The function of OTUD5 is required to allow the rapid activation of p53-dependent transcription and a p53-dependent apoptosis in response to DNA damage stress.As a novel deubiquitinating enzyme for p53, OTUD5 is required for the stabilization and the activation of a p53 response.

Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

International Nuclear Information System (INIS)

Tommaso, Anne di; Hagen, Jussara; Tompkins, Van; Muniz, Viviane; Dudakovic, Amel; Kitzis, Alain; Ladeveze, Veronique; Quelle, Dawn E.

2009-01-01

The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala 14 and Thr 31 ) were found to destabilize the protein while two others (Val 24 and Ala 41 ) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significant biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val 24 was required for p53-independent growth suppression whereas multiple residues (Val 24 , Thr 31 , Ala 41 and His 60 ) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.

DNA-PK, ATM and ATR collaboratively regulate p53-RPA interaction to facilitate homologous recombination DNA repair.

Science.gov (United States)

Serrano, M A; Li, Z; Dangeti, M; Musich, P R; Patrick, S; Roginskaya, M; Cartwright, B; Zou, Y

2013-05-09

Homologous recombination (HR) and nonhomologous end joining (NHEJ) are two distinct DNA double-stranded break (DSB) repair pathways. Here, we report that DNA-dependent protein kinase (DNA-PK), the core component of NHEJ, partnering with DNA-damage checkpoint kinases ataxia telangiectasia mutated (ATM) and ATM- and Rad3-related (ATR), regulates HR repair of DSBs. The regulation was accomplished through modulation of the p53 and replication protein A (RPA) interaction. We show that upon DNA damage, p53 and RPA were freed from a p53-RPA complex by simultaneous phosphorylations of RPA at the N-terminus of RPA32 subunit by DNA-PK and of p53 at Ser37 and Ser46 in a Chk1/Chk2-independent manner by ATR and ATM, respectively. Neither the phosphorylation of RPA nor of p53 alone could dissociate p53 and RPA. Furthermore, disruption of the release significantly compromised HR repair of DSBs. Our results reveal a mechanism for the crosstalk between HR repair and NHEJ through the co-regulation of p53-RPA interaction by DNA-PK, ATM and ATR.

Bacillus subtilis SepF binds to the C-terminus of FtsZ.

Science.gov (United States)

Król, Ewa; van Kessel, Sebastiaan P; van Bezouwen, Laura S; Kumar, Neeraj; Boekema, Egbert J; Scheffers, Dirk-Jan

2012-01-01

Bacterial cell division is mediated by a multi-protein machine known as the "divisome", which assembles at the site of cell division. Formation of the divisome starts with the polymerization of the tubulin-like protein FtsZ into a ring, the Z-ring. Z-ring formation is under tight control to ensure bacteria divide at the right time and place. Several proteins bind to the Z-ring to mediate its membrane association and persistence throughout the division process. A conserved stretch of amino acids at the C-terminus of FtsZ appears to be involved in many interactions with other proteins. Here, we describe a novel pull-down assay to look for binding partners of the FtsZ C-terminus, using a HaloTag affinity tag fused to the C-terminal 69 amino acids of B. subtilis FtsZ. Using lysates of Escherichia coli overexpressing several B. subtilis cell division proteins as prey we show that the FtsZ C-terminus specifically pulls down SepF, but not EzrA or MinC, and that the interaction depends on a conserved 16 amino acid stretch at the extreme C-terminus. In a reverse pull-down SepF binds to full-length FtsZ but not to a FtsZΔC16 truncate or FtsZ with a mutation of a conserved proline in the C-terminus. We show that the FtsZ C-terminus is required for the formation of tubules from FtsZ polymers by SepF rings. An alanine-scan of the conserved 16 amino acid stretch shows that many mutations affect SepF binding. Combined with the observation that SepF also interacts with the C-terminus of E. coli FtsZ, which is not an in vivo binding partner, we propose that the secondary and tertiary structure of the FtsZ C-terminus, rather than specific amino acids, are recognized by SepF.

Bacillus subtilis SepF binds to the C-terminus of FtsZ.

Directory of Open Access Journals (Sweden)

Ewa Król

Full Text Available Bacterial cell division is mediated by a multi-protein machine known as the "divisome", which assembles at the site of cell division. Formation of the divisome starts with the polymerization of the tubulin-like protein FtsZ into a ring, the Z-ring. Z-ring formation is under tight control to ensure bacteria divide at the right time and place. Several proteins bind to the Z-ring to mediate its membrane association and persistence throughout the division process. A conserved stretch of amino acids at the C-terminus of FtsZ appears to be involved in many interactions with other proteins. Here, we describe a novel pull-down assay to look for binding partners of the FtsZ C-terminus, using a HaloTag affinity tag fused to the C-terminal 69 amino acids of B. subtilis FtsZ. Using lysates of Escherichia coli overexpressing several B. subtilis cell division proteins as prey we show that the FtsZ C-terminus specifically pulls down SepF, but not EzrA or MinC, and that the interaction depends on a conserved 16 amino acid stretch at the extreme C-terminus. In a reverse pull-down SepF binds to full-length FtsZ but not to a FtsZΔC16 truncate or FtsZ with a mutation of a conserved proline in the C-terminus. We show that the FtsZ C-terminus is required for the formation of tubules from FtsZ polymers by SepF rings. An alanine-scan of the conserved 16 amino acid stretch shows that many mutations affect SepF binding. Combined with the observation that SepF also interacts with the C-terminus of E. coli FtsZ, which is not an in vivo binding partner, we propose that the secondary and tertiary structure of the FtsZ C-terminus, rather than specific amino acids, are recognized by SepF.

The DNA binding and activation domains of Gal4p are sufficient for conveying its regulatory signals.

OpenAIRE

Ding, W V; Johnston, S A

1997-01-01

The transcriptional activation function of the Saccharomyces cerevisiae activator Gal4p is known to rely on a DNA binding activity at its amino terminus and an activation domain at its carboxy terminus. Although both domains are required for activation, truncated forms of Gal4p containing only these domains activate poorly in vivo. Also, mutations in an internal conserved region of Gal4p inactivate the protein, suggesting that this internal region has some function critical to the activity of...

Diverse amino acid changes at specific positions in the N-terminal region of the coat protein allow Plum pox virus to adapt to new hosts.

Science.gov (United States)

Carbonell, Alberto; Maliogka, Varvara I; Pérez, José de Jesús; Salvador, Beatriz; León, David San; García, Juan Antonio; Simón-Mateo, Carmen

2013-10-01

Plum pox virus (PPV)-D and PPV-R are two isolates from strain D of PPV that differ in host specificity. Previous analyses of chimeras originating from PPV-R and PPV-D suggested that the N terminus of the coat protein (CP) includes host-specific pathogenicity determinants. Here, these determinants were mapped precisely by analyzing the infectivity in herbaceous and woody species of chimeras containing a fragment of the 3' region of PPV-D (including the region coding for the CP) in a PPV-R backbone. These chimeras were not infectious in Prunus persica, but systemically infected Nicotiana clevelandii and N. benthamiana when specific amino acids were modified or deleted in a short 30-amino-acid region of the N terminus of the CP. Most of these mutations did not reduce PPV fitness in Prunus spp. although others impaired systemic infection in this host. We propose a model in which the N terminus of the CP, highly relevant for virus systemic movement, is targeted by a host defense mechanism in Nicotiana spp. Mutations in this short region allow PPV to overcome the defense response in this host but can compromise the efficiency of PPV systemic movement in other hosts such as Prunus spp.

Piracetam ameliorated oxygen and glucose deprivation-induced injury in rat cortical neurons via inhibition of oxidative stress, excitatory amino acids release and P53/Bax.

Science.gov (United States)

He, Zhi; Hu, Min; Zha, Yun-hong; Li, Zi-cheng; Zhao, Bo; Yu, Ling-ling; Yu, Min; Qian, Ying

2014-05-01

Our previous work has demonstrated that piracetam inhibited the decrease in amino acid content induced by chronic hypoperfusion, ameliorated the dysfunction of learning and memory in a hypoperfusion rat model, down-regulated P53, and BAX protein, facilitated the synaptic plasticity, and may be helpful in the treatment of vascular dementia. To explore the precise mechanism, the present study further evaluated effects of piracetam on Oxygen and glucose deprivation (OGD)-induced neuronal damage in rat primary cortical cells. The addition of piracetam to the cultured cells 12 h before OGD for 4 h significantly reduced neuronal damage as determined by MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and lactate dehydrogenase release experiments. Piracetam also lowered the levels of malondialdehyde, nitrogen monoxidum, and xanthine oxidase which was increased in the OGD cells, and enhanced the activities of superoxide dismutase and glutathione peroxidase, which were decreased in the OGD cells. We also demonstrated that piracetam could decrease glutamate and aspartate release when cortical cells were subjected to OGD. Furthermore, Western blot study demonstrated that piracetam attenuated the increased expression of P53 and BAX protein in OGD cells. These observations demonstrated that piracetam reduced OGD-induced neuronal damage by inhibiting the oxidative stress and decreasing excitatory amino acids release and lowering P53/Bax protein expression in OGD cells.

Importance of Terminal Amino Acid Residues to the Transport of Oligopeptides across the Caco-2 Cell Monolayer.

Science.gov (United States)

Ding, Long; Wang, Liying; Yu, Zhipeng; Ma, Sitong; Du, Zhiyang; Zhang, Ting; Liu, Jingbo

2017-09-06

The objective of this paper was to investigate the effects of terminal amino acids on the transport of oligopeptides across the Caco-2 cell monolayer. Ala-based tetra- and pentapeptides were designed, and the N- or C-terminal amino acid residues were replaced by different amino acids. The results showed that the oligopeptides had a wide range of transport permeability across the Caco-2 cell monolayer and could be divided into four categories: non-/poor permeability, low permeability, intermediate permeability, and good permeability. Tetrapeptides with N-terminal Leu, Pro, Ile, Cys, Met, and Val or C-terminal Val showed the highest permeability, with apparent permeability coefficient (P app ) values over 10 × 10 -6 cm/s (p transport of tetrapeptides. Pentapeptides with N- or C-terminal Tyr also showed high permeability levels, with P app values of about 10 × 10 -6 cm/s. The amino acids Glu, Asn, and Thr at the N terminus or Lys, Asp, and Arg at the C terminus were also beneficial for the transport of tetra- and pentapeptides, with P app values ranging from 1 × 10 -6 to 10 × 10 -6 cm/s. In addition, peptides with amino acids replaced at the N terminus generally showed higher permeability than those with amino acids replaced at the C terminus (p transport of oligopeptides across the Caco-2 cell monolayer.

The pH Stability of Foot-and-Mouth Disease Virus Particles Is Modulated by Residues Located at the Pentameric Interface and in the N Terminus of VP1.

Science.gov (United States)

Caridi, Flavia; Vázquez-Calvo, Angela; Sobrino, Francisco; Martín-Acebes, Miguel A

2015-05-01

The picornavirus foot-and-mouth disease virus (FMDV) is the etiological agent of a highly contagious disease that affects important livestock species. The FMDV capsid is highly acid labile, and viral particles lose infectivity due to their disassembly at pH values slightly below neutrality. This acid sensitivity is related to the mechanism of viral uncoating and genome penetration from endosomes. In this study, we have analyzed the molecular basis of FMDV acid-induced disassembly by isolating and characterizing a panel of novel FMDV mutants differing in acid sensitivity. Amino acid replacements altering virion stability were preferentially distributed in two different regions of the capsid: the N terminus of VP1 and the pentameric interface. Even more, the acid labile phenotype induced by a mutation located at the pentameric interface in VP3 could be compensated by introduction of an amino acid substitution in the N terminus of VP1. These results indicate that the acid sensitivity of FMDV can be considered a multifactorial trait and that virion stability is the fine-tuned product of the interaction between residues from different capsid proteins, in particular those located within the N terminus of VP1 or close to the pentameric interface. The viral capsid protects the viral genome from environmental factors and contributes to virus dissemination and infection. Thus, understanding of the molecular mechanisms that modulate capsid stability is of interest for the basic knowledge of the biology of viruses and as a tool to improve the stability of conventional vaccines based on inactivated virions or empty capsids. Using foot-and-mouth disease virus (FMDV), which displays a capsid with extreme acid sensitivity, we have performed a genetic study to identify the molecular determinants involved in capsid stability. A panel of FMDV mutants with differential sensitivity to acidic pH was generated and characterized, and the results showed that two different regions of FMDV

Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

Science.gov (United States)

Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

2017-09-29

p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Chimeric Protein PTEN-L-p53 Enters U251 Cells to Repress Proliferation and Invasion.

Science.gov (United States)

Xiao, Man; An, Yang; Wang, Fengling; Yao, Chao; Zhang, Chu; Xin, Junfang; Duan, Yongjian; Zhao, Xiaofang; Fang, Na; Ji, Shaoping

2018-05-23

PTEN, a well-known tumor suppressor, dephosphorylates PIP3 and inhibits AKT activity. A translational variant of PTEN has been identified and termed PTEN-Long (PTEN-L). The additional 173 amino acids (PTEN-L leader) at the N-terminal constitute a potential signal peptide. Differing from canonical PTEN, PTEN-L is secreted into the extracellular fluid and re-enters recipient cells, playing the similar roles as PTEN in vivo and in vitro. This character confers the PTEN-L a therapeutic ability via directly protein delivering instead of traditional DNA and RNA vector options. In the present study, we employed PTEN-L leader to assemble a fusion protein, PTEN-L-p53, inosculated with the transcriptional regulator TP53, which is another powerful tumor suppressor. We overexpressed PTEN-L-p53 in HEK293T cells and detected it in both the cytoplasm and nucleus. Subsequently, we found that PTEN-L-p53 was secreted outside of the cells and detected in the culture media by immunoblotting. Furthermore, we demonstrated that PTEN-L-p53 freely entered the cells and suppressed the viability of U251cells (p53 R273H , a cell line with p53 R273H-mutation). PTEN-L-p53 is composed of endogenous protein/peptide bearing low immunogenicity, and only the junction region between PTEN-L leader and p53 can act as a new immune epitope. Accordingly, this fusion protein can potentially be used as a therapeutic option for TP53-abnormality cancers. Copyright © 2018. Published by Elsevier Inc.

P53 Gene Mutation as Biomarker of Radiation Induced Cell Injury and Genomic Instability

International Nuclear Information System (INIS)

Mukh-Syaifudin

2006-01-01

Gene expression profiling and its mutation has become one of the most widely used approaches to identify genes and their functions in the context of identify and categorize genes to be used as radiation effect markers including cell and tissue sensitivities. Ionizing radiation produces genetic damage and changes in gene expression that may lead to cancer due to specific protein that controlling cell proliferation altered the function, its expression or both. P53 protein encoded by p53 gene plays an important role in protecting cell by inducing growth arrest and or cell suicide (apoptosis) after deoxyribonucleic acid (DNA) damage induced by mutagen such as ionizing radiation. The mutant and thereby dysfunctional of this gene was found in more than 50% of various human cancers, but it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. P53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests that alterations in the p53 gene might lead to oncogenic transformation. Current attractive model of carcinogenesis also showed that p53 gene is the major target of radiation. The majority of p53 mutations found so far is single base pair changes ( point mutations), which result in amino acid substitutions or truncated forms of the p53 protein, and are widely distributed throughout the evolutionary conserved regions of the gene. Examination of p53 mutations in human cancer also shows an association between particular carcinogens and

Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

Science.gov (United States)

Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

2017-01-01

Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

A potyvirus vector efficiently targets recombinant proteins to chloroplasts, mitochondria and nuclei in plant cells when expressed at the amino terminus of the polyprotein.

Science.gov (United States)

Majer, Eszter; Navarro, José-Antonio; Daròs, José-Antonio

2015-09-01

Plant virus-based expression systems allow quick and efficient production of recombinant proteins in plant biofactories. Among them, a system derived from tobacco etch virus (TEV; genus potyvirus) permits coexpression of equimolar amounts of several recombinant proteins. This work analyzed how to target recombinant proteins to different subcellular localizations in the plant cell using this system. We constructed TEV clones in which green fluorescent protein (GFP), with a chloroplast transit peptide (cTP), a nuclear localization signal (NLS) or a mitochondrial targeting peptide (mTP) was expressed either as the most amino-terminal product or embedded in the viral polyprotein. Results showed that cTP and mTP mediated efficient translocation of GFP to the corresponding organelle only when present at the amino terminus of the viral polyprotein. In contrast, the NLS worked efficiently at both positions. Viruses expressing GFP in the amino terminus of the viral polyprotein produced milder symptoms. Untagged GFPs and cTP and NLS tagged amino-terminal GFPs accumulated to higher amounts in infected tissues. Finally, viral progeny from clones with internal GFPs maintained the extra gene better. These observations will help in the design of potyvirus-based vectors able to coexpress several proteins while targeting different subcellular localizations, as required in plant metabolic engineering. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6

Energy Technology Data Exchange (ETDEWEB)

Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Yu, Ting, E-mail: t.yu2@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Lang, Matti A., E-mail: m.lang@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia); Hakkola, Jukka, E-mail: Jukka.hakkola@oulu.fi [Institute of Biomedicine, Department of Pharmacology and Toxicology and Medical Research Center Oulu, Oulu University Hospital and University of Oulu, Oulu (Finland); Abu-Bakar, A' edah, E-mail: a.abubakar@uq.edu.au [The University of Queensland, National Research Centre for Environmental Toxicology (Entox), 4072 Brisbane, Queensland (Australia)

2015-11-15

Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsiveness in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4�

Degradation of p53 by human Alphapapillomavirus E6 proteins shows a stronger correlation with phylogeny than oncogenicity.

Directory of Open Access Journals (Sweden)

Leiping Fu

2010-09-01

Full Text Available Human Papillomavirus (HPV E6 induced p53 degradation is thought to be an essential activity by which high-risk human Alphapapillomaviruses (alpha-HPVs contribute to cervical cancer development. However, most of our understanding is derived from the comparison of HPV16 and HPV11. These two viruses are relatively distinct viruses, making the extrapolation of these results difficult. In the present study, we expand the tested strains (types to include members of all known HPV species groups within the Alphapapillomavirus genus.We report the biochemical activity of E6 proteins from 27 HPV types representing all alpha-HPV species groups to degrade p53 in human cells. Expression of E6 from all HPV types epidemiologically classified as group 1 carcinogens significantly reduced p53 levels. However, several types not associated with cancer (e.g., HPV53, HPV70 and HPV71 were equally active in degrading p53. HPV types within species groups alpha 5, 6, 7, 9 and 11 share a most recent common ancestor (MRCA and all contain E6 ORFs that degrade p53. A unique exception, HPV71 E6 ORF that degraded p53 was outside this clade and is one of the most prevalent HPV types infecting the cervix in a population-based study of 10,000 women. Alignment of E6 ORFs identified an amino acid site that was highly correlated with the biochemical ability to degrade p53. Alteration of this amino acid in HPV71 E6 abrogated its ability to degrade p53, while alteration of this site in HPV71-related HPV90 and HPV106 E6s enhanced their capacity to degrade p53.These data suggest that the alpha-HPV E6 proteins' ability to degrade p53 is an evolved phenotype inherited from a most recent common ancestor of the high-risk species that does not always segregate with carcinogenicity. In addition, we identified an amino-acid residue strongly correlated with viral p53 degrading potential.

Converging Mechanisms of p53 Activation Drive Motor Neuron Degeneration in Spinal Muscular Atrophy

Directory of Open Access Journals (Sweden)

Christian M. Simon

2017-12-01

Full Text Available The hallmark of spinal muscular atrophy (SMA, an inherited disease caused by ubiquitous deficiency in the SMN protein, is the selective degeneration of subsets of spinal motor neurons. Here, we show that cell-autonomous activation of p53 occurs in vulnerable but not resistant motor neurons of SMA mice at pre-symptomatic stages. Moreover, pharmacological or genetic inhibition of p53 prevents motor neuron death, demonstrating that induction of p53 signaling drives neurodegeneration. At late disease stages, however, nuclear accumulation of p53 extends to resistant motor neurons and spinal interneurons but is not associated with cell death. Importantly, we identify phosphorylation of serine 18 as a specific post-translational modification of p53 that exclusively marks vulnerable SMA motor neurons and provide evidence that amino-terminal phosphorylation of p53 is required for the neurodegenerative process. Our findings indicate that distinct events induced by SMN deficiency converge on p53 to trigger selective death of vulnerable SMA motor neurons.

Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

Science.gov (United States)

Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

2012-01-20

The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

p53 and ARF: Unexpected players in autophagy

OpenAIRE

Balaburski, Gregor M.; Hontz, Robert D.; Murphy, Maureen E.

2010-01-01

p53 and ARF are well-established tumor suppressor proteins that function together in the negative regulation of cancer. Recently, both of these proteins were found to play surprising roles in autophagy. Autophagy (“self-eating”) is a critical response of eukaryotic cells to metabolic and other stress. During this process, portions of the cytosol are sequestered into characteristic double membrane vesicles that are delivered to the lysosome for degradation, leading to the release of free amino...

INGN 201: Ad-p53, Ad5CMV-p53, Adenoviral p53, INGN 101, p53 gene therapy--Introgen, RPR/INGN 201.

Science.gov (United States)

2003-01-01

Introgen's adenoviral p53 gene therapy [INGN 201, ADVEXIN] is in clinical development for the treatment of various cancers. The p53 tumour suppressor gene is deleted or mutated in many tumour cells and is one of the most frequently mutated genes in human tumours. INGN 201 has been shown to kill cancer cells directly. In August 2002, Introgen announced plans to file an application for INGN 201 with the European Agency for the Evaluation of Medicinal Products (EMEA) for the treatment of head and neck cancer; the European filing will be submitted simultaneously with the previously scheduled (planned for 2004) submission of a Biologics License Application (BLA) for ADVEXIN to the US FDA. On 20 February 2003, INGN 201 received orphan drug designation from the US FDA for head and neck cancer. INGN 201 is available for licensing although Introgen favours retaining partial or full rights to the therapy in the US. Introgen Therapeutics and its collaborative partner for the p53 programme, Aventis Gencell, have been developing p53 gene therapy products. The agreement was originally signed by Rhône-Poulenc Rorer's Gencell division, which became Aventis Gencell after Rhône-Poulenc Rorer merged with Hoechst Marion Roussel to form Aventis Pharma. According to the original agreement, Introgen was responsible for phase I and preclinical development in North America, while Aventis Gencell was responsible for clinical trials conducted in Europe and for clinical trials in North America beyond phase I. In April 2001, Aventis Gencell and Introgen restructured their existing collaboration agreement for p53 gene therapy products. Aventis Gencell indicated that p53 research had suffered from internal competition for resources and was pulling back from its development agreement with Introgen for p53 gene therapy products. Introgen will assume responsibility for worldwide development of all p53 programmes and will obtain exclusive worldwide commercial rights to p53-based gene therapy

Cleavage sites in the polypeptide precursors of poliovirus protein P2-X

International Nuclear Information System (INIS)

Selmer, B.L.; Hanecak, R.; Anderson, C.W.; Wimmer, E.

1981-01-01

Partial amino-terminal sequence analysis has been performed on the three major polypeptide products (P2-3b, P2-5b, and P2-X) from the central region (P2) of the poliovirus polyprotein, and this analysis precisely locates the amino termini of these products with respect to the nucleotide sequence of the poliovirus RNA genome. Like most of the products of the replicase region (P3), the amino termini of P2-5b and P2-X are generated by cleavage between glutamine and glycine residues. Thus, P2-5b and P2-X are probably both produced by the action of a singly (virus-encoded.) proteinase. The amino terminus of P2-3b, on the other hand, is produced by a cleavage between the carboxy-terminal tyrosine of VP1 and the glycine encoded by nucleotides 3381-3383. This result may suggest that more than one proteolytic activity is required for the complete processing of the poliovirus polyprotein

p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

Science.gov (United States)

Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

2004-06-01

The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

The maternal genes Ci-p53/p73-a and Ci-p53/p73-b regulate zygotic ZicL expression and notochord differentiation in Ciona intestinalis embryos.

Science.gov (United States)

Noda, Takeshi

2011-12-01

I isolated a Ciona intestinalis homolog of p53, Ci-p53/p73-a, in a microarray screen of rapidly degraded maternal mRNA by comparing the transcriptomes of unfertilized eggs and 32-cell stage embryos. Higher expression of the gene in eggs and lower expression in later embryonic stages were confirmed by whole-mount in situ hybridization (WISH) and quantitative reverse transcription-PCR (qRT-PCR); expression was ubiquitous in eggs and early embryos. Knockdown of Ci-p53/p73-a by injection of antisense morpholino oligonucleotides (MOs) severely perturbed gastrulation cell movements and expression of notochord marker genes. A key regulator of notochord differentiation in Ciona embryos is Brachyury (Ci-Bra), which is directly activated by a zic-like gene (Ci-ZicL). The expression of Ci-ZicL and Ci-Bra in A-line notochord precursors was downregulated in Ci-p53/p73-a knockdown embryos. Maternal expression of Ci-p53/p73-b, a homolog of Ci-p53/p73-a, was also detected. In Ci-p53/p73-b knockdown embryos, gastrulation cell movements, expression of Ci-ZicL and Ci-Bra in A-line notochord precursors, and expression of notochord marker gene at later stages were perturbed. The upstream region of Ci-ZicL contains putative p53-binding sites. Cis-regulatory analysis of Ci-ZicL showed that these sites are involved in expression of Ci-ZicL in A-line notochord precursors at the 32-cell and early gastrula stages. These results suggest that p53 genes are maternal factors that play a crucial role in A-line notochord differentiation in C. intestinalis embryos by regulating Ci-ZicL expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Inhibition of p53 acetylation by INHAT subunit SET/TAF-Iβ represses p53 activity.

Science.gov (United States)

Kim, Ji-Young; Lee, Kyu-Sun; Seol, Jin-Ee; Yu, Kweon; Chakravarti, Debabrata; Seo, Sang-Beom

2012-01-01

The tumor suppressor p53 responds to a wide variety of cellular stress signals. Among potential regulatory pathways, post-translational modifications such as acetylation by CBP/p300 and PCAF have been suggested for modulation of p53 activity. However, exactly how p53 acetylation is modulated remains poorly understood. Here, we found that SET/TAF-Iβ inhibited p300- and PCAF-mediated p53 acetylation in an INHAT (inhibitor of histone acetyltransferase) domain-dependent manner. SET/TAF-Iβ interacted with p53 and repressed transcription of p53 target genes. Consequently, SET/TAF-Iβ blocked both p53-mediated cell cycle arrest and apoptosis in response to cellular stress. Using different apoptosis analyses, including FACS, TUNEL and BrdU incorporation assays, we also found that SET/TAF-Iβ induced cellular proliferation via inhibition of p53 acetylation. Furthermore, we observed that apoptotic Drosophila eye phenotype induced by either dp53 overexpression or UV irradiation was rescued by expression of dSet. Inhibition of dp53 acetylation by dSet was observed in both cases. Our findings provide new insights into the regulation of stress-induced p53 activation by HAT-inhibiting histone chaperone SET/TAF-Iβ.

Expression of Androgen Receptor Is Negatively Regulated By p53

Directory of Open Access Journals (Sweden)

Fatouma Alimirah

2007-12-01

Full Text Available Increased expression of androgen receptor (AR in prostate cancer (PC is associated with transition to androgen independence. Because the progression of PC to advanced stages is often associated with the loss of p53 function, we tested whether the p53 could regulate the expression of AR gene. Here we report that p53 negatively regulates the expression of AR in prostate epithelial cells (PrECs. We found that in LNCaP human prostate cancer cells that express the wild-type p53 and AR and in human normal PrECs, the activation of p53 by genotoxic stress or by inhibition of p53 nuclear export downregulated the expression of AR. Furthermore, forced expression of p53 in LNCaP cells decreased the expression of AR. Conversely, knockdown of p53 expression in LNCaP cells increased the AR expression. Consistent with the negative regulation of AR expression by p53, the p53-null HCT116 cells expressed higher levels of AR compared with the isogenic HCT116 cells that express the wildtype p53. Moreover, we noted that in etoposide treated LNCaP cells p53 bound to the promoter region of the AR gene, which contains a potential p53 DNA-binding consensus sequence, in chromatin immunoprecipitation assays. Together, our observations provide support for the idea that the loss of p53 function in prostate cancer cells contributes to increased expression of AR.

N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

Science.gov (United States)

Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

2012-08-01

Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

Recent progress of the study of p53 control mechanism by ionizing radiation

International Nuclear Information System (INIS)

Kawai, Hidehiko

2004-01-01

Reviewed are the recent findings on the control mechanism of function and activity of p53 as a response factor to stress of ionizing radiation. The p53 protein is controlled to be essentially inactive in cells under normal conditions and is activated by various stresses. The role of p53 as a stress-responding and tumor-suppressing factor in cells with damaged DNA is discussed in relation with its participation in G1/S and G2/M checkpoints, DNA repair, and apoptosis. The stress like radiation affects the control mechanisms of stability and function of p53 through modification of its N-terminal region (the activation domain of transcription), DNA binding region (core domain) and C-terminal region (domains of the nuclear export signaling, tetramer formation and its own regulation). MDM2 (mouse double minute 2) family, the most important regulatory factor of p53, forms a negative feedback cycle since the family is the target factor of p53 transcription and also suppressor of p53. MDM2 is regulated by phosphorylation and by interaction with itself or other factors like p300/CBP. Further studies on p53 are thus important in various fields as well as in radiation biology. (N.I.)

p53 oncogene mutations in head and neck cancer based on the ...

African Journals Online (AJOL)

Yomi

2012-01-26

Jan 26, 2012 ... In order to study the p53 mutations in head and neck cancer, we explored the relationship between the different positions of the bases and the amino acids' physical and chemical properties. In this paper, the Euclidean distance (d) was defined. Furthermore, by using improved variation coefficient method,.

Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

Science.gov (United States)

De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

2017-05-01

Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great

Transforming p21 ras protein: flexibility in the major variable region linking the catalytic and membrane-anchoring domains

DEFF Research Database (Denmark)

Willumsen, B M; Papageorge, A G; Hubbert, N

1985-01-01

or increasing it to 50 amino acids has relatively little effect on the capacity of the gene to induce morphological transformation of NIH 3T3 cells. Assays of GTP binding, GTPase and autophosphorylating activities of such mutant v-rasH-encoded proteins synthesized in bacteria indicated that the sequences...... that is required for post-translational processing, membrane localization and transforming activity of the proteins. We have now used the viral oncogene (v-rasH) of Harvey sarcoma virus to study the major variable region by deleting or duplicating parts of the gene. Reducing this region to five amino acids...... that encode these biochemical activities are located upstream from the major variable region. In the context of transformation, we propose that the region of sequence heterogeneity serves principally to connect the N-terminal catalytic domain with amino acids at the C terminus that are required to anchor...

The 52Cr(p, γ)53Mn reaction

NARCIS (Netherlands)

Vuister, P.H.

The 52Cr(p, γ)53Mn reaction was investigated in the energy region Ep = 1.36–2.26 MeV. The resonance energies, the corresponding 53Mn excitation energies and the resonance strengths of 199 resonances, assigned to this reaction, are reported. The excitation energies and gamma-ray branchings of 13

p53 Aggregates penetrate cells and induce the co-aggregation of intracellular p53.

Directory of Open Access Journals (Sweden)

Karolyn J Forget

Full Text Available Prion diseases are unique pathologies in which the infectious particles are prions, a protein aggregate. The prion protein has many particular features, such as spontaneous aggregation, conformation transmission to other native PrP proteins and transmission from an individual to another. Protein aggregation is now frequently associated to many human diseases, for example Alzheimer's disease, Parkinson's disease or type 2 diabetes. A few proteins associated to these conformational diseases are part of a new category of proteins, called prionoids: proteins that share some, but not all, of the characteristics associated with prions. The p53 protein, a transcription factor that plays a major role in cancer, has recently been suggested to be a possible prionoid. The protein has been shown to accumulate in multiple cancer cell types, and its aggregation has also been reproduced in vitro by many independent groups. These observations suggest a role for p53 aggregates in cancer development. This study aims to test the «prion-like» features of p53. Our results show in vitro aggregation of the full length and N-terminally truncated protein (p53C, and penetration of these aggregates into cells. According to our findings, the aggregates enter cells using macropinocytosis, a non-specific pathway of entry. Lastly, we also show that once internalized by the cell, p53C aggregates can co-aggregate with endogenous p53 protein. Together, these findings suggest prion-like characteristics for p53 protein, based on the fact that p53 can spontaneously aggregate, these aggregates can penetrate cells and co-aggregate with cellular p53.

Glycerol restores the p53 function in human lingual cancer cells bearing mutant p53

International Nuclear Information System (INIS)

Ota, Ichiro; Yane, Katsunari; Yuki, Kazue; Kanata, Hirokazu; Hosoi, Hiroshi; Miyahara, Hiroshi

2001-01-01

Mutations in p53, tumor suppressor gene, have recently been shown to have an impact on the clinical course of several human tumors, including head and neck cancers. The genetic status of the p53 gene has been focused on as the most important candidate among various cancer-related genes for prognosis-predictive assays of cancer therapy. We examined the restoration of radiation- or cisplatin (CDDP)-induced p53-dependent apoptosis in human lingual cancer cells. The results suggest that glycerol is effective in inducing a conformational change of p53 and restoring normal function of mutant p53, leading to enhanced radiosensitivity or chemosensitivity through the induction of apoptosis. We have also represented the same results in vivo as in vitro. Thus, this novel tool for enhancement of radiosensitivity or chemosensitivity in cancer cells bearing m p53 may be applicable for p53-targeted cancer therapy. (author)

p53 Acetylation: Regulation and Consequences

International Nuclear Information System (INIS)

Reed, Sara M.; Quelle, Dawn E.

2014-01-01

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer

p53 Acetylation: Regulation and Consequences

Energy Technology Data Exchange (ETDEWEB)

Reed, Sara M. [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Quelle, Dawn E., E-mail: dawn-quelle@uiowa.edu [Department of Pharmacology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Medical Scientist Training Program, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States); Department of Pathology, The University of Iowa Carver College of Medicine, Iowa City, IA 52242 (United States)

2014-12-23

Post-translational modifications of p53 are critical in modulating its tumor suppressive functions. Ubiquitylation, for example, plays a major role in dictating p53 stability, subcellular localization and transcriptional vs. non-transcriptional activities. Less is known about p53 acetylation. It has been shown to govern p53 transcriptional activity, selection of growth inhibitory vs. apoptotic gene targets, and biological outcomes in response to diverse cellular insults. Yet recent in vivo evidence from mouse models questions the importance of p53 acetylation (at least at certain sites) as well as canonical p53 functions (cell cycle arrest, senescence and apoptosis) to tumor suppression. This review discusses the cumulative findings regarding p53 acetylation, with a focus on the acetyltransferases that modify p53 and the mechanisms regulating their activity. We also evaluate what is known regarding the influence of other post-translational modifications of p53 on its acetylation, and conclude with the current outlook on how p53 acetylation affects tumor suppression. Due to redundancies in p53 control and growing understanding that individual modifications largely fine-tune p53 activity rather than switch it on or off, many questions still remain about the physiological importance of p53 acetylation to its role in preventing cancer.

Isolation and characterization of DUSP11, a novel p53 target gene

DEFF Research Database (Denmark)

Caprara, Greta; Zamponi, Raffaella; Melixetian, Marina

2009-01-01

target gene. Consistent with this, the expression of DUSP11 is induced in a p53-dependent manner after treatment with DNA damaging agents. Chromatin immunoprecipitation analysis showed that p53 binds to 2 putative p53 DNA binding sites in the promoter region of DUSP11. Colony formation and proliferation...

FATS is a transcriptional target of p53 and associated with antitumor activity

Directory of Open Access Journals (Sweden)

Zhang Xifeng

2010-09-01

Full Text Available Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374 through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS. Mouse FATS was highly expressed in testis. The p53-responsive elements existed in proximal region of both mouse and human FATS promoters. Functional study indicated that the transcription of FATS gene was activated by p53, whereas such effect was abolished by site-directed mutagenesis in the p53-RE of FATS promoter. Furthermore, the expression of FATS increased upon DNA damage in a p53-dependent manner. FATS expression was silent or downregulated in human cancers, and overexpression of FATS suppressed tumorigenicity in vivo independently of p53. Our results reveal FATS as a p53-regulated gene to monitor genomic stability.

DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

International Nuclear Information System (INIS)

Wei Tang; Powell, Simon N.

1996-01-01

Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

Conserved amino acids within the N-terminus of the West Nile virus NS4A protein contribute to virus replication, protein stability and membrane proliferation

International Nuclear Information System (INIS)

Ambrose, R.L.; Mackenzie, J.M.

2015-01-01

The West Nile virus strain Kunjin virus (WNV KUN ) NS4A protein is a multifunctional protein involved in many aspects of the virus life-cycle and is a major component of the WNV KUN replication complex (RC). Previously we identified a conserved region in the C-terminus of NS4A regulating proteolytic processing and RC assembly, and now investigate key conserved residues in the N-terminus of NS4A and their contribution to WNV KUN replication. Mutation of P13 completely ablated replication, whereas, mutation of P48 and D49, near the first transmembrane helix, and G66 within the helix, showed variable defects in replication, virion secretion and membrane proliferation. Intriguingly, the P48 and G66 NS4A mutants resulted in specific proteasome depletion of NS4A that could in part be rescued with a proteasome inhibitor. Our results suggest that the N-terminus of NS4A contributes to correct folding and stability, essential for facilitating the essential roles of NS4A during replication. - Highlights: • Mutation of Proline13 of the WNV NS4A protein is lethal to replication. • 1st TMB helix of NS4A contributes to protein stability and membrane remodelling. • Unstable mutants of NS4A can be rescued with a proteasome inhibitor. • This study (and of others) contributes to a functional mapping of the NS4A protein

RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53abnormal myeloma cells independently of the p53 pathway.

Science.gov (United States)

Surget, Sylvanie; Descamps, Géraldine; Brosseau, Carole; Normant, Vincent; Maïga, Sophie; Gomez-Bougie, Patricia; Gouy-Colin, Nadège; Godon, Catherine; Béné, Marie C; Moreau, Philippe; Le Gouill, Steven; Amiot, Martine; Pellat-Deceunynck, Catherine

2014-06-14

The aim of this study was to evaluate the efficacy of the p53-reactivating drugs RITA and nutlin3a in killing myeloma cells. A large cohort of myeloma cell lines (n = 32) and primary cells (n = 21) was used for this study. This cohort contained cell lines with various TP53 statuses and primary cells with various incidences of deletion of chromosome 17. Apoptosis was evaluated using flow cytometry with Apo2.7 staining of the cell lines or via the loss of the myeloma-specific marker CD138 in primary cells. Apoptosis was further confirmed by the appearance of a subG1 peak and the activation of caspases 3 and 9. Activation of the p53 pathway was monitored using immunoblotting via the expression of the p53 target genes p21, Noxa, Bax and DR5. The involvement of p53 was further studied in 4 different p53-silenced cell lines. Both drugs induced the apoptosis of myeloma cells. The apoptosis that was induced by RITA was not related to the TP53 status of the cell lines or the del17p status of the primary samples (p = 0.52 and p = 0.80, respectively), and RITA did not commonly increase the expression level of p53 or p53 targets (Noxa, p21, Bax or DR5) in sensitive cells. Moreover, silencing of p53 in two TP53(mutated) cell lines failed to inhibit apoptosis that was induced by RITA, which confirmed that RITA-induced apoptosis in myeloma cells was p53 independent. In contrast, apoptosis induced by nutlin3a was directly linked to the TP53 status of the cell lines and primary samples (p RITA, in contrast to nutlin3a, effectively induced apoptosis in a subset of MM cells independently of p53. The findings and could be of interest for patients with a 17p deletion, who are resistant to current therapies.

The p53-dependent radioadaptive response

Science.gov (United States)

Ohnishi, Takeo

We already reported that conditioning exposures at low doses, or at low dose-rates, lowered radiation-induced p53-dependent apoptosis in cultured cells in vitro and in the spleens of mice in vivo. In this study, the aim was to characterize the p53-dependent radioadaptive response at the molecular level. We used wild-type (wt) p53 and mutated (m) p53 containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulation of p53, Hdm2, and iNOS was analyzed with Western blotting. The quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about 2-4 fold after challenging irradiation following a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of Pifithrin-α (a p53 inhibitor), RITA or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an iNOS inhibitor) and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover, radioresistance developed when wtp53 cells were treated with ISDN (an NO generating agent) alone. These findings suggest that NO radicals are an initiator of the radioadaptive response acting through the activation of Hdm2 and the depression of p53 accumulations.

RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

Science.gov (United States)

Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

2014-07-10

Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

Directory of Open Access Journals (Sweden)

Lin Tai-Du

2010-12-01

Full Text Available Abstract Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1 are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development.

Crystal structure of the karyopherin Kap121p bound to the extreme C-terminus of the protein phosphatase Cdc14p

Energy Technology Data Exchange (ETDEWEB)

Kobayashi, Junya [Division of Biological Science, Graduate School of Science, Nagoya University (Japan); Hirano, Hidemi [Division of Biological Science, Graduate School of Science, Nagoya University (Japan); Structural Biology Research Center, Graduate School of Science, Nagoya University (Japan); Matsuura, Yoshiyuki, E-mail: matsuura.yoshiyuki@d.mbox.nagoya-u.ac.jp [Division of Biological Science, Graduate School of Science, Nagoya University (Japan); Structural Biology Research Center, Graduate School of Science, Nagoya University (Japan)

2015-07-31

In Saccharomyces cerevisiae, the protein phosphatase Cdc14p is an antagonist of mitotic cyclin-dependent kinases and is a key regulator of late mitotic events such as chromosome segregation, spindle disassembly and cytokinesis. The activity of Cdc14p is controlled by cell-cycle dependent changes in its association with its competitive inhibitor Net1p (also known as Cfi1p) in the nucleolus. For most of the cell cycle up to metaphase, Cdc14p is sequestered in the nucleolus in an inactive state. During anaphase, Cdc14p is released from Net1p, spreads into the nucleus and cytoplasm, and dephosphorylates key mitotic targets. Although regulated nucleocytoplasmic shuttling of Cdc14p has been suggested to be important for exit from mitosis, the mechanism underlying Cdc14p nuclear trafficking remains poorly understood. Here we show that the C-terminal region (residues 517–551) of Cdc14p can function as a nuclear localization signal (NLS) in vivo and also binds to Kap121p (also known as Pse1p), an essential nuclear import carrier in yeast, in a Gsp1p-GTP-dependent manner in vitro. Moreover we report a crystal structure, at 2.4 Å resolution, of Kap121p bound to the C-terminal region of Cdc14p. The structure and structure-based mutational analyses suggest that either the last five residues at the extreme C-terminus of Cdc14p (residues 547–551; Gly-Ser-Ile-Lys-Lys) or adjacent residues with similar sequence (residues 540–544; Gly-Gly-Ile-Arg-Lys) can bind to the NLS-binding site of Kap121p, with two residues (Ile in the middle and Lys at the end of the five residues) of Cdc14p making key contributions to the binding specificity. Based on comparison with other structures of Kap121p-ligand complexes, we propose “IK-NLS” as an appropriate term to refer to the Kap121p-specific NLS. - Highlights: • The C-terminus of Cdc14p binds to Kap121p in a Gsp1p-GTP-dependent manner. • The crystal structure of Kap121p-Cdc14p complex is determined. • The structure reveals how

Crystal structure of the karyopherin Kap121p bound to the extreme C-terminus of the protein phosphatase Cdc14p

International Nuclear Information System (INIS)

Kobayashi, Junya; Hirano, Hidemi; Matsuura, Yoshiyuki

2015-01-01

In Saccharomyces cerevisiae, the protein phosphatase Cdc14p is an antagonist of mitotic cyclin-dependent kinases and is a key regulator of late mitotic events such as chromosome segregation, spindle disassembly and cytokinesis. The activity of Cdc14p is controlled by cell-cycle dependent changes in its association with its competitive inhibitor Net1p (also known as Cfi1p) in the nucleolus. For most of the cell cycle up to metaphase, Cdc14p is sequestered in the nucleolus in an inactive state. During anaphase, Cdc14p is released from Net1p, spreads into the nucleus and cytoplasm, and dephosphorylates key mitotic targets. Although regulated nucleocytoplasmic shuttling of Cdc14p has been suggested to be important for exit from mitosis, the mechanism underlying Cdc14p nuclear trafficking remains poorly understood. Here we show that the C-terminal region (residues 517–551) of Cdc14p can function as a nuclear localization signal (NLS) in vivo and also binds to Kap121p (also known as Pse1p), an essential nuclear import carrier in yeast, in a Gsp1p-GTP-dependent manner in vitro. Moreover we report a crystal structure, at 2.4 Å resolution, of Kap121p bound to the C-terminal region of Cdc14p. The structure and structure-based mutational analyses suggest that either the last five residues at the extreme C-terminus of Cdc14p (residues 547–551; Gly-Ser-Ile-Lys-Lys) or adjacent residues with similar sequence (residues 540–544; Gly-Gly-Ile-Arg-Lys) can bind to the NLS-binding site of Kap121p, with two residues (Ile in the middle and Lys at the end of the five residues) of Cdc14p making key contributions to the binding specificity. Based on comparison with other structures of Kap121p-ligand complexes, we propose “IK-NLS” as an appropriate term to refer to the Kap121p-specific NLS. - Highlights: • The C-terminus of Cdc14p binds to Kap121p in a Gsp1p-GTP-dependent manner. • The crystal structure of Kap121p-Cdc14p complex is determined. • The structure reveals how

S100A4 interacts with p53 in the nucleus and promotes p53 degradation.

Science.gov (United States)

Orre, L M; Panizza, E; Kaminskyy, V O; Vernet, E; Gräslund, T; Zhivotovsky, B; Lehtiö, J

2013-12-05

S100A4 is a small calcium-binding protein that is commonly overexpressed in a range of different tumor types, and it is widely accepted that S100A4 has an important role in the process of cancer metastasis. In vitro binding assays has shown that S100A4 interacts with the tumor suppressor protein p53, indicating that S100A4 may have additional roles in tumor development. In the present study, we show that endogenous S100A4 and p53 interact in complex samples, and that the interaction increases after inhibition of MDM2-dependent p53 degradation using Nutlin-3A. Further, using proximity ligation assay, we show that the interaction takes place in the cell nucleus. S100A4 knockdown experiments in two p53 wild-type cell lines, A549 and HeLa, resulted in stabilization of p53 protein, indicating that S100A4 is promoting p53 degradation. Finally, we demonstrate that S100A4 knockdown leads to p53-dependent cell cycle arrest and increased cisplatin-induced apoptosis. Thus, our data add a new layer to the oncogenic properties of S100A4 through its inhibition of p53-dependent processes.

Hypoxia-induced p53 modulates both apoptosis and radiosensitivity via AKT

Science.gov (United States)

Leszczynska, Katarzyna B.; Foskolou, Iosifina P.; Abraham, Aswin G.; Anbalagan, Selvakumar; Tellier, Céline; Haider, Syed; Span, Paul N.; O’Neill, Eric E.; Buffa, Francesca M.; Hammond, Ester M.

2015-01-01

Restoration of hypoxia-induced apoptosis in tumors harboring p53 mutations has been proposed as a potential therapeutic strategy; however, the transcriptional targets that mediate hypoxia-induced p53-dependent apoptosis remain elusive. Here, we demonstrated that hypoxia-induced p53-dependent apoptosis is reliant on the DNA-binding and transactivation domains of p53 but not on the acetylation sites K120 and K164, which, in contrast, are essential for DNA damage–induced, p53-dependent apoptosis. Evaluation of hypoxia-induced transcripts in multiple cell lines identified a group of genes that are hypoxia-inducible proapoptotic targets of p53, including inositol polyphosphate-5-phosphatase (INPP5D), pleckstrin domain–containing A3 (PHLDA3), sulfatase 2 (SULF2), B cell translocation gene 2 (BTG2), cytoplasmic FMR1-interacting protein 2 (CYFIP2), and KN motif and ankyrin repeat domains 3 (KANK3). These targets were also regulated by p53 in human cancers, including breast, brain, colorectal, kidney, bladder, and melanoma cancers. Downregulation of these hypoxia-inducible targets associated with poor prognosis, suggesting that hypoxia-induced apoptosis contributes to p53-mediated tumor suppression and treatment response. Induction of p53 targets, PHLDA3, and a specific INPP5D transcript mediated apoptosis in response to hypoxia through AKT inhibition. Moreover, pharmacological inhibition of AKT led to apoptosis in the hypoxic regions of p53-deficient tumors and consequently increased radiosensitivity. Together, these results identify mediators of hypoxia-induced p53-dependent apoptosis and suggest AKT inhibition may improve radiotherapy response in p53-deficient tumors. PMID:25961455

Human papillomavirus and p53 expression in cancer of unknown primary in the head and neck region in relation to clinical outcome

International Nuclear Information System (INIS)

Sivars, Lars; Näsman, Anders; Tertipis, Nikolaos; Vlastos, Andrea; Ramqvist, Torbjörn; Dalianis, Tina; Munck-Wikland, Eva; Nordemar, Sushma

2014-01-01

Patients with cancer of unknown primary (CUP) in the head neck region are generally treated with neck dissection followed by radiotherapy at times combined with chemotherapy, a treatment associated with considerable side effects. Some of these tumors may originate as human papillomavirus (HPV)-positive oropharyngeal squamous cell carcinoma (OSCC), with better clinical outcome than head neck squamous cell cancer (HNSCC) in general, and could potentially do well with less treatment. Here, we therefore investigated whether HPV status and p53-expression correlated to clinical outcome in patients with CUP in the head neck region. Fifty metastases were analyzed for presence of HPV DNA, and expression of p16 INK4A and p53 and the data were correlated to clinical outcome. Patients with HPV DNA-positive (HPV DNA+ ) metastases had significantly better 5-year overall survival (OS) compared to those with HPV DNA− metastases (80.0% vs. 36.7%, respectively; P = 0.004), with a similar tendency for disease-free survival (DFS). These survival rates showed excellent concordance with those of HPV DNA+ and HPV DNA− OSCC in Sweden during the same time period, strengthening the hypothesis that HPV DNA+ head and neck CUP may originate from HPV DNA+ OSCC. In addition, having absent/intermediary-low as compared to high expression of p53 correlated to a better prognosis with a 69% as compared to 14% 5-year OS, respectively (P < 0.001), and for DFS the tendency was analogous. In conclusion, both HPV status and p53 expression are valuable prognostic factors in patients with CUP in the head and neck region and should be further explored for clinical use

Chromatin-Bound MDM2 Regulates Serine Metabolism and Redox Homeostasis Independently of p53.

Science.gov (United States)

Riscal, Romain; Schrepfer, Emilie; Arena, Giuseppe; Cissé, Madi Y; Bellvert, Floriant; Heuillet, Maud; Rambow, Florian; Bonneil, Eric; Sabourdy, Frédérique; Vincent, Charles; Ait-Arsa, Imade; Levade, Thierry; Thibaut, Pierre; Marine, Jean-Christophe; Portais, Jean-Charles; Sarry, Jean-Emmanuel; Le Cam, Laurent; Linares, Laetitia K

2016-06-16

The mouse double minute 2 (MDM2) oncoprotein is recognized as a major negative regulator of the p53 tumor suppressor, but growing evidence indicates that its oncogenic activities extend beyond p53. Here, we show that MDM2 is recruited to chromatin independently of p53 to regulate a transcriptional program implicated in amino acid metabolism and redox homeostasis. Identification of MDM2 target genes at the whole-genome level highlights an important role for ATF3/4 transcription factors in tethering MDM2 to chromatin. MDM2 recruitment to chromatin is a tightly regulated process that occurs during oxidative stress and serine/glycine deprivation and is modulated by the pyruvate kinase M2 (PKM2) metabolic enzyme. Depletion of endogenous MDM2 in p53-deficient cells impairs serine/glycine metabolism, the NAD(+)/NADH ratio, and glutathione (GSH) recycling, impacting their redox state and tumorigenic potential. Collectively, our data illustrate a previously unsuspected function of chromatin-bound MDM2 in cancer cell metabolism. Copyright © 2016 Elsevier Inc. All rights reserved.

Expression of p53 and p21 in primary glioblastomas

International Nuclear Information System (INIS)

Gross, M.W.; Nashwan, K.; Engenhart-Cabillic, R.; Kraus, A.; Mennel, H.D.; Schlegel, J.

2005-01-01

Background and purpose: primary glioblastomas (GBMs) are highly radioresistant, and in contrast to secondary GBMs, they bear wild-type (wt) p53 protein, which is stabilized in a proportion of these tumors. Therefore, it was investigated in vivo whether p53 expression has prognostic value in patients undergoing radiochemotherapy. Additionally, the authors tried to identify, in vitro, subgroups of primary GBM with different susceptibilities to irradiation, on the basis of their p53 and p21 responses to ionizing radiation. Material and methods: tumor tissue samples from 31 patients suffering from primary GBM undergoing a combined radiochemotherapy with topotecan were investigated. The percentage of cells expressing p53 protein was determined immunohistochemically. Additionally, primary cultures from eleven primary GBMs were established and investigated. p53 and p21 expressions were evaluated before irradiation with 10 Gy and at 2 and 8 h after irradiation. p53 protein expression was measured by western analysis and p21 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR). Results: the percentage of p53-positive cells within the tumor specimens obtained from the 31 patients ranged from 0% to 28%, the median value being 4.3%. No significant correlation with disease-free survival or overall survival was found. In vitro, p53 protein was detected in seven of eleven cultures from primary GBM. After irradiation a decrease in p53 protein expression was seen in six of the seven p53-positive cultures. Half of the cultures (two of four) without basal p53 expression showed an increase in p53 expression after irradiation. Basal overexpression of p21 was detected in six of the eleven cultures; in four out of six irradiation led to a decrease in p21 expression. In all cell lines (five of eleven) initially showing absent p21 expression, irradiation induced p21 expression. Despite these responses, G1 arrest was not detectable in any of the GBM cultures

Immunohistochemical study of p53, pRb, p16 in esophageal cancer

International Nuclear Information System (INIS)

Zo, Jae Ill; Zo, Kyung Ja; Park, Jong Ho; Kim, Mi Hee

1998-01-01

To confirm the expression of molecular genetic alterations of p53, pRb, p16 in esophageal cancer and to investigate the expression of p53, pRb, p16 in esophageal cancer according to the pathologic steps of carcinogenesis, immuno-histochemistry was performed in 15 resected esophageal cancer specimens with multiple separated lesions after pathologic mapping. The accumulation of mutant p53 was observed in 60 % of dysplasia and 47 % of invasive cancer, while pRb was not detected in 91 % of dysplasia and 72.7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 7 % of invasive cancer. But p16 was not observed in 0 % in dysplasia and 28.6 % in invasive cancer. There was no simultaneous negative pRb and p16 expression. There was no relations between p53 and p16, pRb. As a results, the expression of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53, pRb, p16 was co-related well with molecular genetic changes and inactivation of p53 and pRb was common and early event in esophageal carcinogenesis in Korea, but inactivation of p16 was a infrequent change. (author). 17 refs., 2 tabs., 7 figs

Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

Directory of Open Access Journals (Sweden)

Jeyran eShahbazi

2013-05-01

Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

Science.gov (United States)

Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

2012-04-05

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

p53 Over-expression and p53 mutations in colon carcinomas: Relation to dietary risk factors

NARCIS (Netherlands)

Voskuil, D.W.; Kampman, E.; Kraats, A.A. van; Balder, H.F.; Muijen, G.N.P. van; Goldbohm, R.A.; Veer, P. van 't

1999-01-01

Epidemiological studies have suggested that dietary factors may differently affect p53-dependent and p53-independent pathways to colon cancer. Results of such studies may depend on the method used to assess p53 status. This case-control study of 185 colon-cancer cases and 259 controls examines this

Amino-terminal residues of ΔNp63, mutated in ectodermal dysplasia, are required for its transcriptional activity.

Science.gov (United States)

Lena, Anna Maria; Duca, Sara; Novelli, Flavia; Melino, Sonia; Annicchiarico-Petruzzelli, Margherita; Melino, Gerry; Candi, Eleonora

2015-11-13

p63, a member of the p53 family, is a crucial transcription factor for epithelial development and skin homeostasis. Heterozygous mutations in TP63 gene have been associated with human ectodermal dysplasia disorders. Most of these TP63 mutations are missense mutations causing amino acidic substitutions at p63 DNA binding or SAM domains that reduce or abolish the transcriptional activity of mutants p63. A significant number of mutants, however, resides in part of the p63 protein that apparently do not affect DNA binding and/or transcriptional activity, such as the N-terminal domain. Here, we characterize five p63 mutations at the 5' end of TP63 gene aiming to understand the pathogenesis of the diseases and to uncover the role of ΔNp63α N-terminus residues in determining its transactivation potential. Copyright © 2015 Elsevier Inc. All rights reserved.

Regulation of autophagy by cytoplasmic p53.

Science.gov (United States)

Tasdemir, Ezgi; Maiuri, M Chiara; Galluzzi, Lorenzo; Vitale, Ilio; Djavaheri-Mergny, Mojgan; D'Amelio, Marcello; Criollo, Alfredo; Morselli, Eugenia; Zhu, Changlian; Harper, Francis; Nannmark, Ulf; Samara, Chrysanthi; Pinton, Paolo; Vicencio, José Miguel; Carnuccio, Rosa; Moll, Ute M; Madeo, Frank; Paterlini-Brechot, Patrizia; Rizzuto, Rosario; Szabadkai, Gyorgy; Pierron, Gérard; Blomgren, Klas; Tavernarakis, Nektarios; Codogno, Patrice; Cecconi, Francesco; Kroemer, Guido

2008-06-01

Multiple cellular stressors, including activation of the tumour suppressor p53, can stimulate autophagy. Here we show that deletion, depletion or inhibition of p53 can induce autophagy in human, mouse and nematode cells subjected to knockout, knockdown or pharmacological inhibition of p53. Enhanced autophagy improved the survival of p53-deficient cancer cells under conditions of hypoxia and nutrient depletion, allowing them to maintain high ATP levels. Inhibition of p53 led to autophagy in enucleated cells, and cytoplasmic, not nuclear, p53 was able to repress the enhanced autophagy of p53(-/-) cells. Many different inducers of autophagy (for example, starvation, rapamycin and toxins affecting the endoplasmic reticulum) stimulated proteasome-mediated degradation of p53 through a pathway relying on the E3 ubiquitin ligase HDM2. Inhibition of p53 degradation prevented the activation of autophagy in several cell lines, in response to several distinct stimuli. These results provide evidence of a key signalling pathway that links autophagy to the cancer-associated dysregulation of p53.

SV40 large T-p53 complex: evidence for the presence of two immunologically distinct forms of p53

International Nuclear Information System (INIS)

Milner, J.; Gamble, J.

1985-01-01

The transforming protein of SV40 is the large T antigen. Large T binds a cellular protein, p53, which is potentially oncogenic by virtue of its functional involvement in the control of cell proliferation. This raises the possibility that p53 may mediate, in part, the transforming function of SV40 large T. Two immunologically distinct forms of p53 have been identified in normal cells: the forms are cell-cycle dependent, one being restricted to nondividing cells (p53-Go) and the second to dividing cells (p53-G divided by). The authors have now dissociated and probed the multimeric complex of SV40 large T-p53 for the presence of immunologically distinct forms of p53. Here they present evidence for the presence of p53-Go and p53-G divided by complexed with SV40 large T

LACTB, a novel epigenetic silenced tumor suppressor, inhibits colorectal cancer progression by attenuating MDM2-mediated p53 ubiquitination and degradation.

Science.gov (United States)

Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui

2018-06-13

Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.

Restoration of mp53 to wtp53 by chemical chaperones restores p53-dependent apoptosis after radiotherapy

International Nuclear Information System (INIS)

Ohnishi, T.; Asakawa, I.; Tamamoto, T.; Takahashi, A.; Ohnishi, K.

2003-01-01

The mutations of many kinds of cancer related genes have been investigated for the predictive assay against cancer therapy by the application of molecular biology. A tumor suppressor gene product of wtp53 plays important roles in cancer suppression through the induction of cell growth arrest, DNA repair or apoptosis. The p53 exerts its function by induction of downstream genes and/or interaction to various proteins. Mutations in the p53 gene (mp53) cause conformational alterations in the p53 protein, the majority of which can no longer induce expression of the downstream genes. The genetic status of p53 gene has been focused as the most important candidate among them for cancer therapy. The gene therapy of p53 has been already applied. We reported that the transfection of mp53 gene increased the radio-, thermo- and chemo-resistance, and depressed apoptosis introduced with them through bax-induction and proteolysis of PARP and caspase-3. From these results, we propose that the gene therapy of wtp53 to p53-deleted cancer cells may be very useful for cancer therapy by the combination with radiotherapy. Even in the case of mp53 cancer cells, we succeeded the restoration of mp53 to wtp53 by glycerol or C-terminal peptide of p53 as chemical chaperones. These experimental progresses might support effective cancer therapy against individual patients bearing with different p53 gene status by the use of the most suitable treatment to them in the near future

P53 family members modulate the expression of PRODH, but not PRODH2, via intronic p53 response elements.

Directory of Open Access Journals (Sweden)

Ivan Raimondi

Full Text Available The tumor suppressor p53 was previously shown to markedly up-regulate the expression of the PRODH gene, encoding the proline dehydrogenase (PRODH enzyme, which catalyzes the first step in proline degradation. Also PRODH2, which degrades 4-hydroxy-L-proline, a product of protein (e.g. collagen catabolism, was recently described as a p53 target. Here, we confirmed p53-dependent induction of endogenous PRODH in response to genotoxic damage in cell lines of different histological origin. We established that over-expression of TAp73β or TAp63β is sufficient to induce PRODH expression in p53-null cells and that PRODH expression parallels the modulation of endogenous p73 by genotoxic drugs in several cell lines. The p53, p63, and p73-dependent transcriptional activation was linked to specific intronic response elements (REs, among those predicted by bioinformatics tools and experimentally validated by a yeast-based transactivation assay. p53 occupancy measurements were validated in HCT116 and MCF7 human cell lines. Conversely, PRODH2 was not responsive to p63 nor p73 and, at best, could be considered a weak p53 target. In fact, minimal levels of PRODH2 transcript induction by genotoxic stress was observed exclusively in one of four p53 wild-type cell lines tested. Consistently, all predicted p53 REs in PRODH2 were poor matches to the p53 RE consensus and showed very weak responsiveness, only to p53, in the functional assay. Taken together, our results highlight that PRODH, but not PRODH2, expression is under the control of p53 family members, specifically p53 and p73. This supports a deeper link between proteins of the p53-family and metabolic pathways, as PRODH modulates the balance of proline and glutamate levels and those of their derivative alpha-keto-glutarate (α-KG under normal and pathological (tumor conditions.

The expanding regulatory universe of p53 in gastrointestinal cancer.

Science.gov (United States)

Fesler, Andrew; Zhang, Ning; Ju, Jingfang

2016-01-01

Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

Novel small molecule induces p53-dependent apoptosis in human colon cancer cells

International Nuclear Information System (INIS)

Park, Sang Eun; Min, Yong Ki; Ha, Jae Du; Kim, Bum Tae; Lee, Woo Ghil

2007-01-01

Using high-throughput screening with small-molecule libraries, we identified a compound, KCG165 [(2-(3-(2-(pyrrolidin-1-yl)ethoxy)-1,10b-dihydro-[1,2,4]triazolo[1,5-c] quinazolin-5(6H)-one)], which strongly activated p53-mediated transcriptional activity. KCG165-induced phosphorylations of p53 at Ser 6 , Ser 15 , and Ser 20 , which are all key residues involved in the activation and stabilization of p53. Consistent with these findings, KCG165 increased level of p53 protein and led to the accumulation of transcriptionally active p53 in the nucleus with the increased occupancy of p53 in the endogenous promoter region of its downstream target gene, p21 WAF1/CIP . Notably, KCG165-induced p53-dependent apoptosis in cancer cells. Furthermore, we suggested topoisomerase II as the molecular target of KCG165. Together, these results indicate that KCG165 may have potential applications as an antitumor agent

Interaction of an anticancer peptide fragment of azurin with p53 and its isolated domains studied by atomic force spectroscopy.

Science.gov (United States)

Bizzarri, Anna Rita; Santini, Simona; Coppari, Emilia; Bucciantini, Monica; Di Agostino, Silvia; Yamada, Tohru; Beattie, Craig W; Cannistraro, Salvatore

2011-01-01

p28 is a 28-amino acid peptide fragment of the cupredoxin azurin derived from Pseudomonas aeruginosa that preferentially penetrates cancerous cells and arrests their proliferation in vitro and in vivo. Its antitumor activity reportedly arises from post-translational stabilization of the tumor suppressor p53 normally downregulated by the binding of several ubiquitin ligases. This would require p28 to specifically bind to p53 to inhibit specific ligases from initiating proteosome-mediated degradation. In this study, atomic force spectroscopy, a nanotechnological approach, was used to investigate the interaction of p28 with full-length p53 and its isolated domains at the single molecule level. Analysis of the unbinding forces and the dissociation rate constant suggest that p28 forms a stable complex with the DNA-binding domain of p53, inhibiting the binding of ubiquitin ligases other than Mdm2 to reduce proteasomal degradation of p53.

Nuclear localization signal of ING4 plays a key role in its binding to p53

International Nuclear Information System (INIS)

Zhang Xin; Wang Kesheng; Wang Zhiqin; Xu Lusheng; Wang Qingwan; Chen Fei; Wei Dongzhi; Han Zeguang

2005-01-01

ING4, a novel member of ING family, is recently reported to interact with tumor suppressor p53 and negatively regulate the cell growth with significant G2/M arrest of cell cycle in HepG2 cells through upregulation of p53-inducible gene p21. However, which region of ING4 could have contributed to the binding to p53 remains largely unclear. Herein, the GST-pulldown experiments revealed that the middle region of ING4, a potential bipartite nuclear localization signal (NLS), could be involved in the binding to p53. Furthermore, the interaction of ING4 to p53 was abrogated in vitro and in vivo when certain mutations or the entire deletion of the NLS domain occurred. More interestingly, the mutations of the NLS domain could alter the ING4 nuclear localization, disrupt the interaction of ING4 with p53, and even, deregulate the p53-inducible gene p21 in MCF-7 cells. All data indicated that the NLS domain of ING4 is essential for the binding of ING4 to p53 and the function of ING4 associated with p53

DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

Science.gov (United States)

Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

2014-04-01

p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

Effect of p-amino-diphenyl ethers on hepatic microsomal cytochrome P450.

Science.gov (United States)

Jiang, Huidi; Xuan, Guida

2003-09-01

The present paper aims to investigate whether p-amino-2',4'-dichlorodiphenyl ether and p-amino-4'-methyldiphenyl ether are inhibitors as well as inducers of P450. Mice were given daily intraperitoneal (ip) injections of p-amino-2',4'-dichlorodiphenyl ether (0.25 mmol/kg) or p-amino-4'-methyldiphenyl ether (0.25 mmol/kg) for 4 days and tested at 24 h and 48 h after the last dose injection. The results showed the mice pentobarbital sleeping time was shorter and the P450 content of hepatic microsome increased significantly in the group pretreated with p-amino-4'-methyldiphenyl ether when compared with the control group, while in mice pretreated with p-amino-2',4'-dichlorodiphenyl ether the hepatic microsome P450 content increased but the pentobarbital sleeping time was extended in clear contrast to the control group. The sleeping time of the phenobarbital group (80 mg/kg daily ip injection for 4 days) was shortened at 24 h after the last injection with increased P450 content of hepatic microsome, but it showed no difference at 48 h. The zoxazolamine-paralysis times of mice treated with p-amino-2',4'-dichlorodiphenyl ether were longer than those of the control mice, while the same dose of zoxazolamine did not lead to paralysis in mice pretreated with BNF. p-Amino-2',4'-dichlorodiphenyl ether and p-amino-4'-methyldiphenyl ether inhibited the activity of 7-ethoxyresorufin O-deethylase from rat hepatic microsome induced by BNF in vitro by 70.0% and 50.1% respectively. These results suggest that p-amino-2',4'-dichlorodiphenyl ether and p-amino-4'-methyldiphenyl ether are inhibitors as well as inducers of P450.

The novel fusion proteins, GnRH-p53 and GnRHIII-p53, expression and their anti-tumor effect.

Directory of Open Access Journals (Sweden)

Peiyuan Jia

Full Text Available p53, one of the most well studied tumor suppressor factor, is responsible to a variety of damage owing to the induction of apoptosis and cell cycle arrest in the tumor cells. More than 50% of human tumors contain mutation or deletion of p53. Gonadotrophin-releasing hormone (GnRH, as the ligand of Gonadotrophin-releasing hormone receptor (GnRH-R, was used to deliver p53 into tumor cells. The p53 fusion proteins GnRH-p53 and GnRH iii-p53 were expressed and their targeted anti-tumor effects were determined. GnRH mediates its fusion proteins transformation into cancer cells. The intracellular delivery of p53 fusion proteins exerted the inhibition of the growth of H1299 cells in vitro and the reduction of tumor volume in vivo. Their anti-tumor effect was functioned by the apoptosis and cell cycle arrest induced by p53. Hence, the fusion protein could be a novel protein drug for anti-tumor therapy.

Distinct regions in the C-Terminus required for GLP-1R cell surface expression, activity and internalisation.

Science.gov (United States)

Thompson, Aiysha; Kanamarlapudi, Venkateswarlu

2015-09-15

The glucagon-like peptide-1 (GLP-1) receptor (GLP-1R), an important drug target in the treatment of type 2 diabetes, is a G-protein coupled receptor (GPCR) that mediates insulin secretion by GLP-1. The N-terminus controls GLP-1R biosynthetic trafficking to the cell surface but the C-terminus involvement in that trafficking is unknown. The aim of this study was to identify distinct regions within the C-terminal domain required for human GLP-1R (hGLP-1R) cell surface expression, activity and internalisation using a number of C-terminal deletions and site-directed mutations. The results of this study revealed that the residues 411-418 within the C-terminal domain of the hGLP-1R are critical in targeting the newly synthesised receptor to the plasma membrane. The residues 419-430 are important for cAMP producing activity of the receptor, most likely by coupling to Gαs. However, the residues 431-450 within the C-terminus are essential for agonist-induced hGLP-1R internalisation. In conclusion, these findings demonstrate the hGLP-1R has distinct regions within the C-terminal domain required for its cell surface expression, activity and agonist-induced internalisation. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

p53 mutations promote proteasomal activity.

Science.gov (United States)

Oren, Moshe; Kotler, Eran

2016-07-27

p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.

Directory of Open Access Journals (Sweden)

Carlos Farkas

Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.

Targeting the p53 Pathway in Ewing Sarcoma

Science.gov (United States)

Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

2011-01-01

The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

Division-induced DNA double strand breaks in the chromosome terminus region of Escherichia coli lacking RecBCD DNA repair enzyme.

Directory of Open Access Journals (Sweden)

Anurag Kumar Sinha

2017-10-01

Full Text Available Marker frequency analysis of the Escherichia coli recB mutant chromosome has revealed a deficit of DNA in a specific zone of the terminus, centred on the dif/TerC region. Using fluorescence microscopy of a marked chromosomal site, we show that the dif region is lost after replication completion, at the time of cell division, in one daughter cell only, and that the phenomenon is transmitted to progeny. Analysis by marker frequency and microscopy shows that the position of DNA loss is not defined by the replication fork merging point since it still occurs in the dif/TerC region when the replication fork trap is displaced in strains harbouring ectopic Ter sites. Terminus DNA loss in the recB mutant is also independent of dimer resolution by XerCD at dif and of Topo IV action close to dif. It occurs in the terminus region, at the point of inversion of the GC skew, which is also the point of convergence of specific sequence motifs like KOPS and Chi sites, regardless of whether the convergence of GC skew is at dif (wild-type or a newly created sequence. In the absence of FtsK-driven DNA translocation, terminus DNA loss is less precisely targeted to the KOPS convergence sequence, but occurs at a similar frequency and follows the same pattern as in FtsK+ cells. Importantly, using ftsIts, ftsAts division mutants and cephalexin treated cells, we show that DNA loss of the dif region in the recB mutant is decreased by the inactivation of cell division. We propose that it results from septum-induced chromosome breakage, and largely contributes to the low viability of the recB mutant.

Enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell with different p53 status

International Nuclear Information System (INIS)

Pang Dequan; Wang Peiguo; Wang Ping; Zhang Weiming

2008-01-01

Objective: To investigate the enhancement of radiosensitivity of recombinant Ad-p53 gene on human lung adenocarcinoma cell lines(A549 and GLC-82) with different p53 status in vitro. Methods: Two human lung adenocarcinoma cell lines of A549 and GLC-82 were examined on their difference in p53 status with immunohistochemistry stain and PCR-SSCP technique. Expand Ad-wtp53 was transfected into tumor cells. Clonogenic assays were performed to evaluate the inhibition effect on cell growth and the degree of sensitization to irradiation. Apoptosis and cell cycle changes were determined using the flow cytometry assay. Results: The A549 cell line presented positive P53 expression while GLC-82 negative. GLC-82 bore mutant p53 on the exon 7. The wtp53 gene could be efficiently expressed in the two cell lines and greatly inhibit the cell growth. Its efficiency didn't depend on the intrinsic p53 genetic status. After irradiation, its function of inducing G 1 arrest and apoptosis on GLC-82 cell line was much stronger than the A549 cell line. In both the A549 and GLC-82 cell lines, the combination of Ad-p53 plus radiation resulted in more apoptosis than the others. There was no significant difference between two groups. Conclusions: Ad-p53 can depress the tumor growth and enhance the radiosensitivity of human lung adenocarcinoma cells. And this effect is independent of endogenous p53 status. (authors)

The expanding universe of p53 targets.

Science.gov (United States)

Menendez, Daniel; Inga, Alberto; Resnick, Michael A

2009-10-01

The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

Energy Technology Data Exchange (ETDEWEB)

Cappadone, C., E-mail: concettina.cappadone@unibo.it [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Stefanelli, C. [Department for Life Quality Studies, University of Bologna, Rimini Campus, Rimini (Italy); Malucelli, E. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Zini, M. [Department of Biomedical and Neuromotor Sciences, University of Bologna, Bologna (Italy); Onofrillo, C. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Locatelli, A.; Rambaldi, M.; Sargenti, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Merolle, L. [ELETTRA–Sincrotrone Trieste S.C.p.A., Trieste (Italy); Farruggia, G. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy); Graziadio, A. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); Montanaro, L. [Department of Experimental, Diagnostic and Specialty Medicine, University of Bologna, Bologna (Italy); Iotti, S. [Department of Pharmacy and Biotechnology, University of Bologna, Bologna (Italy); National Institute of Biostructures and Biosystems, Roma (Italy)

2015-11-13

Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

p53-dependent and p53-independent anticancer activity of a new indole derivative in human osteosarcoma cells

International Nuclear Information System (INIS)

Cappadone, C.; Stefanelli, C.; Malucelli, E.; Zini, M.; Onofrillo, C.; Locatelli, A.; Rambaldi, M.; Sargenti, A.; Merolle, L.; Farruggia, G.; Graziadio, A.; Montanaro, L.; Iotti, S.

2015-01-01

Osteosarcoma (OS) is the most common primary malignant tumor of bone, occurring most frequently in children and adolescents. The mechanism of formation and development of OS have been studied for a long time. Tumor suppressor pathway governed by p53 gene are known to be involved in the pathogenesis of osteosarcoma. Moreover, loss of wild-type p53 activity is thought to be a major predictor of failure to respond to chemotherapy in various human cancers. In previous studies, we described the activity of a new indole derivative, NSC743420, belonging to the tubulin inhibitors family, capable to induce apoptosis and arrest of the cell cycle in the G2/M phase of various cancer cell lines. However, this molecule has never been tested on OS cell line. Here we address the activity of NSC743420 by examine whether differences in the p53 status could influence its effects on cell proliferation and death of OS cells. In particular, we compared the effect of the tested molecule on p53-wild type and p53-silenced U2OS cells, and on SaOS2 cell line, which is null for p53. Our results demonstrated that NSC743420 reduces OS cell proliferation by p53-dependent and p53-independent mechanisms. In particular, the molecule induces proliferative arrest that culminate to apoptosis in SaOS2 p53-null cells, while it brings a cytostatic and differentiating effect in U2OS cells, characterized by the cell cycle arrest in G0/G1 phase and increased alkaline phosphatase activity. - Highlights: • The indole derivative NSC743420 induces antitumor effects on osteosarcoma cells. • p53 status could drive the activity of antitumor agents on osteosarcoma cells. • NSC743420 induces cytostatic and differentiating effects on U2OS cells. • NSC743420 causes apoptosis on p53-null SaOS2 cells.

Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

Science.gov (United States)

Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

2010-10-10

Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

Cancerous hyper-mutagenesis in p53 genes is possibly associated with transcriptional bypass of DNA lesions

International Nuclear Information System (INIS)

Rodin, S.N.; Rodin, A.S.; Juhasz, A.; Holmquist, G.P.

2002-01-01

The database of tumor-associated p53 base substitutions includes about 5% of tumors with two or more base substitutions. These multiplet base substitutions in one tumor are evidence for hyper-mutagenesis. Our retrospective analysis of this database indicates that most multiplets arise from a single transient hyper-mutagenic event in one cell that subsequently proliferated into a clonal tumor. The hyper-mutagenesis, 1.8x10 -4 substitutions per base pair, is detected as multiple mutations in p53 genes of tumors. It requires one strongly tumorigenic p53 substitution, usually missense, called the driver mutation. The occurrence frequencies of ancillary base substitutions, those that hitch-hike along with the driver mutation, are independent of their amino acid coding properties. In this respect, they act like neutral mutations. In support of this neutrality, we find that the frequency distribution of hitch-hiking CpG transitions along the p53 exons, their mutational spectrum, approximates the spontaneous pre-selection mutational spectrum of most human tissues and is correlated with the mutational spectrum of p53 pseudogenes in mammalian germ cells. The driver substitutions of multiplets predominantly originate along the transcribed strand while the ancillary substitutions tend to originate along the non-transcribed strand. This data is consistent with a model of time-dependent mutagenesis in non-dividing stem cells for generating multiple strand-asymmetric p53 mutations in tumors. By transcriptional bypass of DNA lesions with concomitant misincorporation, transcriptional mutagenesis generates a transient mutant p53 mRNA. The associated mutant p53 protein could allow the host cell a growth advantage, release from G 1 -arrest. Then, during subsequent DNA replication and misreading of the same lesion, the damaged base along the transcribed DNA strand would serve as the origin of the p53 base substitution that drives the hyper-mutagenic event leading to tumors with

Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

Science.gov (United States)

Yang, Sujeong; Thackray, Alana M.; Hopkins, Lee; Monie, Tom P.; Burke, David F.; Bujdoso, Raymond

2014-01-01

Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie. PMID:25126555

p53-Dependent and -Independent Epithelial Integrity: Beyond miRNAs and Metabolic Fluctuations

Directory of Open Access Journals (Sweden)

Tsukasa Oikawa

2018-05-01

Full Text Available In addition to its classical roles as a tumor suppressor, p53 has also been shown to act as a guardian of epithelial integrity by inducing the microRNAs that target transcriptional factors driving epithelial–mesenchymal transition. On the other hand, the ENCODE project demonstrated an enrichment of putative motifs for the binding of p53 in epithelial-specific enhancers, such as CDH1 (encoding E-cadherin enhancers although its biological significance remained unknown. Recently, we identified two novel modes of epithelial integrity (i.e., maintenance of CDH1 expression: one involves the binding of p53 to a CDH1 enhancer region and the other does not. In the former, the binding of p53 is necessary to maintain permissive histone modifications around the CDH1 transcription start site, whereas in the latter, p53 does not bind to this region nor affect histone modifications. Furthermore, these mechanisms likely coexisted within the same tissue. Thus, the mechanisms involved in epithelial integrity appear to be much more complex than previously thought. In this review, we describe our findings, which may instigate further experimental scrutiny towards understanding the whole picture of epithelial integrity as well as the related complex asymmetrical functions of p53. Such understanding will be important not only for cancer biology but also for the safety of regenerative medicine.

Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

NARCIS (Netherlands)

Michaelis, M.; Rothweiler, F.; Agha, B.; Barth, S.; Voges, Y.; Loeschmann, N.; von Deimling, A.; Breitling, R.; Doerr, H. Wilhelm; Roedel, F.; Speidel, D.; Cinatl, J.; Cinatl Jr., J.; Stephanou, A.

Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3,

Apoptosis in spermatogonia irradiated P53 null mice

International Nuclear Information System (INIS)

Streit-Bianchi, M.; Hendry, J.H.; Roberts, S.A.; Morris, J.D.; Durgaryan, A.A.

2007-01-01

Complete text of publication follows. The exposure of germ cells to ionizing radiations is of concern both from high-dose therapeutic exposures and from low doses causing deleterious trans-generational mutations. P53 protein plays an important role in cellular damage and is expressed in the testis normally during meiosis, its expression being localised to the preleptotene and early/mid pachytene spermatocytes. P53 null mice, heterozygotes possessing a 129 Sv/C57BL6 genetic background and B6D2F1 mice have been irradiated to 1 and 2 Gy single doses. Fractionated exposures of 1+1 Gy at 4 hours interval were also carried out. Apoptosis induction, spermatogonia and spermatocytes survival were assessed by microscope analysis of histological samples at 4 to 96 hours after irradiation in time-course experiments. The same end-points were also assessed at 72 and 96 hours after irradiation to single doses in the region between 20cGy to 2Gy. A dose dependent level of p53 expression was observed at 4 hours after irradiation to 1 and 2 Gy which returned to normal level by 24 hours. Our data support a two process mode of apoptosis with a first wave around 12 hours followed by a second wave at 2-3 days. The first wave apoptosis is substantially reduced in p53 null mice whereas the second wave is reduced in B6D2F1 mice. The initial increase in apoptosis was delayed in some stages of the of germ cells development which were identified by the spermatids shape. Clear correlation exists between apoptosis and survival assessed in stage XI-XII Tubules 72 hours after irradiation. The data are in agreement with other data in literature indicating that irradiated spermatogonia die through apoptosis. The lack of apoptosis observed in p53 null mice results in a very high survival rate of daughter cells assessed later. Theses spermatocytes and the following progenitor cells are likely to carry mutations as most will not die in the smaller second wave of apoptosis observed 3 days after

Expression of Egr1 and p53 in human carotid plaques and apoptosis induced by 7-oxysterol or p53.

Science.gov (United States)

Miah, Sayem; Zadeh, Shahram Nour Mohammad; Yuan, Xi-Ming; Li, Wei

2013-07-01

Egr-1 and p53 are involved in pathology of both atherosclerosis and cancer. However, it is unknown whether p53 and Egr1 are interactively involved in apoptosis in atherosclerosis. We found that in human carotid plaques, the expression of p53 was inversely correlated with Egr1. In U937 cells, 7β-hydroxycholesterol and 7-ketocholesterol induced production of reactive oxygen species (ROS), transient up-regulation of Egr1 followed by late induction of p53 and apoptosis. Cells with nuclear fragmentation induced by 7-oxysterol or p53 showed increased levels of p53, but decreased levels of Egr1. In conclusion, ROS induced by 7-oxysterols may function as an early initiator of Egr1 expression. The late induced p53 by 7-oxysterols contributes to apoptotic cell death and is linked to the reduction of Egr1 levels, which resembles the differential expression of p53 and Egr1 in human atheroma progression. Copyright © 2012 Elsevier GmbH. All rights reserved.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth

International Nuclear Information System (INIS)

Golubovskaya, Vita M; Ho, Baotran; Zheng, Min; Magis, Andrew; Ostrov, David; Morrison, Carl; Cance, William G

2013-01-01

Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. By different assays in isogenic HCT116p53 + / + and HCT116 p53 - / - cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53 + / + but not in HCT116 p53 - / - xenografts in vivo. In addition, R2 sensitized HCT116p53 + / + cells to doxorubicin and 5-fluorouracil. Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches

TRIM65 negatively regulates p53 through ubiquitination

Energy Technology Data Exchange (ETDEWEB)

Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: zhenxiangyu2015@gmail.com [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)

2016-04-22

Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

Divergent evolution of human p53 binding sites: cell cycle versus apoptosis.

Directory of Open Access Journals (Sweden)

Monica M Horvath

2007-07-01

difference suggests that among mammalian species, evolutionary conservation differs among p53 REs, with some having ancient ancestry and others of more recent origin. Overall our results reveal divergent evolutionary pressure among the binding targets of p53 and emphasize that comparative genomics methods must be used judiciously and tailored to the evolutionary history of the targeted functional regulatory regions.

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

Science.gov (United States)

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-11-02

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

Science.gov (United States)

Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

2002-08-22

A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

Chemical Variations on the p53 Reactivation Theme

Directory of Open Access Journals (Sweden)

Carlos J. A. Ribeiro

2016-05-01

Full Text Available Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX. Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented.

A surrogate p53 reporter in Drosophila reveals the interaction of eIF4E and p53

International Nuclear Information System (INIS)

Corujo, G.; Campagno, R.; Rivera Pomar, R.; Ferrero, P.; Lu, W.J.

2011-01-01

eIF4E promotes translation upon binding the mRNA 5'cap and it is required for cell proliferation. p53 is a proapoptotic protein which is activated in response to DNA damage. There is evidence that suggests that eIF4E and p53 are connected in a mechanism that regulates their function. We propose a model for that such a mechanism to explain the equilibrium between apoptosis and cell proliferation. Our data shows a correlation between the overexpression of eIF4E and the suppression of apoptosis triggered by the overexpression of p53 in Drosophila imaginal discs. We also studied a reporter transgene which expresses GFP in response to p53 activation by gamma radiation. We could confirm that this p53 surrogate works in imaginal discs as well as in embryos. This provided us a tool to quantify the effect on the GFP signal by overexpression of eIF4E to confirm how these two proteins could interact in vivo. Our results suggest that p53 and eIF4E are indeed in an equilibrium that decides if a cell shall proliferate or die. (authors)

Effect of sequence and stereochemistry reversal on p53 peptide mimicry.

Directory of Open Access Journals (Sweden)

Alessio Atzori

Full Text Available Peptidomimetics effective in modulating protein-protein interactions and resistant to proteolysis have potential in therapeutic applications. An appealing yet underperforming peptidomimetic strategy is to employ D-amino acids and reversed sequences to mimic a lead peptide conformation, either separately or as the combined retro-inverso peptide. In this work, we examine the conformations of inverse, reverse and retro-inverso peptides of p53(15-29 using implicit solvent molecular dynamics simulation and circular dichroism spectroscopy. In order to obtain converged ensembles for the peptides, we find enhanced sampling is required via the replica exchange molecular dynamics method. From these replica exchange simulations, the D-peptide analogues of p53(15-29 result in a predominantly left-handed helical conformation. When the parent sequence is reversed sequence as either the L-peptide and D-peptide, these peptides display a greater helical propensity, feature reflected by NMR and CD studies in TFE/water solvent. The simulations also indicate that, while approximately similar orientations of the side-chains are possible by the peptide analogues, their ability to mimic the parent peptide is severely compromised by backbone orientation (for D-amino acids and side-chain orientation (for reversed sequences. A retro-inverso peptide is disadvantaged as a mimic in both aspects, and further chemical modification is required to enable this concept to be used fruitfully in peptidomimetic design. The replica exchange molecular simulation approach adopted here, with its ability to provide detailed conformational insights into modified peptides, has potential as a tool to guide structure-based design of new improved peptidomimetics.

Involvement of hGLD-2 in cytoplasmic polyadenylation of human p53 mRNA

DEFF Research Database (Denmark)

Glahder, Jacob-Andreas Harald; Norrild, Bodil

2011-01-01

Cytoplasmic polyadenylation is a post-transcriptional mechanism regulating mRNA stability and translation. The human p53 3'-untranslated region (3'-UTR) contains two regions similar to cytoplasmic polyadenylation elements (CPEs) just upstream of the poly(A) hexanucleotide. Evaluation of the p53 CPE......-like elements was performed by luciferase reporter assays, qPCR, and poly(A) assays. Herein, we report the down regulation of a luciferase reporter fused to the p53 3'-UTR, when human CPE-binding protein 1 (hCPEB1) is overexpressed. This inhibition is partially rescued when hCPEB1fused to hGLD-2 [a human...... cytoplasmic poly(A) polymerase] is overexpressed instead. The stability of a luciferase mRNA containing the p53 3'-UTR downstream, is decreased when hCPEB1 is overexpressed as seen by qPCR. Expression of hGLD-2 restores the mRNA stability. This is due to elongation of the poly(A) tail as seen by a PCR...

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

International Nuclear Information System (INIS)

Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

2009-01-01

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

Energy Technology Data Exchange (ETDEWEB)

Yu, Zhendong, E-mail: zdyu@hotmail.com [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Wang, Hao [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China); Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li [Department of Clinical laboratory, Peking University Shenzhen Hospital, Guangdong (China); Li, Pengfei, E-mail: lipengfei@cuhk.edu.hk [Department of pathology, The Chinese University of Hong Kong, Hong Kong (China)

2009-09-04

CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

P53 overexpression in head and neck carcinoma and radiotherapy results

International Nuclear Information System (INIS)

Awwad, Saif; Jaros, Evelyn; Somes, James; Lunec, John

1996-01-01

Purpose: P53 gene mutations are the common genetic changes encountered in human cancers, and there is extensive evidence that the P53 status may determine tumor response to therapy. This study was carried out to investigate whether there is any correlation between accumulation (overexpression) of P53 protein and poor prognosis in patients with head and neck carcinomas treated with radical radiotherapy. Methods and Materials: Seventy-nine patients with head and neck carcinomas who were diagnosed and treated in 1989-90 with curative radiotherapy were studied retrospectively. Paraffin sections from archival material were studied using immunohistochemical staining (IHC) with mouse monoclonal antibodies (D0-7) to human P53 protein. Univariate and multivariate analysis of loco-regional tumor control and patient survival were performed on possible prognostic factors. Results: Forty-two (53%) patients showed positive IHC staining in their tumors. Fifty-three percent of the laryngeal, 64% of the oropharyngeal, and 43% of the oral cavity carcinomas showed P53 overexpression. All tumor specimens with vascular, lymphatic, and/or sarcolemmal invasion showed P53 overexpression. The proportion of tumor-stained nuclei was higher in the poorly differentiated than in the well and moderately differentiated tumors (p < 0.05), but there was no correlation with the patient overall or disease-free 5-year actuarial survival. There was no difference in the 5-year actuarial survival and disease-free survival between patients with P53 immunostaining in their tumors and those with no immunostaining (59% vs. 65% and 57% vs. 51%, respectively). The TNM tumor stage was the most significant prognostic factor with 5-year actuarial survival of 87% for early and 14% for late stages (p << 0.0001). There was a significant correlation between immunostaining and history of smoking (p = 0.02). Conclusion: The data demonstrate that the P53 accumulation as detected by immunohistochemical staining in a

p53 specific (auto)immunity in mice

NARCIS (Netherlands)

Lauwen, Marjolein Monique

2008-01-01

Self-tolerance to p53 is a major potential limitation for the activation of the endogenous T-cell repertoire. So far, p53 specific CD8+ and CD4+ T-cell immunity has been described in cancer patients and healthy individuals. However, the restrictions of tolerance on the recruitment of p53 specific T

Exploring a minimal two-component p53 model

International Nuclear Information System (INIS)

Sun, Tingzhe; Zhu, Feng; Shen, Pingping; Yuan, Ruoshi; Xu, Wei

2010-01-01

The tumor suppressor p53 coordinates many attributes of cellular processes via interlocked feedback loops. To understand the biological implications of feedback loops in a p53 system, a two-component model which encompasses essential feedback loops was constructed and further explored. Diverse bifurcation properties, such as bistability and oscillation, emerge by manipulating the feedback strength. The p53-mediated MDM2 induction dictates the bifurcation patterns. We first identified irradiation dichotomy in p53 models and further proposed that bistability and oscillation can behave in a coordinated manner. Further sensitivity analysis revealed that p53 basal production and MDM2-mediated p53 degradation, which are central to cellular control, are most sensitive processes. Also, we identified that the much more significant variations in amplitude of p53 pulses observed in experiments can be derived from overall amplitude parameter sensitivity. The combined approach with bifurcation analysis, stochastic simulation and sampling-based sensitivity analysis not only gives crucial insights into the dynamics of the p53 system, but also creates a fertile ground for understanding the regulatory patterns of other biological networks

The Transcriptional Landscape of p53 Signalling Pathway

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2017-06-01

Full Text Available Although recent cancer genomics studies have identified a large number of genes that were mutated in human cancers, p53 remains as the most frequently mutated gene. To further elucidate the p53-signalling network, we performed transcriptome analysis on 24 tissues in p53+/+ or p53−/− mice after whole-body X-ray irradiation. Here we found transactivation of a total of 3551 genes in one or more of the 24 tissues only in p53+/+ mice, while 2576 genes were downregulated. p53 mRNA expression level in each tissue was significantly associated with the number of genes upregulated by irradiation. Annotation using TCGA (The Cancer Genome Atlas database revealed that p53 negatively regulated mRNA expression of several cancer therapeutic targets or pathways such as BTK, SYK, and CTLA4 in breast cancer tissues. In addition, stomach exhibited the induction of Krt6, Krt16, and Krt17 as well as loricrin, an epidermal differentiation marker, after the X-ray irradiation only in p53+/+ mice, implying a mechanism to protect damaged tissues by rapid induction of differentiation. Our comprehensive transcriptome analysis elucidated tissue specific roles of p53 and its signalling networks in DNA-damage response that will enhance our understanding of cancer biology.

Expression of p53 in oligodendrogliomas

NARCIS (Netherlands)

J.M. Kros (Johan); J.J.C.J. Godschalk (J. J C J); K.K. Krishnadath (Kausilia); C.G. van Eden (C.)

1993-01-01

textabstractThe expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and

Expression of p53 in oligodendrogliomas

NARCIS (Netherlands)

Kros, J. M.; Godschalk, J. J.; Krishnadath, K. K.; van Eden, C. G.

1993-01-01

The expression of the nuclear protein p53 in oligodendrogliomas was investigated by immunohistochemistry, using a monoclonal anti-p53 antibody (DO-7) on formalin-fixed, paraffin-embedded material in 84 histologically verified cases, and compared with the histopathological grade and survival.

Mirrors in the PDB: left-handed alpha-turns guide design with D-amino acids.

Science.gov (United States)

Annavarapu, Srinivas; Nanda, Vikas

2009-09-22

Incorporating variable amino acid stereochemistry in molecular design has the potential to improve existing protein stability and create new topologies inaccessible to homochiral molecules. The Protein Data Bank has been a reliable, rich source of information on molecular interactions and their role in protein stability and structure. D-amino acids rarely occur naturally, making it difficult to infer general rules for how they would be tolerated in proteins through an analysis of existing protein structures. However, protein elements containing short left-handed turns and helices turn out to contain useful information. Molecular mechanisms used in proteins to stabilize left-handed elements by L-amino acids are structurally enantiomeric to potential synthetic strategies for stabilizing right-handed elements with D-amino acids. Propensities for amino acids to occur in contiguous alpha(L) helices correlate with published thermodynamic scales for incorporation of D-amino acids into alpha(R) helices. Two backbone rules for terminating a left-handed helix are found: an alpha(R) conformation is disfavored at the amino terminus, and a beta(R) conformation is disfavored at the carboxy terminus. Helix capping sidechain-backbone interactions are found which are unique to alpha(L) helices including an elevated propensity for L-Asn, and L-Thr at the amino terminus and L-Gln, L-Thr and L-Ser at the carboxy terminus. By examining left-handed alpha-turns containing L-amino acids, new interaction motifs for incorporating D-amino acids into right-handed alpha-helices are identified. These will provide a basis for de novo design of novel heterochiral protein folds.

Significant difference in p53 and p21 protein immunoreactivity in HPV 16 positive and HPV negative breast carcinomas

International Nuclear Information System (INIS)

Hennig, E.M.; Norwegian Radium Hospital, Oslo; Kvinnsland, S.; Holm, R.; Nesland, J.M.

1999-01-01

Human papillomavirus (HPV) 16 has previously been found in 19/41 breast carcinomas (46%) in women with a history of HPV 16 positive CIN III lesions. There was no significant difference in distribution of histological subtypes, mean or median tumour diameter or number of regional lymph node metastases in the HPV positive and HPV negative breast carcinoma groups. P53, p21 and c-erbB-2 proteins were analyzed by immunohistochemistry in the HPV 16 positive and HPV negative breast carcinomas. There was a significant difference in p53 and p21 protein immunoreactivity between HPV 16 positive and HPV negative breast carcinomas (p=0.0091 and p=0.0040), with a significant less detectable p53 and p21 protein immunoreactivity in the HPV 16 positive cases. There was also a significant difference in the coexpression of p53/p21 between the HPV 16 positive and HPV 16 negative breast carcinomas (p=0.002). No significant difference in immunostaining for c-erbB-2 protein in the two groups was found (p=0.15), or for the coexpression of p53/c-erbB-2 (p=0.19). The significantly lower expression of p53 and p21 proteins in HPV 16 positive than in HPV 16 negative breast carcinomas supports the hypothesis of inactivation and degradation of wild-type p53 proteins by HPV 16 E6 and that p53 mutation is not necessary for transformation in the HPV 16 positive cases. (orig.)

GRIM-19 disrupts E6/E6AP complex to rescue p53 and induce apoptosis in cervical cancers.

Directory of Open Access Journals (Sweden)

Ying Zhou

Full Text Available BACKGROUND: Our previous studies showed a down-regulation of GRIM-19 in primary human cervical cancers, and restoration of GRIM-19 induced tumor regression. The induction of tumor suppressor protein p53 ubiquitination and degradation by E6 oncoportein of high risk-HPV through forming a stable complex with E6AP is considered as a critical mechanism for cervical tumor development. The aims of this study were to determine the potential role of GRIM-19 in rescuing p53 protein and inducing cervical cancer cell apoptosis. METHODOLOGY/PRINCIPAL FINDINGS: The protein levels of GRIM-19 and p53 were detected in normal cervical tissues from 45 patients who underwent hysterectomy for reasons other than neoplasias of either the cervix or endometrium, and cervical cancer tissues from 60 patients with non-metastatic squamous epithelial carcinomas. Coimmunoprecipitation and GST pull-down assay were performed to examine the interaction of GRIM-19 with 18E6 and E6AP in vivo and in vitro respectively. The competition of 18E6 with E6AP in binding GRIM-19 by performing competition pull-down assays was designed to examine the disruption of E6/E6AP complex by GRIM-19. The augment of E6AP ubiquitination by GRIM-19 was detected in vivo and in vitro ubiquitination assay. The effects of GRIM-19-dependent p53 accumulation on cell proliferation, cell cycle, apoptosis were explored by MTT, flow cytometry and transmission electron microscopy respectively. The tumor suppression was detected by xenograft mouse model. CONCLUSION/SIGNIFICANCE: The levels of GRIM-19 and p53 were concurrently down regulated in cervical cancers. The restoration of GRIM-19 can induce ubiquitination and degradation of E6AP, and disrupt the E6/E6AP complex through the interaction of N-terminus of GRIM-19 with both E6 and E6AP, which protected p53 from degradation and promoted cell apoptosis. Tumor xenograft studies also revealed the suppression of p53 degradation in presence of GRIM-19. These data

p53 in differentiation of thyroid cancer

International Nuclear Information System (INIS)

Seyama, Toshio; Ito, Takashi; Akiyama, Mitoshi; Hayashi, Yuzo; Dohi, Kiyohiko.

1993-01-01

P53 is a tumor suppressor gene with such a recessive nature and is inactivated in many carcinomas. DNA was extracted from 10 primary papillary adenocarcinomas and eight undifferentiated carcinomas of the thyroid, using three 5 μm sliced paraffin segments, and then amplified by PCR. The products were analyzed for mutations in the p53 gene exons 5 to 8 by the direct sequencing method and for allelic deletion by the RFLP method. In five human thyroid carcinomas, DNA was extracted from each tissue and analyzed. Mutations in the p53 gene exons 5 to 8 and p53 gene deletions were not detected in the 10 papillary adenocarcinomas, mutations were detected in seven of eight cases and allelic deletions was detected in three of the five cases examined. In each of the five cases which had both differentiated and undifferentiated tissues in the same tumor, p53 gene mutations were not detected in the differentiated tissues while mutations and gene deletions were detected in the undifferentiated sections. The p53 gene was analyzed using paraffin-embedded tissues by the combined use of the direct sequencing and PCR methods and by the RFLP method. It was found that the progression of human thyroid carcinoma is closely related to the p53 genetic changes. Furthermore, the analysis of differentiated and undifferentiated tissues in the same tumor showed that human undifferentiated thyroid carcinomas develop from differentiated carcinomas. (J.P.N.)

Biologic effect of exogenous wild p53 combined with irradiation on human melanoma cell lines with different p53 status

International Nuclear Information System (INIS)

Min Fengling; Zhang Hong; Li Wenjian; Liu Bing; Zhou Qingming; Duan Xin; Gao Qingxiang

2007-01-01

Objective: To investigate the effect of low dose irradiation on gene transfer efficiency and the effect of adenoviral-mediated exogenous P53 overexpression on apoptosis and radiosensitivity of radioresistant human melanoma cell lines A375(wild type p53)and WM983a(mutant type p53). Methods: Control vector, a replication deficient recombinant adenoviral vector containing a CMV promoter and green fluorescent protein (AdCMV-GFP), was used to transfect A375 cells and WM983a cells preirradiated with or without 1 Gy X-ray. The transduction efficiency of GFP gene was determined with fluorescence microscope directly. These two types of cells irradiated by 1 Gy X-ray were transfected with a replication deficient recombinant adenoviral vector carrying human wild p53 (AdCMV-p53), and mRNA level was detected by RT-PCR. The cell cycle delay and the expression of exogenous P53 were detected using flow cytometry (FCM) at different times after transfection. Tunel technique was used to detect cell apoptosis. The radiosensivity of A375 and WM983a cells after p53 transduction was analyzed by colony formation. Results: It is found that 1 Gy irradiation increased the gene transfection efficiency of A375 and WM983a cells. The expression of exogenous P53 was found to range from 60% to 80% among transfected cells during the first three days after transduction and then declined continuously down to the control level on day 10. G 1 cell cycle arrest was also observed after p53 gene transduction. WM983a cells transfected with p53 showed higher sensitivity to X-ray-induced cell killing than A375 cells. Conclusions: It is indicated that low dose of ionizing radiation can improve gene transfection efficiency of A375 and WM983a cells mediated by adenovirus vector. Althrough the overexpresion of exogenous p53 may not inhibit cell growth and induce apoptosis of melanoma cell line A375 and WM983a irt vitro, the two cell lines are much more sensitive to cell death induced by irradiation. It is

p53 and the pathogenesis of skin cancer

International Nuclear Information System (INIS)

Benjamin, Cara L.; Ananthaswamy, Honnavara N.

2007-01-01

The p53 tumor suppressor gene and gene product are among the most diverse and complex molecules involved in cellular functions. Genetic alterations within the p53 gene have been shown to have a direct correlation with cancer development and have been shown to occur in nearly 50% of all cancers. p53 mutations are particularly common in skin cancers and UV irradiation has been shown to be a primary cause of specific 'signature' mutations that can result in oncogenic transformation. There are certain 'hot-spots' in the p53 gene where mutations are commonly found that result in a mutated dipyrimidine site. This review discusses the role of p53 from normal function and its dysfunction in pre-cancerous lesions and non-melanoma skin cancers. Additionally, special situations are explored, such as Li-Fraumeni syndrome in which there is an inherited p53 mutation, and the consequences of immune suppression on p53 mutations and the resulting increase in non-melanoma skin cancer in these patients

Acetylation of the pro-apoptotic factor, p53 in the hippocampus following cerebral ischemia and modulation by estrogen.

Directory of Open Access Journals (Sweden)

Limor Raz

Full Text Available Recent studies demonstrate that acetylation of the transcription factor, p53 on lysine(373 leads to its enhanced stabilization/activity and increased susceptibility of cells to stress. However, it is not known whether acetylation of p53 is altered in the hippocampus following global cerebral ischemia (GCI or is regulated by the hormone, 17β-estradiol (17β-E(2, and thus, this study examined these issues.The study revealed that Acetyl p53-Lysine(373 levels were markedly increased in the hippocampal CA1 region after GCI at 3 h, 6 h and 24 h after reperfusion, an effect strongly attenuated by 17β-E(2. 17β-E(2 also enhanced interaction of p53 with the ubiquitin ligase, Mdm2, increased ubiquitination of p53, and induced its down-regulation, as well as attenuated elevation of the p53 transcriptional target, Puma. We also observed enhanced acetylation of p53 at a different lysine (Lys(382 at 3 h after reperfusion, and 17β-E(2 also markedly attenuated this effect. Furthermore, administration of an inhibitor of CBP/p300 acetyltransferase, which acetylates p53, was strongly neuroprotective of the CA1 region following GCI. In long-term estrogen deprived (LTED animals, the ability of 17β-E(2 to attenuate p53 acetylation was lost, and intriguingly, Acetyl p53-Lysine(373 levels were markedly elevated in sham (non-ischemic LTED animals. Finally, intracerebroventricular injections of Gp91ds-Tat, a specific NADPH oxidase (NOX2 inhibitor, but not the scrambled tat peptide control (Sc-Tat, attenuated acetylation of p53 and reduced levels of Puma following GCI.The studies demonstrate that p53 undergoes enhanced acetylation in the hippocampal CA1 region following global cerebral ischemia, and that the neuroprotective agent, 17β-E(2, markedly attenuates the ischemia-induced p53 acetylation. Furthermore, following LTED, the suppressive effect of 17β-E(2 on p53 acetylation is lost, and p53 acetylation increases in the hippocampus, which may explain previous

The role of the Cx43 C-terminus in GJ plaque formation and internalization

International Nuclear Information System (INIS)

Wayakanon, Praween; Bhattacharjee, Rajib; Nakahama, Ken-ichi; Morita, Ikuo

2012-01-01

Highlights: ► Cx43-GFP or -DsRed fusion proteins were expressed in HeLa cells. ► Roles of C-terminus were examined using various mutants. ► Gap junction plaque size was dependent on the length of C-terminus. ► C-terminus dependent gap junction plaque internalization was observed. -- Abstract: Connexin 43 (Cx43) is a major gap junction (GJ) protein found in many mammalian cell types. The C-terminal (CT) domain of Cx43 has unique characteristics in terms of amino acid (aa) sequence and its length differs from other connexins. This CT domain can be associated with protein partners to regulate GJ assembly and degradation, which results in the direct control of gap junction intercellular communication (GJIC). However, the essential roles of the CT regions involved in these mechanisms have not been fully elucidated. In this study, we aimed to investigate the specific regions of Cx43CT involved in GJ formation and internalization. Wild type Cx43 (382aa) and 10 CT truncated mutants were stably expressed in HeLa cells as GFP or DsRed tagged proteins. First, we found that the deletion of 235–382aa from Cx43 resulted in failure to make GJ and establish GJIC. Second, the Cx43 with 242–382aa CT deletion could form functional GJs and be internalized as annular gap junctions (AGJs). However, the plaques consisting of Cx43 with CT deletions (Δ242–382aa to Δ271–382aa) were longer than the plaques consisting of Cx43 with CT deletions (Δ302–382aa). Third, co-culture experiments of cells expressing wild type Cx43 (382) with cells expressing Cx43CT mutants revealed that the directions of GJ internalization were dependent on the length of the respective CT. Moreover, a specific region, 325–342aa residues of Cx43, played an important role in the direction of GJ internalization. These results showed the important roles of the Cx43 C-terminus in GJ expression and its turnover.

p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

Science.gov (United States)

Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

2009-04-01

Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

Functional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation

International Nuclear Information System (INIS)

Hanafusa, Tadashi; Shinji, Toshiyuki; Shiraha, Hidenori; Nouso, Kazuhiro; Iwasaki, Yoshiaki; Yumoto, Eichiro; Ono, Toshiro; Koide, Norio

2005-01-01

Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered. In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity. Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated. From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells

Cytotoxic effects of replication-competent adenoviruses on human esophageal carcinoma are enhanced by forced p53 expression

International Nuclear Information System (INIS)

Yang, Shan; Kawamura, Kiyoko; Okamoto, Shinya; Yamauchi, Suguru; Shingyoji, Masato; Sekine, Ikuo; Kobayashi, Hiroshi; Tada, Yuji; Tatsumi, Koichiro; Hiroshima, Kenzo; Shimada, Hideaki; Tagawa, Masatoshi

2015-01-01

Improvement of transduction and augmentation of cytotoxicity are crucial for adenoviruses (Ad)-mediated gene therapy for cancer. Down-regulated expression of type 5 Ad (Ad5) receptors on human tumors hampered Ad-mediated transduction. Furthermore, a role of the p53 pathways in cytotoxicity mediated by replication-competent Ad remained uncharacterized. We constructed replication-competent Ad5 of which the E1 region genes were activated by a transcriptional regulatory region of the midkine or the survivin gene, which is expressed preferentially in human tumors. We also prepared replication-competent Ad5 which were regulated by the same region but had a fiber-knob region derived from serotype 35 (AdF35). We examined the cytotoxicity of these Ad and a possible combinatory use of the replication-competent AdF35 and Ad5 expressing the wild-type p53 gene (Ad5/p53) in esophageal carcinoma cells. Expression levels of molecules involved in cell death, anti-tumor effects in vivo and production of viral progenies were also investigated. Replication-competent AdF35 in general achieved greater cytotoxic effects to esophageal carcinoma cells than the corresponding replication-competent Ad5. Infection with the AdF35 induced cleavages of caspases and increased sub-G1 fractions, but did not activate the autophagy pathway. Transduction with Ad5/p53 in combination with the replication-competent AdF35 further enhanced the cytotoxicity in a synergistic manner. We also demonstrated the combinatory effects in an animal model. Transduction with Ad5/p53 however suppressed production of replication-competent AdF35 progenies, but the combination augmented Ad5/p53-mediated p53 expression levels and the downstream pathways. Combination of replication-competent AdF35 and Ad5/p53 achieved synergistic cytotoxicity due to enhanced p53-mediated apoptotic pathways. The online version of this article (doi:10.1186/s12885-015-1482-8) contains supplementary material, which is available to authorized

Conserved region at the COOH terminus of human immunodeficiency virus gp120 envelope protein contains an immunodominant epitope

International Nuclear Information System (INIS)

Palker, T.J.; Matthews, T.J.; Clark, M.E.

1987-01-01

A highly immunogenic epitope from a conserved COOH-terminal region of the human immunodeficiency virus (HIV) gp120 envelope protein has been identified with antisera from HIV-seropositive subjects and a synthetic peptide (SP-22) containing 15 amino acids from this region (Ala-Pro-Thr-Lys-Ala-Lys-Arg-Arg-Val-Val-Gln-Arg-Glu-Lys-Arg). Peptide SP-22 absorbed up to 100% of anti-gp120 antibody reactivity from select HIV + patient sera in immunoblot assays and up to 79% of serum anti-gp120 antibody reactivity in competition RIA. In RIA, 45% of HIV-seropositive subjects had antibodies that bound to peptide SP-22. Human anti-SP-22 antibodies that bound to and were eluted from an SP-22 affinity column reacted with gp120 in RIA and immunoblot assays but did not neutralize HIV or inhibit HIV-induced syncytium formation in vitro, even though these antibodies comprised 70% of all anti-gp120 antibodies in the test serum. In contrast, the remaining 30% of SP-22 nonreactive anti-gp120 antibodies did not react with gp120 in immunoblot assays but did react in RIA and neutralized HIV in vitro. Thus, ≅ 50% of HIV-seropositive patients make high titers of nonneutralizing antibodies to an immunodominant antigen on gp120 defined by SP-22. Moreover, the COOH terminus of gp120 contains the major antigen or antigens identified by human anti-gp120 antibodies in immunoblot assays

A família do p53: aspectos estruturais e funcionais do p73 e do p63 The p53 family: structural and functional aspects of p73 and p63

Directory of Open Access Journals (Sweden)

Alfredo Ribeiro-Silva

2003-06-01

Full Text Available O p53 é um gene regulador chave do ciclo celular que, quando sofre mutações, leva ao desenvolvimento de neoplasias, atuando, portanto, como um gene supressor tumoral em condições normais. Recentemente foram identificados genes homólogos ao p53 denominados p73 e p63, provavelmente oriundos de um gene ancestral comum. Apesar da grande homologia estrutural, os membros da família do p53 possuem diferenças funcionais entre si. O presente artigo tem por finalidade discorrer sobre os principais aspectos estruturais e funcionais do p73 e do p63, ressaltando seus papéis na tumorigênese humana. O p73 ativa vários genes responsivos ao p53 e, quando superexpresso, inibe a ação do p53. Raramente encontra-se mutado em neoplasias, e seu papel na tumorigênese humana ainda é motivo de controvérsias. O p63 não é um gene supressor tumoral clássico, sendo essencial para a manutenção de uma população de células precursoras (células-tronco em vários tecidos epiteliais. O p63 marca as células basais de vários órgãos epiteliais, como a pele e a próstata, podendo ser considerado um marcador de indiferenciação celular. O p63 é um marcador recentemente descrito e ainda requer maior investigação para determinar seu papel no desenvolvimento de neoplasias em humanos.The p53 gene has a key role in the cell cycle control. When mutated, it promotes the development of neoplasms, acting in so far as a tumor suppressor gene in normal conditions. Recently, genes homologue to p53 were identified, named p73 e p63, probably originated from a common ancestral gene. Despite the great structural homology, the members of p53 family have functional differences. This article aims to discourse about the major structural and functional aspects of p73 and p63, reinforcing their role in human tumorigenesis. P73 activates several p53 responsive genes and, when overexpressed, inhibits the p53 action. It is rarely mutated in neoplasms and its role in human

System-based strategies for p53 recovery.

Science.gov (United States)

Azam, Muhammad Rizwan; Fazal, Sahar; Ullah, Mukhtar; Bhatti, Aamer I

2018-06-01

The authors have proposed a systems theory-based novel drug design approach for the p53 pathway. The pathway is taken as a dynamic system represented by ordinary differential equations-based mathematical model. Using control engineering practices, the system analysis and subsequent controller design is performed for the re-activation of wild-type p53. p53 revival is discussed for both modes of operation, i.e. the sustained and oscillatory. To define the problem in control system paradigm, modification in the existing mathematical model is performed to incorporate the effect of Nutlin. Attractor point analysis is carried out to select the suitable domain of attraction. A two-loop negative feedback control strategy is devised to drag the system trajectories to the attractor point and to regulate cellular concentration of Nutlin, respectively. An integrated framework is constituted to incorporate the pharmacokinetic effects of Nutlin in the cancerous cells. Bifurcation analysis is also performed on the p53 model to see the conditions for p53 oscillation.

Microbial Regulation of p53 Tumor Suppressor.

Directory of Open Access Journals (Sweden)

Alexander I Zaika

2015-09-01

Full Text Available p53 tumor suppressor has been identified as a protein interacting with the large T antigen produced by simian vacuolating virus 40 (SV40. Subsequent research on p53 inhibition by SV40 and other tumor viruses has not only helped to gain a better understanding of viral biology, but also shaped our knowledge of human tumorigenesis. Recent studies have found, however, that inhibition of p53 is not strictly in the realm of viruses. Some bacterial pathogens also actively inhibit p53 protein and induce its degradation, resulting in alteration of cellular stress responses. This phenomenon was initially characterized in gastric epithelial cells infected with Helicobacter pylori, a bacterial pathogen that commonly infects the human stomach and is strongly linked to gastric cancer. Besides H. pylori, a number of other bacterial species were recently discovered to inhibit p53. These findings provide novel insights into host-bacteria interactions and tumorigenesis associated with bacterial infections.

Battle Against Cancer: An Everlasting Saga of p53

Directory of Open Access Journals (Sweden)

Qian Hao

2014-12-01

Full Text Available Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress—p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

Science.gov (United States)

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Regulation of p53 tetramerization and nuclear export by ARC.

Science.gov (United States)

Foo, Roger S-Y; Nam, Young-Jae; Ostreicher, Marc Jason; Metzl, Mark D; Whelan, Russell S; Peng, Chang-Fu; Ashton, Anthony W; Fu, Weimin; Mani, Kartik; Chin, Suet-Feung; Provenzano, Elena; Ellis, Ian; Figg, Nichola; Pinder, Sarah; Bennett, Martin R; Caldas, Carlos; Kitsis, Richard N

2007-12-26

Inactivation of the transcription factor p53 is central to carcinogenesis. Yet only approximately one-half of cancers have p53 loss-of-function mutations. Here, we demonstrate a mechanism for p53 inactivation by apoptosis repressor with caspase recruitment domain (ARC), a protein induced in multiple cancer cells. The direct binding in the nucleus of ARC to the p53 tetramerization domain inhibits p53 tetramerization. This exposes a nuclear export signal in p53, triggering Crm1-dependent relocation of p53 to the cytoplasm. Knockdown of endogenous ARC in breast cancer cells results in spontaneous tetramerization of endogenous p53, accumulation of p53 in the nucleus, and activation of endogenous p53 target genes. In primary human breast cancers with nuclear ARC, p53 is almost always WT. Conversely, nearly all breast cancers with mutant p53 lack nuclear ARC. We conclude that nuclear ARC is induced in cancer cells and negatively regulates p53.

Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

Science.gov (United States)

Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

2018-05-31

The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Tumor hypoxia, p53, and prognosis in cervical cancers

International Nuclear Information System (INIS)

Haensgen, Gabriele; Krause, Ulf; Becker, Axel; Stadler, Peter; Lautenschlaeger, Christine; Wohlrab, Wolfgang; Rath, Friedrich W.; Molls, Michael; Dunst, Juergen

2001-01-01

Background: The p53 protein is involved in the regulation of initiation of apoptosis. In vitro, p53-deficient cells do not respond to hypoxia with apoptosis as do p53-normal cells, and this may lead to a relative growth advantage of cells without a functioning p53 under hypoxia. On the basis of this hypothesis, a selection of cells with a functionally inactive p53 may occur in hypoxic tumors. The development of uterine cervical carcinomas is closely associated with infections of human papilloma viruses, which may cause a degradation of the tumor suppressor gene p53, resulting in a restriction of apoptosis. Thus, cervical cancers have often a functionally inactive p53. The purpose of our clinical study was therefore to investigate the association between p53, hypoxia, and prognosis in cervical cancers in which the oxygenation status can be determined by clinical methods. Material and Methods: Seventy patients with locally advanced squamous cell cervical cancer Stages IIB (n=14), IIIB (n=49), and IVA (n=7) were investigated in the period from 1996 through 1999. All were treated with definitive radiotherapy with curative intent by a combination of external radiotherapy plus high-dose-rate afterloading. Before therapy, tumor oxygenation was measured with a needle probe polarographically using the Eppendorf histograph. Hypoxic tumors were defined as those with pO 2 measurements below 5 mm Hg (HF5). Pretreatment biopsies were taken and analyzed immunohistologically for p53 protein expression with the DO-7 antibody. The DNA index was measured by flow cytometry. The statistical data analysis was done with SPSS 9.0 for Windows. Results: The 3-year overall survival was 55% for the whole group of patients. Clinical prognostic factors in a multivariate analysis were pretreatment hemoglobin level (3-year survival 62% for patients with a pretreatment hemoglobin ≥11 g/dl vs. 27% for hemoglobin <11 g/dl, p=0.006) and FIGO stage (Stage IIB: 65%; Stage IIIB: 60%; Stage IVA: 29%, p

The miR-1000-p53 pathway regulates apoptosis and virus infection in shrimp.

Science.gov (United States)

Gong, Yi; Ju, Chenyu; Zhang, Xiaobo

2015-10-01

The p53 protein plays an important role in apoptosis which is involved in the immunity of animals. However, effects of the miRNA-mediated regulation of p53 expression on apoptosis and virus infection are not extensively investigated. To address this issue, the miRNA-mediated p53-dependent apoptotic pathway was explored in this study. The results indicated that p53 could regulate the apoptotic activity of Marsupenaeus japonicas shrimp and influence the infection of white spot syndrome virus (WSSV). The further data presented that miR-1000 could target the 3'-untranslated region (3'UTR) of p53 gene. The results of in vivo experiments showed that the miR-1000 overexpression led to significant decreases of shrimp apoptotic activity and the capacity of WSSV infection, while the miR-1000 silencing resulted in significant increases of apoptotic activity and virus infection, indicating that miR-1000 took great effects on apoptosis and virus infection by targeting p53. Therefore, our study revealed a novel mechanism that the miR-1000-p53 pathway regulated apoptosis and virus infection in shrimp. Copyright © 2015 Elsevier Ltd. All rights reserved.

FATS is a transcriptional target of p53 and associated with antitumor activity

OpenAIRE

Zhang Xifeng; Zhang Qian; Zhang Jun; Qiu Li; Yan Shuang-shuang; Feng Juling; Sun Yan; Huang Xingxu; Lu Karen H; Li Zheng

2010-01-01

Abstract Frequent mutations of p53 in human cancers exemplify its crucial role as a tumor suppressor transcription factor, and p21, a transcriptional target of p53, plays a central role in surveillance of cell-cycle checkpoints. Our previous study has shown that FATS stabilize p21 to preserve genome integrity. In this study we identified a novel transcript variant of FATS (GenBank: GQ499374) through screening a cDNA library from mouse testis, which uncovered the promoter region of mouse FATS....

Analysis of p53- immunoreactivity in astrocytic brain tumors

Directory of Open Access Journals (Sweden)

Shinkarenko T.V.

2016-12-01

Full Text Available P53 is an antioncogene with the frequently occured mutations in human tumor cells, leading to corresponding protein overexpression which can be detected by immunohistochemistry. Researches dedicated to the investigation of possibilities of using this technique gave controversial results. The authors investigated features of p53 protein expression in astrocytic brain tumors with different degrees of malignancy. Analyzed the relationship of the expression level of p53 by tumor cells with clinical parameters and Ki-67 proliferation index (PI as well. Tissues were collected from 52 cases with diagnosed astrocytic brain tumors. The sections were immunohistochemically stained with p53 and Ki-67. For each marker, 1000 tumor cells were counted and the ratio of positive tumor cells was calculated using software package ImageJ 1,47v. In normal brain tissue p53- expression was not identified. p53-immunoreactive tumor cells were detected in 25% (1/4 pilocytic astrocytomas, 33.3% (2/6 of diffuse astrocytomas, 53.8% (7/13 anaplastic astrocytomas, 58.6% (17/29 glioblastomas. A high proportion of p53-immunoreactive cells (> 30% was observed only in glioblastomas. The level of p53-imunoreactivity was not related to the age, gender and Grade WHO (p> 0,05. Spearman correlation coefficient between the relative quantity of ki-67- and p53-immunoreactive nuclei showed weak direct correlation (0.023, but the one was not statistically significant (p> 0,05. The level of p53-imunoreactivity is not dependent from age and sex of patients, Grade (WHO and proliferative activity (p>0,05 but the high level of p53-immunoreactive cells (>30% is found in glioblastoma specimens only, that may be due to the accumulation of mutations in DNA of tumor cells. There is insignificant weak relationship between relative quantities of ki-67- and p53-immunoreactive tumor cells (p>0,05.

Mirrors in the PDB: left-handed α-turns guide design with D-amino acids

Directory of Open Access Journals (Sweden)

Nanda Vikas

2009-09-01

Full Text Available Abstract Background Incorporating variable amino acid stereochemistry in molecular design has the potential to improve existing protein stability and create new topologies inaccessible to homochiral molecules. The Protein Data Bank has been a reliable, rich source of information on molecular interactions and their role in protein stability and structure. D-amino acids rarely occur naturally, making it difficult to infer general rules for how they would be tolerated in proteins through an analysis of existing protein structures. However, protein elements containing short left-handed turns and helices turn out to contain useful information. Molecular mechanisms used in proteins to stabilize left-handed elements by L-amino acids are structurally enantiomeric to potential synthetic strategies for stabilizing right-handed elements with D-amino acids. Results Propensities for amino acids to occur in contiguous αL helices correlate with published thermodynamic scales for incorporation of D-amino acids into αR helices. Two backbone rules for terminating a left-handed helix are found: an αR conformation is disfavored at the amino terminus, and a βR conformation is disfavored at the carboxy terminus. Helix capping sidechain-backbone interactions are found which are unique to αL helices including an elevated propensity for L-Asn, and L-Thr at the amino terminus and L-Gln, L-Thr and L-Ser at the carboxy terminus. Conclusion By examining left-handed α-turns containing L-amino acids, new interaction motifs for incorporating D-amino acids into right-handed α-helices are identified. These will provide a basis for de novo design of novel heterochiral protein folds.

Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

International Nuclear Information System (INIS)

Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira

2007-01-01

p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53ΔC) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53ΔC was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain

The nucleolus directly regulates p53 export and degradation.

Science.gov (United States)

Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

2011-09-05

The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

Immunohistochemical analysis of P53 protein in odontogenic cysts

Science.gov (United States)

Gaballah, Essam Taher M.A.; Tawfik, Mohamed A.

2010-01-01

The p53 is a well-known tumor suppressor gene, the mutations of which are closely related to the decreased differentiation of cells. Findings of studies on immunohistochemical P53 expression in odontogenic cysts are controversial. The present study was carried-out to investigate the immunohistochemical expression of P53 protein in odontogenic cysts. Thirty paraffin blocks of diagnosed odontogenic cysts were processed to determine the immunohistochemical expression of P53 protein. Nine of the 11 odontogenic keratocysts (81.8%) expressed P53, one of three dentigerous cyst cases expressed P53, while none of the 16 radicular cysts expressed P53 protein. The findings of the present work supported the reclassification of OKC as keratocystic odontogenic tumor. PMID:23960493

Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?

International Nuclear Information System (INIS)

Blackburn, Anneke C; Jerry, D Joseph

2002-01-01

The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer

Confirmation of a blocked amino terminus of sulfhydryl oxidase

International Nuclear Information System (INIS)

Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.

1990-01-01

The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked

Impact of Alu repeats on the evolution of human p53 binding sites

Directory of Open Access Journals (Sweden)

Sirotin Michael V

2011-01-01

Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu

[Punish or cherish: p53, metabolism and tumor suppression].

Science.gov (United States)

Albagli, Olivier

2015-10-01

The p53 gene is essential for tumor suppression, but how it does so remains unclear. Upon genotoxic or oncogenic stresses, increased p53 activity induces transient cell cycle arrest, senescence or apoptosis, the three cornerstones of the so-called triumvirate. Accordingly, it has long been thought that p53 suppresses tumorigenesis by somehow counteracting cell proliferation or survival. However, several recently described genetically modified mice indicate that p53 can suppress tumorigenesis without triggering these three responses. Rather, as an important mechanism for tumor suppression, these mutant mice point to the ability of p53 to prevent the Warburg effect, that is to dampen glycolysis and foster mitochondrial respiration. Interestingly, these metabolic functions of p53 rely, in part, on its "unstressed" (basal) expression, a feature shared by its mechanistically linked anti-oxydant function. Together, these "conservative" activities of p53 may prevent tumor initiation by promoting and maintaining a normal oxidative metabolism and hence underly the "daily" tumor suppression by p53 in most cells. Conversely, destructive activities elicited by high p53 levels and leading to senescence or apoptosis provide a shield against partially or overtly transformed cells. This last situation, although relatively infrequent throughout life, is usual in experimental settings, which could explain the disproportionally high number of data implicating the triumvirate in tumor suppression by p53. © 2015 médecine/sciences – Inserm.

p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

Science.gov (United States)

Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

2017-11-01

Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

Mutations in p53, p53 protein overexpression and breast cancer survival

Czech Academy of Sciences Publication Activity Database

Rössner ml., Pavel; Gammon, M. D.; Zhang, Y.J.; Terry, M. B.; Hibshoosh, H.; Memeo, L.; Mansukhani, M.; Long, CH.M.; Gabrowski, G.; Agrawal, M.; Kalra, T.S.; Teitelbaum, S. L.; Neugut, A. I.; Santella, R. M.

2009-01-01

Roč. 13, č. 9B (2009), s. 3847-3857 ISSN 1582-1838 Institutional research plan: CEZ:AV0Z50390512 Keywords : Breast cancer * p53 mutations * Survival Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 5.228, year: 2009

The genetic alteration of p53 in esophageal cancer

Energy Technology Data Exchange (ETDEWEB)

Cho, Jae Il; Baik, Hee Jong; Kim, Chang Min; Kim, Mi Hee [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

1996-01-01

Genetic alterations in the p53 gene have been detected in various human malignancies, and its alterations inactive the function of p53 as a tumor suppressor. Point mutation and gene deletion are the main mechanisms of p53 inactivation. To determine the incidence of genetic alteration of p53 and their clinical implications in Korean patients of esophageal cancer, we investigated p53 alterations in 26 esophageal cancer tissues paired with its normal tissue by Southern blot analysis, PCR-SSCP, and direct sequencing. Allelic loss of chromosome 17p occurred in 12 out of 21 informative cases(57%) by Southern blot analysis, and 16 cases showed mobility shift in PCR-SSCP, so overall incidence of p53 gene alterations was 77%(20/26). The mutations detected was randomly dispersed over exon4-8 and was frequently G-T transversion and C:T transitions. Three identical mutations were clustered at codon 213 suggested the same etiologic agents in this cases. The p53 gene alterations play a significant role in the development of esophageal cancers, however, no relationship between p53 mutation and clinical data was detected so far. 9 refs. (Author).

The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region

Directory of Open Access Journals (Sweden)

Jordi Pujols

2018-05-01

Full Text Available Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1 protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.

The Disordered C-Terminus of Yeast Hsf1 Contains a Cryptic Low-Complexity Amyloidogenic Region.

Science.gov (United States)

Pujols, Jordi; Santos, Jaime; Pallarès, Irantzu; Ventura, Salvador

2018-05-06

Response mechanisms to external stress rely on networks of proteins able to activate specific signaling pathways to ensure the maintenance of cell proteostasis. Many of the proteins mediating this kind of response contain intrinsically disordered regions, which lack a defined structure, but still are able to interact with a wide range of clients that modulate the protein function. Some of these interactions are mediated by specific short sequences embedded in the longer disordered regions. Because the physicochemical properties that promote functional and abnormal interactions are similar, it has been shown that, in globular proteins, aggregation-prone and binding regions tend to overlap. It could be that the same principle applies for disordered protein regions. In this context, we show here that a predicted low-complexity interacting region in the disordered C-terminus of the stress response master regulator heat shock factor 1 (Hsf1) protein corresponds to a cryptic amyloid region able to self-assemble into fibrillary structures resembling those found in neurodegenerative disorders.

c-Jun binds the N terminus of human TAF(II)250 to derepress RNA polymerase II transcription in vitro.

Science.gov (United States)

Lively, T N; Ferguson, H A; Galasinski, S K; Seto, A G; Goodrich, J A

2001-07-06

c-Jun is an oncoprotein that activates transcription of many genes involved in cell growth and proliferation. We studied the mechanism of transcriptional activation by human c-Jun in a human RNA polymerase II transcription system composed of highly purified recombinant and native transcription factors. Transcriptional activation by c-Jun depends on the TATA-binding protein (TBP)-associated factor (TAF) subunits of transcription factor IID (TFIID). Protein-protein interaction assays revealed that c-Jun binds with high specificity to the largest subunit of human TFIID, TAF(II)250. The region of TAF(II)250 bound by c-Jun lies in the N-terminal 163 amino acids. This same region of TAF(II)250 binds to TBP and represses its interaction with TATA boxes, thereby decreasing DNA binding by TFIID. We hypothesized that c-Jun is capable of derepressing the effect of the TAF(II)250 N terminus on TFIID-driven transcription. In support of this hypothesis, we found that c-Jun increased levels of TFIID-driven transcription in vitro when added at high concentrations to a DNA template lacking activator protein 1 (AP-1) sites. Moreover, c-Jun blocked the repression of TBP DNA binding caused by the N terminus of TAF(II)250. In addition to revealing a mechanism by which c-Jun activates transcription, our studies provide the first evidence that an activator can bind directly to the N terminus of TAF(II)250 to derepress RNA polymerase II transcription in vitro.

The intercorrelation of the amino acid quality between raw, steeped ...

African Journals Online (AJOL)

The total amino acid contents were: steeped [57.71 g/100 g crude protein (c.p.)], germinated (53.37 g/100 g c.p.) and raw (37.91 g/100 g c.p.) with respective essential amino acids of 30.70 g/100 g c.p., 28.33 g/100 g c.p. and 21.48 g/100 g c.p. Percentage cystine/total sulfur amino acid (% Cys/TSAA) trend was 72.0 ...

Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf–Hirschhorn syndrome

Science.gov (United States)

South, Sarah T; Lortz, Amanda; Hensel, Charles H; Sdano, Mallory R; Vanzo, Rena J; Martin, Megan M; Peiffer, Andreas; Lambert, Christophe G; Calhoun, Amy; Carey, John C; Battaglia, Agatino

2016-01-01

Background Wolf–Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving variable size deletions of the 4p16.3 region. Seizures are frequently, but not always, associated with WHS. We hypothesised that the size and location of the deleted region may correlate with seizure presentation. Methods Using chromosomal microarray analysis, we finely mapped the breakpoints of copy number variants (CNVs) in 48 individuals with WHS. Seizure phenotype data were collected through parent-reported answers to a comprehensive questionnaire and supplemented with available medical records. Results We observed a significant correlation between the presence of an interstitial 4p deletion and lack of a seizure phenotype (Fisher's exact test p=3.59e-6). In our cohort, there were five individuals with interstitial deletions with a distal breakpoint at least 751 kbp proximal to the 4p terminus. Four of these individuals have never had an observable seizure, and the fifth individual had a single febrile seizure at the age of 1.5 years. All other individuals in our cohort whose deletions encompass the terminal 751 kbp region report having seizures typical of WHS. Additional examples from the literature corroborate these observations and further refine the candidate seizure susceptibility region to a region 197 kbp in size, starting 368 kbp from the terminus of chromosome 4. Conclusions We identify a small terminal region of chromosome 4p that represents a seizure susceptibility region. Deletion of this region in the context of WHS is sufficient for seizure occurrence. PMID:26747863

Tobacco, alcohol, and p53 overexpression in early colorectal neoplasia

International Nuclear Information System (INIS)

Terry, Mary Beth; Neugut, Alfred I; Mansukhani, Mahesh; Waye, Jerome; Harpaz, Noam; Hibshoosh, Hanina

2003-01-01

The p53 tumor suppressor gene is commonly mutated in colorectal cancer. While the effect of p53 mutations on colorectal cancer prognosis has been heavily studied, less is known about how epidemiologic risk factors relate to p53 status, particularly in early colorectal neoplasia prior to clinically invasive colorectal cancer (including adenomas, carcinoma in situ (CIS), and intramucosal carcinoma). We examined p53 status, as measured by protein overexpression, in 157 cases with early colorectal neoplasia selected from three New York City colonoscopy clinics. After collecting paraffin-embedded tissue blocks, immunohistochemistry was performed using an anti-p53 monoclonal mouse IgG 2 a [BP53-12-1] antibody. We analyzed whether p53 status was different for risk factors for colorectal neoplasia relative to a polyp-free control group (n = 508). p53 overexpression was found in 10.3%, 21.7%, and 34.9%, of adenomatous polyps, CIS, and intramucosal cases, respectively. Over 90% of the tumors with p53 overexpression were located in the distal colon and rectum. Heavy cigarette smoking (30+ years) was associated with cases not overexpressing p53 (OR = 1.8, 95% CI = 1.1–2.9) but not with those cases overexpressing p53 (OR = 1.0, 95% CI = 0.4–2.6). Heavy beer consumption (8+ bottles per week) was associated with cases overexpressing p53 (OR = 4.0, 95% CI = 1.3–12.0) but not with cases without p53 overexpression (OR = 1.6, 95% CI = 0.7–3.7). Our findings that p53 overexpression in early colorectal neoplasia may be positively associated with alcohol intake and inversely associated with cigarette smoking are consistent with those of several studies of p53 expression and invasive cancer, and suggest that there may be relationships of smoking and alcohol with p53 early in the adenoma to carcinoma sequence

Hormonal control of p53 and chemoprevention

International Nuclear Information System (INIS)

Jerry, D Joseph; Minter, Lisa M; Becker, Klaus A; Blackburn, Anneke C

2002-01-01

Improvements in the detection and treatment of breast cancer have dramatically altered its clinical course and outcome. However, prevention of breast cancer remains an elusive goal. Parity, age of menarche, and age at menopause are major risk factors drawing attention to the important role of the endocrine system in determining the risk of breast cancer, while heritable breast cancer susceptibility syndromes have implicated tumor suppressor genes as important targets. Recent work demonstrating hormonal modulation of the p53 tumor suppressor pathway draws together these established determinants of risk to provide a model of developmental susceptibility to breast cancer. In this model, the mammary epithelium is rendered susceptible due to impaired p53 activity during specific periods of mammary gland development, but specific endocrine stimuli serve to activate p53 function and to mitigate this risk. The results focus attention on p53 as a molecular target for therapies to reduce the risk of breast cancer

Insight into the Structural and Biological Relevance of the T/R Transition of the N-Terminus of the B-Chain in Human Insulin

Czech Academy of Sciences Publication Activity Database

Kosinová, Lucie; Veverka, Václav; Novotná, P.; Collinsová, Michaela; Urbanová, M.; Moody, N. R.; Turkenburg, J. P.; Jiráček, Jiří; Brzozowski, A. M.; Žáková, Lenka

2014-01-01

Roč. 53, č. 21 (2014), s. 3392-3402 ISSN 0006-2960 R&D Projects: GA ČR GPP207/11/P430; GA ČR GAP208/11/0105; GA MŠk(CZ) LK11205 Institutional support: RVO:61388963 Keywords : insulin * structure * N-terminus * B-chain * T/R transition Subject RIV: CE - Biochemistry Impact factor: 3.015, year: 2014

Friend or Foe: MicroRNAs in the p53 network.

Science.gov (United States)

Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

2018-04-10

The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

A dual role of p53 in the control of autophagy.

Science.gov (United States)

Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

2008-08-01

Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

Directory of Open Access Journals (Sweden)

Christian Bressy

2017-06-01

Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

The role of p53 and pRB in apoptosis and cancer

DEFF Research Database (Denmark)

Hickman, Emma S; Moroni, M Cristina; Helin, Kristian

2002-01-01

Loss of function of both the p53 pathway and the retinoblastoma protein (pRB) pathway plays a significant role in the development of most human cancers. Loss of pRB results in deregulated cell proliferation and apoptosis, whereas loss of p53 desensitizes cells to checkpoint signals, including...

REDOX IMAGING OF THE p53-DEPENDENT MITOCHONDRIAL REDOX STATE IN COLON CANCER EX VIVO

Science.gov (United States)

XU, HE N.; FENG, MIN; MOON, LILY; DOLLOFF, NATHAN; EL-DEIRY, WAFIK; LI, LIN Z.

2015-01-01

The mitochondrial redox state and its heterogeneity of colon cancer at tissue level have not been previously reported. Nor has how p53 regulates mitochondrial respiration been measured at (deep) tissue level, presumably due to the unavailability of the technology that has sufficient spatial resolution and tissue penetration depth. Our prior work demonstrated that the mitochondrial redox state and its intratumor heterogeneity is associated with cancer aggressiveness in human melanoma and breast cancer in mouse models, with the more metastatic tumors exhibiting localized regions of more oxidized redox state. Using the Chance redox scanner with an in-plane spatial resolution of 200 μm, we imaged the mitochondrial redox state of the wild-type p53 colon tumors (HCT116 p53 wt) and the p53-deleted colon tumors (HCT116 p53−/−) by collecting the fluorescence signals of nicotinamide adenine dinucleotide (NADH) and oxidized flavoproteins [Fp, including flavin adenine dinucleotide (FAD)] from the mouse xenografts snap-frozen at low temperature. Our results show that: (1) both tumor lines have significant degree of intratumor heterogeneity of the redox state, typically exhibiting a distinct bi-modal distribution that either correlates with the spatial core–rim pattern or the “hot/cold” oxidation-reduction patches; (2) the p53−/− group is significantly more heterogeneous in the mitochondrial redox state and has a more oxidized tumor core compared to the p53 wt group when the tumor sizes of the two groups are matched; (3) the tumor size dependence of the redox indices (such as Fp and Fp redox ratio) is significant in the p53−/− group with the larger ones being more oxidized and more heterogeneous in their redox state, particularly more oxidized in the tumor central regions; (4) the H&E staining images of tumor sections grossly correlate with the redox images. The present work is the first to reveal at the submillimeter scale the intratumor heterogeneity pattern

Clonal expansion to anaplasia in Wilms` tumors is associated with p53 mutations

Energy Technology Data Exchange (ETDEWEB)

Pelletier, J.; Beckwith, B.; Bardeesy, N. [Loma Linda Univ., CA (United States)]|[McGill Univ., Montreal (Canada)

1994-09-01

The genetics of Wilms` tumor (WT), a pediatric malignancy of the kidney, is complex. Three loci are implicated in WT initiation and include the WT1 tumor suppressor gene (residing at 11p13), an 11p15 locus, and a non-11p locus. As well, allelic loss at 16q24 in {approximately}20% of sporadic WTs suggests the location of (an) additional gene(s) involved in tumor progression. Initiation and progression in WTs is associated with multiple histological variants. Anaplasia is a rare WT subtype associated with poor prognosis and defined by enlarged and multipolar mitotic figures, a threefold nuclear enlargement (compared with adjacent nuclei of the same cell type), and hyperchromasia of the enlarged nuclei. We have previously demonstrated that p53 gene mutations are exclusively associated with anaplastic WTs, being absent from a large number of non-anaplastic WTs analyzed. To determine if such mutations are involved in clonal progression to anaplasia, we performed a retrospective analysis of histologically defined sections from tumor specimens. Six of ten WTs demonstrated p53 mutations by PCR-single stranded conformational polymorphism analysis. Two of these samples were paired, consisting of geographically demarcated anaplastic cells embedded within a non-anaplastic tumor bed. In these cases, p53 mutations were only present in the anaplastic region of the tumor. An overall decrease in the number of apoptotic cells was found associated with the anaplastic tumor region, compared to adjacent non-anaplastic tumor bed. These results indicate that p53 mutations arise during progression to anaplasia late in Wilms` tumor etiology and are associated with a more aggressive form of this cancer.

CLCA2 as a p53-Inducible Senescence Mediator

Directory of Open Access Journals (Sweden)

Chizu Tanikawa

2012-02-01

Full Text Available p53 is a tumor suppressor gene that is frequently mutated in multiple cancer tissues. Activated p53 protein regulates its downstream genes and subsequently inhibits malignant transformation by inducing cell cycle arrest, apoptosis, DNA repair, and senescence. However, genes involved in the p53-mediated senescence pathway are not yet fully elucidated. Through the screening of two genome-wide expression profile data sets, one for cells in which exogenous p53 was introduced and the other for senescent fibroblasts, we have identified chloride channel accessory 2 (CLCA2 as a p53-inducible senescence-associated gene. CLCA2 was remarkably induced by replicative senescence as well as oxidative stress in a p53-dependent manner. We also found that ectopically expressed CLCA2 induced cellular senescence, and the down-regulation of CLCA2 by small interfering RNA caused inhibition of oxidative stress-induced senescence. Interestingly, the reduced expression of CLCA2 was frequently observed in various kinds of cancers including prostate cancer, whereas its expression was not affected in precancerous prostatic intraepithelial neoplasia. Thus, our findings suggest a crucial role of p53/CLCA2-mediated senescence induction as a barrier for malignant transformation.

Targeting p53 by small molecules in hematological malignancies

OpenAIRE

Saha, Manujendra N; Qiu, Lugui; Chang, Hong

2013-01-01

p53 is a powerful tumor suppressor and is an attractive cancer therapeutic target. A breakthrough in cancer research came from the discovery of the drugs which are capable of reactivating p53 function. Most anti-cancer agents, from traditional chemo- and radiation therapies to more recently developed non-peptide small molecules exert their effects by enhancing the anti-proliferative activities of p53. Small molecules such as nutlin, RITA, and PRIMA-1 that can activate p53 have shown their ant...

Actinomycin D synergistically enhances the cytotoxicity of CDDP on KB cells by activating P53 via decreasing P53-MDM2 complex.

Science.gov (United States)

Wang, Lin; Pang, Xiao-Cong; Yu, Zi-Ru; Yang, Sheng-Qian; Liu, Ai-Lin; Wang, Jin-Hua; Du, Guan-Hua

2017-06-01

The aim of this study is to investigate the synergism of low dose of actinomycin D (LDActD) to the cytotoxicity of cisplatin (CDDP) on KB cells. The role of P53 reactivation by LDActD in the synergism and its mechanism were further studied. Cell viability was determined by MTT assay. Apoptosis was determined by AnnexinV-FITC/PI staining. Mitochondrial membrane potential (MMP) was detected by JC-1 staining. Expression of proteins was detected by Western blotting (WB) and/or immunofluorescence (IF). Molecular docking of actinomycin D (ACTD) to Mouse double minute 2 homolog (MDM2) and Mouse double minute 2 homolog X (MDMX). MDMX was analyzed by Discovery Studio. The content of P53-MDM2 complex was detected by ELISA assay. The cytotoxicity of CDDP was increased by the combination of LDActD in kinds of cancer cells. Molecular docking showed strong interaction between ACTD and MDM2/MDMX. Meanwhile, LDActD significantly decreased P53-MDM2 complex. Significant increase of the apoptotic activity by the combination therapy in KB cells is P53 upregulated modulator of apoptosis (PUMA) dependent. In addition to the decrease in MMP, LDActD increased P53 regulated protein and decreased BCL-XL in KB cells. LDActD efficiently enhanced the cytotoxicity of CDDP in cancer cells and induced P53-PUMA-dependent and mitochondria-mediated apoptosis in KB cells. The reactivation of P53 was probably achieved by disturbing the interaction of P53 and MDM2/MDMX.

Knockdown of p53 suppresses Nanog expression in embryonic stem cells

Energy Technology Data Exchange (ETDEWEB)

Abdelalim, Essam Mohamed, E-mail: emohamed@qf.org.qa [Qatar Biomedical Research Institute, Qatar Foundation, Doha 5825 (Qatar); Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan); Department of Cytology and Histology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia (Egypt); Tooyama, Ikuo [Molecular Neuroscience Research Center, Shiga University of Medical Science, Setatsukinowa-cho, Otsu, Shiga 520-2192 (Japan)

2014-01-10

Highlights: •We investigate the role of p53 in ESCs in the absence of DNA damage. •p53 knockdown suppresses ESC proliferation. •p53 knockdown downregulates Nanog expression. •p53 is essential for mouse ESC self-renewal. -- Abstract: Mouse embryonic stem cells (ESCs) express high levels of cytoplasmic p53. Exposure of mouse ESCs to DNA damage leads to activation of p53, inducing Nanog suppression. In contrast to earlier studies, we recently reported that chemical inhibition of p53 suppresses ESC proliferation. Here, we confirm that p53 signaling is involved in the maintenance of mouse ESC self-renewal. RNA interference-mediated knockdown of p53 induced downregulation of p21 and defects in ESC proliferation. Furthermore, p53 knockdown resulted in a significant downregulation in Nanog expression at 24 and 48 h post-transfection. p53 knockdown also caused a reduction in Oct4 expression at 48 h post-transfection. Conversely, exposure of ESCs to DNA damage caused a higher reduction of Nanog expression in control siRNA-treated cells than in p53 siRNA-treated cells. These data show that in the absence of DNA damage, p53 is required for the maintenance of mouse ESC self-renewal by regulating Nanog expression.

Analysis of Primary Structural Determinants That Distinguish the Centromere-Specific Function of Histone Variant Cse4p from Histone H3

OpenAIRE

Keith, Kevin C.; Baker, Richard E.; Chen, Yinhuai; Harris, Kendra; Stoler, Sam; Fitzgerald-Hayes, Molly

1999-01-01

Cse4p is a variant of histone H3 that has an essential role in chromosome segregation and centromere chromatin structure in budding yeast. Cse4p has a unique 135-amino-acid N terminus and a C-terminal histone-fold domain that is more than 60% identical to histone H3 and the mammalian centromere protein CENP-A. Cse4p and CENP-A have biochemical properties similar to H3 and probably replace H3 in centromere-specific nucleosomes in yeasts and mammals, respectively. In order to identify regions o...

Mutant, wild type, or overall p53 expression: freedom from clinical progression in tumours of astrocytic lineage.

Science.gov (United States)

Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M

2004-11-01

Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (Pexpression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.

Regulation of Metabolic Activity by p53

Directory of Open Access Journals (Sweden)

Jessica Flöter

2017-05-01

Full Text Available Metabolic reprogramming in cancer cells is controlled by the activation of multiple oncogenic signalling pathways in order to promote macromolecule biosynthesis during rapid proliferation. Cancer cells also need to adapt their metabolism to survive and multiply under the metabolically compromised conditions provided by the tumour microenvironment. The tumour suppressor p53 interacts with the metabolic network at multiple nodes, mostly to reduce anabolic metabolism and promote preservation of cellular energy under conditions of nutrient restriction. Inactivation of this tumour suppressor by deletion or mutation is a frequent event in human cancer. While loss of p53 function lifts an important barrier to cancer development by deleting cell cycle and apoptosis checkpoints, it also removes a crucial regulatory mechanism and can render cancer cells highly sensitive to metabolic perturbation. In this review, we will summarise the major concepts of metabolic regulation by p53 and explore how this knowledge can be used to selectively target p53 deficient cancer cells in the context of the tumour microenvironment.

Regional amino acid transport into brain during diabetes: Effect of plasma amino acids

International Nuclear Information System (INIS)

Mans, A.M.; DeJoseph, M.R.; Davis, D.W.; Hawkins, R.A.

1987-01-01

Transport of phenylalanine and lysine into the brain was measured in 4-wk streptozotocin-diabetic rats to assess the effect on the neutral and basic amino acid transport systems at the blood-brain barrier. Amino acid concentrations in plasma and brain were also measured. Regional permeability-times-surface area (PS) products and influx were determined using a continuous infusion method and quantitative autoradiography. The PS of phenylalanine was decreased by an average of 40% throughout the entire brain. Influx was depressed by 35%. The PS of lysine was increased by an average of 44%, but the influx was decreased by 27%. Several plasma neutral amino acids (branched chain) were increased, whereas all basic amino acids were decreased. Brain tryptophan, phenylalanine, tyrosine, methionine, and lysine contents were markedly decreased. The transport changes were almost entirely accounted for by the alterations in the concentrations of the plasma amino acids that compete for the neutral and basic amino acid carriers. The reduced influx could be responsible for the low brain content of some essential amino acids, with possibly deleterious consequences for brain functions

Characterization and role of p53 family members in the symbiont-induced morphogenesis of the Euprymna scolopes light organ.

Science.gov (United States)

Goodson, Michael S; Crookes-Goodson, Wendy J; Kimbell, Jennifer R; McFall-Ngai, Margaret J

2006-08-01

Within hours of hatching, the squid Euprymna scolopes forms a specific light organ symbiosis with the marine luminous bacterium Vibrio fischeri. Interactions with the symbiont result in the loss of a complex ciliated epithelium dedicated to promoting colonization of host tissue, and some or all of this loss is due to widespread, symbiont-induced apoptosis. Members of the p53 family, including p53, p63, and p73, are conserved across broad phyletic lines and p63 is thought to be the ancestral gene. These proteins have been shown to induce apoptosis and developmental morphogenesis. In this study, we characterized p63-like transcripts from mRNA isolated from the symbiotic tissues of E. scolopes and described their role in symbiont-induced morphogenesis. Using degenerate RT-PCR and RACE PCR, we identified two p63-like transcripts encoding proteins of 431 and 567 amino acids. These transcripts shared identical nucleotides where they overlapped, suggesting that they are splice variants of the same gene. Immunocytochemistry and Western blots using an antibody specific for E. scolopes suggested that the p53 family members are activated in cells of the symbiont-harvesting structures of the symbiotic light organ. We propose that once the symbiosis is initiated, a symbiont-induced signal activates p53 family members, inducing apoptosis and developmental morphogenesis of the light organ.

Post-translational regulation enables robust p53 regulation.

Science.gov (United States)

Shin, Yong-Jun; Chen, Kai-Yuan; Sayed, Ali H; Hencey, Brandon; Shen, Xiling

2013-08-30

The tumor suppressor protein p53 plays important roles in DNA damage repair, cell cycle arrest and apoptosis. Due to its critical functions, the level of p53 is tightly regulated by a negative feedback mechanism to increase its tolerance towards fluctuations and disturbances. Interestingly, the p53 level is controlled by post-translational regulation rather than transcriptional regulation in this feedback mechanism. We analyzed the dynamics of this feedback to understand whether post-translational regulation provides any advantages over transcriptional regulation in regard to disturbance rejection. When a disturbance happens, even though negative feedback reduces the steady-state error, it can cause a system to become less stable and transiently overshoots, which may erroneously trigger downstream reactions. Therefore, the system needs to balance the trade-off between steady-state and transient errors. Feedback control and adaptive estimation theories revealed that post-translational regulation achieves a better trade-off than transcriptional regulation, contributing to a more steady level of p53 under the influence of noise and disturbances. Furthermore, post-translational regulation enables cells to respond more promptly to stress conditions with consistent amplitude. However, for better disturbance rejection, the p53- Mdm2 negative feedback has to pay a price of higher stochastic noise. Our analyses suggest that the p53-Mdm2 feedback favors regulatory mechanisms that provide the optimal trade-offs for dynamic control.

Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf-Hirschhorn syndrome.

Science.gov (United States)

Ho, Karen S; South, Sarah T; Lortz, Amanda; Hensel, Charles H; Sdano, Mallory R; Vanzo, Rena J; Martin, Megan M; Peiffer, Andreas; Lambert, Christophe G; Calhoun, Amy; Carey, John C; Battaglia, Agatino

2016-04-01

Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving variable size deletions of the 4p16.3 region. Seizures are frequently, but not always, associated with WHS. We hypothesised that the size and location of the deleted region may correlate with seizure presentation. Using chromosomal microarray analysis, we finely mapped the breakpoints of copy number variants (CNVs) in 48 individuals with WHS. Seizure phenotype data were collected through parent-reported answers to a comprehensive questionnaire and supplemented with available medical records. We observed a significant correlation between the presence of an interstitial 4p deletion and lack of a seizure phenotype (Fisher's exact test p=3.59e-6). In our cohort, there were five individuals with interstitial deletions with a distal breakpoint at least 751 kbp proximal to the 4p terminus. Four of these individuals have never had an observable seizure, and the fifth individual had a single febrile seizure at the age of 1.5 years. All other individuals in our cohort whose deletions encompass the terminal 751 kbp region report having seizures typical of WHS. Additional examples from the literature corroborate these observations and further refine the candidate seizure susceptibility region to a region 197 kbp in size, starting 368 kbp from the terminus of chromosome 4. We identify a small terminal region of chromosome 4p that represents a seizure susceptibility region. Deletion of this region in the context of WHS is sufficient for seizure occurrence. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Analysis of a p53 Mutation Associated with Cancer Susceptibility for Biochemistry and Genetic Laboratory Courses

Science.gov (United States)

Soto-Cruz, Isabel; Legorreta-Herrera, Martha

2009-01-01

We have devised and implemented a module for an upper division undergraduate laboratory based on the amplification and analysis of a p53 polymorphism associated with cancer susceptibility. First, students collected a drop of peripheral blood cells using a sterile sting and then used FTA cards to extract the genomic DNA. The p53 region is then PCR…

Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

Science.gov (United States)

Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

2011-01-01

The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

An adaptive molecular timer in p53-meidated cell fate decision

Science.gov (United States)

Zhang, Xiao-Peng; Wang, Ping; Liu, Feng; Wang, Wei

The tumor suppressor p53 decides cellular outcomes in the DNA damage response. It is intriguing to explore the link between p53 dynamics and cell fates. We developed a theoretical model of p53 signaling network to clarify the mechanism of cell fate decision mediated by its dynamics. We found that the interplay between p53-Mdm2 negative feedback loop and p53-PTEN-Mdm2 positive feedback loop shapes p53 dynamics. Depending on the intensity of DNA damage, p53 shows three modes of dynamics: persistent pulses, two-phase dynamics with pulses followed by sustained high levels and straightforward high levels. Especially, p53 shows two-phase dynamics upon moderated damage and the required number of p53 pulses before apoptosis induction decreases with increasing DNA damage. Our results suggested there exists an adaptive molecular timer that determines whether and when the apoptosis switch should be triggered. We clarified the mechanism behind the switching of p53 dynamical modes by bifurcation analysis. Moreover, we reproduced the experimental results that drug additions alter p53 pulses to sustained p53 activation and leads to senescence. Our work may advance the understanding the significance of p53 dynamics in tumor suppression. This work was supported by National Natural Science Foundation of China (Nos. 11175084, 11204126 and 31361163003).

Dopaminergic Neuron-Specific Deletion of p53 Gene Attenuates Methamphetamine Neurotoxicity.

Science.gov (United States)

Lu, Tao; Kim, Paul P; Greig, Nigel H; Luo, Yu

2017-08-01

p53 plays an essential role in the regulation of cell death in dopaminergic (DA) neurons and its activation has been implicated in the neurotoxic effects of methamphetamine (MA). However, how p53 mediates MA neurotoxicity remains largely unknown. In this study, we examined the effect of DA-specific p53 gene deletion in DAT-p53KO mice. Whereas in vivo MA binge exposure reduced locomotor activity in wild-type (WT) mice, this was significantly attenuated in DAT-p53KO mice and associated with significant differences in the levels of the p53 target genes BAX and p21 between WT and DAT-p53KO. Notably, DA-specific deletion of p53 provided protection of substantia nigra pars reticulata (SNpr) tyrosine hydroxylase (TH) positive fibers following binge MA, with DAT-p53KO mice having less decline of TH protein levels in striatum versus WT mice. Whereas DAT-p53KO mice demonstrated a consistently higher density of TH fibers in striatum compared to WT mice at 10 days after MA exposure, DA neuron counts within the substantia nigra pars compacta (SNpc) were similar. Finally, supportive of these results, administration of a p53-specific inhibitor (PFT-α) provided a similarly protective effect on MA binge-induced behavioral deficits. Neither DA specific p53 deletion nor p53 pharmacological inhibition affected hyperthermia induced by MA binge. These findings demonstrate a specific contribution of p53 activation in behavioral deficits and DA neuronal terminal loss by MA binge exposure.

Maintaining appearances-The role of p53 in adult neurogenesis

International Nuclear Information System (INIS)

Medrano, Silvia; Scrable, Heidi

2005-01-01

In the adult mammalian brain, neuronal turnover continues to replenish cells in existing neuronal circuits, such as those involved either in odor discrimination or in learning and memory, throughout life. With age, however, the capacity for neurogenesis diminishes and these functions become impaired. Neuronal turnover is a two-step process, which first generates excess neuronal progenitors and then eliminates all but the few that differentiate into fully functional neurons. This process requires a fine balance between cell proliferation and cell death. Altered activity of the tumor suppressor p53 can upset this balance by affecting the rate of cell proliferation, but not the rate of cell death, in neurogenic regions of the adult brain. Genetically engineered mice in which p53 activity is increased demonstrate that premature loss of neurogenic capacity is linked to accelerated organismal aging

Sequence of the amino-terminal region of rat liver ribosomal proteins S4, S6, S8, L6, L7a, L18, L27, L30, L37, L37a, and L39.

Science.gov (United States)

Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G

1979-01-01

The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

Science.gov (United States)

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Actual Proliferating Index and p53 protein expression as prognostic marker in odontogenic cysts.

Science.gov (United States)

Gadbail, A R; Chaudhary, M; Patil, S; Gawande, M

2009-10-01

The purpose of this study was to evaluate the biological aggressiveness of odontogenic keratocyst/keratocystic odontogenic tumour (KCOT), radicular cyst (RC) and dentigerous cyst (DC) by observing the actual proliferative activity of epithelium, and p53 protein expression. The actual proliferative activity was measured by Ki-67 Labelling Index and argyrophilic nucleolar organizing regions (AgNOR) count per nucleus. The p53 protein expression was also evaluated. Ki-67 positive cells were observed higher in suprabasal cell layers of KCOT with uniform distribution, a few of them were predominantly observed in basal cell layer in RC and DC. The AgNOR count was significantly higher in suprabasal cell layers of KCOT. The actual proliferative activity was noted to be higher in suprabasal cell layers of KCOT. The p53 immunolabelling was dense and scattered in basal and suprabasal cell layers in KCOT. The weakly stained p53 positive cells were observed diffusely distributed in KCOT, whereas they were mainly seen in basal cell layer of RC and DC. The quantitative and qualitative differences of the proliferative activity and the p53 protein expression in sporadic KCOT may be associated with intrinsic growth potential that could play a role in its development and explain locally aggressive biological behaviour. AgNOR count and p53 protein detection in odontogenic lesions can be of great consequence to predict the biological behaviour and prognosis.

Mitofusin-2 is a novel direct target of p53

International Nuclear Information System (INIS)

Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

2010-01-01

Research highlights: → Mfn2 is a novel target gene of p53. → Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. → Mfn2 promoter activity can be elevated by the p53 protein. → P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

Differential sensitivity of p53+ and p53- cells to caffeine-induced radiosensitization and override of G2 delay

International Nuclear Information System (INIS)

Powell, S.N.; DeFrank, J.S.; Connell, P.; Eogan, M.; Preffer, F.; Dombkowski, D.; Tang, W.; Friend, S.H.

1995-01-01

Purpose: Most drug discovery efforts have focused on finding new DNA damaging agents to kill tumor cells preferentially. An alternative approach is to find ways to increase tumor specific killing by modifying tumor specific responses to that damage. We asked whether cells lacking the G1/S arrest in response to X-rays are more sensitive to X-ray damage when treated with agents that override G2/M arrest. Materials and Methods: Mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) p53 and rat embryonic fibroblasts (REF) made (+) or (-) for wild-type p53 function by transfection were irradiated with and without caffeine, a known checkpoint inhibitor. Caffeine treatment was maintained for 24 hours from 1 hour prior to irradiation. Cell survival following ionizing radiation was measured by clonogenic assay. For cell-cycle analysis, cells were in exponential asynchronous growth at the time of irradiation. The proportion of cells in G1, S and G2/M phases of the cell cycle were recorded immediately before and following irradiation and subsequently at 3,6,9,12,24 and 48 hours following irradiation. Results: Caffeine was found to cause radiosensitzation at low dose (0.5mM) in (-/-) cells but not in (+/+) cells. The sensitization enhancement ratio (SER) was 1.45 at 0.1 survival and 1.56 at 0.01 survival. At this dose of caffeine, this SER reflected therapeutic gain as there was no detectable effect on (+/+) cells. At 1mM caffeine, sensitization of (-/-) cells was 1.77, but (+/+) cells now also showed sensitization (SER=1.25). In (-/-) cells at 0.1mM caffeine the SER was 1.5 at 0.01 survival. The transfected REF cells (functionally null for p53) also exhibited caffeine-induced radiosensitization at both 0.5 and 2mM caffeine with a SER 1.45 for 2mM at 0.1 survival. No significant sensitization could be demonstrated for REF cells at the same doses of caffeine. The REF cells, with wild-type p53, transfected with pCMVneo alone showed no change in radiosensitivity or

40 Years of Research Put p53 in Translation

Science.gov (United States)

Marcel, Virginie; Nguyen Van Long, Flora; Diaz, Jean-Jacques

2018-01-01

Since its discovery in 1979, p53 has shown multiple facets. Initially the tumor suppressor p53 protein was considered as a stress sensor able to maintain the genome integrity by regulating transcription of genes involved in cell cycle arrest, apoptosis and DNA repair. However, it rapidly came into light that p53 regulates gene expression to control a wider range of biological processes allowing rapid cell adaptation to environmental context. Among them, those related to cancer have been extensively documented. In addition to its role as transcription factor, scattered studies reported that p53 regulates miRNA processing, modulates protein activity by direct interaction or exhibits RNA-binding activity, thus suggesting a role of p53 in regulating several layers of gene expression not restricted to transcription. After 40 years of research, it appears more and more clearly that p53 is strongly implicated in translational regulation as well as in the control of the production and activity of the translational machinery. Translation control of specific mRNAs could provide yet unsuspected capabilities to this well-known guardian of the genome.

ZNF307, a novel zinc finger gene suppresses p53 and p21 pathway

International Nuclear Information System (INIS)

Li Jing; Wang Yuequn; Fan Xiongwei; Mo Xiaoyang; Wang Zequn; Li Yongqing; Yin Zhaochu; Deng Yun; Luo Na; Zhu Chuanbing; Liu Mingyao; Ma Qian; Ocorr, Karen; Yuan Wuzhou; Wu Xiushan

2007-01-01

We have cloned a novel KRAB-related zinc finger gene, ZNF307, encoding a protein of 545 aa. ZNF307 is conserved across species in evolution and is differentially expressed in human adult and fetal tissues. The fusion protein of EGFP-ZNF307 localizes in the nucleus. Transcriptional activity assays show ZNF307 suppresses transcriptional activity of L8G5-luciferase. Overexpressing ZNF307 in different cell lines also inhibits the transcriptional activities of p53 and p21. Moreover, ZNF307 works by reducing the p53 protein level and p53 protein reduction is achieved by increasing transcription of MDM2 and EP300. ZNF307 might suppress p53-p21 pathway through activating MDM2 and EP300 expression and inducing p53 degradation

PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

Science.gov (United States)

Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

2012-12-13

p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

International Nuclear Information System (INIS)

Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

2008-01-01

Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

Single nucleotide polymorphisms in the TP53 region and susceptibility to invasive epithelial ovarian cancer

DEFF Research Database (Denmark)

Schildkraut, Joellen M; Goode, Ellen L; Clyde, Merlise A

2009-01-01

The p53 protein is critical for multiple cellular functions including cell growth and DNA repair. We assessed whether polymorphisms in the region encoding TP53 were associated with risk of invasive ovarian cancer. The study population includes a total of 5,206 invasive ovarian cancer cases (2,829...

The Prognostic Impact of p53 Expression on Sporadic Colorectal Cancer Is Dependent on p21 Status

International Nuclear Information System (INIS)

Kruschewski, Martin; Mueller, Kathrin; Lipka, Sybille; Budczies, Jan; Noske, Aurelia; Buhr, Heinz Johannes; Elezkurtaj, Sefer

2011-01-01

The prognostic value of p53 and p21 expression in colorectal cancer is still under debate. We hypothesize that the prognostic impact of p53 expression is dependent on p21 status. The expression of p53 and p21 was immunohistochemically investigated in a prospective cohort of 116 patients with UICC stage II and III sporadic colorectal cancer. The results were correlated with overall and recurrence-free survival. The mean observation period was 51.8 ± 2.5 months. Expression of p53 was observed in 72 tumors (63%). Overall survival was significantly better in patients with p53-positive carcinomas than in those without p53 expression (p = 0.048). No differences were found in recurrence-free survival (p = 0.161). The p53+/p21− combination was seen in 68% (n = 49), the p53+/p21+ combination in 32% (n = 23). Patients with p53+/p21− carcinomas had significantly better overall and recurrence-free survival than those with p53+/p21+ (p < 0.0001 resp. p = 0.003). Our data suggest that the prognostic impact of p53 expression on sporadic colorectal cancer is dependent on p21 status

Molecular mechanism of X-ray-induced p53-dependent apoptosis

Energy Technology Data Exchange (ETDEWEB)

Nakano, Hisako [Tokyo Metropolitan Inst. of Medical Center (Japan)

1999-03-01

Radiation-induced cell death has been classified into the interphase- and mitotic-ones, both of which apoptosis involving. This review described the molecular mechanism of the apoptosis, focusing on its p53-dependent process. It is known that there are genes regulating cell death either negatively or positively and the latter is involved in apoptosis. As an important factor in the apoptosis, p53 has become remarkable since it was shown that X-ray-induced apoptosis required RNA and protein syntheses in thymocytes and those cells of p53 gene-depleted mouse were shown to be resistant to gamma-ray-induced apoptosis. Radiation sensitivity of MOLT-4 cells derived from human T cell leukemia, exhibiting the typical X-ray-induced p53-dependent apoptosis, depends on the levels of p53 mRNA and protein. p53 is a gene suppressing tumor and also a transcription factor. Consequently, mutation of p53 conceivably leads to the failure of cell cycle regulation, which allows damaged cells to divide without both repair and exclusion due to loss of the apoptotic mechanism, and finally results in carcinogenesis. The radiation effect occurs in the order of the cell damage, inhibition of p53-Mdm2 binding, accumulation of p53, activation of mdm2 transcription, Mdm2 accumulation, p53-protein degradation and recovery to the steady state level. Here, the cystein protease (caspases) plays an important role as a disposing mechanism for cells scheduled to die. However, many are unknown to be solved in future. (K.H.) 119 refs.

Gene expression patterns associated with p53 status in breast cancer

International Nuclear Information System (INIS)

Troester, Melissa A; Herschkowitz, Jason I; Oh, Daniel S; He, Xiaping; Hoadley, Katherine A; Barbier, Claire S; Perou, Charles M

2006-01-01

Breast cancer subtypes identified in genomic studies have different underlying genetic defects. Mutations in the tumor suppressor p53 occur more frequently in estrogen receptor (ER) negative, basal-like and HER2-amplified tumors than in luminal, ER positive tumors. Thus, because p53 mutation status is tightly linked to other characteristics of prognostic importance, it is difficult to identify p53's independent prognostic effects. The relation between p53 status and subtype can be better studied by combining data from primary tumors with data from isogenic cell line pairs (with and without p53 function). The p53-dependent gene expression signatures of four cell lines (MCF-7, ZR-75-1, and two immortalized human mammary epithelial cell lines) were identified by comparing p53-RNAi transduced cell lines to their parent cell lines. Cell lines were treated with vehicle only or doxorubicin to identify p53 responses in both non-induced and induced states. The cell line signatures were compared with p53-mutation associated genes in breast tumors. Each cell line displayed distinct patterns of p53-dependent gene expression, but cell type specific (basal vs. luminal) commonalities were evident. Further, a common gene expression signature associated with p53 loss across all four cell lines was identified. This signature showed overlap with the signature of p53 loss/mutation status in primary breast tumors. Moreover, the common cell-line tumor signature excluded genes that were breast cancer subtype-associated, but not downstream of p53. To validate the biological relevance of the common signature, we demonstrated that this gene set predicted relapse-free, disease-specific, and overall survival in independent test data. In the presence of breast cancer heterogeneity, experimental and biologically-based methods for assessing gene expression in relation to p53 status provide prognostic and biologically-relevant gene lists. Our biologically-based refinements excluded genes

Effect of p53 genotype on gene expression profiles in murine liver

International Nuclear Information System (INIS)

Morris, Suzanne M.; Akerman, Gregory S.; Desai, Varsha G.; Tsai, Chen-an; Tolleson, William H.; Melchior, William B.; Lin, Chien-Ju; Fuscoe, James C.; Casciano, Daniel A.; Chen, James J.

2008-01-01

The tumor suppressor protein p53 is a key regulatory element in the cell and is regarded as the 'guardian of the genome'. Much of the present knowledge of p53 function has come from studies of transgenic mice in which the p53 gene has undergone a targeted deletion. In order to provide additional insight into the impact on the cellular regulatory networks associated with the loss of this gene, microarray technology was utilized to assess gene expression in tissues from both the p53 -/- and p53 +/- mice. Six male mice from each genotype (p53 +/+ , p53 +/- , and p53 -/- ) were humanely killed and the tissues processed for microarray analysis. The initial studies have been performed in the liver for which the Dunnett test revealed 1406 genes to be differentially expressed between p53 +/+ and p53 +/- or between p53 +/+ and p53 -/- at the level of p ≤ 0.05. Both genes with increased expression and decreased expression were identified in p53 +/- and in p53 -/- mice. Most notable in the gene list derived from the p53 +/- mice was the significant reduction in p53 mRNA. In the p53 -/- mice, not only was there reduced expression of the p53 genes on the array, but genes associated with DNA repair, apoptosis, and cell proliferation were differentially expressed, as expected. However, altered expression was noted for many genes in the Cdc42-GTPase pathways that influence cell proliferation. This may indicate that alternate pathways are brought into play in the unperturbed liver when loss or reduction in p53 levels occurs

p18(Hamlet) mediates different p53-dependent responses to DNA-damage inducing agents.

Science.gov (United States)

Lafarga, Vanesa; Cuadrado, Ana; Nebreda, Angel R

2007-10-01

Cells organize appropriate responses to environmental cues by activating specific signaling networks. Two proteins that play key roles in coordinating stress responses are the kinase p38alpha (MAPK14) and the transcription factor p53 (TP53). Depending on the nature and the extent of the stress-induced damage, cells may respond by arresting the cell cycle or by undergoing cell death, and these responses are usually associated with the phosphorylation of particular substrates by p38alpha as well as the activation of specific target genes by p53. We recently characterized a new p38alpha substrate, named p18(Hamlet) (ZNHIT1), which mediates p53-dependent responses to different genotoxic stresses. Thus, cisplatin or UV light induce stabilization of the p18(Hamlet) protein, which then enhances the ability of p53 to bind to and activate the promoters of pro-apoptotic genes such as NOXA and PUMA leading to apoptosis induction. In a similar way, we report here that p18(Hamlet) can also mediate the cell cycle arrest induced in response to gamma-irradiation, by participating in the p53-dependent upregulation of the cell cycle inhibitor p21(Cip1) (CDKN1A).

Stimulation of autophagy by the p53 target gene Sestrin2.

Science.gov (United States)

Maiuri, Maria Chiara; Malik, Shoaib Ahmad; Morselli, Eugenia; Kepp, Oliver; Criollo, Alfredo; Mouchel, Pierre-Luc; Carnuccio, Rosa; Kroemer, Guido

2009-05-15

The oncosuppressor protein p53 regulates autophagy in a dual fashion. The pool of cytoplasmic p53 protein represses autophagy in a transcription-independent fashion, while the pool of nuclear p53 stimulates autophagy through the transactivation of specific genes. Here we report the discovery that Sestrin2, a novel p53 target gene, is involved in the induction of autophagy. Depletion of Sestrin2 by RNA interference reduced the level of autophagy in a panel of p53-sufficient human cancer cell lines responding to distinct autophagy inducers. In quantitative terms, Sestrin2 depletion was as efficient in preventing autophagy induction as was the depletion of Dram, another p53 target gene. Knockout of either Sestrin2 or Dram reduced autophagy elicited by nutrient depletion, rapamycin, lithium or thapsigargin. Moreover, autophagy induction by nutrient depletion or pharmacological stimuli led to an increase in Sestrin2 expression levels in p53-proficient cells. In strict contrast, the depletion of Sestrin2 or Dram failed to affect autophagy in p53-deficient cells and did not modulate the inhibition of baseline autophagy by a cytoplasmic p53 mutant that was reintroduced into p53-deficient cells. We conclude that Sestrin2 acts as a positive regulator of autophagy in p53-proficient cells.

Astrocytes Can Adopt Endothelial Cell Fates in a p53-Dependent Manner.

Science.gov (United States)

Brumm, Andrew J; Nunez, Stefanie; Doroudchi, Mehdi M; Kawaguchi, Riki; Duan, Jinhzu; Pellegrini, Matteo; Lam, Larry; Carmichael, S Thomas; Deb, Arjun; Hinman, Jason D

2017-08-01

Astrocytes respond to a variety of CNS injuries by cellular enlargement, process outgrowth, and upregulation of extracellular matrix proteins that function to prevent expansion of the injured region. This astrocytic response, though critical to the acute injury response, results in the formation of a glial scar that inhibits neural repair. Scar-forming cells (fibroblasts) in the heart can undergo mesenchymal-endothelial transition into endothelial cell fates following cardiac injury in a process dependent on p53 that can be modulated to augment cardiac repair. Here, we sought to determine whether astrocytes, as the primary scar-forming cell of the CNS, are able to undergo a similar cellular phenotypic transition and adopt endothelial cell fates. Serum deprivation of differentiated astrocytes resulted in a change in cellular morphology and upregulation of endothelial cell marker genes. In a tube formation assay, serum-deprived astrocytes showed a substantial increase in vessel-like morphology that was comparable to human umbilical vein endothelial cells and dependent on p53. RNA sequencing of serum-deprived astrocytes demonstrated an expression profile that mimicked an endothelial rather than astrocyte transcriptome and identified p53 and angiogenic pathways as specifically upregulated. Inhibition of p53 with genetic or pharmacologic strategies inhibited astrocyte-endothelial transition. Astrocyte-endothelial cell transition could also be modulated by miR-194, a microRNA downstream of p53 that affects expression of genes regulating angiogenesis. Together, these studies demonstrate that differentiated astrocytes retain a stimulus-dependent mechanism for cellular transition into an endothelial phenotype that may modulate formation of the glial scar and promote injury-induced angiogenesis.

Tumor suppressor p53 biology, its role in radioresponse and the analysis of p53 mutation/expression among Filipino breast cancers

International Nuclear Information System (INIS)

Deocaris, Custer C.

2004-01-01

Ionizing radiation remains one of the most effective tools for the treatment of breast cancer. It combines properties of a potent DNA-damaging agent and high degree of spatial specificity to the target tissue. Nonetheless, there remain considerable differences in the outcome for treatment of tumors of differing histological type treated by radiotherapy. The identification of predictive indicators of radiosensitivity is crucial for selecting patients suited for preoperative radiotherapy as well as those unwarranted for postoperative treatments. To improve prognostication, numerous genes involved in the breast carcinogenesis have been studied and thus far over the last decade several multi-center researches converge on the role of tumor suppressor p53 in tumor biology. The p53 gene is located on the short arm of chromosome 17 and encodes a 53-kd nuclear protein, p-53, also referred to as 'the guardian of the genome', it orchestrates multiple cellular processes such as cell growth control, DNA repair and programmed cell death. During radiotherapy, genotoxic damage induces p53 overexpression in order to control the rate of proliferating damaged cells, repair damage or induce the apoptotic pathway. Its molecular inactivation in a tumor cell, typically by a point mutation, leads to chemo/radio resistance due to the inability of the molecule to trigger p53-dependent programmed cell death

Phenotype specific analyses reveal distinct regulatory mechanism for chronically activated p53.

Directory of Open Access Journals (Sweden)

Kristina Kirschner

2015-03-01

Full Text Available The downstream functions of the DNA binding tumor suppressor p53 vary depending on the cellular context, and persistent p53 activation has recently been implicated in tumor suppression and senescence. However, genome-wide information about p53-target gene regulation has been derived mostly from acute genotoxic conditions. Using ChIP-seq and expression data, we have found distinct p53 binding profiles between acutely activated (through DNA damage and chronically activated (in senescent or pro-apoptotic conditions p53. Compared to the classical 'acute' p53 binding profile, 'chronic' p53 peaks were closely associated with CpG-islands. Furthermore, the chronic CpG-island binding of p53 conferred distinct expression patterns between senescent and pro-apoptotic conditions. Using the p53 targets seen in the chronic conditions together with external high-throughput datasets, we have built p53 networks that revealed extensive self-regulatory 'p53 hubs' where p53 and many p53 targets can physically interact with each other. Integrating these results with public clinical datasets identified the cancer-associated lipogenic enzyme, SCD, which we found to be directly repressed by p53 through the CpG-island promoter, providing a mechanistic link between p53 and the 'lipogenic phenotype', a hallmark of cancer. Our data reveal distinct phenotype associations of chronic p53 targets that underlie specific gene regulatory mechanisms.

Acetylation Is Crucial for p53-Mediated Ferroptosis and Tumor Suppression

Directory of Open Access Journals (Sweden)

Shang-Jui Wang

2016-10-01

Full Text Available Although previous studies indicate that loss of p53-mediated cell cycle arrest, apoptosis, and senescence does not completely abrogate its tumor suppression function, it is unclear how the remaining activities of p53 are regulated. Here, we have identified an acetylation site at lysine K98 in mouse p53 (or K101 for human p53. Whereas the loss of K98 acetylation (p53K98R alone has very modest effects on p53-mediated transactivation, simultaneous mutations at all four acetylation sites (p534KR: K98R+ 3KR[K117R+K161R+K162R] completely abolish its ability to regulate metabolic targets, such as TIGAR and SLC7A11. Notably, in contrast to p533KR, p534KR is severely defective in suppressing tumor growth in mouse xenograft models. Moreover, p534KR is still capable of inducing the p53-Mdm2 feedback loop, but p53-dependent ferroptotic responses are markedly abrogated. Together, these data indicate the critical role of p53 acetylation in ferroptotic responses and its remaining tumor suppression activity.

p53-Induced Apoptosis Occurs in the Absence of p14ARF in Malignant Pleural Mesothelioma

Directory of Open Access Journals (Sweden)

Sally Hopkins-Donaldson

2006-07-01

Full Text Available Malignant pleural mesotheliomas (MPMs are usually wild type for the p53 gene but contain homozygous deletions in the INK4A locus that encodes p14ARF, an inhibitor of p53-MDM2 interaction. Previous findings suggest that lack of p14ARF expression and the presence of SV40 large T antigen (L-Tag result in p53 inactivation in MPM. We did not detect SV40 L-Tag mRNA in either MPM cell lines or primary cultures, treatment of p14ARF-deficient cells with cisplatin (CDDP increased both total and phosphorylated p53 and enhanced p53 DNA-binding activity. On incubation with CDDP, levels of positively regulated p53 transcriptional targets p21WAF, PIG3, MDM2, Bax, PUMA increased in p14ARF-deficient cells, whereas negatively regulated survivin decreased. Significantly, p53-induced apoptosis was activated by CDDP in p14ARF-deficient cells, treatment with p53-specific siRNA rendered them more CDDP-resistant. p53 was also activated by: 1 inhibition of MDM2 (using nutlin-3; 2 transient overexpression of p14ARF; and 3 targeting of survivin using antisense oligonucleotides. However, it is noteworthy that only survivin downregulation sensitized cells to CDDP-induced apoptosis. These results suggest that p53 is functional in the absence of p14ARF in MPM and that targeting of the downstream apoptosis inhibitor survivin can sensitize to CDDP-induced apoptosis.

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

International Nuclear Information System (INIS)

Di Masi, Alessandra; Antoccia, Antonio; Dimauro, Ivan; Argentino-Storino, Alberta; Mosiello, Alberto; Mango, Ruggiero; Novelli, Giuseppe; Tanzarella, Caterina

2006-01-01

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses

Gene expression and apoptosis induction in p53-heterozygous irradiated mice

Energy Technology Data Exchange (ETDEWEB)

Di Masi, Alessandra [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Antoccia, Antonio [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Dimauro, Ivan [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy); Argentino-Storino, Alberta [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mosiello, Alberto [Research Toxicology Centre S.p.A., Via Tito Speri, 18, 00040 Pomezia (RM) (Italy); Mango, Ruggiero [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Novelli, Giuseppe [Centre of Excellence for Genomic Risk Assessment in Multifactorial and Complex Diseases, School of Medicine, University of Rome ' Tor Vergata' , Rome (Italy); Tanzarella, Caterina [Department of Biology, University of Rome ' Roma Tre' , Viale G. Marconi, 446, 00146 Rome (Italy)]. E-mail: tanzarel@uniroma3.it

2006-02-22

The role of the p53-genetic background in the expression of genes involved in either cell cycle checkpoint activation or apoptosis was evaluated in p53+/+ and p53+/- mouse strains at both basal levels and after DNA-induced damage. The spleen, colon, kidneys, lungs and liver of both strains were harvested from untreated animals and from mice exposed to 7.5 Gy of X-rays and sacrificed after 5 h. No significant differences were observed in the basal levels of p53 protein, CDKN1A and bax mRNA and spontaneous apoptosis, neither among the different organs within the same strain, nor between the same organ in the p53+/+ and p53+/- strains. After X-ray exposure, p53-dependent regulation was strikingly tissue-specific. In wild-type irradiated mice, p53 protein level increased after radiation treatment in all the organs analysed, whereas both CDKN1A and bax genes transcription increased in the spleen, colon and lungs, as assessed by means of quantitative RT-PCR. In p53+/- irradiated mice, on the contrary, a significant p53 induction was detected only in the spleen, while CDKN1A and bax genes levels increased in the spleen, colon and lungs, revealing the existence of different mechanisms of gene regulation in different organs. Apoptosis induction was observed in the spleen and colon of both strains, even if to lower extent in p53+/- mice compared to p53+/+ animals. In conclusion, in the spleen and colon, target gene transcription and apoptosis may be related to p53 genotype after DNA damage-induction. Moreover, our findings highlight the selectivity of p53 in transactivation following DNA damage in vivo, resulting in tissue-specific responses.

Family matters: sibling rivalry and bonding between p53 and p63 in cancer.

Science.gov (United States)

Romano, Rose-Anne; Sinha, Satrajit

2014-04-01

The p53 family (p53, p63 and p73) is intimately linked with an overwhelming number of cellular processes during normal physiological as well as pathological conditions including cancer. The fact that these proteins are expressed in myriad isoforms, each with unique biochemical properties and distinct effects on tumorigenesis, complicates their study. A case in point is Squamous Cell Carcinoma (SCC) where p53 is often mutated and the ΔNp63 isoform is overexpressed. Given that p53 and p63 can hetero-dimerize, bind to quite similar DNA elements and share common co-factors, any alterations in their individual expression levels, activity and/or mutation can severely disrupt the family equilibrium. The burgeoning genomics data sets and new additions to the experimental toolbox are offering crucial insights into the complex role of the p53 family in SCC, but more mechanistic studies are needed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

p53 tumor suppressor gene: significance in neoplasia - a review

International Nuclear Information System (INIS)

Alam, J.M.

2000-01-01

p53 is a tumor suppressor gene located on chromosome 17p13.1. Its function includes cell cycle control and apoptosis. Loss of p53 function, either due to decreased level or genetic transformation, is associated with loss of cell cycle control, decrease, apoptosis and genomic modification, such mutation of p53 gene is now assessed and the indicator of neoplasia of cancer of several organs and cell types, p53 has demonstrated to have critical role in defining various progressive stages of neoplasia, therapeutic strategies and clinical application. The present review briefly describes function of p53 in addition to its diagnostic and prognostic significance in detecting several types of neoplasia. (author)

1800MHz Microwave Induces p53 and p53-Mediated Caspase-3 Activation Leading to Cell Apoptosis In Vitro.

Directory of Open Access Journals (Sweden)

Fuqiang Xing

Full Text Available Recent studies have reported that exposure of mammalian cells to microwave radiation may have adverse effects such as induction of cell apoptosis. However, the molecular mechanisms underlying microwave induced mammalian cell apoptosis are not fully understood. Here, we report a novel mechanism: exposure to 1800MHz microwave radiation induces p53-dependent cell apoptosis through cytochrome c-mediated caspase-3 activation pathway. We first measured intensity of microwave radiation from several electronic devices with an irradiation detector. Mouse NIH/3T3 and human U-87 MG cells were then used as receivers of 1800MHz electromagnetic radiation (EMR at a power density of 1209 mW/m2. Following EMR exposure, cells were analyzed for viability, intracellular reactive oxygen species (ROS generation, DNA damage, p53 expression, and caspase-3 activity. Our analysis revealed that EMR exposure significantly decreased viability of NIH/3T3 and U-87 MG cells, and increased caspase-3 activity. ROS burst was observed at 6 h and 48 h in NIH/3T3 cells, while at 3 h in U-87 MG cells. Hoechst 33258 staining and in situ TUNEL assay detected that EMR exposure increased DNA damage, which was significantly restrained in the presence of N-acetyl-L-cysteine (NAC, an antioxidant. Moreover, EMR exposure increased the levels of p53 protein and p53 target gene expression, promoted cytochrome c release from mitochondrion, and increased caspase-3 activity. These events were inhibited by pretreatment with NAC, pifithrin-α (a p53 inhibitor and caspase inhibitor. Collectively, our findings demonstrate, for the first time, that 1800MHz EMR induces apoptosis-related events such as ROS burst and more oxidative DNA damage, which in turn promote p53-dependent caspase-3 activation through release of cytochrome c from mitochondrion. These findings thus provide new insights into physiological mechanisms underlying microwave-induced cell apoptosis.

The effects of combining ionizing radiation and adenoviral p53 therapy in nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Li Jianhua; Lax, Stuart A.; Kim, John; Klamut, Henry; Liu Feifei

1999-01-01

Purpose: Nasopharyngeal carcinoma (NPC) is a malignant disease of the head/neck region, with a 5-year survival level of approximately 65%. To explore gene therapy as a novel approach which might improve outcome, we have shown previously that introduction of human recombinant wild-type p53 mediated by the adenoviral vector (Ad5CMV-p53) was cytotoxic in two human nasopharyngeal carcinoma (NPC) cell lines (CNE-1 and CNE-2Z). The current work was designed to determine whether this strategy, combined with ionizing radiation (XRT), was more effective than either treatment alone. Methods and Materials: CNE-1, CNE-2Z, and a normal human nasopharyngeal fibroblast strain, KS1, were infected with 2- and 6-plaque-forming units (pfu)/cell of Ad5CMV-p53, respectively. These doses were iso-effective for β-galactosidase activity in the CNE-1 and CNE-2Z cells. XRT was administered 24 h post-infection, and Western blot analyses were conducted for p53, p21 WAF1/CIP1 , bax, and bcl-2 2 days after XRT. Cell survival was assessed using a clonogenic assay. Presence of DNA ladders reflecting apoptosis was detected using DNA agarose gel electrophoresis, and cell cycle was analyzed using flow cytometry. Results: The combination of Ad5CMV-p53 plus XRT (2, 4, and 6 Gy) resulted in an approximately 1-log greater level of cytotoxicity compared to that observed with XRT alone for both NPC cell lines. The two modalities appear to be interacting in a synergistic manner in cancer cells, but not in KS1 fibroblasts. XRT alone stimulated minimal p53 expression in control cells; Ad5CMV-p53 alone induced significant recombinant p53 expression, which was not further enhanced by the addition of XRT. Similar observations were made for p21 WAF1/CIP1 expression. No changes were observed for bax or bcl-2 expression with any of these treatments. Apoptosis was induced following 4 Gy of XRT alone, but was observed after only 2 Gy when combined with Ad5CMV-p53. Cell cycle analysis indicated that Ad5CMV-p53

POSTRANSLATIONAL MODIFICATIONS OF P53: UPSTREAM SIGNALING PATHWAYS.

Energy Technology Data Exchange (ETDEWEB)

ANDERSON,C.W.APPELLA,E.

2003-10-23

The p53 tumor suppressor is a tetrameric transcription factor that is posttranslational modified at >20 different sites by phosphorylation, acetylation, or sumoylation in response to various cellular stress conditions. Specific posttranslational modifications, or groups of modifications, that result from the activation of different stress-induced signaling pathways are thought to modulate p53 activity to regulate cell fate by inducing cell cycle arrest, apoptosis, or cellular senescence. Here we review recent progress in characterizing the upstream signaling pathways whose activation in response to various genotoxic and non-genotoxic stresses result in p53 posttranslational modifications.

Effect of hydroxyurea on the promoter occupancy profiles of tumor suppressor p53 and p73

Directory of Open Access Journals (Sweden)

Lu Xin

2009-06-01

Full Text Available Abstract Background The p53 tumor suppressor and its related protein, p73, share a homologous DNA binding domain, and mouse genetics studies have suggested that they have overlapping as well as distinct biological functions. Both p53 and p73 are activated by genotoxic stress to regulate an array of cellular responses. Previous studies have suggested that p53 and p73 independently activate the cellular apoptotic program in response to cytotoxic drugs. The goal of this study was to compare the promoter-binding activity of p53 and p73 at steady state and after genotoxic stress induced by hydroxyurea. Results We employed chromatin immunoprecipitation, the NimbleGen promoter arrays and a model-based algorithm for promoter arrays to identify promoter sequences enriched in anti-p53 or anti-p73 immunoprecipitates, either before or after treatment with hydroxyurea, which increased the expression of both p53 and p73 in the human colon cancer cell line HCT116-3(6. We calculated a model-based algorithm for promoter array score for each promoter and found a significant correlation between the promoter occupancy profiles of p53 and p73. We also found that after hydroxyurea treatment, the p53-bound promoters were still bound by p73, but p73 became associated with additional promoters that that did not bind p53. In particular, we showed that hydroxyurea induces the binding of p73 but not p53 to the promoter of MLH3, which encodes a mismatch repair protein, and causes an up-regulation of the MLH3 mRNA. Conclusion These results suggest that hydroxyurea exerts differential effects on the promoter-binding functions of p53 and p73 and illustrate the power of model-based algorithm for promoter array in the analyses of promoter occupancy profiles of highly homologous transcription factors.

The role of p53 molecule in radiation and hyperthermic therapies

International Nuclear Information System (INIS)

Yasumoto, Jun-ichi; Takahashi, Akihisa; Ohnishi, Ken; Ohnishi, Takeo

2003-01-01

In recent years, cancer-related genes have been analyzed at the molecular level as predictive indicators for cancer therapy. Among those genes, the tumor suppressor gene p53 is worthy of notice in cancer therapy, because the p53 molecule prevents the malignant degeneration of non-cancer cells by regulating cell-cycle arrest, apoptosis, and DNA repair. An abnormality of the p53 gene introduces a genetic instability and increases the incidence of carcinogenesis and teratogenesis. Therefore, p53 is called a guardian of the genome. Mutations of p53 are observed at a high frequency in human tumors, and are recognized in about half of all malignant tumors in human head and neck cancers. We previously reported that radio- and heat-sensitivities of human cultured tongue squamous cell carcinoma cells are p53-dependent, and are closely correlated with the induction of apoptosis. In a human cell culture system, the interactive hyperthermic enhancement of radiosensitivity was observed in wild-type p53 cells, but not in mutated p53 cells. In a transplanted tumor system, the combination therapies of radiation and hyperthermia induced efficient tumor growth depression and apoptosis in the wild-type p53 tumors. In this review, we discuss the p53 activation signaling pathways through the modification of p53 molecules, such as phosphorylation after radiation and hyperthermia treatments. (author)

The Contribution of Transactivation Subdomains 1 and 2 to p53-Induced Gene Expression Is Heterogeneous But Not Subdomain-Specific

Directory of Open Access Journals (Sweden)

Jennifer M. Smith

2007-12-01

Full Text Available Two adjacent regions within the transactivation domain of p53 are sufficient to support sequence-specific transactivation when fused to a heterologous DNA binding domain. It has been hypothesized that these two subdomains of p53 may contribute to the expression of distinct p53-responsive genes. Here we have used oligonucleotide microarrays to identify transcripts induced by variants of p53 with point mutations within subdomains 1, 2, or 1 and 2 (QS1, QS2, QS1/QS2, respectively. The expression of 254 transcripts was increased in response to wild-type p53 expression but most of these transcripts were poorly induced by these variants of p53. Strikingly, a number of known p53regulated transcripts including TNFRSF10B, BAX, BTG2, POLH were increased to wild-type levels by p53QS1 and p53QS2 but not p53QS1/QS2, indicating that either sub domain 1 or 2 is sufficient for p53-dependent expression of a small subset of p53-responsive genes. Unexpectedly, there was no evidence for p53QS1- or p53QS2-specific gene expression. Taken together, we found heterogeneity in the requirement for transactivation subdomains 1 and 2 of p53 without any subdomain-specific contribution to p53-induced gene expression.

Pigmentation, Melanocyte Colonization, and p53 Status in Basal Cell Carcinoma

International Nuclear Information System (INIS)

Frey, L. M.; Houben, R.; Brocker, E. B.

2011-01-01

Basal cell carcinoma (BCC) is the most common neoplasm in the Caucasian population. Only a fraction of BCC exhibits pigmentation. Lack of melanocyte colonization has been suggested to be due to p53-inactivating mutations in the BCC cells interfering with the p53-proopiomelanocortin pathway and the production of alpha melanocyte-stimulating hormone in the tumor. To evaluate this, we determined tumor pigmentation as well as expression of melan-A and of p53 in 49 BCC tissues by means of immunohistochemistry. As expected, we observed a positive relation between tumor pigmentation and melan-A positive intra-tumoral melanocytes. Melanocyte colonization and, to a lesser extent, p53 overexpression showed intraindividual heterogeneity in larger tumors. p53 overexpression, which is indicative of p53 mutations, was not correlated to melanocyte colonization of BCC. Sequencing of exon 5-8 of the p53 gene in selected BCC cases revealed that colonization by melanocytes and BCC pigmentation is neither ablated by p53 mutations nor generally present in BCCs with wild-type p53.

Therapeutic targeting of the p53 pathway in cancer stem cells

Science.gov (United States)

Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

2013-01-01

Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-07-15

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

Science.gov (United States)

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

Science.gov (United States)

Saha, Manujendra N; Jiang, Hua; Yang, Yijun; Zhu, Xiaoyun; Wang, Xiaoming; Schimmer, Aaron D; Qiu, Lugui; Chang, Hong

2012-01-01

The low frequency of p53 alterations e.g., mutations/deletions (∼10%) in multiple myeloma (MM) makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK) signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP) analysis showed that activated c-Jun binds to the activator protein-1 (AP-1) binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA) against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with JNK

Targeting p53 via JNK pathway: a novel role of RITA for apoptotic signaling in multiple myeloma.

Directory of Open Access Journals (Sweden)

Manujendra N Saha

Full Text Available The low frequency of p53 alterations e.g., mutations/deletions (∼10% in multiple myeloma (MM makes this tumor type an ideal candidate for p53-targeted therapies. RITA is a small molecule which can induce apoptosis in tumor cells by activating the p53 pathway. We previously showed that RITA strongly activates p53 while selectively inhibiting growth of MM cells without inducing genotoxicity, indicating its potential as a drug lead for p53-targeted therapy in MM. However, the molecular mechanisms underlying the pro-apoptotic effect of RITA are largely undefined. Gene expression analysis by microarray identified a significant number of differentially expressed genes associated with stress response including c-Jun N-terminal kinase (JNK signaling pathway. By Western blot analysis we further confirmed that RITA induced activation of p53 in conjunction with up-regulation of phosphorylated ASK-1, MKK-4 and c-Jun. These results suggest that RITA induced the activation of JNK signaling. Chromatin immunoprecipitation (ChIP analysis showed that activated c-Jun binds to the activator protein-1 (AP-1 binding site of the p53 promoter region. Disruption of the JNK signal pathway by small interfering RNA (siRNA against JNK or JNK specific inhibitor, SP-600125 inhibited the activation of p53 and attenuated apoptosis induced by RITA in myeloma cells carrying wild type p53. On the other hand, p53 transcriptional inhibitor, PFT-α or p53 siRNA not only inhibited the activation of p53 transcriptional targets but also blocked the activation of c-Jun suggesting the presence of a positive feedback loop between p53 and JNK. In addition, RITA in combination with dexamethasone, known as a JNK activator, displays synergistic cytotoxic responses in MM cell lines and patient samples. Our study unveils a previously undescribed mechanism of RITA-induced p53-mediated apoptosis through JNK signaling pathway and provides the rationale for combination of p53 activating drugs with

Paracrine Apoptotic Effect of p53 Mediated by Tumor Suppressor Par-4

Directory of Open Access Journals (Sweden)

Ravshan Burikhanov

2014-01-01

Full Text Available The guardian of the genome, p53, is often mutated in cancer and may contribute to therapeutic resistance. Given that p53 is intact and functional in normal tissues, we harnessed its potential to inhibit the growth of p53-deficient cancer cells. Specific activation of p53 in normal fibroblasts selectively induced apoptosis in p53-deficient cancer cells. This paracrine effect was mediated by p53-dependent secretion of the tumor suppressor Par-4. Accordingly, the activation of p53 in normal mice, but not p53−/− or Par-4−/− mice, caused systemic elevation of Par-4, which induced apoptosis of p53-deficient tumor cells. Mechanistically, p53 induced Par-4 secretion by suppressing the expression of its binding partner, UACA, which sequesters Par-4. Thus, normal cells can be empowered by p53 activation to induce Par-4 secretion for the inhibition of therapy-resistant tumors.

Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

OpenAIRE

Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

1992-01-01

Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-...

The expanding regulatory universe of p53 in gastrointestinal cancer [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Andrew Fesler

2016-04-01

Full Text Available Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs. Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

Pax3 stimulates p53 ubiquitination and degradation independent of transcription.

Directory of Open Access Journals (Sweden)

Xiao Dan Wang

Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.

p63 expression confers significantly better survival outcomes in high-risk diffuse large B-cell lymphoma and demonstrates p53-like and p53-independent tumor suppressor function

DEFF Research Database (Denmark)

Xu-Monette, Zijun Y; Zhang, Shanxiang; Li, Xin

2016-01-01

with a pan-p63-monoclonal antibody and correlated it with other clinicopathologic factors and clinical outcomes. p63 expression was observed in 42.5% of DLBCL, did not correlate with p53 levels, but correlated with p21, MDM2, p16INK4A, Ki-67, Bcl-6, IRF4/MUM-1 and CD30 expression, REL gains, and BCL6...... was likely due to the association of p63 expression with high-risk IPI, and potential presence of ∆Np63 isoform in TP63 rearranged patients (a mere speculation). Gene expression profiling suggested that p63 has both overlapping and distinct functions compared with p53, and that p63 and mutated p53 antagonize...

Translational Control Protein 80 Stimulates IRES-Mediated Translation of p53 mRNA in Response to DNA Damage

Directory of Open Access Journals (Sweden)

Marie-Jo Halaby

2015-01-01

Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.

The N-terminus of RPA large subunit and its spatial position are important for the 5'->3' resection of DNA double-strand breaks.

Science.gov (United States)

Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

2015-10-15

The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5' strand to generate 3' ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5'->3' directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3'->5' helicase activity and DNA2's 5'->3' ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

International Nuclear Information System (INIS)

Yi Fuming; Saha, Abhik; Murakami, Masanao; Kumar, Pankaj; Knight, Jason S.; Cai Qiliang; Choudhuri, Tathagata; Robertson, Erle S.

2009-01-01

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3C with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF Skp2 , cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53 -/- ) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.

p53-dependent non-coding RNA networks in chronic lymphocytic leukemia

NARCIS (Netherlands)

Blume, C. J.; Hotz-Wagenblatt, A.; Hüllein, J.; Sellner, L.; Jethwa, A.; Stolz, T.; Slabicki, M.; Lee, K.; Sharathchandra, A.; Benner, A.; Dietrich, S.; Oakes, C. C.; Dreger, P.; te Raa, D.; Kater, A. P.; Jauch, A.; Merkel, O.; Oren, M.; Hielscher, T.; Zenz, T.

2015-01-01

Mutations of the tumor suppressor p53 lead to chemotherapy resistance and a dismal prognosis in chronic lymphocytic leukemia (CLL). Whereas p53 targets are used to identify patient subgroups with impaired p53 function, a comprehensive assessment of non-coding RNA targets of p53 in CLL is missing. We

Thymocyte apoptosis induced by p53-dependent and independent pathways

International Nuclear Information System (INIS)

Clarke, A.R.; Purdie, C.A.; Harrison, D.J.; Morris, R.G.; Bird, C.C.; Hooper, M.L.; Wyllie, A.H.

1993-01-01

The authors studied the dependence of apoptosis on p53 expression in cells from the thymus cortex. Short-term thymocyte cultures were prepared from mice constitutively heterozygous or homozygous for a deletion in the p53 gene introduced into the germ line after gene targeting. Wild-type thymocytes readily undergo apoptosis after treatment with ionizing radiation, the glucocorticoid methylprednisolone, or etoposide (an inhibitor of topoisomerase II), or after Ca 2+ -dependent activation by phorbol ester and a calcium ionophore. In contrast, homozygous null p53 thymocytes are resistant to induction of apoptosis by radiation or etoposide, but retain normal sensitivity to glucocorticoid and calcium. The time-dependent apoptosis that occurs in untreated cultures is unaffected by p53 status. Cells heterozygous for p53 deletion are partially resistant to radiation and etoposide. Results show that p53 exerts a significant and dose-dependent effect in the initiation of apoptosis, but only when it is induced by agents that cause DNA-strand breakage. (Author)

Roles for the coat protein telokin-like domain and the scaffolding protein amino-terminus

Science.gov (United States)

Suhanovsky, Margaret M.; Teschke, Carolyn M.

2011-01-01

Assembly of icosahedral capsids of proper size and symmetry is not understood. Residue F170 in bacteriophage P22 coat protein is critical for conformational switching during assembly. Substitutions at this site cause assembly of tubes of hexamerically arranged coat protein. Intragenic suppressors of the ts phenotype of F170A and F170K coat protein mutants were isolated. Suppressors were repeatedly found in the coat protein telokin-like domain at position 285, which caused coat protein to assemble into petite procapsids and capsids. Petite capsid assembly strongly correlated to the side chain volume of the substituted amino acid. We hypothesize that larger side chains at position 285 torque the telokin-like domain, changing flexibility of the subunit and intercapsomer contacts. Thus, a single amino acid substitution in coat protein is sufficient to change capsid size. In addition, the products of assembly of the variant coat proteins were affected by the size of the internal scaffolding protein. PMID:21784500

Isoelectric focusing of dansylated amino acids in immobilized pH gradients

Science.gov (United States)

Bianchi-Bosisio, Adriana; Righetti, Pier Giorgio; Egen, Ned B.; Bier, Milan

1986-01-01

The 21 free amino acids commonly encountered in proteins have been transformed into 'carrier ampholyte' species by reacting their primary amino groups with dansyl chloride. These derivatives can thus be focused in an immobilized pH gradient covering the pH interval 3.1 to 4.1, except for arginine, which still retains a pI of 8.8. Due to their inherent fluorescence, the dansyl derivatives are revealed in UV light, with a sensitivity of the order of 2-4 ng/sq mm. All nearest neighbors are separated except for the following couples: Asn-Gln, Gly-Thr, Val-Ile and Cys-Cys2, with a resolving power, in a Delta(pI) scale, of the order of 0.0018 pH units. Except for a few cases (notably the aromatic amino acids), the order of pI values is well correlated with the pK values of carboxyl groups, suggesting that the latter are not altered by dansylation. From the set of pK(COOH)-pI values of the different amino acids, the pK of the tertiary amino group in the dansyl label has been calculated to be 5.11 + or - 0.06. Knowing the pK of the amino-dansyl and the pI of the excess, free dansyl label (pI = 3.34), a pK of 1.57 is derived for its sulfonic acid group.

Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

Science.gov (United States)

Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

2015-10-01

The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

Retromer associates with the cytoplasmic amino-terminus of polycystin-2.

Science.gov (United States)

Tilley, Frances C; Gallon, Matthew; Luo, Chong; Danson, Chris M; Zhou, Jing; Cullen, Peter J

2018-05-03

Autosomal dominant polycystic kidney disease (ADPKD) is the most common monogenic human disease, with around 12.5 million people affected worldwide. ADPKD results from mutations in either PKD1 or PKD2 , which encode the atypical G-protein coupled receptor polycystin-1 (PC1) and the transient receptor potential channel polycystin-2 (PC2) respectively. Although altered intracellular trafficking of PC1 and PC2 appear as an underlying feature of ADPKD, the mechanisms which govern vesicular transport of the polycystins through the biosynthetic and endosomal membrane networks remain to be fully elucidated. Here, we describe an interaction between PC2 and retromer, a master controller for the sorting of integral membrane proteins through the endo-lysosomal network. We show that association of PC2 with retromer occurs via a region in the PC2 cytoplasmic amino-terminal domain, independently of the retromer-binding Wiskott-Aldrich syndrome and scar homologue (WASH) complex. Based on observations that retromer preferentially interacts with a trafficking population of PC2, and that ciliary levels of PC1 are reduced upon mutation of key residues required for retromer-association in PC2, our data is consistent with the identification of PC2 as a retromer cargo protein. © 2018. Published by The Company of Biologists Ltd.

HEXIM1, a New Player in the p53 Pathway

Energy Technology Data Exchange (ETDEWEB)

Lew, Qiao Jing; Chu, Kai Ling; Chia, Yi Ling; Cheong, Nge [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Chao, Sheng-Hao, E-mail: jimmy_chao@bti.a-star.edu.sg [Expression Engineering Group, Bioprocessing Technology Institute, A*STAR (Agency for Science, Technology and Research), 20 Biopolis Way, #06-01, Singapore 138668 (Singapore); Department of Microbiology, National University of Singapore, Singapore 117597 (Singapore)

2013-07-04

Hexamethylene bisacetamide-inducible protein 1 (HEXIM1) is best known as the inhibitor of positive transcription elongation factor b (P-TEFb), which controls transcription elongation of RNA polymerase II and Tat transactivation of human immunodeficiency virus. Besides P-TEFb, several proteins have been identified as HEXIM1 binding proteins. It is noteworthy that more than half of the HEXIM1 binding partners are involved in cancers. P53 and two key regulators of the p53 pathway, nucleophosmin (NPM) and human double minute-2 protein (HDM2), are among the factors identified. This review will focus on the functional importance of the interactions between HEXIM1 and p53/NPM/HDM2. NPM and the cytoplasmic mutant of NPM, NPMc+, were found to regulate P-TEFb activity and RNA polymerase II transcription through the interaction with HEXIM1. Importantly, more than one-third of acute myeloid leukemia (AML) patients carry NPMc+, suggesting the involvement of HEXIM1 in tumorigenesis of AML. HDM2 was found to ubiquitinate HEXIM1. The HDM2-mediated ubiquitination of HEXIM1 did not lead to protein degradation of HEXIM1 but enhanced its inhibitory activity on P-TEFb. Recently, HEXIM1 was identified as a novel positive regulator of p53. HEXIM1 prevented p53 ubiquitination by competing with HDM2 in binding to p53. Taken together, the new evidence suggests a role of HEXIM1 in regulating the p53 pathway and tumorigenesis.

Regulation of Mdmx and its role in the p53 pathway

NARCIS (Netherlands)

Meulmeester, Erik

2006-01-01

The p53 protein is an important tumor suppressor that acts as a key regulator of the integrity of the genome. Two essential regulators of the p53 protein are Mdm2 and its homologue Mdmx. Like Mdm2, Mdmx represses p53-induced transcription. However, Mdmx cannot ubiquitinate or degrade p53 opposed to

p53 expression in biopsies from children with Langerhans cell histiocytosis

DEFF Research Database (Denmark)

Bank, Micha I; Lundegaard, Pia Rengtved; Carstensen, Henrik

2002-01-01

based on CD1a positivity. The slides were stained with p53 antibody and semiquantitatively evaluated using a grading system from 1 to 5 as an estimate for 0% to 20%, 20% to 40%, 40% to 60%, 60% to 80%, and 80% to 100% p53-positive for pathologic Langerhans cells (pLC), respectively. RESULTS: The p53...... protein was expressed in various degrees in pLC in all lesions. The degree of p53 expression could not be correlated to either clinical manifestation or outcome. CONCLUSIONS: An increased expression of p53 in pLC indicates an altered DNA repair control with or without abnormal control of apoptosis....

Morphological Heterogeneity of p53 Positive and p53 Negative Nuclei in Breast Cancers Stratified by Clinicopathological Variables

Directory of Open Access Journals (Sweden)

Katrin Friedrich

1997-01-01

Full Text Available The study was aimed to detect differences in nuclear morphology between nuclear populations as well as between tumours with different p53 expression in breast cancers with different clinicopathological features, which also reflect the stage of tumour progression. The p53 immunohistochemistry was performed on paraffin sections from 88 tumour samples. After the cells had been localised by means of an image cytometry workstation and their immunostaining had been categorised visually, the sections were destained and stained by the Feulgen protocol. The nuclei were relocated and measured cytometrically by the workstation.

Mutual interactions between P53 and growth factors in cancer

NARCIS (Netherlands)

Asschert, JGW; Vellenga, E; De Jong, S; De Vries, EGE

1998-01-01

The function of p53 armour suppressor protein is determined by various intrinsic properties of the protein. The effect of p53 DNA-binding, and platein-protein interactions are determined by the conformation of the protein. Thus p53 fulfils its role in cell cycle control and the onset of apoptotic

Restriction of human herpesvirus 6B replication by p53

DEFF Research Database (Denmark)

Øster, Bodil; Kofod-Olsen, Emil; Bundgaard, Bettina

2008-01-01

Human herpesvirus 6B (HHV-6B) induces significant accumulation of p53 in both the nucleus and cytoplasm during infection. Activation of p53 by DNA damage is known to induce either growth arrest or apoptosis; nevertheless, HHV-6B-infected cells are arrested in their cell cycle independently of p53...

Ribosomal protein-Mdm2-p53 pathway coordinates nutrient stress with lipid metabolism by regulating MCD and promoting fatty acid oxidation.

Science.gov (United States)

Liu, Yong; He, Yizhou; Jin, Aiwen; Tikunov, Andrey P; Zhou, Lishi; Tollini, Laura A; Leslie, Patrick; Kim, Tae-Hyung; Li, Lei O; Coleman, Rosalind A; Gu, Zhennan; Chen, Yong Q; Macdonald, Jeffrey M; Graves, Lee M; Zhang, Yanping

2014-06-10

The tumor suppressor p53 has recently been shown to regulate energy metabolism through multiple mechanisms. However, the in vivo signaling pathways related to p53-mediated metabolic regulation remain largely uncharacterized. By using mice bearing a single amino acid substitution at cysteine residue 305 of mouse double minute 2 (Mdm2(C305F)), which renders Mdm2 deficient in binding ribosomal proteins (RPs) RPL11 and RPL5, we show that the RP-Mdm2-p53 signaling pathway is critical for sensing nutrient deprivation and maintaining liver lipid homeostasis. Although the Mdm2(C305F) mutation does not significantly affect growth and development in mice, this mutation promotes fat accumulation under normal feeding conditions and hepatosteatosis under acute fasting conditions. We show that nutrient deprivation inhibits rRNA biosynthesis, increases RP-Mdm2 interaction, and induces p53-mediated transactivation of malonyl-CoA decarboxylase (MCD), which catalyzes the degradation of malonyl-CoA to acetyl-CoA, thus modulating lipid partitioning. Fasted Mdm2(C305F) mice demonstrate attenuated MCD induction and enhanced malonyl-CoA accumulation in addition to decreased oxidative respiration and increased fatty acid accumulation in the liver. Thus, the RP-Mdm2-p53 pathway appears to function as an endogenous sensor responsible for stimulating fatty acid oxidation in response to nutrient depletion.

Identification of functionally important amino acid residues in the mitochondria targeting sequence of Hepatitis B virus X protein

International Nuclear Information System (INIS)

Li, Sai Kam; Ho, Sai Fan; Tsui, Kwok Wing; Fung, Kwok Pui; Waye, M.Y. Mary

2008-01-01

Chronic hepatitis B virus (HBV) infection has been strongly associated with hepatocellular carcinoma (HCC) and the X protein (HBx) is thought to mediate the cellular changes associated with carcinogenesis. Recently, isolation of the hepatitis B virus integrants from HCC tissue by others have established the fact that the X gene is often truncated at its C-terminus. Expression of the GFP fusion proteins of HBx and its truncation mutants with a GFP tag in human liver cell-lines in this study revealed that the C-terminus of HBx is indispensable for its specific localization in the mitochondria. A crucial region of seven amino acids at the C-terminus has been mapped out in which the cysteine residue at position 115 serves as the most important residue for the subcellular localization. When cysteine 115 of HBx is mutated to alanine the mitochondria targeting property of HBx is abrogated

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

Science.gov (United States)

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.

Directory of Open Access Journals (Sweden)

Mariell Pettersson

Full Text Available The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2 via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.

Complete amino acid sequence of a Lolium perenne (perennial rye grass) pollen allergen, Lol p II.

Science.gov (United States)

Ansari, A A; Shenbagamurthi, P; Marsh, D G

1989-07-05

The complete amino acid sequence of a Lolium perenne (rye grass) pollen allergen, Lol p II was determined by automated Edman degradation of the protein and selected fragments. Cleavage of the protein by enzymatic and chemical techniques established an unambiguous sequence for the protein. Lol p II contains 97 amino acid residues, with a calculated molecular weight of 10,882. The protein lacks cysteine and glutamine and shows no evidence of glycosylation. Theoretical predictions by Fraga's (Fraga, S. (1982) Can. J. Chem. 60, 2606-2610) and Hopp and Woods' (Hopp, T. P., and Woods, K. R. (1981) Proc. Natl. Acad. Sci. U.S.A. 78, 3824-3828) methods indicate the presence of four hydrophilic regions, which may contribute to sequential or parts of conformational B-cell epitopes. Analysis of amphipathic regions by Berzofsky's method indicates the presence of a highly amphipathic region, which may contain, or contribute to, an Ia/T-cell epitope. This latter segment of Lol p II was found to be highly homologous with an antibody-binding segment of the major rye allergen Lol p I and may explain why immune responsiveness to both the allergens is associated with HLA-DR3.

C-terminus of the P4-ATPase ATP8A2 functions in protein folding and regulation of phospholipid flippase activity.

Science.gov (United States)

Chalat, Madhavan; Moleschi, Kody; Molday, Robert S

2017-02-01

ATP8A2 is a P4-ATPase that flips phosphatidylserine and phosphatidylethanolamine across cell membranes. This generates membrane phospholipid asymmetry, a property important in many cellular processes, including vesicle trafficking. ATP8A2 deficiency causes severe neurodegenerative diseases. We investigated the role of the C-terminus of ATP8A2 in its expression, subcellular localization, interaction with its subunit CDC50A, and function as a phosphatidylserine flippase. C-terminal deletion mutants exhibited a reduced tendency to solubilize in mild detergent and exit the endoplasmic reticulum. The solubilized protein, however, assembled with CDC50A and displayed phosphatidylserine flippase activity. Deletion of the C-terminal 33 residues resulted in reduced phosphatidylserine-dependent ATPase activity, phosphatidylserine flippase activity, and neurite extension in PC12 cells. These reduced activities were reversed with 60- and 80-residue C-terminal deletions. Unlike the yeast P4-ATPase Drs2, ATP8A2 is not regulated by phosphoinositides but undergoes phosphorylation on the serine residue within a CaMKII target motif. We propose a model in which the C-terminus of ATP8A2 consists of an autoinhibitor domain upstream of the C-terminal 33 residues and an anti-autoinhibitor domain at the extreme C-terminus. The latter blocks the inhibitory activity of the autoinhibitor domain. We conclude that the C-terminus plays an important role in the efficient folding and regulation of ATP8A2. © 2017 Chalat et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Structural Characterization of the Loop at the Alpha-Subunit C-Terminus of the Mixed Lineage Leukemia Protein Activating Protease Taspase1.

Directory of Open Access Journals (Sweden)

Johannes van den Boom

Full Text Available Type 2 asparaginases, a subfamily of N-terminal nucleophile (Ntn hydrolases, are activated by limited proteolysis. This activation yields a heterodimer and a loop region at the C-terminus of the α-subunit is released. Since this region is unresolved in all type 2 asparaginase crystal structures but is close to the active site residues, we explored this loop region in six members of the type 2 asparaginase family using homology modeling. As the loop model for the childhood cancer-relevant protease Taspase1 differed from the other members, Taspase1 activation as well as the conformation and dynamics of the 56 amino acids loop were investigated by CD and NMR spectroscopy. We propose a helix-turn-helix motif, which can be exploited as novel anticancer target to inhibit Taspase1 proteolytic activity.

THE EXON 5, 6, 7, 8 OF P53 MUTATIONS IN ORAL SQUAMOUS CELLS CARCINOMA

Directory of Open Access Journals (Sweden)

Retno P Rahayu

2012-04-01

Full Text Available Genetic instability may underlie the etiology of multistep carcinogenesis. The altered p53 gene observed in tumors may represent the expression of such instability and may allow the accumulation of other gene alterations caused by multiple mechanism. p53 gene is the guardian of the genome, that is why we pay more attention to this gene. In this study, we evaluated the significance of p53 mutation in 55 patient with oral squamous carcinoma. Thirty among them underwent well-differentiated carcinoma, while the remaining 25 patients underwent poorly differentiated carcinoma. The mutations were detected by PCR-SSCP (Single strand Conformational Polymorphism analysis in the region between exon 5 and exon 8. The results indicated that the p53 mutation in exon 5 (40%, exon 6 (28%, exon 7 (24% and exon 8 (8% were associated with poorly differentiated carcinoma, whereas mutation in exon 5 (10%, exon 6 (30%, exon 7 (40% and exon 8 (20% were associated with well-differentiated carcinoma. These observations suggest that p53 mutation in exon 5, 6, and 7 have strong correlation with poorly differentiated in oral squamous carcinoma while well-differentiated level was related with mutation in exon 6,7 and 8.

Mutations in the p53 homolog p63: allele-specific developmental syndromes in humans.

NARCIS (Netherlands)

Bokhoven, J.H.L.M. van; McKeon, F.

2002-01-01

p63 is the most recently discovered but most ancient member of the p53 family. In marked contrast to p53, p63 is highly expressed in embryonic ectoderm and in the basal, regenerative layers of many epithelial tissues in the adult. The p63-knockout mouse dies at birth and lacks limbs, epidermis,

Cisplatinum and Taxol Induce Different Patterns of p53 Phosphorylation

Directory of Open Access Journals (Sweden)

Giovanna Damia

2001-01-01

Full Text Available Posttranslational modifications of p53 induced by two widely used anticancer agents, cisplatinum (DDP and taxol were investigated in two human cancer cell lines. Although both drugs were able to induce phosphorylation at serine 20 (Ser20, only DDP treatment induced p53 phosphorylation at serine 15 (Ser15. Moreover, both drug treatments were able to increase p53 levels and consequently the transcription of waf1 and mdm-2 genes, although DDP treatment resulted in a stronger inducer of both genes. Using two ataxia telangiectasia mutated (ATM cell lines, the role of ATM in druginduced p53 phosphorylations was investigated. No differences in drug-induced p53 phosphorylation could be observed, indicating that ATM is not the kinase involved in these phosphorylation events. In addition, inhibition of DNA-dependent protein kinase activity by wortmannin did not abolish p53 phosphorylation at Ser15 and Ser20, again indicating that DNA-PK is unlikely to be the kinase involved. After both taxol and DDP treatments, an activation of hCHK2 was found and this is likely to be responsible for phosphorylation at Ser20. In contrast, only DDP was able to activate ATR, which is the candidate kinase for phosphorylation of Ser15 by this drug. This data clearly suggests that differential mechanisms are involved in phosphorylation and activation of p53 depending on the drug type.

The pro-survival function of p53 in HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Kim, Jin Kyu; Kang, Mi Young; Jang, Eun Yeong; Kim, Jin Hong [Korea Atomic Energy Research Institute, Advanced Radiation Technology Institute, Jeongeup (Korea, Republic of)

2014-11-15

The rate of apoptosis and autophagy was variable with different p53 status after IR treatment of cells. The influence of p53 status on cell fate suggests a role of p53 in two fundamentally important cell biological pathways: autophagy and apoptosis. p53 coordinates cell cycle arrest and apoptosis to govern cell fate. This study was done to identify p53-mediated regulation of cell's fate. Autophagy induced by IR may prevent cells from undergoing apoptosis, implying an interlink modulation between autophagy and apoptosis. The rate of apoptosis and autophagy was determined with different p53 status after IR treatment of HeLa cells in this study. Our research on IR-induced cellular responses may provide new information about fate decision between the processes of apoptosis and autophagy.

Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

Directory of Open Access Journals (Sweden)

Iva Simeonova

2013-06-01

Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

P53 expression in prostatic cancer: an immunohistochemical study

International Nuclear Information System (INIS)

Al-Nuaimy, W.M.; Al-Allaf, L.I.; Alnaimi, H.A.

2011-01-01

Prostate cancer is the most common malignancy in men and second leading cause of cancer death in the Western world. P53 alterations are the most frequent genetic changes in human cancers. Mutation of the p53 gene has been implicated in the development of >50% of all human cancer. The current study aims at evaluating the immuno-histochemical expression of p53 protein in patients with cancer of prostate, as prognostic parameter in correlation with other parameters including PSA receptors, and to correlate the results with those of other studies. (authors).

A Reduced Risk of Infection with Plasmodium vivax and Clinical Protection against Malaria Are Associated with Antibodies against the N Terminus but Not the C Terminus of Merozoite Surface Protein 1†

Science.gov (United States)

Nogueira, Paulo Afonso; Piovesan Alves, Fabiana; Fernandez-Becerra, Carmen; Pein, Oliver; Rodrigues Santos, Neida; Pereira da Silva, Luiz Hildebrando; Plessman Camargo, Erney; del Portillo, Hernando A.

2006-01-01

Progress towards the development of a malaria vaccine against Plasmodium vivax, the most widely distributed human malaria parasite, will require a better understanding of the immune responses that confer clinical protection to patients in regions where malaria is endemic. The occurrence of clinical protection in P. vivax malaria in Brazil was first reported among residents of the riverine community of Portuchuelo, in Rondônia, western Amazon. We thus analyzed immune sera from this same human population to determine if naturally acquired humoral immune responses against the merozoite surface protein 1 of P. vivax, PvMSP1, could be associated with reduced risk of infection and/or clinical protection. Our results demonstrated that this association could be established with anti-PvMSP1 antibodies predominantly of the immunoglobulin G3 subclass directed against the N terminus but not against the C terminus, in spite of the latter being more immunogenic and capable of natural boosting. This is the first report of a prospective study of P. vivax malaria demonstrating an association of reduced risk of infection and clinical protection with antibodies against an antigen of this parasite. PMID:16622209

The critical role of catalase in prooxidant and antioxidant function of p53

Science.gov (United States)

Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

2013-01-01

The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

A synthetic interaction screen identifies factors selectively required for proliferation and TERT transcription in p53-deficient human cancer cells.

Directory of Open Access Journals (Sweden)

Li Xie

Full Text Available Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi-based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53- human cancer cells. We find that compared to p53-competent (p53+ human cancer cell lines, diverse p53- human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53- cells, RNAi-mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53- but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53- cancer cells.

Mathematical Modeling of E6-p53 interactions in Cervical Cancer

Science.gov (United States)

Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

2017-04-01

Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License