WorldWideScience

Sample records for p40 nosilen nycoline

  1. Rock bream (Oplegnathus fasciatus) IL-12p40: identification, expression, and effect on bacterial infection.

    Science.gov (United States)

    Zhang, Lu; Zhang, Bao-Cun; Hu, Yong-Hua

    2014-08-01

    IL-12p40, also called IL-12β, is a subunit of the proinflammatory cytokines interleukin (IL)-12 and IL-23. In teleost, IL-12p40 homologues have been identified in several species, however, the biological function of fish IL-12p40 is essentially unknown. In this work, we reported the identification and analysis of an IL-12p40, OfIL-12p40, from rock bream (Oplegnathus fasciatus). OfIL-12p40 is composed of 361 amino acids and possesses a conserved IL-12p40 domain and a WSxWS signature motif characteristic of known IL-12p40. Constitutive expression of OfIL-12p40 occurred in multiple tissues and was highest in kidney. Experimental infection with bacterial pathogen upregulated the expression of OfIL-12p40 in kidney and spleen in a time-dependent manner. Purified recombinant OfIL-12p40 (rOfIL-12p40) stimulated the respiratory burst activity of peripheral blood leukocytes in a dose-dependent manner. rOfIL-12p40 also enhanced the resistance of rock bream against bacterial infection and upregulated the expression of innate immune genes in kidney. Taken together, these results indicate that OfIL-12p40 possesses cytokine-like property and plays a role in immune defense against bacterial infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Inflammation and elevation of interleukin-12p40 in patients with schizophrenia

    Directory of Open Access Journals (Sweden)

    Nora eBedrossian

    2016-03-01

    Full Text Available Schizophrenia is a serious mental illness with chronic symptoms and significant impairment in psychosocial functioning, which suggests that it likely has neurodegenerative characteristics. Inflammatory markers such as pro-inflammatory cytokines are well-known etiological contributors for psychiatric disorders, including schizophrenia. Although the role of inflammation in schizophrenia is becoming evident, the number of studies in this area is relatively scarce, especially in Lebanon, and increased procedural thoroughness is needed. Cytokines play a key role in the activation of the immune system and strongly influence neurotransmission. Previous investigation of plasma levels showed dysregulation of interleukin (IL-12. However, genotypical variations of this interleukin have not been investigated for patients with schizophrenia yet. Thus, in this paper, we aimed to compute and assess IL-12p40 levels in the sera of individuals with schizophrenia from different provinces in Lebanon and compare it to controls. Healthy subjects comprised 60 individuals with a male/female (M/F ratio of 31/29, whereas patients with schizophrenia consisted of 63 subjects with an M/F ratio of 30/33. The mean age for healthy controls was 30 years, whereas that for patients with schizophrenia was 35 years. A standardized ELISA technique was used to measure the concentration of IL-12p40 in all collected sera (n=123. The mean IL-12p40 levels in patients with schizophrenia were significantly higher than in healthy controls (p=0.002. Healthy females had a significantly higher concentration of IL-12p40 than healthy males (p=0.009. Female patients with schizophrenia had significantly higher concentrations of IL-12p40 than their male counterparts (p<0.001, healthy females (p=0.018 and healthy males (p<0.001, respectively. Male patients with schizophrenia had significantly higher concentrations of IL-12p40 than healthy males (p=0.023. The study’s results suggest that IL-12p40

  3. Quantitative evaluation of interleukin-12 p40 gene expression in peripheral blood mononuclear cells.

    Science.gov (United States)

    Conte, Enrico; Nigro, Luciano; Fagone, Evelina; Drago, Francesco; Cacopardo, Bruno

    2008-01-01

    The heterodimeric cytokine IL-12 (composed of a p35 and a p40 subunit) is produced primarily by monocytes, macrophages and B cells. In vitro and in vivo experiments have demonstrated the crucial role of IL-12 in initiating and establishing both innate immunity and T cell-mediated resistance to intracellular pathogens, including Leishmania donovani, Toxoplasma gondii, Listeria monocytogenes, and Mycobacterium tuberculosis. Assessment of cytokine expression has thus become crucial to understand host responses to infections. In this study, by using the reverse transcriptase-real time PCR we developed a highly specific and sensitive assay to quantitatively evaluate IL-12p40 mRNA transcription levels in peripheral blood mononuclear cells (PBMCs) stimulated with PHA vs. unstimulated cells. We also used the ELISA to evaluate bioactive IL-12 release in culture supernatants. We provide evidence that IL-12 p40 mRNA levels were significantly up-regulated in PHA-activated PBMCs. These results were correlated with data of IL-12 levels obtained by ELISA.

  4. Characterization of a monoclonal antibody (P40) against the 68 kD major allergen of Penicillium notatum.

    Science.gov (United States)

    Shen, H D; Choo, K B; Chen, J H; Lin, W L; Chang, Z N; Han, S H

    1992-04-01

    A monoclonal antibody (MoAb P40) against the 68 kD major allergen of Penicillium notatum (P. notatum) was obtained by immunizing the mouse with a crude extract of P. notatum. Analysed by two-dimensional gel electrophoresis and immunoblotting, P40 reacted with two different isoforms of the 68 kD component of P. notatum with pIs of 5.4 and 5.5. In addition to P. notatum, P40 showed positive ELISA activity to Aspergillus fumigatus (A. fumigatus) but not to components of six other fungi including Alternaria porri, Cladosporium cladosporoides, Aureobasidium pullulans, Fusarium solani, Rhizopus arrhizus and Candida albicans. Analysed by ELISA, MoAb P40 also showed positive activity to two (P. frequentans and P. roseopurpureum) of the 10 other Penicillium species and two (A. terreus and A. flavus) of the four other Aspergillus species tested. SDS-PAGE and immunoblotting studies demonstrated P40 positive reactivity to components with MW of about 67 kD in all these Penicillium and Aspergillus species with positive ELISA activity to P40. Furthermore, immunoblotting activity of MoAb P40 to the 67 kD component of A. niger was also observed. The epitope of the 68 kD allergen of P. notatum recognized by MoAb P40 was resistant to treatment of periodate oxidation with concentration of NaIO4 up to 20 mM. This MoAb may thus be useful in the characterization and purification of the 68 kD allergen from crude extracts, and in the molecular cloning of allergen genes.

  5. Reduced cerebrospinal fluid concentration of interleukin-12/23 subunit p40 in patients with cognitive impairment.

    Directory of Open Access Journals (Sweden)

    Per Johansson

    Full Text Available The role of inflammation in Alzheimer's disease (AD and other cognitive disorders is unclear. In a well-defined mono-center population, we measured cytokines and chemokines in paired serum and cerebrospinal fluid (CSF samples.Consecutive patients with AD (n = 30, stable mild cognitive impairment (SMCI, n = 11, other dementias (n = 11, and healthy controls (n = 18 were included. None of the subjects was treated with glucocorticoids, cholinesterase inhibitors, or non-steroidal anti-inflammatory drugs. Serum and CSF concentrations of interleukin-6 (IL-6, IL-8, IL-12/23 p40, IL-15, IL-16, vascular endothelial growth factor-A (VEGF-A, and three chemokines were measured using a multiplex panel.After correction for multiple comparisons, only CSF IL-12/23 p40 concentration differed significantly between the total patient group (n = 52 and controls (n = 18; p = 0.002. Further analyses showed that CSF IL-12/23 p40 concentration was decreased in all patient subgroups (AD, other dementias, and SMCI compared to healthy controls (p < 0.01, p < 0.05, and p < 0.05, respectively. In the total study population (n = 70, CSF IL-12/23 p40 concentrations correlated positively with CSF concentrations of β-amyloid1-42 (Aβ1-42 and phosphorylated tau protein (P-tau whereas in AD patients (n = 30, CSF IL-12/23 p40 only correlated positively with CSF P-Tau (r = 0.46, p = 0.01.Most cytokines and chemokines were similar in patients and controls, but CSF IL-12/23 subunit p40 concentration was decreased in patients with cognitive impairment, and correlated with markers of AD disease status. Further studies are needed to evaluate the role of CSF IL-12/23 p40 in other dementias and SMCI.

  6. Psoriasis is not associated with IL-12p70/IL-12p40 production and IL12B promoter polymorphism

    DEFF Research Database (Denmark)

    Litjens, Nicolle H R; van der Plas, Mariena J A; Ravensbergen, Bep

    2004-01-01

    Psoriasis is a type-1 T cell-mediated, chronic inflammatory disease. Since interleukin (IL)-12p70 promotes the development of type-1 T cells, we investigated whether psoriasis is associated with an increased production of this cyctokine by blood cells. Results revealed that the production of IL-12p....... The frequencies of the various genotypes for the promoter region of the gene encoding IL-12p40 (IL12B) did not differ between psoriasis patients and controls. No association was observed between the various IL12B promoter genotypes and the LPS-stimulated production of IL-12p70 or IL-12p40 by blood cells. Together......, psoriasis is not associated with a promoter polymorphism in the IL12B gene nor with the production of IL-12p70 by LPS-stimulated blood cells....

  7. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events

    DEFF Research Database (Denmark)

    Jackers, P; Clausse, N; Fernandez, M

    1996-01-01

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed...

  8. A lactobacillus rhamnosus GG-derived soluble protein, p40, stimulates ligand release from intestinal epithelial cells to transactivate epidermal growth factor receptor

    Science.gov (United States)

    Protein p40, a Lactobacillus rhamnosus GG (LGG)-derived soluble protein, ameliorates intestinal injury and colitis, reduces apoptosis and preserves barrier function by activation of EGF receptor (EGFR) in intestinal epithelial cells. The aim of this study was to determine the mechanisms by which p40...

  9. Cerebrospinal fluid IL-12p40, CXCL13 and IL-8 as a combinatorial biomarker of active intrathecal inflammation.

    Directory of Open Access Journals (Sweden)

    Bibiana Bielekova

    Full Text Available Diagnosis and management of the neuroinflammatory diseases of the central nervous system (CNS are hindered by the lack of reliable biomarkers of active intrathecal inflammation. We hypothesized that measuring several putative inflammatory biomarkers simultaneously will augment specificity and sensitivity of the biomarker to the clinically useful range. Based on our pilot experiment in which we measured 18 inflammatory biomarkers in 10-fold concentrated cerebrospinal fluid (CSF derived from 16 untreated patients with highly active multiple sclerosis (MS we selected a combination of three CSF biomarkers, IL-12p40, CXCL13 and IL-8, for further validation.Concentrations of IL-12p40, CXCL13 and IL-8 were determined in a blinded fashion in CSF samples from an initial cohort (n = 72 and a confirmatory cohort (n = 167 of prospectively collected, untreated subjects presenting for a diagnostic work-up of possible neuroimmunological disorder. Diagnostic conclusion was based on a thorough clinical workup, which included laboratory assessment of the blood and CSF, neuroimaging and longitudinal follow-up. Receiver operating characteristic (ROC curve analysis in conjunction with principal component analysis (PCA, which was used to combine information from all three biomarkers, assessed the diagnostic value of measured biomarkers.Each of the three biomarkers was significantly increased in MS and other inflammatory neurological disease (OIND in comparison to non-inflammatory neurological disorder patients (NIND at least in one cohort. However, considering all three biomarkers together improved accuracy of predicting the presence of intrathecal inflammation to the consistently good to excellent range (area under the ROC curve = 0.868-0.924.Future clinical studies will determine if a combinatorial biomarker consisting of CSF IL-12p40, CXCL13 and IL-8 provides utility in determining the presence of active intrathecal inflammation in diagnostically

  10. P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae

    Directory of Open Access Journals (Sweden)

    Michael Widjaja

    2015-12-01

    Full Text Available Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i provides cell polarity, (ii directs adherence to receptors presented on respiratory epithelium, and (iii plays a major role in cell motility. The major adhesins, P1 (Mpn141 and P30 (Mpn453, are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28 during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457 generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30.

  11. P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae

    Science.gov (United States)

    Widjaja, Michael; Berry, Iain J.; Pont, Elsa J.; Padula, Matthew P.; Djordjevic, Steven P.

    2015-01-01

    Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i) provides cell polarity, (ii) directs adherence to receptors presented on respiratory epithelium, and (iii) plays a major role in cell motility. The major adhesins, P1 (Mpn141) and P30 (Mpn453), are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28) during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457) generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS) analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30. PMID:28248283

  12. The secreted form of the p40 subunit of interleukin (IL)-12 inhibits IL-23 functions and abrogates IL-23-mediated antitumour effects

    Science.gov (United States)

    Shimozato, Osamu; Ugai, Shin-ichi; Chiyo, Masako; Takenobu, Hisanori; Nagakawa, Hiroyasu; Wada, Akihiko; Kawamura, Kiyoko; Yamamoto, Hiroshi; Tagawa, Masatoshi

    2006-01-01

    Interleukin (IL)-23 is a heterodimeric cytokine consisting of a novel p19 molecule and the p40 subunit of IL-12. Since secreted p40 can act as an antagonist for IL-12, we investigated whether p40 also inhibited IL-23-mediated immunological functions. p40 did not induce interferon (IFN)-γ or IL-17 production from splenocytes but impaired IL-23-induced cytokine production by competitive binding to the IL-23 receptors. Furthermore, a mixed population of murine colon carcinoma Colon 26 cells transduced with the p40 gene and those transduced with the IL-23 gene developed tumours in syngenic mice, whereas the IL-23-expressing Colon 26 cells were completely rejected. p40 also suppressed IFN-γ production of antigen-stimulated splenocytes and IL-23-mediated cytotoxic T-lymphocyte activities in the mice that rejected Colon 26 cells expressing IL-23. p40 can thereby antagonize IL-23 and is a possible therapeutic agent for suppression of IL-23 functions. PMID:16423037

  13. Nfkb1 inhibits LPS-induced IFN-β and IL-12 p40 production in macrophages by distinct mechanisms.

    Directory of Open Access Journals (Sweden)

    Xixing Zhao

    Full Text Available Nfkb1-deficient murine macrophages express higher levels of IFN-β and IL-12 p40 following LPS stimulation than control macrophages, but the molecular basis for this phenomenon has not been completely defined. Nfkb1 encodes several gene products including the NF-κB subunit p50 and its precursor p105. p50 is derived from the N-terminal of 105, and p50 homodimers can exhibit suppressive activity when overexpressed. The C-terminal region of p105 is necessary for LPS-induced ERK activation and it has been suggested that ERK activity inhibits both IFN-β and IL-12 p40 following LPS stimulation. However, the contributions of p50 and the C-terminal domain of p105 in regulating endogenous IFN-β(Ifnb and IL-12 p40 (Il12b gene expression in macrophages following LPS stimulation have not been directly compared.We have used recombinant retroviruses to express p105, p50, and the C-terminal domain of p105 (p105ΔN in Nfkb1-deficient murine bone marrow-derived macrophages at near endogenous levels. We found that both p50 and p105ΔN inhibited expression of Ifnb, and that inhibition of Ifnb by p105ΔN depended on ERK activation, because a mutant of p105ΔN (p105ΔNS930A that lacks a key serine necessary to support ERK activation failed to inhibit. In contrast, only p105ΔN but not p50 inhibited Il12b expression. Surprisingly, p105ΔNS930A retained inhibitory activity for Il12b, indicating that ERK activation was not necessary for inhibition. The differential effects of p105ΔNS930A on Ifnb and Il12b expression inversely correlated with the function of one of its binding partners, c-Rel. This raised the possibility that p105ΔNS930A influences gene expression by interfering with the function of c-Rel.These results demonstrate that Nfkb1 exhibits multiple gene-specific inhibitory functions following TLR stimulation of murine macrophages.

  14. Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Welsh Kenneth I

    2003-06-01

    Full Text Available Abstract Background Genes encoding cytokine mediators are prime candidates for genetic analysis in conditions with T-helper (Th cell disease driven imbalance. Idiopathic Pulmonary Fibrosis (IPF is a predominantly Th2 mediated disease associated with a paucity of interferon-gamma (IFN-γ. The paucity of IFN-γ may favor the development of progressive fibrosis in IPF. Interleukin-12 (IL-12 plays a key role in inducing IFN-γ production. The aim of the current study was to assess whether the 1188 (A/C 3'UTR single nucleotide polymorphism (SNP in the IL-12 p40 subunit gene which was recently found to be functional and the 5644 (G/A 3' UTR SNP of the IFN-γ gene were associated with susceptibility to IPF. Methods We investigated the allelic distribution in these loci in UK white Caucasoid subjects comprising 73 patients with IPF and 157 healthy controls. The SNPs were determined using the polymerase chain reaction in association with sequence-specific primers incorporating mismatches at the 3'-end. Results Our results showed that these polymorphisms were distributed similarly in the IPF and control groups Conclusion We conclude that these two potentially important candidate gene single nucleotide polymorphisms are not associated with susceptibility to IPF.

  15. Expression of p40 (∆Np63) protein in meningiomas, an unexpected finding: immunohistochemical study and evaluation of its possible prognostic role.

    Science.gov (United States)

    Guadagno, Elia; Del Basso De Caro, Marialaura; Pignatiello, Sara; Sciammarella, Concetta; Solari, Domenico; Cappabianca, Paolo; Maiuri, Francesco; Dones, Flavia

    2016-09-01

    According to the 2007 WHO (World Health Organization) Classification, meningiomas are divided into three grades of malignancy, with different recurrence rate, based exclusively on histopathological parameters. Loss/reduction of PgR (Progesterone Receptor) expression and increased Ki67 L.I. (Labeling Index) have been proven as possible prognostic factors able to predict the relapse of the disease. However, they sometimes result unreliable, especially when discordant. p40 is the short form of the p53 homologue gene p63, also named ∆Np63, and its antibody has recently been introduced as a highly specific diagnostic marker of the squamous cell carcinoma of the lung. Nevertheless its expression has been found in many other unconventional sites (e.g. placenta, urotheluim, etc). Herein we assessed the immuno-expression of p40 protein in a series of 72 meningiomas (35 grade I and 37 grade II) and analyzed its correlation with clinicopathological parameters, overall survival and recurrence free interval. We found that a high p40 score correlated with high histological grade, presence of recurrence, increased Ki67 L.I. and loss/reduction of PgR signal. Moreover, a higher expression of p40 was shown to be a significant prognostic factor for the development of recurrences and resulted a prognostic independent variable in multivariate analysis. Overall, for the first time, we investigated the expression of p40 protein in meningiomas and explored its usefulness as prognostic marker in addition to PgR and Ki67 L.I.

  16. The Glycogen Synthase Kinase 3α and β Isoforms Differentially Regulates Interleukin-12p40 Expression in Endothelial Cells Stimulated with Peptidoglycan from Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    Ricarda Cortés-Vieyra

    Full Text Available Glycogen synthase kinase 3 (GSK3 is a constitutively active regulatory enzyme that is important in cancer, diabetes, and cardiovascular, neurodegenerative, and psychiatric diseases. While GSK3α is usually important in neurodegenerative and psychiatric diseases GSK3β is fundamental in the inflammatory response caused by bacterial components. Peptidoglycan (PGN, one of the most abundant cell-wall structures of Gram-positive bacteria, is an important inducer of inflammation. To evaluate whether inhibition of GSK3α and GSK3β activity in bovine endothelial cells (BEC regulates the expression of the pro-inflammatory cytokine IL-12p40, we treated BEC with SDS-purified PGN from Staphylococcus aureus. We found that PGN triggered a TLR2/PI3K/Akt-dependent phosphorylation of GSK3α at Ser21, GSK3β at Ser9, and NF-κB p65 subunit (p65 at Ser536, and the phosphorylation of GSK3α was consistently higher than that of GSK3β. The expression of IL-12p40 was inhibited in BEC stimulated with PGN and pre-treated with a specific neutralizing anti-TLR2 antibody that targets the extracellular domain of TLR2 or by the addition of Akt-i IV (an Akt inhibitor. Inhibition of GSK3α and GSK3β with LiCl or SB216763 induced an increase in IL-12p40 mRNA and protein. The effect of each isoform on IL-12p40 expression was evaluated by siRNA-gene expression silencing of GSK3α and GSK3β. GSK3α gene silencing resulted in a marked increase in IL-12p40 mRNA and protein while GSK3β gene silencing had the opposite effect on IL-12p40 expression. These results indicate that the TLR2/PI3K/Akt-dependent inhibition of GSK3α activity also plays an important role in the inflammatory response caused by stimulation of BEC with PGN from S. aureus.

  17. Increased production of IL-4 and IL-12p40 from bronchoalveolar lavage cells are biomarkers of Mycobacterium tuberculosis in the sputum.

    Directory of Open Access Journals (Sweden)

    Anna Nolan

    Full Text Available Tuberculosis (TB causes 1.45 million deaths annually world wide, the majority of which occur in the developing world. Active TB disease represents immune failure to control latent infection from airborne spread. Acid-fast bacillus (AFB seen on sputum smear is a biomarker for contagiousness.We enrolled 73 tuberculosis patients with extensive infiltrates into a research study using bronchoalveolar lavage (BAL to sample lung immune cells and assay BAL cell cytokine production. All patients had sputum culture demonstrating Mycobacterium tuberculosis and 59/73 (81% had AFB identified by microscopy of the sputum. Compared with smear negative patients, smear positive patients at presentation had a higher proportion with smoking history, a higher proportion with temperature >38.5(0 C, higher BAL cells/ml, lower percent lymphocytes in BAL, higher IL-4 and IL-12p40 in BAL cell supernatants. There was no correlation between AFB smear and other BAL or serum cytokines. Increasing IL-4 was associated with BAL PMN and negatively associated with BAL lymphocytes. Each 10-fold increase in BAL IL-4 and IL-12p40 increased the odds of AFB smear positivity by 7.4 and 2.2-fold, respectively, in a multi-variable logistic model.Increasing IL-4 and IL-12p40 production by BAL cells are biomarkers for AFB in sputum of patients who present with radiographically advanced TB. They likely reflect less effective immune control of pathways for controlling TB, leading to patients with increased infectiousness.

  18. Variation in a surface-exposed region of the Mycoplasma pneumoniae P40 protein as a consequence of homologous DNA recombination between RepMP5 elements.

    Science.gov (United States)

    Spuesens, Emiel B M; van de Kreeke, Nick; Estevão, Silvia; Hoogenboezem, Theo; Sluijter, Marcel; Hartwig, Nico G; van Rossum, Annemarie M C; Vink, Cornelis

    2011-02-01

    Mycoplasma pneumoniae is a human pathogen that causes a range of respiratory tract infections. The first step in infection is adherence of the bacteria to the respiratory epithelium. This step is mediated by a specialized organelle, which contains several proteins (cytadhesins) that have an important function in adherence. Two of these cytadhesins, P40 and P90, represent the proteolytic products from a single 130 kDa protein precursor, which is encoded by the MPN142 gene. Interestingly, MPN142 contains a repetitive DNA element, termed RepMP5, of which homologues are found at seven other loci within the M. pneumoniae genome. It has been hypothesized that these RepMP5 elements, which are similar but not identical in sequence, recombine with their counterpart within MPN142 and thereby provide a source of sequence variation for this gene. As this variation may give rise to amino acid changes within P40 and P90, the recombination between RepMP5 elements may constitute the basis of antigenic variation and, possibly, immune evasion by M. pneumoniae. To investigate the sequence variation of MPN142 in relation to inter-RepMP5 recombination, we determined the sequences of all RepMP5 elements in a collection of 25 strains. The results indicate that: (i) inter-RepMP5 recombination events have occurred in seven of the strains, and (ii) putative RepMP5 recombination events involving MPN142 have induced amino acid changes in a surface-exposed part of the P40 protein in two of the strains. We conclude that recombination between RepMP5 elements is a common phenomenon that may lead to sequence variation of MPN142-encoded proteins.

  19. Secondary particle multiplicity depending on the collisions of π--mesons with 12C nucleons at p=40 GeV/c

    International Nuclear Information System (INIS)

    Angelov, N.S.; Grishin, V.G.; Nad', Yu.; Kanarek, T.; Batskovich, S.

    1978-01-01

    The multiplicities of secondary charged particles in π -12 C-interactions with ν-protons of carbon nucleus at p=40 GeV/c (ν=1-5) is presented. It is shown that the dependence of the average values of particle multiplicities on ν approximately equals the dependence on initial pion energy in π - p-interactions in the range from 40 to 200 GeV. KNO scaling and the Wroblewski empirical law for interactions with several nucleons of 12 C nucleus are observed

  20. Infection Rate and Tissue Localization of Murine IL-12p40-Producing Monocyte-Derived CD103+ Lung Dendritic Cells during Pulmonary Tuberculosis

    Science.gov (United States)

    Leepiyasakulchai, Chaniya; Taher, Chato; Chuquimia, Olga D.; Mazurek, Jolanta; Söderberg-Naucler, Cecilia; Fernández, Carmen; Sköld, Markus

    2013-01-01

    Non-hematopoietic cells, including lung epithelial cells, influence host immune responses. By co-culturing primary alveolar epithelial cells and monocytes from naïve donor mice, we show that alveolar epithelial cells support monocyte survival and differentiation in vitro, suggesting a role for non-hematopoietic cells in monocyte differentiation during the steady state in vivo. CD103+ dendritic cells (αE-DC) are present at mucosal surfaces. Using a murine primary monocyte adoptive transfer model, we demonstrate that αE-DC in the lungs and pulmonary lymph nodes are monocyte-derived during pulmonary tuberculosis. The tissue localization may influence the functional potential of αE-DC that accumulate in Mycobacterium tuberculosis-infected lungs. Here, we confirm the localization of αE-DC in uninfected mice beneath the bronchial epithelial cell layer and near the vascular wall, and show that αE-DC have a similar distribution in the lungs during pulmonary tuberculosis and are detected in the bronchoalveolar lavage fluid from infected mice. Lung DC can be targeted by M. tuberculosis in vivo and play a role in bacterial dissemination to the draining lymph node. In contrast to other DC subsets, only a fraction of lung αE-DC are infected with the bacterium. We also show that virulent M. tuberculosis does not significantly alter cell surface expression levels of MHC class II on infected cells in vivo and that αE-DC contain the highest frequency of IL-12p40+ cells among the myeloid cell subsets in infected lungs. Our results support a model in which inflammatory monocytes are recruited into the M. tuberculosis-infected lung tissue and, depending on which non-hematopoietic cells they interact with, differentiate along different paths to give rise to multiple monocyte-derived cells, including DC with a distinctive αE-DC phenotype. PMID:23861965

  1. Infection rate and tissue localization of murine IL-12p40-producing monocyte-derived CD103(+) lung dendritic cells during pulmonary tuberculosis.

    Science.gov (United States)

    Leepiyasakulchai, Chaniya; Taher, Chato; Chuquimia, Olga D; Mazurek, Jolanta; Söderberg-Naucler, Cecilia; Fernández, Carmen; Sköld, Markus

    2013-01-01

    Non-hematopoietic cells, including lung epithelial cells, influence host immune responses. By co-culturing primary alveolar epithelial cells and monocytes from naïve donor mice, we show that alveolar epithelial cells support monocyte survival and differentiation in vitro, suggesting a role for non-hematopoietic cells in monocyte differentiation during the steady state in vivo. CD103(+) dendritic cells (αE-DC) are present at mucosal surfaces. Using a murine primary monocyte adoptive transfer model, we demonstrate that αE-DC in the lungs and pulmonary lymph nodes are monocyte-derived during pulmonary tuberculosis. The tissue localization may influence the functional potential of αE-DC that accumulate in Mycobacterium tuberculosis-infected lungs. Here, we confirm the localization of αE-DC in uninfected mice beneath the bronchial epithelial cell layer and near the vascular wall, and show that αE-DC have a similar distribution in the lungs during pulmonary tuberculosis and are detected in the bronchoalveolar lavage fluid from infected mice. Lung DC can be targeted by M. tuberculosis in vivo and play a role in bacterial dissemination to the draining lymph node. In contrast to other DC subsets, only a fraction of lung αE-DC are infected with the bacterium. We also show that virulent M. tuberculosis does not significantly alter cell surface expression levels of MHC class II on infected cells in vivo and that αE-DC contain the highest frequency of IL-12p40(+) cells among the myeloid cell subsets in infected lungs. Our results support a model in which inflammatory monocytes are recruited into the M. tuberculosis-infected lung tissue and, depending on which non-hematopoietic cells they interact with, differentiate along different paths to give rise to multiple monocyte-derived cells, including DC with a distinctive αE-DC phenotype.

  2. Project installation the large equipment in line system in Brazil. Gas export line valve P-40 FPSO-MLS. Field Marlim Sul, Campos Basin, Brazil; Operacao de instalacao do maior equipamento no sistema in line ja realizado no Brasil. Valvula do gasoduto P-40 X FPSO-MLS. Campo de Marlim Sul, Bacia de Campos, Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Marques, Marcos Antonio Rodrigues; Fernandes, Paulo Tavares [PETROBRAS, Campos dos Goytacases, RJ (Brazil). Exploracao e Producao

    2005-07-01

    This work will approach the current level of development of the installation of connected underwater equipment to flexible lines in the underwater engineering operations in Campos' Basin. The project will show studies, analysis and simulations (through software developed by PETROBRAS) about the installation of the largest equipment laid in the 'in-line' system (connected to flexible lines) in Brazil - and one of the largest of the world: the ESDV (Emergency Shut Down Valve) of the gas pipeline P-40 x FPSO-MLS, in the South Marlim field, in Campos' Basin. This ESDV, of about 18.000 kg, 4 m height and 6,5 m length, has the purpose of assuring the safety conditions on the facilities, interrupting the gas flow exported for P-40 in case of emergency situations. Its installation opened a new alternative in releasing underwater equipment, using the ships that install the flexible lines. This operation occurred in June, 2004, and required the use of a second vessel for support and monitoring of the ESDV laying. The ESDV was installed at 400 m from FPSO-MLS, in a water depth of 1.137 m. This method shall be used broadly by the company in the implantation of the new units of Campos' Basin, and the upcoming studies must consider the gradual increase of the water depth in the new projects. This work will focus the technological development in this area, and one of its purposes is to foresee the future difficulties that can appear in the implantation of the production systems in deep and ultra-deep waters. (author)

  3. Mycobacterium tuberculosis PPE44 (Rv2770c) is involved in response to multiple stresses and promotes the macrophage expression of IL-12 p40 and IL-6 via the p38, ERK, and NF-κB signaling axis.

    Science.gov (United States)

    Yu, Zhaoxiao; Zhang, Chenhui; Zhou, Mingliang; Li, Qiming; Li, Hui; Duan, Wei; Li, Xue; Feng, Yonghong; Xie, Jianping

    2017-09-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis, remains a formidable threat to global public health. The successful intracellular persistence of M. tuberculosis significantly contributes to the intractability of tuberculosis. Proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) are mycobacterial exclusive protein families that widely reported to be involved in the bacterial virulence, physiology and interaction with host. Rv2770c (PPE44), a predicted virulence factor, was up-regulated upon the infected guinea pig lungs. To investigate the role of Rv2770c, we heterologously expressed the PPE44 in the nonpathogenic fast-growing M. smegmatis strain. Subcellular location analysis demonstrated that Rv2770c is a cell wall associated protein, suggestive of a potential candidate involved in host-pathogen interaction. The Rv2770c can enhance M. smegmatis survival within macrophages and under stresses such as H 2 O 2 , SDS, diamide exposure, and low pH condition. M. smegmatis expressing Rv2770c is more virulent as testified by the increased death of macrophages and the increased expression of interlukin-6 (IL-6) and interlukin-12p40 (IL-12p40). Moreover, Rv2770c altered the secretion of IL-6 and IL-12p40 of macrophages via NF-κB, ERK1/2 and p38 MAPK axis. Taken together, this study implicated that Rv2770c was a virulent factor actively engaged in the interaction with host macrophage. Copyright © 2017. Published by Elsevier B.V.

  4. A comparative evaluation of the in vitro penetration performance of the improved Crest complete toothbrush versus the Current Crest complete toothbrush, the Colgate Precision toothbrush and the Oral-B P40 toothbrush.

    Science.gov (United States)

    Volpenhein, D W; Handel, S E; Hughes, T J; Wild, J

    1996-01-01

    Removal of plaque and debris from interproximal surfaces during toothbrushing has generally been difficult to achieve, in large part because traditional flat-bristled toothbrushes do not offer good interproximal penetration. As a result, a number of varying bristle designs have been developed, with the rippled-design brush shown to be particularly effective at removing interproximal plaque. Recently, an existing brush, the original Crest Complete, was modified to offer a more deeply rippled version. This study evaluated the interproximal penetration of four bristle designs: rippled pattern (original Crest Complete), deeper rippled pattern (improved Crest Complete), multi-level (Colgate Precision), and flat-tufted (Oral-B P40). The study used a previously reported in vitro model for determining interproximal penetration of manual toothbrushes (J Clin Dent 5:27-33, 1994). In order to effectively mimic the in-use characteristics of toothbrushing, this model is based on analysis of videotaped consumer brushing habits, tooth morphology, and in vivo plaque tenacity characteristics and uses the three most predominantly used brushing techniques (circular, up-and-down, and back-and-forth, with the brush held at both 45 and 90 degrees to the tooth surface). In addition, the model's brush stroke length, brush force, and brush speed are likewise based on analysis of consumer brushing patterns. The results of the study indicate that the new Crest Complete with deeper rippled bristles provided significantly superior (p Colgate Precision and Oral-B brushes overall and for three of the four brush strokes tested. In addition, the new Crest Complete was found to provide significantly superior interproximal penetration to the original Crest Complete overall and in circular and up-and-down strokes, and the original Crest Complete provided superior overall interproximal penetration to the Colgate and Oral-B brushes.

  5. Caracterización molecular de las proteínas p47phox y p40phox del sistema NADPH oxidasa mediante mutagénesis sitio dirigida

    Directory of Open Access Journals (Sweden)

    Juan Alvaro López

    2000-02-01

    Full Text Available

    Los neutrófilos responden a diferentes estímulos con un fenómeno conocido como “explosión respiratoria” la cual depende del sistema NADPH oxidasa. La importancia de este sistema para la actividad microbicida de las células fagocíticas es evidente en pacientes con Enfermedad Granulomatosa Crónica (EGC, los cuales sufren un incremento en la susceptibilidad a infecciones por hongos y bacterias debido a una deficiencia en la producción de agentes oxidantes por los fagocitos. El sistema NADPH oxidasa está formado por seis componentes esenciales: p40phox, p47phox, p67phox, p22phox y gp91phox. Una sexta proteína implicada en la activación del sistema es la proteína p21rac, de la familia de las GTPasas relacionadas con Ras. El centro funcional de este sistema se encuentra en el flavocitocromo b558, compuesto por las subunidades gp91phox y p22phox ubicadas en la membrana de las vesículas secretorias y gránulos específicos, las cuales aceptan electrones del NADPH citosólico y lo donan al oxígeno molecular que se encuentra en la vacuola fagocítica.

  6. An InGaAs/InP 40 GHz CML static frequency divider

    International Nuclear Information System (INIS)

    Su Yongbo; Jin Zhi; Cheng Wei; Ge Ji; Wang Xiantai; Chen Gaopeng; Liu Xinyu; Xu Anhuai; Qi Ming

    2011-01-01

    Static frequency dividers are widely used as a circuit performance benchmark or figure-of-merit indicator to gauge a particular device technology's ability to implement high speed digital and integrated high performance mixed-signal circuits. We report a 2 : 1 static frequency divider in InGaAs/InP heterojunction bipolar transistor technology. This is the first InP based digital integrated circuit ever reported on the mainland of China. The divider is implemented in differential current mode logic (CML) with 30 transistors. The circuit operated at a peak clock frequency of 40 GHz and dissipated 650 mW from a single -5 V supply. (semiconductor integrated circuits)

  7. Quark (diquark) fragmentation in soft π-p interactions at P=40 GeV/c

    International Nuclear Information System (INIS)

    Didenko, L.A.; Grishin, V.G.; Kuznetsov, V.A.

    1984-01-01

    The quark and diquark fragmentation into π +- -, K 0 -mesons and Λ-hyperons in soft π - p-interactions at 40 GeV/c is studied. Fragmentation Dsup(πsup(+-)) (Xsub(F)) and invariant Fsup(πsup(+-)) (Xsub(F)) functions are compared with analogous data on ν(anti ν)p - interactions. It is shown that a good agreement exists in the region Xsub(F) > or approximately 0.15 for these different processes. The Xsub(E)-dependence of the quark and diquark fragmentation function for neutral kaons is similar to that in e + e - annihilation. The pickup probability of strange s(anti s) quark (lambda sub(s)) and diquark (lambda sub(qq)) relative to u(anti u) and d(anti d) quarks from the sea has been found to be equal to lambda sub(s)=0.17 and lambda sub(qq)=0.14+-0.03

  8. SU-E-P-40: Dosimetric Characteristics of Field Aperture Margin Design in Stereotactic Body Radiation Therapy (SBRT)

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, J

    2015-06-15

    Purpose: To characterize the dosimetric effects of field aperture margin design in Stereotactic Body Radiation Therapy (SBRT). Methods: Three artificial spherical PTVs, with diameter of 10mm, 20mm and 30mm, were created on CT images of a human body thoracic phantom. Seven non-coplanar isocentric fields were used for treatment planning. For each PTV, treatment plans with margins 0mm, 1mm, 2mm and 3mm were planned. Dosimetric comparison among plans was done considering the following parameters: prescribed isodose line for target coverage, maximum dose, mean dose as well as dose spillages of V80, V50, and V20. Results: Corresponding to aperture margins of 0mm, 1mm,2m and 3mm used in the treatment planning, the percentage of isodose line chosen for dose prescription increases from 65% to 93% for 10mm PTV, 70% to 92% for 20mm PTV, and 75% to 92% for 30mm PTV. The maximum dose decrease accordingly from 155.7% to 109.5% for 10mm PTV, 145% to 111.6% for 20mm PTV, 137% to 112.2% for 30mm PTV. The mean dose decrease from 138.% to 104.4% for 10mm PTV, 122.8% to 106.1% for 20mm PTV, 121.3% to 106% for 30mm PTV. Dose spillages (mm3) increase (V80−2.6 to 4.02, V50−4.55 to 9.3, V20–87.86 to 101.71) for 10 mm PTV, (V80−6.78 to 9.89, V50–13.46 to 20.4, V20-119.16 to 219.1) for 20 mm PTV, (V80–22.01 to 28.59, V50–41.56 to 52.66, V20-532.71 to 551.84) for 30 mm PTV. Conclusion: In SBRT treatment planning, tight field aperture margin requires prescribing dose to lower isodose line that leading to higher dose inhomogeneity and higher mean dose to PTV. Loose margin allows prescribing dose to higher isodose line, therefore improves the dose homogeneity. However, it increases dose spillages. Clinician could try different margins according to the PTV size and location of surrounding critical organs to optimize the dose delivered to the patient.

  9. SU-F-P-40: Analysis of Pelvic Lymph Node Margin Using Prostate Fiducial Markers, for SBRT Treatments

    Energy Technology Data Exchange (ETDEWEB)

    Torres, J; Castro Pena, P; Garrigo, E; Zunino, S; Venencia, C [Instituto de Radioterapia - Fundacion Marie Curie, Cordoba (Argentina)

    2016-06-15

    Purpose: The use of fiducials markers in prostate treatment allows a precise localization of this volume. Typical prostate SBRT margins with fiducials markers are 5mm in all directions, except toward the rectum, where 3mm is used. For some patients nearby pelvic lymph nodes with 5mm margin need to be irradiate assuming that its localization is linked to the prostate fiducial markers instead of bony anatomy. The purpose of this work was to analyze the geometric impact of locate the lymph node regions through the patient positioning by prostate fiducial markers. Methods: 10 patients with prostate SBRT with lymph nodes irradiation were selected. Each patient had 5 implanted titanium fiducial markers. A Novalis TX (BrainLAB-Varian) with ExacTrac and aSi1000 portal image was used. Treatment plan uses 11 beams with a dose prescription (D95%) of 40Gy to the prostate and 25Gy to the lymph node in 5 fractions. Daily positioning was carried out by ExacTrac system based on the implanted fiducials as the reference treatment position; further position verification was performed using the ExacTrac and two portal images (gantry angle 0 and 90) based on bony structures. Comparison between reference position with bony based ExacTrac and portal image localization, was done for each treatment fraction Results: A total of 50 positioning analysis were done. The average discrepancy between reference treatment position and ExacTrac based on bony anatomy (pubic area) was 4.2mm [0.3; 11.2]. The discrepancy was <5mm in 61% of the cases and <9mm in 92%. Using portal images the average discrepancy was 3.7mm [0.0; 11.1]. The discrepancy was <5mm in 69% of the cases and <9mm in 96%. Conclusion: Localizing lymph node by prostate fiducial markers may produce large discrepancy as large as 11mm compared to bony based localization. Dosimetric impact of this discrepancy should be studied.

  10. Elastic scattering analysis of p + 40Ca at incident energies from threshold to 48.4 MeV and nuclear matter radius

    International Nuclear Information System (INIS)

    Ismail, Atef; Lee, Yen Cheong; Tammam, M.

    2015-01-01

    Proton elastic scattering at various incident energies is one method to study nuclear density distributions and nuclear radii. Single folding potential describing the p-scattering on 40 Ca over a broad energy range 9–48.4 MeV is constructed. The resulting potential does not need any renormalization to fit the measured elastic scattering angular distributions and total reaction cross-sections. Furthermore, correlation between volume integral and proton incident energy is discussed. Theoretical calculations are in a good agreement with existing experimental data. (author)

  11. Identification and expression analysis of two interleukin-23α (p19) isoforms, in rainbow trout Oncorhynchus mykiss and Atlantic salmon Salmo salar.

    Science.gov (United States)

    Jiang, Yousheng; Husain, Mansourah; Qi, Zhitao; Bird, Steve; Wang, Tiehui

    2015-08-01

    Interleukin (IL)-23 is a heterodimeric IL-12 family cytokine composed of a p19 α-chain, linked to a p40 β-chain that is shared with IL-12. IL-23 is distinguished functionally from IL-12 by its ability to induce the production of IL-17, and differentiation of Th17 cells in mammals. Three isoforms of p40 (p40a, p40b and p40c) have been found in some 3R teleosts. Salmonids also possess three p40 isoforms (p40b1, p40b2 and p40c) although p40a is missing, and two copies (paralogues) of p40b are present that have presumably been retained following the 4R duplication in this fish lineage. Teleost p19 has been discovered recently in zebrafish, but to date there is limited information on expression and modulation of this molecule. In this report we have cloned two p19 paralogues (p19a and p19b) in salmonids, suggesting that a salmonid can possess six potential IL-23 isoforms. Whilst Atlantic salmon has two active p19 genes, the rainbow trout p19b gene may have been pseudogenized. The salmonid p19 translations share moderate identities (22.8-29.9%) to zebrafish and mammalian p19 molecules, but their identity was supported by structural features, a conserved 4 exon/3 intron gene organisation, and phylogenetic tree analysis. The active salmonid p19 genes are highly expressed in blood and gonad. Bacterial (Yersinia ruckeri) and viral infection in rainbow trout induces the expression of p19a, suggesting pathogen-specific induction of IL-23 isoforms. Trout p19a expression was also induced by PAMPs (poly IC and peptidoglycan) and the proinflammatory cytokine IL-1β in primary head kidney macrophages. These data may indicate diverse functional roles of trout IL-23 isoforms in regulating the immune response in fish. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Interleukin 12 in part regulates gamma interferon release in human whole blood stimulated with Leptospira interrogans

    NARCIS (Netherlands)

    de Fost, Maaike; Hartskeerl, Rudy A.; Groenendijk, Martijn R.; van der Poll, Tom

    2003-01-01

    Heat-killed pathogenic Leptospira interrogans serovar rachmati induced the production of gamma interferon (IFN-gamma) and the IFN-gamma-inducing cytokines interleukin-12p40 (IL-12p40) and tumor necrosis factor alpha in human whole blood in vitro. The production of IFN-gamma was largely dependent on

  13. Colon-specific delivery of a probiotic-derived soluble protein ameliorates intestinal inflammation in mice through an EGFR-dependent mechanism

    Science.gov (United States)

    Yan, Fang; Cao, Hanwei; Cover, Timothy L.; Washington, M. Kay; Shi, Yan; Liu, LinShu; Chaturvedi, Rupesh; Peek, Richard M.; Wilson, Keith T.; Polk, D. Brent

    2011-01-01

    Probiotic bacteria can potentially have beneficial effects on the clinical course of several intestinal disorders, but our understanding of probiotic action is limited. We have identified a probiotic bacteria–derived soluble protein, p40, from Lactobacillus rhamnosus GG (LGG), which prevents cytokine-induced apoptosis in intestinal epithelial cells. In the current study, we analyzed the mechanisms by which p40 regulates cellular responses in intestinal epithelial cells and p40’s effects on experimental colitis using mouse models. We show that the recombinant p40 protein activated EGFR, leading to Akt activation. Activation of EGFR by p40 was required for inhibition of cytokine-induced apoptosis in intestinal epithelial cells in vitro and ex vivo. Furthermore, we developed a pectin/zein hydrogel bead system to specifically deliver p40 to the mouse colon, which activated EGFR in colon epithelial cells. Administration of p40-containing beads reduced intestinal epithelial apoptosis and disruption of barrier function in the colon epithelium in an EGFR-dependent manner, thereby preventing and treating DSS-induced intestinal injury and acute colitis. Furthermore, p40 activation of EGFR was required for ameliorating colon epithelial cell apoptosis and chronic inflammation in oxazolone-induced colitis. These data define what we believe to be a previously unrecognized mechanism of probiotic-derived soluble proteins in protecting the intestine from injury and inflammation. PMID:21606592

  14. Bioresorbable screws reinforced with phosphate glass fibre: manufacturing and mechanical property characterisation.

    Science.gov (United States)

    Felfel, R M; Ahmed, I; Parsons, A J; Rudd, C D

    2013-01-01

    Use of bioresorbable screws could eliminate disadvantages associated with metals such as removal operations, corrosion, MRI interference and stress shielding. Mechanical properties of bioresorbable polymers alone are insufficient for load bearing applications application as screws. Thus, reinforcement is necessary to try and match or surpass the mechanical properties of cortical bone. Phosphate based glass fibres were used to reinforce polylactic acid (PLA) in order to produce unidirectionally aligned (UD) and unidirectionally plus randomly distributed (UD/RM) composite screws (P40 UD and P40 UD/RM). The maximum flexural and push-out properties for the composite screws (P40 UD and P40 UD/RM) increased by almost 100% in comparison with the PLA screws. While the pull-out strength and stiffness of the headless composite screws were ∼80% (strength) and ∼130% (stiffness) higher than for PLA, those with heads exhibited properties lower than those for PLA alone as a result of failure at the heads. An increase in the maximum shear load and stiffness for the composite screws (∼30% and ∼40%) in comparison to the PLA screws was also seen. Maximum torque for the PLA screws was ∼1000 mN m, while that for the composite screws were slightly lower. The SEM micrographs for P40 UD and P40 UD/RM screws revealed small gaps around the fibres, which were suggested to be due to buckling of the UD fibres during the manufacturing process. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. IL-23 p19 knockout mice exhibit minimal defects in responses to primary and secondary infection with Francisella tularensis LVS.

    Directory of Open Access Journals (Sweden)

    Sherry L Kurtz

    Full Text Available Our laboratory's investigations into mechanisms of protective immunity against Francisella tularensis Live Vaccine Strain (LVS have uncovered mediators important in host defense against primary infection, as well as those correlated with successful vaccination. One such potential correlate was IL-12p40, a pleiotropic cytokine that promotes Th1 T cell function as part of IL-12p70. LVS-infected IL-12p40 deficient knockout (KO mice maintain a chronic infection, but IL-12p35 KO mice clear LVS infection; thus the role that IL-12p40 plays in immunity to LVS is independent of the IL-12p70 heterodimer. IL-12p40 can also partner with IL-23p19 to create the heterodimeric cytokine IL-23. Here, we directly tested the role of IL-23 in LVS resistance, and found IL-23 to be largely dispensable for immunity to LVS following intradermal or intranasal infection. IL-23p19 KO splenocytes were fully competent in controlling intramacrophage LVS replication in an in vitro overlay assay. Further, antibody responses in IL-23p19 KO mice were similar to those of normal wild type mice after LVS infection. IL-23p19 KO mice or normal wild type mice that survived primary LVS infection survived maximal doses of LVS secondary challenge. Thus p40 has a novel role in clearance of LVS infection that is unrelated to either IL-12 or IL-23.

  16. Proximate, chemical compositions and sulphur concentrations on ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-05-08

    May 8, 2013 ... 1Department of Agriculture, Animal Health and Human Ecology, College of Agriculture and Environmental Sciences,. University of South Africa, ... Fruit drying industry is becoming a thriving business in. South Africa, presumably due .... Chemie AG (Buchs, Switzerland). Petroleum ether (B.P 40-60°C),.

  17. Synthesis and antinociceptive activity of methyl nicotinate | Erharuyi ...

    African Journals Online (AJOL)

    ... neutralization of the reaction mixture with 10% sodium bicarbonate. The product was purified by column chromatography and purity ascertained by thin layer chromatography. Structure of the desired product was confirmed by NMR and Mass spectroscopy. Methyl nicotinate was obtained as a white powder (m.p. 40-42oC, ...

  18. 78 FR 77502 - NASA Applied Sciences Advisory Committee Meeting

    Science.gov (United States)

    2013-12-23

    ... NATIONAL AERONAUTICS AND SPACE ADMINISTRATION [Notice (13-152)] NASA Applied Sciences Advisory... Aeronautics and Space Administration (NASA) announces a meeting of the Applied Sciences Advisory Committee.... ADDRESSES: NASA Headquarters, Room 3P40, 300 E Street SW., Washington, DC 20546. FOR FURTHER INFORMATION...

  19. Two major secreted proteins as probiotic effectors of Lactobacillus rhamnosus GG

    NARCIS (Netherlands)

    Claes, I.; Segers, M.; Ossowski, von I.; Reunanen, J.; Palva, A.; Vos, de W.M.

    2011-01-01

    The well-documented probiotic bacterium Lactobacillus rhamnosus GG (LGG) produces two major secreted proteins, named Msp1 (LGG_00324 or p75) and Msp2 (LGG_00031 or p40), which have been previously reported to promote the survival and growth of intestinal epithelial cells. We could demonstrate that

  20. Genetic and biochemical characterization of the cell wall hydrolase activity of the major secreted protein of Lactobacillus rhamnosus GG

    NARCIS (Netherlands)

    Claes, I.J.; Schoofs, G.; Regulski, K.; Vos, de W.M.

    2012-01-01

    Lactobacillus rhamnosus GG (LGG) produces two major secreted proteins, designated here Msp1 (LGG_00324 or p75) and Msp2 (LGG_00031 or p40), which have been reported to promote the survival and growth of intestinal epithelial cells. Intriguingly, although each of these proteins shares homology with

  1. Lower limb SSEP changes in stroke-predictive values regarding functional recovery.

    Science.gov (United States)

    Tzvetanov, Pl; Rousseff, R T; Milanov, Iv

    2003-04-01

    To assess the predictive value of lower limbs somatosensory evoked potentials (SSEPs) in the acute phase of stroke. 94 stroke patients (mean age: 61.2; S.D.: 11.8; 43 women) were included. Computed tomography confirmed diagnosis was cortical middle cerebral artery (MCA) infarction in 35, subcortical MCA in 11, and mixed in 25. By size, infarctions were large (29), limited (33), and lacunar (9). Thalamic haemorrhage was found in eight patients, putaminal in seven, small capsular in two, massive in two and lobar in four patients. All patients presented with hemiparesis (54) or hemiplegia (40), pure in five and combined with hemihypesthesia in 89. Tibial nerve SSEPs were recorded early in the course of the disease (up to third day). SSEP parameters (presence/absence of SSEP, absolute P40 latency, amplitude and amplitude ratio-affected/healthy side of P40-N50) were evaluated and compared with motor ability using the Medical Research Council (MRC) scale, and daily living activities using Barthel index (ADLB) followed for 3 months after stroke. Disability was assessed after the Rankin scale. The absolute amplitude of P40 has moderately strong correlation with Barthel index (r=0.63) and nearly moderate (r=-0.46) with Rankin scale at 3 months. P40 ratio exhibits weaker correlations with clinical outcome parameters. The combination of SSEP abnormalities and MRC has stronger predictive value than MRC alone (Pvs Pstroke, independently or combined with muscle power assessment, significantly increases prognostic capability.

  2. 40 CFR 721.10097 - Disubstituted benzenesulfonic acid, alkali metal salt (generic).

    Science.gov (United States)

    2010-07-01

    ... chemical substance identified generically as disubstituted benzenesulfonic acid, alkali metal salt (PMN P... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Disubstituted benzenesulfonic acid, alkali metal salt (generic). 721.10097 Section 721.10097 Protection of Environment ENVIRONMENTAL...

  3. Formation of carbon nanostructures using acetylene, argon-acetylene and argon-hydrogen-acetylene plasmas

    International Nuclear Information System (INIS)

    Marcinauskas, L.; Grigonis, A.; Minialga, V.; Marcinauskas, L.; Valincius, V.

    2013-01-01

    The films prepared in argon-acetylene plasma are attributed to graphite-like carbon films. Addition of the hydrogen decreases growth rate and the surface roughness of the films and lead to the formation of nanocrystalline graphite. The carbon nanotubes were formed at low (≤ 450°C; p = 40 Pa) temperature in pure acetylene plasma. (authors)

  4. Equol Effectively Inhibits Toxic Activity of Human Neutrophils without Influencing Their Viability

    Czech Academy of Sciences Publication Activity Database

    Pažoureková, S.; Lucová, M.; Nosál, R.; Drábiková, K.; Harmatha, Juraj; Šmidrkal, J.; Jančinová, V.

    2016-01-01

    Roč. 97, 3/4 (2016), s. 138-145 ISSN 0031-7012 Institutional support: RVO:61388963 Keywords : neutrophils * equol * chemiluminescence * reactive oxygen species * p40(phox) * apoptosis Subject RIV: FR - Pharmacology ; Medidal Chemistry Impact factor: 1.442, year: 2016

  5. Batf3 and Id2 have a synergistic effect on Irf8-directed classical CD8α+ dendritic cell development

    KAUST Repository

    Jaiswal, Hemant; Kaushik, Monika; Sougrat, Rachid; Gupta, Monica; Dey, Anup; Verma, Rohit; Ozato, Keiko; Tailor, Prafullakumar B.

    2013-01-01

    model for DC development and function. Expression of Irf8 in DC9 cells led to plasmacytoid DCs and CD8α+ DC-like cells, with a concomitant increase in plasmacytoid DC- and CD8α+ DC-specific gene transcripts and induction of type I IFNs and IL12p40

  6. 77 FR 14994 - Fisheries of the Exclusive Economic Zone Off Alaska; Reallocation of Pollock in the Bering Sea...

    Science.gov (United States)

    2012-03-14

    ... error on page 12215 in row 16 of the third column. The 2012 A season directed fishing allowance for the... \\1\\ 2013 B season \\1\\ season \\1\\ Area and sector 2012 2013 Allocations A season SCA harvest B season... allocated as a DFA as follows: inshore sector--50 percent, catcher/processor sector (C/P)--40 percent, and...

  7. The effect of carbohydrate addition on water quality and the nitrogen budget in extensive shrimp culture systems

    NARCIS (Netherlands)

    Hari, B.; Kurup, B.M.; Varghese, J.T.; Schrama, J.W.; Verdegem, M.C.J.

    2006-01-01

    Water quality and shrimp production were monitored in extensively managed ponds which were fed a 25% (P25) or 40% (P40) dietary protein, each diet complemented with or without carbohydrate (CH) addition. The experiment was carried out in 6-m3 concrete tanks, with a mud bottom and stocked with 7 post

  8. Cytokines and adhesion molecules in multiple sclerosis patients treated with interferon-beta1b

    DEFF Research Database (Denmark)

    Jensen, Jakob; Krakauer, Martin; Sellebjerg, Finn

    2005-01-01

    inconsistent. We found decreases in CD4 and CD8 T cell expression of the CD49d/VLA-4 molecule, increases in plasma concentrations of soluble vascular cell adhesion molecule (sVCAM-1), and increases in plasma concentrations of tumor necrosis factor and interleukin (IL)-12 p40 chain in patients with MS who were...

  9. Dirac-global fits to calcium elastic scattering data in the range 21-200 MeV

    International Nuclear Information System (INIS)

    Cooper, E.D.

    1988-01-01

    We present a global relativistic optical model for p+ 40 Ca consisting of Lorentz scalar and vector potentials parametrized as a function of energy. The shapes chosen are Woods-Saxons for the real potentials, and a linear combination of Woods-Saxons and derivative Woods-Saxons for the imaginary potentials. (orig.)

  10. Energy transfer from carotenoids to chlorophyll in blue-green, red and green algae and greening bean leaves

    NARCIS (Netherlands)

    Goedheer, J.C.

    1969-01-01

    From fluorescence action spectra, fluorescence spectra and absorption spectra measured at room temperature and at 77 °K of light petroleum (b.p. 40–60°)-treated and normal chloroplasts, it is concluded that: 1. 1. In blue-green and red algae energy transfer from β-carotene to chlorophyll occurs

  11. Momentum and angular characteristics of diffractional and nondiffractional π-p interactions at 40 GeV/c

    International Nuclear Information System (INIS)

    Grishin, V.G.; Kerachev, P.P.; Tsivtsivadze, Eh.T.

    1976-01-01

    The πsup(+-)-meson and γ-quantum distribution on the longitudinal rapidities and transversal momenta in diffractional and nondiffractional interactions at p=40 GeV/c are presented. The topological cross sections and the dependence of the average multiplicity of π 0 -mesons on the number of secondary charged particles in the diffraction interactions have been determined

  12. Effects of carbohydrate addition on production in extensive shrimp culture systems

    NARCIS (Netherlands)

    Hari, B.; Kurup, B.M.; Varghese, J.T.; Schrama, J.W.; Verdegem, M.C.J.

    2004-01-01

    One indoor and one on-farm trial were conducted to evaluate the effect of control of carbon/ nitrogen ratio (C/N ratio) by addition of carbohydrate to the water column in extensive types of shrimp culture systems. In the indoor experiment, 25% and 40% dietary protein ('P25' and 'P40') with or

  13. The amphipod genus Acidostoma

    NARCIS (Netherlands)

    Dahl, E.

    1964-01-01

    The genus Acidostoma was established by Lilljeborg (1865, p. 24) to receive Anonyx obesus Sp. Bate (1862, p. 74). Afterwards two further species have been added, viz. A. laticorne G. O. Sars (1879, p. 440) and A. nodiferum Stephensen (1923, p. 40). In the present paper it will be shown that A.

  14. Clinical, functional, and genetic characterization of chronic granulomatous disease in 89 Turkish patients

    NARCIS (Netherlands)

    Köker, Mustafa Yavuz; Camcıoğlu, Yıldız; van Leeuwen, Karin; Kılıç, Sara Şebnem; Barlan, Işıl; Yılmaz, Mustafa; Metin, Ayşe; de Boer, Martin; Avcılar, Hüseyin; Patıroğlu, Türkan; Yıldıran, Alişan; Yeğin, Olcay; Tezcan, Ilhan; Sanal, Ozden; Roos, Dirk

    2013-01-01

    Chronic granulomatous disease (CGD) is a rare primary immunodeficiency disorder of phagocytes resulting in impaired killing of bacteria and fungi. A mutation in one of the 4 genes encoding the components p22(phox), p47(phox), p67(phox), and p40(phox) of the leukocyte nicotinamide dinucleotide

  15. Bioresorbable composite screws manufactured via forging process: pull-out, shear, flexural and degradation characteristics.

    Science.gov (United States)

    Felfel, R M; Ahmed, I; Parsons, A J; Rudd, C D

    2013-02-01

    Bioresorbable screws have the potential to overcome some of the complications associated with metallic screws currently in use. Removal of metallic screws after bone has healed is a serious issue which can lead to refracture due to the presence of screw holes. Poly lactic acid (PLA), fully 40 mol% P(2)O(5) containing phosphate unidirectional (P40UD) and a mixture of UD and short chopped strand random fibre mats (P40 70%UD/30%RM) composite screws were prepared via forging composite bars. Water uptake and mass loss for the composite screws manufactured increased significantly to ∼1.25% (P=0.0002) and ∼1.1% (P<0.0001), respectively, after 42 days of immersion in PBS at 37 °C. The initial maximum flexural load for P40 UD/RM and P40 UD composite screws was ∼60% (P=0.0047) and ∼100% (P=0.0037) higher than for the PLA screws (∼190 N), whilst the shear load was slightly higher in comparison to PLA (∼2.2 kN). The initial pull-out strengths for the P40 UD/RM and PLA screws were similar whereas that for P40 UD screws was ∼75% higher (P=0.022). Mechanical properties for the composite screws decreased initially after 3 days of immersion and this reduction was ascribed to the degradation of the fibre/matrix interface. After 3 days interval the mechanical properties (flexural, shear and pull-out) maintained their integrity for the duration of the study (at 42 days). This property retention was attributed to the chemical durability of the fibres used and stability of the matrix properties during the degradation process. It was also deemed necessary to enhance the fibre/matrix interface via use of a coupling agent in order to maintain the initial mechanical properties acquired for the required period of time. Lastly, it is also suggested that the degrading reinforcement fibres may have the potential to buffer any acidic products released from the PLA matrix. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Lactobacillus delbrueckii UFV-H2b20 induces type 1 cytokine production by mouse cells in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    E. Neumann

    2009-04-01

    Full Text Available Lactobacillus delbrueckii UFV-H2b20 has been shown to increase clearance of bacteria injected into the blood of germ-free mice. Moreover, it induces the production of type 1 cytokines by human peripheral mononuclear cells. The objective of the present study was to investigate the production of inflammatory cytokines [interleukin-12 (IL-12 p40, tumor necrosis factor-α (TNF-α, and interferon-γ (IFN-γ] triggered in vitro by live, heat-killed or lysozyme-treated L. delbrueckii UFV-H2b20 and in vivo by a live preparation. Germ-free, L. delbrueckii-monoassociated and lipopolysaccharide (LPS-resistant C3H/HeJ mice were used as experimental models. UFV-H2b20 induced the production of IL-12 p40 and TNF-α by peritoneal cells and IFN-γ by spleen cells from germ-free or monoassociated Swiss/NIH mice and LPS-hyporesponsive mice (around 40 ng/mL for IL-12 p40, 200 pg/mL for TNF-α and 10 ng/mL for IFN-γ. Heat treatment of L. delbrueckii did not affect the production of these cytokines. Lysozyme treatment decreased IL-12 p40 production by peritoneal cells from C3H/HeJ mice, but did not affect TNF-α production by these cells or IFN-γ production by spleen cells from the same mouse strain. TNF-α production by peritoneal cells from Swiss/NIH L. delbrueckii-monoassociated mice was inhibited by lysozyme treatment. When testing IL-12 p40 and IFN-γ levels in sera from germ-free or monoassociated Swiss/NIH mice systemically challenged with Escherichia coli we observed that IL-12 p40 was produced at marginally higher levels by monoassociated mice than by germ-free mice (40 vs 60 ng/mL, but IFN-γ was produced earlier and at higher levels by monoassociated mice (monoassociated 4 and 14 ng/mL 4 and 8 h after infection, germfree 0 and 7.5 ng/mL at the same times. These results show that L. delbrueckii UFV-H2b20 stimulates the production of type 1 cytokines in vitro and in vivo, therefore suggesting that L. delbrueckii might have adjuvant properties in infection

  17. Crystal Structures of the Pro-Inflammatory Cytokine Interleukin-23 and Its Complex with a High-Affinity Neutralizing Antibody

    Energy Technology Data Exchange (ETDEWEB)

    Beyer, Brian M.; Ingram, Richard; Ramanathan, Lata; Reichert, Paul; Le, Hung V.; Madison, Vincent; Orth, Peter (SPRI)

    2009-06-25

    Interleukin (IL)-23 is a pro-inflammatory cytokine playing a key role in the pathogenesis of several autoimmune and inflammatory diseases. We have determined the crystal structures of the heterodimeric p19-p40 IL-23 and its complex with the Fab (antigen-binding fragment) of a neutralizing antibody at 2.9 and 1.9 {angstrom}, respectively. The IL-23 structure closely resembles that of IL-12. They share the common p40 subunit, and IL-23 p19 overlaps well with IL-12 p35. Along the hydrophilic heterodimeric interface, fewer charged residues are involved for IL-23 compared with IL-12. The binding site of the Fab is located exclusively on the p19 subunit, and comparison with published cytokine-receptor structures suggests that it overlaps with the IL-23 receptor binding site.

  18. Ascending Aortic Dimensions in Former National Football League Athletes.

    Science.gov (United States)

    Gentry, James L; Carruthers, David; Joshi, Parag H; Maroules, Christopher D; Ayers, Colby R; de Lemos, James A; Aagaard, Philip; Hachamovitch, Rory; Desai, Milind Y; Roselli, Eric E; Dunn, Reginald E; Alexander, Kezia; Lincoln, Andrew E; Tucker, Andrew M; Phelan, Dermot M

    2017-11-01

    Ascending aortic dimensions are slightly larger in young competitive athletes compared with sedentary controls, but rarely >40 mm. Whether this finding translates to aortic enlargement in older, former athletes is unknown. This cross-sectional study involved a sample of 206 former National Football League (NFL) athletes compared with 759 male subjects from the DHS-2 (Dallas Heart Study-2; mean age of 57.1 and 53.6 years, respectively, P 40 mm (29.6% versus 8.6%; P history of hypertension, current smoking, diabetes mellitus, and lipid profile, the former NFL athletes still had significantly larger ascending aortas ( P 40 mm after adjusting for the same parameters. Ascending aortic dimensions were significantly larger in a sample of former NFL athletes after adjusting for their size, age, race, and cardiac risk factors. Whether this translates to an increased risk is unknown and requires further evaluation. © 2017 American Heart Association, Inc.

  19. Two cis-acting elements responsible for posttranscriptional trans-regulation of gene expression of human T-cell leukemia virus type I

    International Nuclear Information System (INIS)

    Seiki, Motoharu; Inoue, Junichiro; Hidaka, Makoto; Yoshida, Mitsuaki

    1988-01-01

    The pX sequence of human T-cell leukemia virus type I codes for two nuclear proteins, p40 tax and p27 rex and a cytoplasmic protein, p21 X-III . p40 tax activates transcription from the long terminal repeat (LTR), whereas p27 rex modulates posttranscriptional processing to accumulate gag and env mRNAs that retain intron sequences. In this paper, the authors identify two cis-acting sequence elements needed for regulation by p27 rex : a 5' splice signal and a specific sequence in the 3' LTR. These two sequence elements are sufficient for regulation by p27 rex ; expression of a cellular gene (metallothionein I) became sensitive to rex regulation when the LTR was inserted at the 3' end of this gene. The requirement for these two elements suggests and unusual regulatory mechanism of RNA processing in the nucleus

  20. Preparation, crystallization and preliminary X-ray diffraction studies of the glycosylated form of human interleukin-23

    International Nuclear Information System (INIS)

    Shirouzono, Takumi; Chirifu, Mami; Nakamura, Chiharu; Yamagata, Yuriko; Ikemizu, Shinji

    2012-01-01

    Interleukin-23 (IL-23), a member of the IL-12 family, is a heterodimeric cytokine composed of p19 and p40 subunits. Human p19 and p40 subunits were cloned and coexpressed in N-acetylglucosaminyltransferase I-negative 293S cells. The glycosylated human IL-23 was purified and crystallized by the hanging-drop vapour-diffusion method. Interleukin-23 (IL-23), a member of the IL-12 family, is a heterodimeric cytokine composed of p19 and p40 subunits. IL-23 plays crucial roles in the activation, proliferation and survival of IL-17-producing helper T cells which induce various autoimmune diseases. Human p19 and p40 subunits were cloned and coexpressed in N-acetylglucosaminyltransferase I-negative 293S cells, which produce high-mannose-type glycosylated proteins in order to diminish the heterogeneity of modified N-linked glycans. The glycosylated human IL-23 was purified and crystallized by the hanging-drop vapour-diffusion method. X-ray diffraction data were then collected to 2.6 Å resolution. The crystal belonged to space group P6 1 or P6 5 , with unit-cell parameters a = b = 108.94, c = 83.79 Å, γ = 120°. Assuming that the crystal contains one molecule per asymmetric unit, the calculated Matthews coefficient was 2.69 Å 3 Da −1 , with a solvent content of 54.2%. The structure was determined by the molecular-replacement method, with an initial R factor of 52.6%. After subsequent rigid-body and positional refinement, the R work and R free values decreased to 31.4% and 38.7%, respectively

  1. On transverse momentum dependence of average multiplicity

    International Nuclear Information System (INIS)

    Slepchenko, L.A.; Matveev, V.A.; Sissakian, A.N.

    1975-01-01

    The behaviour of the mean associated multiplicity of the secondary particles as function of the transverse momentum is considered. New scaling regularities of the cross-sections of the semi-inclusive reactions are predicted and compared with the experimental data obtained in the two-meter propane chamber of JINR, irradiated by π - -mesons with p=40 GeV/c at the Serpukhov accelerator

  2. Complement C1q regulates LPS-induced cytokine production in bone marrow-derived dendritic cells.

    Science.gov (United States)

    Yamada, Masahide; Oritani, Kenji; Kaisho, Tsuneyasu; Ishikawa, Jun; Yoshida, Hitoshi; Takahashi, Isao; Kawamoto, Shinichirou; Ishida, Naoko; Ujiie, Hidetoshi; Masaie, Hiroaki; Botto, Marina; Tomiyama, Yoshiaki; Matsuzawa, Yuji

    2004-01-01

    We show here that C1q suppresses IL-12p40 production in LPS-stimulated murine bone marrow-derived dendritic cells (BMDC). Serum IL-12p40 concentration of C1q-deficient mice was higher than that of wild-type mice after intraperitoneal LPS-injection. Because neither globular head of C1q (gC1q) nor collagen-like region of C1q (cC1q) failed to suppress LPS-induced IL-12p40 production, both gC1q and cC1q, and/or some specialized conformation of native C1q may be required for the inhibition. While C1q did not affect mRNA expression of Toll-like receptor 4 (TLR4), MD-2, and myeloid differentiation factor 88 (MyD88), BMDC treated with C1q showed the reduced activity of NF-kappaB and the delayed phosphorylation of p38, c-Jun N-terminal kinase, and extracellular signal-regulated kinase after LPS-stimulation. CpG oligodeoxynucleotide-induced IL-12p40 and TNF-alpha production, another MyD88-dependent TLR-mediated signal, was also suppressed by C1q treatment. Therefore, C1q is likely to suppress MyD88-dependent pathway in TLR-mediated signals. In contrast, C1q failed to suppress colony formation of B cells responding to LPS or LPS-induced CD40 and CD86 expression on BMDC in MyD88-deficient mice, indicating that inhibitory effects of C1q on MyD88-independent pathways may be limited. Taken together, C1q may regulate innate and adaptive immune systems via modification of signals mediated by interactions between invading pathogens and TLR.

  3. Pharmacological Evaluation of the SCID T Cell Transfer Model of Colitis

    DEFF Research Database (Denmark)

    Lindebo Holm, Thomas; Poulsen, Steen Seier; Markholst, Helle

    2012-01-01

    the SCID adoptive transfer colitis model, we have evaluated the effect of currently used IBD drugs and IBD drug candidates, that is, anti-TNF-α, TNFR-Fc, anti-IL-12p40, anti-IL-6, CTLA4-Ig, anti-α4β7 integrin, enrofloxacin/metronidazole, and cyclosporine. We found that anti-TNF-α, antibiotics, anti-IL-12p...

  4. The Cloning, Characterization, and Functional Analysis of Murine Pregnancy Specific Glycoproteins

    Science.gov (United States)

    1999-07-23

    wash at 550 C Sense AS Probe CTCCTCTCI I IrCATCTGT TCACTCATTT(AG~CACAGCCAG CTGGTACAAAGGGCTGATTG Cloni"gflllll~"gtltPsg19 5861 (AceS) 5859 ( AccAS ) 8050...12p40, iNOS, orTGF-1J mRNA. In RAW 264.7 cells, LPS upregulated mRNA expression for all cytokines examined, except for TGF- f3 mRNA. However, treatment

  5. Defective glucose and lipid metabolism in human immunodeficiency virus-infected patients with lipodystrophy involve liver, muscle tissue and pancreatic beta-cells

    DEFF Research Database (Denmark)

    Haugaard, Steen B; Andersen, Ove; Dela, Flemming

    2005-01-01

    ), 18 patients without lipodystrophy on HAART (NONLIPO) and seven patients who were naive to antiretroviral therapy (NAIVE) respectively). beta-cell function was evaluated by an intravenous glucose tolerance test. RESULTS: Compared with NONLIPO and NAIVE separately, LIPO displayed markedly reduced ratio...... of limb to trunk fat (RLF; > 34%, P 40%, P disposal (>50%, P 50%, P ... acids (P disposal (r = 0.71) and incremental exogenous glucose storage (r = 0.40), all P

  6. Molecular Dynamics Simulations of Poly(dimethylsiloxane) Properties

    Czech Academy of Sciences Publication Activity Database

    Fojtíková, J.; Kalvoda, L.; Sedlák, Petr

    2015-01-01

    Roč. 128, č. 4 (2015), s. 637-639 ISSN 0587-4246 R&D Projects: GA ČR GB14-36566G Institutional support: RVO:61388998 Keywords : molecular dynamics * poly(dimethylsiloxane) * dissipative particle dynamics Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.525, year: 2015 http://przyrbwn.icm.edu.pl/APP/PDF/128/a128z4p40.pdf

  7. Identification of novel key amino acids at the interface of the transmembrane domains of human BST-2 and HIV-1 Vpu.

    Science.gov (United States)

    Pang, Xiaojing; Hu, Siqi; Li, Jian; Xu, Fengwen; Mei, Shan; Zhou, Jinming; Cen, Shan; Jin, Qi; Guo, Fei

    2013-08-06

    BST-2 (bone marrow stromal cell antigen 2) is an interferon-inducible protein that inhibits virus release by tethering viral particles to the cell surface. This antiviral activity of BST-2 is antagonized by HIV-1 accessory protein Vpu. Vpu physically interacts with BST-2 through their mutual transmembrane (TM) domains. In this study, we utilized the BRET assay and molecular dynamics (MD) simulation method to further characterize the interaction of BST-2 and Vpu. Amino acids I34, L37, P40 and L41 in the TM domain of BST-2, and L11, A18 and W22 in the TM domain of Vpu were identified to be critical for the interaction between BST-2 and Vpu. The residues P40 in the TM domain of BST-2 and L11 in the TM domain of Vpu were shown, for the first time, to be important for their interaction. Furthermore, triple-amino-acid substitutions, 14-16 (AII to VAA) and 26-28 (IIE to AAA) in Vpu TM, not the single-residue mutation, profoundly disrupted BST-2/Vpu interaction. The results of MD simulation revealed significant conformational changes of the BST-2/Vpu complex as a result of mutating P40 of BST-2 and L11, 14-16 (AII to VAA) and 26-28 (IIE to AAA) of Vpu. In addition, disrupting the interaction between BST-2 and Vpu rendered BST-2 resistant to Vpu antagonization. Through use of the BRET assay, we identified novel key residues P40 in the TM domain of BST-2 and L11 in the TM domain of Vpu that are important for their interaction. These results add new insights into the molecular mechanism behind BST-2 antagonization by HIV-1 Vpu.

  8. Purification and characterization of three lowmolecular- weight acid ...

    African Journals Online (AJOL)

    SDS-PAGE of the purified acid phosphatase PI resolved two closely protein bands that migrated to approximately 14 and 12 kDa. ... The three enzymes had a similar optima pH (5.0) and temperature (55°C), and appeared to be stable in the presence of non-ionic detergents such as Triton X-100, Nonidet P 40 as well as Na+ ...

  9. The Usefulness of Impact Dampers for Space Applications.

    Science.gov (United States)

    1983-03-01

    5 ’DTIC ditfibutif’n is uni td . 14 1983 THDEPARTMENT OF THE AIR FORCER ’.’. AIR UNIVERSITY (ATC)FAIR FORCE INSTITUTE OF TECHNOLOGY TilES I W right...Laboratory with Important Parameters 88 -. . . . . . - 4.. X0 a >1 0 t 0.. 43 fqj 050i ONr 4*) flj $4 04 k5* 0 .0r 0V1: 5.4 0 4 (d P40 00 05 4.)v4 04

  10. EST Table: FS934649 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS934649 E_FL_fwgP_40K10_F_0 10/09/28 31 %/210 aa ref|NP_001129360.1| osiris 9 [Bom...byx mori] gb|ACI23620.1| osiris 9 [Bombyx mori] 10/09/13 n.h 10/08/29 n.h 10/09/10 low homology 10/09/10 n.h 10/09/10 n.h FS923180 fwgP ...

  11. HIGH FIELD 13C NMR SPECTROSCOPIC ANALYSIS OF THE ...

    African Journals Online (AJOL)

    a

    water through azeotropic distillation. The extracted oil was purified. 2 g of extracted oil was percolated through a silica gel (15 g) column with a mixture of petroleum ether (b.p. 40-60 0C) and diethyl ether (95:5, v/v, 150 mL). The eluate was evaporated under reduced pressure to 5 mL portion and this portion further.

  12. [Mutational analysis and genetic cloning of the agnostic locus controlling learning ability in Drosophila].

    Science.gov (United States)

    Peresleni, A I; Savvateeva, E V; Peresleni, I V; Sharagina, L M

    1995-08-01

    The ts-mutations of the agnostic gene either increased or decreased the activity of the AC and PDE. A chromosomal deficiency in the 11B region failed to complement with the agnostic behavioral defect like agn P29 and P40, led to an increased proportion of the PDE-1 in total PDE and to the structural defects in the central complex thus indicating that the P insertion is responsible for the mutant agnostic phenotype.

  13. The role of cytokines in a Porphyromonas gingivalis-induced murine abscess model.

    Science.gov (United States)

    Alayan, J; Gemmell, E; Ford, P; Hamlet, S; Bird, P S; Ivanovski, S; Farah, C S

    2007-10-01

    Porphyromonas gingivalis is an important periodontopathic bacterium that is strongly associated with periodontal disease and is part of human dental plaque. Periodontal disease results from the interaction of the host with bacterial products, and T-cell-derived cytokines remain critical in the immunoregulation of periodontal disease. The aim of this study was to examine the role of T helper type 1 [interleukin-12p40 (IL-12p40), interferon-gamma, tumour necrosis factor (TNF)] and type 2 (IL-4, IL-10) cytokines in the immune response to a subcutaneous challenge with P. gingivalis using a well-established murine abscess model, in genetically modified cytokine-specific knockout mice. IL-12p40(-/-) mice exhibited more advanced tissue destruction and a reduced inflammatory cell infiltrate after subcutaneous P. gingivalis challenge. Deficiency of IL-4 or IL-10 did not result in increased susceptibility to P. gingivalis-mediated tissue destruction. Furthermore, TNF deficiency appeared to reduce local tissue destruction. Interestingly, serum-specific antibodies suggested a strong T helper type 2 response. The results of our study indicate an important role for IL-12 in a primary P. gingivalis subcutaneous challenge.

  14. Effects of the Replacement of Soybean Meal with Pea as Dietary Protein Source on the Serum Protein Fractions of Broilers

    Directory of Open Access Journals (Sweden)

    NT Bingol

    Full Text Available ABSTRACT The aim of this study was to determine the effects of the replacement of different levels of protein derived from soybean meal with that from peas in broiler diets on serum protein fractions. A corn-soybean meal basal diet was formulated as the control diet (Control=C (NRC, 1994, and then pea was added to the control diet to replace 20% (P20 or 40% (P40 of the crude protein of the control diet. The diets were randomly fed to 12 pens per treatment, each housing five birds, for 42 days. Blood samples were collected from 36 birds (3 birds x 4 pens x3 treatments and the serum protein fractions were separated. Gamma-globulin percentage was higher in group P20 compared with C and P40 groups. Total protein, beta-globulin, and gamma-globulin concentrations were significantly higher in group P20 compared with those of both control and P40 group (p<0.05.

  15. Pharmacological Evaluation of the SCID T Cell Transfer Model of Colitis: As a Model of Crohn's Disease

    Directory of Open Access Journals (Sweden)

    Thomas Lindebo Holm

    2012-01-01

    Full Text Available Animal models are important tools in the development of new drug candidates against the inflammatory bowel diseases (IBDs Crohn's disease and ulcerative colitis. In order to increase the translational value of these models, it is important to increase knowledge relating to standard drugs. Using the SCID adoptive transfer colitis model, we have evaluated the effect of currently used IBD drugs and IBD drug candidates, that is, anti-TNF-α, TNFR-Fc, anti-IL-12p40, anti-IL-6, CTLA4-Ig, anti-α4β7 integrin, enrofloxacin/metronidazole, and cyclosporine. We found that anti-TNF-α, antibiotics, anti-IL-12p40, anti-α4β7 integrin, CTLA4-Ig, and anti-IL-6 effectively prevented onset of colitis, whereas TNFR-Fc and cyclosporine did not. In intervention studies, antibiotics, anti-IL-12p40, and CTLA4-Ig induced remission, whereas the other compounds did not. The data suggest that the adoptive transfer model and the inflammatory bowel diseases have some main inflammatory pathways in common. The finding that some well-established IBD therapeutics do not have any effect in the model highlights important differences between the experimental model and the human disease.

  16. The Relationship Between Serum Levels of Total IgE, IL-18, IL-12, IFN- γ and Disease Severity in Children With Atopic Dermatitis

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Studies about the role of cytokines on the immunopathogenesis of atopic dermatitis (AD are generally based on in vitro observations and this role has not been completely clarified yet. Serum levels of total IgE, IL-18, IL-12, IFN- γ and the relationship between these parameters and disease severity, determined using the SCORAD index, in a group of atopic patients were investigated in this study. Serum levels of total IgE were measured by the nephelometric method and serum levels of IL-18, IL-12/p40 and IFN- γ were measured by ELISA method. Serum levels of total IgE and IL-18 were found significantly higher in study group than in controls ( p<.001 . There was no statistically significant difference between patients and controls in respect of serum levels of IL-12/p40 ( p=.227 . A statistically significant relationship between SCORAD values and serum levels of total IgE ( p<.001 , IL-18 ( p<.001 , and IL-12/p40 ( p<.001 was determined. These results show that serum levels of IL-18 can be a sensitive parameter that importantly correlates with clinical severity of AD, can play a role in the immunopathogenesis of AD, and furthermore may be used in the diagnosis and follow-up of the disease in addition to other parameters.

  17. Differential adenoassociated virus vector-driven expression of a neuropeptide Y gene in primary rat brain astroglial cultures after transfection with Sendai virosomes versus Lipofectin.

    Science.gov (United States)

    de Fiebre, C M; Wu, P; Notabartolo, D; Millard, W J; Meyer, E M

    1994-06-01

    The ability of Sendai virosomes or Lipofectin to introduce an AAV vector into primary rat brain astroglial cultures was characterized. The pJDT95npy vector was constructed by inserting rat NPY cDNA downstream from the indigenous AAV p5, p19 and p40 promoters in pJDT95. Lipofectin-mediated transfection with pJDT95npy (10 micrograms) resulted in pronounced expression of several NPY mRNA species: p5-driven (3.3 kb), p19-driven (2.7 kb) and p40-driven (0.6, 0.8, 1.1, and 1.8 kb). Exposure to virosomally encapsulated pJDT95npy (50 or 100 ng) resulted in transient expression of some p40-driven mRNA species (0.8 and 1.8 kb). Neither method produced astroglia cells which synthesized mature NPY immunoreactivity. This demonstrates that an AAV-derived vector can drive gene expression in astroglia, that Sendai virosomes can infuse vectors into astroglia, but that the amount of DNA infused in this manner may limit long term expression.

  18. How Does HTLV-1 Undergo Oncogene-Dependent Replication Despite a Strong Immune Response?

    Directory of Open Access Journals (Sweden)

    Hélène Gazon

    2018-01-01

    Full Text Available In 1987, Mitsuaki Yoshida proposed the following model (Yoshida and Seiki, 1987: “... T-cells activated through the endogenous p40x would express viral antigens including the envelope glycoproteins which are exposed on the cell surface. These glycoproteins are targets of host immune surveillance, as is evidenced by the cytotoxic effects of anti-envelope antibodies or patient sera. Eventually all cells expressing the viral antigens, that is, all cells driven by the p40x would be rejected by the host. Only those cells that did not express the viral antigens would survive. Later, these antigen-negative infected cells would begin again to express viral antigens, including p40x, thus entering into the second cycle of cell propagation. These cycles would be repeated in so-called healthy virus carriers for 20 or 30 years or longer....” Three decades later, accumulated experimental facts particularly on intermittent viral transcription and regulation by the host immune response appear to prove that Yoshida was right. This Hypothesis and Theory summarizes the evidences that support this paradigm.

  19. Immunological profile in cerebrospinal fluid of patients with multiple sclerosis after treatment switch to rituximab and compared with healthy controls.

    Directory of Open Access Journals (Sweden)

    Pierre de Flon

    Full Text Available To investigate changes in the cerebrospinal fluid (CSF immunological profile after treatment switch from first-line injectables to rituximab in patients with relapsing-remitting MS (RRMS, and to compare the profile in MS patients with healthy controls (HC.Cerebrospinal fluid from 70 patients with clinically stable RRMS and 55 HC was analysed by a multiplex electrochemiluminescence method for a broad panel of cytokines and immunoactive substances before, and over a two-year period after, treatment switch to rituximab. After quality assessment of data, using a predefined algorithm, 14 analytes were included in the final analysis.Ten of the 14 analytes differed significantly in MS patients compared with HC at baseline. Levels of IP-10 (CXCL10, IL-12/23p40, IL-6, sVCAM1, IL-15, sICAM1 and IL-8 (CXCL8 decreased significantly after treatment switch to rituximab. The cytokines IP-10 and IL-12/IL-23p40 displayed the largest difference versus HC at baseline and also the largest relative reduction after therapy switch to rituximab.We found significant changes in the immunological profile after therapy switch to rituximab in RRMS in the direction towards the values of HC. IP-10 and IL12/IL-23p40 deserve further studies as part of the immunopathogenesis of MS as well as for the mode of action of rituximab in MS.

  20. Bioaccumulation Study of Produced Water Discharges from Southeastern Brazilian Offshore Petroleum Industry Using Feral Fishes.

    Science.gov (United States)

    Lourenço, Rafael André; Francioni, Eleine; da Silva, Antonio Henrique M F T; Magalhães, Caio Augusto; Gallotta, Fabiana Dias Costa; de Oliveira, Fabio Francisco; de Souza, João Maximino; de Araújo, Leandro Franco Macena; de Araújo, Liliane Pequeno; de Araújo Júnior, Marcus Antonio G; de Fátima Guadalupe Meniconi, Maria; de Souza Bindes Gomes Lopes, Monica Aparecida Ferreira

    2018-04-01

    The main effluent of oil and gas production is the discharge of produced water (PW). Despite the potential environmental impact, the structure of oil and gas platforms can act as artificial reefs. Two species of fish, Caranx crysos and Tylosurus acus, were captured under two discharging platforms at Campos Basin, P19 and P40. A nondischarging platform, P25, was taken as reference. The highest median concentration of PAH in muscle tissue was observed for C. Crysos at P40 (219.38 ng g -1 ) followed by P19 (68.26 ng g -1 ). For T. acus, the highest median concentrations were 40.07 and 42.21 ng g -1 from P19 and P40 respectively. P25 presented the smallest recorded concentrations. The results of PAH in the muscle tissue of C. crysos enabled to distinguish the platforms with PW discharge from the platform without discharge. Trace elements concentrations reflected the background levels and were not influenced by the PW release.

  1. MODELING OF YIELD AND QUALITY OF TABLE ROOT CROPS WITH THE USE OF DIFFERENT AGROTECHNICAL METHODS

    Directory of Open Access Journals (Sweden)

    S. M. Nadezhkin

    2017-01-01

    Full Text Available The effects of different fertilizer rates, irrigation, sowing rate for carrot and red beet were studied in the field condition in food-hills zone of Chechen Republic. The use of N40-80P40-80K40-80 caused the increase in yield from 22.8 to 30.8-33.2 t/ha or by 35-46%, when cultivating a carrot crop. Under irrigation the yield increases by 30-33%. Application of N40P40K40 and maintenance of soil moisture at 70% of moisture rate provoked the improvement in value, market and biochemical characteristics of roots; where the increased contents of dry matter, total sugar and vitamins were observed. The mathematical modeling for the process of yielding abilities and root quality in carrot and red beet showed that highest productivity can be achieved on chernozem soil at Central Pre-Caucasus zone when the level of mineral plant nutrition was N40-60P40-60K40-60. The further increment in fertilizer doses does not bring an improvement to yields and leads to decrease in quality of yields. The increased level of antecedent soil water moisture 70-75% of moisture rates does not raise the yield, on the contrary decreasing at the same time the root quality. The use of mathematical modeling enables to rationally define the fertilizer rates depending on application of irrigation and sowing rates in cultivation of carrot and red beet.

  2. Adenovirus-mediated interleukin-12 gene transfer combined with cytosine deaminase followed by 5-fluorocytosine treatment exerts potent antitumor activity in Renca tumor-bearing mice

    International Nuclear Information System (INIS)

    Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo

    2005-01-01

    Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers

  3. IMPORTANCE OF THE LEPTIN/GRELIN RATIO AS A BIOMARKER IN DIETARY INDUCED HYPERLIPIDEMIA IN FEMALE C57Black/6 MICE

    Directory of Open Access Journals (Sweden)

    N. A. Riger

    2018-01-01

    total body fat deposition was found. The relationship between the L/Gh and the fat mass was confirmed by the linear regression relationship between the indicators considered. We have also found a correlation between L/Gh and animal fat weight (r = 0.424, α = 0.004, relative mass of adipose tissue (r = 0.663, α = 0.000, liver (r = -0.315, α = 0.035 and spleen (r = -0.585; α = 0.000, statistically significant correlations between L/Gh, organ and tissue weight and concentrations of IL-12(p40, IL-2, IL-9, IL-13, G-CSF and RANTES. In addition, significant differences were found between the control and test groups for plasma concentrations of G-CSF, IL-12(p40, IL-2, IL-3 and IL-9. The IL-12(p40 concentration in plasma from the group 2 mice was the lowest against controls. Meanwhile, the 6th group exhibited highest IL-12(p40 levels against the lowest L/Gh ratios and total fat levels.Thus, a significant relationship was found between L/Gh ratio and changing mass of organs and tissues, as well as with the levels of cytokines involved into the regulation of inflammation. The most significant relationship was found between the relative mass of body fat, L/Gh ratio and the IL-12(p40 concentration. L/ Gh ratio and IL-12p(40 showed both content Not only a correlation dependence, but also significant changes were noted between the experimental groups in the in vivo model of alimentary dyslipidemia in mice.

  4. Reevaluation and reclassification of resected lung carcinomas originally diagnosed as squamous cell carcinoma using immunohistochemical analysis

    Science.gov (United States)

    Kadota, Kyuichi; Nitadori, Jun-ichi; Rekhtman, Natasha; Jones, David R.; Adusumilli, Prasad S.; Travis, William D.

    2015-01-01

    Currently, non-small cell lung carcinomas are primarily classified by light microscopy. However, recent studies have shown that poorly-differentiated tumors are more accurately classified by immunohistochemistry. In this study, we investigated the use of immunohistochemical analysis in reclassifying lung carcinomas that were originally diagnosed as squamous cell carcinoma. Tumor slides and blocks were available for histologic evaluation, and tissue microarrays were constructed from 480 patients with resected lung carcinomas originally diagnosed as squamous cell carcinoma between 1999 and 2009. Immunohistochemistry for p40, p63, thyroid transcription factor-1 (TTF-1; clone SPT24 and 8G7G3/1), Napsin A, Chromogranin A, Synaptophysin, and CD56 were performed. Staining intensity (weak, moderate, or strong) and distribution (focal or diffuse) were also recorded. Of all, 449 (93.5%) patients were confirmed as having squamous cell carcinomas; the cases were mostly diffusely positive for p40 and negative for TTF-1 (8G7G3/1). Twenty cases (4.2%) were reclassified as adenocarcinoma since they were positive for TTF-1 (8G7G3/1 or SPT24) with either no or focal p40 expression, and all of them were poorly-differentiated with squamoid morphology. In addition, 1 case was reclassified as adenosquamous carcinoma, 4 cases as large cell carcinoma, 4 cases as large cell neuroendocrine carcinoma, and 2 cases as small cell carcinoma. In poorly-differentiated non-small cell lung carcinomas, an accurate distinction between squamous cell carcinoma and adenocarcinoma cannot be reliably determined by morphology alone and requires immunohistochemical analysis, even in resected specimens. Our findings suggest that TTF-1 8G7G3/1 may be better suited as the primary antibody in differentiating adenocarcinoma from squamous cell carcinoma. PMID:25871623

  5. Tributyltin exposure alters cytokine levels in mouse serum.

    Science.gov (United States)

    Lawrence, Shanieek; Pellom, Samuel T; Shanker, Anil; Whalen, Margaret M

    2016-11-01

    Tributyltin (TBT), a toxic environmental contaminant, has been widely utilized for various industrial, agricultural and household purposes. Its usage has led to a global contamination and its bioaccumulation in aquatic organisms and terrestrial mammals. Previous studies suggest that TBT has debilitating effects on the overall immune function of animals, rendering them more vulnerable to diseases. TBT (at concentrations that have been detected in human blood) alters secretion of inflammatory cytokines from human lymphocytes ex vivo. Thus, it is important to determine if specified levels of TBT can alter levels of cytokines in an in vivo system. Mice were exposed to biologically relevant concentrations of TBT (200, 100 or 25 nM final concentrations). The quantitative determination of interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL2, IL5, IL7, IL12βp40, IL13, IL15, keratinocyte chemoattractant (KC), macrophage inflammatory protein 1β (MIP), MIP2 and regulated on activation normal T-cell-expressed and secreted (RANTES) was performed in mouse sera by MAGPIX analysis and Western blot. Results indicated alterations (both decreases and increases) in several cytokines. The pro-inflammatory cytokines IFNγ, TNFα, IL-1β, IL-2, IL5, IL12βp40 and IL-15 were altered as were the chemokines MIP-1 and RANTES and the anti-inflammatory cytokine IL-13. Increases in IFNγ and TNFα were seen in the serum of mice exposed to TBT for less than 24 h. Levels of IL1β, IL-12 βp40, IL-5 and IL-15 were also modulated in mouse serum, depending on the specific experiment and exposure level. IL-2 was consistently decreased in mouse serum when animals were exposed to TBT. There were also TBT-induced increases in MIP-1β, RANTES and IL-13. These results from human and murine samples clearly suggest that TBT exposures modulate the secretion inflammatory cytokines.

  6. Tributyltin Exposure Alters Cytokine Levels in Mouse Serum

    Science.gov (United States)

    Lawrence, Shanieek; Pellom, Samuel T.; Shanker, Anil; Whalen, Margaret M.

    2016-01-01

    Tributyltin (TBT), a toxic environmental contaminant, has been widely utilized for various industrial, agricultural and household purposes. Its usage has led to a global contamination and its bioaccumulation in aquatic organisms and terrestrial mammals. Previous studies suggest that TBT has debilitating effects on the overall immune function of animals, rendering them more vulnerable to diseases. TBT (at concentrations that have been detected in human blood) alters secretion of inflammatory cytokines from human lymphocytes ex vivo. Thus, it is important to determine if specified levels of TBT can alter levels of cytokines in an in vivo system. Mice were exposed to biologically relevant concentrations of TBT (200, 100 or 25 nM final concentrations). The quantitative determination of interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL2, IL5, IL7, IL12βp40, IL13, IL15, KC, MIP1β, MIP2 and RANTES was performed in mouse sera by MAGPIX analysis and Western blot. Results indicated alterations (both decreases and increases) in several cytokines. The pro-inflammatory cytokines IFNγ, TNFα, IL-1β, IL-2, IL5, IL12βp40, and IL-15 were altered as were the chemokines MIP-1 and RANTES and the anti-inflammatory cytokine IL-13. Increases in IFNγ and TNFα were seen in serum of mice exposed to TBT for less than 24 hr. IL1-β, IL-12βp40, IL-5 and IL-15 were also modulated in mouse serum depending on the specific experiment and the exposure concentration. IL-2 was consistently decreased in mouse serum when animals were exposed to TBT. There were also TBT-induced increases in MIP-1β, RANTES, and IL-13. These results from human and murine samples clearly suggest that TBT exposures modulate the secretion inflammatory cytokines. PMID:27602597

  7. Diffusion, capture and recycling of SCAR/WAVE and Arp2/3 complexes observed in cells by single-molecule imaging

    Science.gov (United States)

    Millius, Arthur; Watanabe, Naoki; Weiner, Orion D.

    2012-01-01

    The SCAR/WAVE complex drives lamellipodium formation by enhancing actin nucleation by the Arp2/3 complex. Phosphoinositides and Rac activate the SCAR/WAVE complex, but how SCAR/WAVE and Arp2/3 complexes converge at sites of nucleation is unknown. We analyzed the single-molecule dynamics of WAVE2 and p40 (subunits of the SCAR/WAVE and Arp2/3 complexes, respectively) in XTC cells. We observed lateral diffusion of both proteins and captured the transition of p40 from diffusion to network incorporation. These results suggest that a diffusive 2D search facilitates binding of the Arp2/3 complex to actin filaments necessary for nucleation. After nucleation, the Arp2/3 complex integrates into the actin network and undergoes retrograde flow, which results in its broad distribution throughout the lamellipodium. By contrast, the SCAR/WAVE complex is more restricted to the cell periphery. However, with single-molecule imaging, we also observed WAVE2 molecules undergoing retrograde motion. WAVE2 and p40 have nearly identical speeds, lifetimes and sites of network incorporation. Inhibition of actin retrograde flow does not prevent WAVE2 association and disassociation with the membrane but does inhibit WAVE2 removal from the actin cortex. Our results suggest that membrane binding and diffusion expedites the recruitment of nucleation factors to a nucleation site independent of actin assembly, but after network incorporation, ongoing actin polymerization facilitates recycling of SCAR/WAVE and Arp2/3 complexes. PMID:22349699

  8. Anti-inflammatory Flavonoid C-Glycosides from Piper aduncum Leaves.

    Science.gov (United States)

    Thao, Nguyen Phuong; Luyen, Bui Thi Thuy; Widowati, Wahyu; Fauziah, Nurul; Maesaroh, Maesaro; Herlina, Tati; Manzoor, Zahid; Ali, Irshad; Koh, Young Sang; Kim, Young Ho

    2016-11-01

    Four new compounds, acacetin 8-C-[ β -D-apiofuranosyl-(1 → 2)- β -D-glucopyranoside] ( 1 ), 7-methoxyacacetin 8-C-[ β -D-apiofuranosyl-(1 → 3)- β -D-glucopyranoside] ( 2 ), 7-methoxyacacetin 8-C-[ β -D-glucopyranosyl-(1 → 2)- β -D-glucopyranoside] ( 3 ), and 4‴-O-acetylacacetin 8-C-[ α -L-rhamnopyranosyl-(1 → 2)- β -D-glucopyranoside] ( 4 ), along with ten known compounds ( 5 - 14 ), were isolated from Piper aduncum leaves. The effects of these compounds on lipopolysaccharide-induced expression of the proinflammatory cytokines IL-12 p40, IL-6, and TNF- α in bone marrow-derived dendritic cells were evaluated. Compounds 2, 3, 6, 8, 9 , and 11 - 13 inhibited the production of both IL-12 p40 and IL-6, with IC 50 values ranging from 0.35 ± 0.01 to 1.40 ± 0.04 µM and 1.22 ± 0.02 to 3.79 ± 0.10 µM, respectively. Compounds 5 and 10 only showed strong inhibition effects on the production of IL-12 p40, with IC 50 values of 2.76 ± 0.08 and 0.39 ± 0.05 µM, respectively. However, all compounds showed weak activity or no activity on TNF- α production at the tested concentrations. Georg Thieme Verlag KG Stuttgart · New York.

  9. Ginger Extract Reduces the Expression of IL-17 and IL-23 in the Sera and Central Nervous System of EAE Mice.

    Science.gov (United States)

    Jafarzadeh, Abdollah; Azizi, Sayyed-Vahab; Nemati, Maryam; Khoramdel-Azad, Hossain; Shamsizadeh, Ali; Ayoobi, Fatemeh; Taghipour, Zahra; Hassan, Zuhair Mohammad

    2015-12-01

    IL-17/IL-23 axis plays an important role in the pathogenesis of several autoimmune diseases such as experimental autoimmune encephalomyelitis (EAE) and multiple sclerosis (MS). The immunomodulatory properties of ginger are reported in previous studies. To evaluate the effects of ginger extract on the expression of IL-17 and IL-23 in a model of EAE. EAE was induced in C57BL/6 mice by immunization with myelin oligodendroglial glycoprotein and then treated with PBS or ginger extracts, from day +3 to +30. At day 31, mice were scarificed and the expression of IL-17 and IL-23 mRNA in spinal cord were determined by using real time-PCR. The serum levels of cytokines were measured by ELISA. The mRNA expression of IL-17, IL-23 P19 and IL-23 P40 in CNS and serum levels of IL-17 and IL-23 were significantly higher in PBS-treated EAE mice than non-EAE group (pginger-treated EAE mice the mRNA expression of IL-17, P19 and P40 in CNS and serum IL-23 levels were significantly decreased as compared to PBS-treated EAE mice (pginger-treated EAE group had significantly lower expression of IL-17, P19 and P40 in CNS and lower serum IL-17 and IL-23 levels than PBS-treated EAE group (pGinger extract reduces the expression of IL-17 and IL-23 in EAE mice. The therapeutic potential of ginger for treatment of MS could be considered in further studies.

  10. In vitro anti-inflammatory components isolated from the carnivorous plant Nepenthes mirabilis (Lour.) Rafarin.

    Science.gov (United States)

    Thao, Nguyen Phuong; Luyen, Bui Thi Thuy; Koo, Jung Eun; Kim, Sohyun; Koh, Young Sang; Thanh, Nguyen Van; Cuong, Nguyen Xuan; Kiem, Phan Van; Minh, Chau Van; Kim, Young Ho

    2016-01-01

    Nepenthes mirabilis (Lour.) Rafarin (Nepenthaceae) is a carnivorous plant used as a folk medicine in the treatment of jaundice, hepatitis, gastric ulcers, ureteral stones, diarrhea, diabetes, and high blood pressure. Neither the phytochemical content nor biological activities of N. mirabilis have been reported. The anti-inflammatory activity from the N. mirabilis methanolic extract led to the isolation of compounds (1-26). Chromatographic methods were used to isolate compounds from the methanol extract of N. mirabilis branches and leaves. The anti-inflammatory activity of these isolated compounds was investigated in lipopolysaccharide (LPS)-stimulated bone marrow-derived dendritic cells (BMDCs) using ELISA. Primary BMDCs were used to examine the production of pro-inflammatory cytokines (IL-12 p40, IL-6, and TNF-α, at concentrations of 0.1, 0.2, and 1.0 μM) as compared with a positive control, SB203580 (1.0 μM). MTT assays showed that isolated compounds (1-26) did not exhibit significant cytotoxicity at concentrations up to 20.0 μM. Compound 9 showed potent inhibition of IL-12 p40, IL-6, and TNF-α production (IC50 = 0.17 ± 0.02, 0.46 ± 0.01, and 8.28 ± 0.21 μM, respectively). Compound 4 showed potent inhibition of IL-12 p40 and IL-6 production (IC50 = 1.17 ± 0.01 and 2.15 ± 0.04 μM). In addition, IL-12 p40 inhibition by naphthalene derivatives (1-7, 9, and 10), phenolic compounds (11-15), lupeone (18), and flavonoids (22, 25, and 26) was more potent than with the positive control. The isolated compounds exhibited little and/or no inhibitory effects on TNF-α production in LPS-stimulated BMDCs. Taken together, these data suggest that the isolated components have significant inhibitory effects on pro-inflammatory cytokine production and warrant further study concerning their potential medicinal use.

  11. Coast of California Storm and Tidal Waves Study. Southern California Coastal Processes Data Summary,

    Science.gov (United States)

    1986-02-01

    1950-76 (from Brownlie and Taylor, 1981). -42- U r4 P4 V - (1 ,i UU~ll ,,It,,. * *** *i .o o9 o4V4 cc ",,,.I ,- %4 6P atar 4 P40.U0 41 u 1 ඄ 4 .1...Each of these summaries reviews hundreds of scientific papers dealing with California shelf marine geology, chemistry, biology , climatology and...wave action, rain, water, and wind processes, natural or induced landslides, and animal and human activity. Erosion related to animals consists primarily

  12. The antitumor effects of interleukin 12 gene on colon cancer in vitro

    International Nuclear Information System (INIS)

    Xing Chungen; Qian Jianxing; Zhou Liying; Chen Yiren

    2004-01-01

    Objective: To construct a Retroviral vector (GCXEXPN-mIL12) which can coexpress p35 and p40 and establish a PA317-mIL12 packaging cell system which has a sufficient expression quantity of mIL12 and a good biological activity. To observe the effects of PA317-mIL12 on the cancer cell cidal action of human peripheral lymphocyte in vitro. Methods: The full-length cDNA encoding mouse IL12 subunits p35 and p40 were amplified by polymerase chain reaction (PCR) separately. The polycistronic retroviral vector (pGCXEXPN-mIL12) was constructed in which both p35 and p40 were linked with internal ribosome entry site (IRES) from encephalomyocarditis virus and poliovirus by cohesive end ligation action. Subsequently the monophilic retrovirus packaging cell strain (PE 501) was transfected by pGCXEXPN-mIL12 with the method of electroporation. Then the packaging cells (PA317) transfected with bi-ophilic retroviral in viral supernatant were monocloned after screening with G-418 for 4 weeks. The PA317-mIL12 was generated and its virus titre was determined by NIH373. The mIL12 concentration in supernatant of PA317-mIL12 was measured by enzyme-linked immunosorbent assay (ELISA) and its biological activity measured by the method off spleen lymphocyte proliferation. The human colon adenocarcinoma cells (Lovo) were co-incubated with human peripheral blood mononuclear cells and PA317-mIL12. The killing rate of lymphocytes to Lovo was measured by MTT assay. Results: The concentration of mIL12 in the supernatant of PA317-mIL12 reached 27 ng/10 6 /48 hrs and PA317-mIL12 could promote the spleen lymphocytic proliferation just like standard mIL12. The study also showed that the cell-mediated cytotoxicity of lymphocyte was enhanced by PA317-mIL12. The MTT result of experiment group was significantly differ from that of control group (P<0.05). Conclusion: The mIL12 gene transfer system (PA317-mIL12) which can express both p35 and p40 and has potential biological activity can obviously enhance the

  13. PAFR activation of NF-?B p65 or p105 precursor dictates pro- and anti-inflammatory responses during TLR activation in murine macrophages

    OpenAIRE

    Ishizuka, Edson K.; Filgueiras, Luciano Ribeiro; Rios, Francisco J.; Serezani, Carlos H.; Jancar, Sonia

    2016-01-01

    Platelet-activating factor receptor (PAFR) is a G protein-coupled receptor (GPCR) implicated in many diseases. Toll-like receptors (TLRs) play a critical role in shaping innate and adaptive immune responses. In this study, we investigated whether PAFR signaling changes the macrophages responsiveness to agonists of TLR2 (Pam3Cys), TLR4 (LPS), and TLR3 agonist Poly(I:C). Exogenous PAF inhibited the production of pro-inflammatory cytokines (IL-12p40, IL-6, and TNF-α) and increased anti-inflammat...

  14. HPV-related Multiphenotypic Sinonasal Carcinoma

    DEFF Research Database (Denmark)

    Bishop, Justin A; Andreasen, Simon; Hang, Jen-Fan

    2017-01-01

    . Immunohistochemistry for p16, c-kit, and myoepithelial cell markers (S100, actin, calponin, p63, and/or p40) was performed along with RNA in situ hybridization for HPV (type 33-specific as well as a high-risk cocktail). Fluorescence in situ hybridization studies for fusions of MYB, NFIB, and MYBL1 was performed...... gene fusions were positive. In the 38 cases with follow-up data, (mean follow-up, 42 mo) 14 recurred locally and 2 metastasized (lung, finger). There were no regional lymph node metastases, and no tumor-related deaths. HMSC is a distinct sinonasal neoplasm characterized by myoepithelial differentiation...

  15. Predictive validity and immune cell involvement in the pathogenesis of piroxicam-accelerated colitis in interleukin-10 knockout mice

    DEFF Research Database (Denmark)

    Holgersen, Kristine; Kvist, Peter Helding; Hansen, Axel Jacob Kornerup

    2014-01-01

    Piroxicam administration is a method for induction of enterocolitis in interleukin-10 knockout (IL-10 k.o.) mice. The piroxicam-accelerated colitis (PAC) IL-10 k.o. model combines a dysregulated immune response against the gut microbiota with a decreased mucosal integrity. The predictive validity...... and pathogenic mechanisms of the model have not been thoroughly investigated. In this study, IL-10 k.o. mice received piroxicam in the chow, and model qualification was performed by examining the efficacy of prophylactic anti-IL-12/23p40 monoclonal antibody (mAb), anti-TNFαmAb, cyclosporine A (CsA) and oral...

  16. Computation of Propagation Speed and Reflection of Axially Symmetric Waves in Composite Cylinders, with Application to Impedance Tube and Calibrator.

    Science.gov (United States)

    1982-08-25

    hoth real and complex; and () compute the propagation speed in the acoustic cal Ibr:ator. (continued on reverse) DD IARM3 1473 EDITION OF I NOVSSIS...FORMAT (3F15.0) 0131 GO TO 230 0132 690 CONTINUE 0133 END 50 *> SUBROUTINES SUBROUTINE: DET C C SUBROUTINE DET C DECEMBER, 1980 C EDITED BY TINA RUGGIERO...33 AISA =AKDA/BAMS 0008 02A=AKA**’-AKDA**2 0009 S2A=AKA**2-AKSA**2 0010 IF (RHM) 65P65P40 0011 40 AKFA-AKDA/COCD 0012 OF2A-AKA**2-AKFA**2 0013 IF (OF2A

  17. Mapa del proteoma de parásitos de Leishmania Viannia a partir de electroforesis de geles de poliacramida en dos dimensiones y otras técnicas asociadas

    OpenAIRE

    Rafael Góngora; Nathalie Acestor; Manfredo Quadroni; Nicolas Fasel; Nancy G. Saravia; John Walker

    2003-01-01

    En este estudio demostramos el potencial de la electroforesis en dos dimensiones (2DE) como herramienta para la caracterización del proteoma de Leishmania (expresión proteica complementaria del genoma). Los proteomas por 2DE en el rango neutro (pH 5-7) de extractos solubles de promastigotes de Leishmania (Viannia) guyanensis y Leishmania (Viannia) panamensis fueron reproducibles usando tampón de lisis de urea y nonidet P-40. Con la tinción de azul de Coomassie y nitrato de plata se detectaron...

  18. Air University Library Index to Military Periodicals. January - March 1994. Volume 45, Number 1

    Science.gov (United States)

    1994-03-01

    33d) Avidea Oto !& in El Salvador. Marcos R. Mendez , Capt -pojcto Ary Gordon R. force aules *0 . - 1-0da hifs. Military Intelligence 20 no 4 -tcon. pr...Avn) ready -n integraed Army. Military Engineer 86 so 562 (Mar-Apr Weekly 21 no 9 (MarS5 󈨢): p2l-22 CAro L mbom .2dLL iflu. National 󈨢): p40-41 See...during El Salvador’s *94) ~ ~ ~ ~ 0 p1 SNC ader. Bernard Adeisberger. illus transition to pec.Marcos R. Mendez .’ft p1-15N tab. Army Tineess 4 no35(Mar

  19. Porcine blood mononuclear cell cytokine responses to PAMP molecules: comparison of mRNA and protein production

    DEFF Research Database (Denmark)

    Sørensen, Nanna Skall; Skovgaard, Kerstin; Heegaard, Peter M. H.

    2011-01-01

    Pathogen-associated molecular patterns (PAMPs) are conserved molecules of microorganisms inducing innate immune cells to secrete distinct patterns of cytokines. In veterinary species, due to a lack of specific antibodies, cytokines are often monitored as expressed mRNA only. This study investigated...... the induction of IFN-α, IL-12 p40, IL-1β, TNF-α, IL-6 and IL-10 by PAMP-molecules [CpG oligonucleotide D19 (CpG), peptidoglycan (PGN), lipopolysaccharide (LPS), Pam3Cys and poly-U] in porcine blood mononuclear cells (BMC) within a 24h period. As expected, cytokine responses were PAMP-specific, CpG inducing IFN...

  20. Enhancement of Muramyldipeptide (MDP) Immunostimulatory Activity by Controlled Multimerization on Dendrimers

    DEFF Research Database (Denmark)

    Sørensen, Nanna Skall; Boas, Ulrik; Heegaard, Peter M. H.

    2011-01-01

    Peptidoglycan is a widespread bacterial PAMP molecule and a powerful initiator of innate immune responses. It consists of repeating units of MDP, which as a monomer is only weakly immunostimulatory. Here, MDP-coupled dendrimers were prepared and investigated for stimulation of pig blood mononuclear...... cells. Compared to monomeric MDP, MDP-dendrimers induced a markedly enhanced production of IL-12 p40, IL-1β and IL-6 and completely down-regulated surface expression of B7 and MHC class II. These results suggest a possible novel strategy based on controlled multimerization of minimal PAMP motifs...... on dendrimers for preparing molecularly defined immunostimulators with predictable bioactivities....

  1. The effect of type of rooting material and space allowance on exploration and abnormal behaviour in growing pigs

    DEFF Research Database (Denmark)

    Jensen, Margit Bak; Studnitz, Merete; Pedersen, Lene Juul

    2010-01-01

    manipulated rooting material more (23% vs. 18% of pigs; P mates less (2.2% vs. 3.0% of the pigs; P ...%, 40% and 7% of pigs at 09.00, 10.00 and 13.00 h, respectively; P mates (4.1%, 2.1% and 1.5% of the pigs at 09.00, 10.00 and 13.00 h, respectively; P ... manipulated the rooting material more. Finally, increased manipulation of pen mates and pen components just before allocation of new rooting material suggest that the amount available just before the next allocation was insufficient to maintain material manipulation....

  2. Regulation of MDM2 Activity by Nucleolin

    Science.gov (United States)

    2005-06-01

    the mock- treated ceIlls (from 4.5 to 2.9%). In other words, over-expression of nucleolin stimulates apoptosis under normal growth conditions, but...yeast cells with PBS, and then incubated with P13S containing 0.5% Nonidet P-40. Cover- bI using 2-5- to 50-i.m glass beads in uracil RIPA buffer (50 mM...followed by incubation to bind the GST- PBS containing 0.5% Tween 20 and mounted onto glass slides, Fluorescent nucleolin proteins. After three washes with a

  3. The kinematic Stirling engine as an energy conversion subsystem for paraboloidal dish solar thermal plants

    Science.gov (United States)

    Bowyer, J. M.

    1984-01-01

    The potential of a suitably designed and economically manufactured Stirling engine as the energy conversion subsystem of a paraboloidal dish-Stirling solar thermal power module was estimated. Results obtained by elementary cycle analyses were shown to match quite well the performance characteristics of an advanced kinematic Stirling engine, the United Stirling P-40, as established by current prototypes of the engine and by a more sophisticated analytic model of its advanced derivative. In addition to performance, brief consideration was given to other Stirling engine criteria such as durability, reliability, and serviceability. Production costs were not considered here.

  4. Improved Second-Generation 3-D Volumetric Display System. Revision 2

    Science.gov (United States)

    1998-10-01

    computer control, uses infrared lasers to address points within a rare-earth-infused solid glass cube. Already, simple animated computer-generated images...Volumetric Display System permits images to be displayed in a three- dimensional format that can be observed without the use of special glasses . Its...MM 120 nm 60 mm nI POLARIZING I $-"• -’’""BEAMSPLI’i-ER ) 4P40-MHz 50-MHz BW PLRZN i TeO2 MODULATORS TeO2 DEFLECTORS Figure 1-4. NEOS four-channel

  5. A Comprehensive Study of the Tocks Island Lake Project and Alternatives. Part C. Analysis of Alternatives to Supply Resource Needs

    Science.gov (United States)

    1975-06-01

    power. It requires no boiler ; needs no water for cooling; involves minimal siting, housing and foundation problems; and requires a minimum of power...8217-P I .U)0 5 4 co 0) 0 $4 t ) 5 U) . U) 0 CL 0 410 0 P40 O0 o 0 C 0 z 0 r. c H r- caH A 4jdr-00 Uj :HO HHO 0)HO OHd O Hr 00 0 10 OE4-4 P4;1pm46 H XVI

  6. 2011 JSOU and NDIA SO/LIC Division Essays

    Science.gov (United States)

    2011-07-01

    Khakrez dataset with broad-brush strokes , we focus more specifically on the common linkages between the two dominant tribes: the Popolzai and Alikozai...consequently only one potential heat source for IR-guided MANPADS versus the AC-130’s four engines. Cost. The OA-X would also be considerably more...Col. Philip Cochran flew P-40s in North Africa and Lt. Col. John Alison flew them with the Flying Tigers in China.32 AFSOC should supplement its

  7. Ultra Low Loss Optical Fiber Cable Assemblies. Volume 2.

    Science.gov (United States)

    1983-06-07

    AND CABLE ASSEMBLY TEST PLAN I Part 1: CABLE TEST PLAN for U. S. ARMY CORADCOM Fort Monmouth, New Jersey 9~Contract # DA -A B07-78-C-29ZZ * Prepared by...VICES$ 1TEST OArg sMATED UTZx ccwITE I INSERTION LOSS £P40,,T PdA. "AT1 NO. ’we Uva ITS R.H. REQUECZ=ENT: The insertion loss of a mated =ai.r of...16(m separation between the rear of the con- nectar and the first turn on the mandrel. After which the plug and receptacle were mated, the mounting

  8. Neutralization of Human Interleukin 23 by Multivalent Nanobodies Explained by the Structure of Cytokine-Nanobody Complex.

    Science.gov (United States)

    Desmyter, Aline; Spinelli, Silvia; Boutton, Carlo; Saunders, Michael; Blachetot, Christophe; de Haard, Hans; Denecker, Geertrui; Van Roy, Maarten; Cambillau, Christian; Rommelaere, Heidi

    2017-01-01

    The heterodimeric cytokine interleukin (IL) 23 comprises the IL12-shared p40 subunit and an IL23-specific subunit, p19. Together with IL12 and IL27, IL23 sits at the apex of the regulatory mechanisms shaping adaptive immune responses. IL23, together with IL17, plays an important role in the development of chronic inflammation and autoimmune inflammatory diseases. In this context, we generated monovalent antihuman IL23 variable heavy chain domain of llama heavy chain antibody (V HH ) domains (Nanobodies ® ) with low nanomolar affinity for human interleukin (hIL) 23. The crystal structure of a quaternary complex assembling hIL23 and several nanobodies against p19 and p40 subunits allowed identification of distinct epitopes and enabled rational design of a multivalent IL23-specific blocking nanobody. Taking advantage of the ease of nanobody formatting, multivalent IL23 nanobodies were assembled with properly designed linkers flanking an antihuman serum albumin nanobody, with improved hIL23 neutralization capacity in vitro and in vivo , as compared to the monovalent nanobodies. These constructs with long exposure time are excellent candidates for further developments targeting Crohn's disease, rheumatoid arthritis, and psoriasis.

  9. Neutralization of Human Interleukin 23 by Multivalent Nanobodies Explained by the Structure of Cytokine–Nanobody Complex

    Directory of Open Access Journals (Sweden)

    Aline Desmyter

    2017-08-01

    Full Text Available The heterodimeric cytokine interleukin (IL 23 comprises the IL12-shared p40 subunit and an IL23-specific subunit, p19. Together with IL12 and IL27, IL23 sits at the apex of the regulatory mechanisms shaping adaptive immune responses. IL23, together with IL17, plays an important role in the development of chronic inflammation and autoimmune inflammatory diseases. In this context, we generated monovalent antihuman IL23 variable heavy chain domain of llama heavy chain antibody (VHH domains (Nanobodies® with low nanomolar affinity for human interleukin (hIL 23. The crystal structure of a quaternary complex assembling hIL23 and several nanobodies against p19 and p40 subunits allowed identification of distinct epitopes and enabled rational design of a multivalent IL23-specific blocking nanobody. Taking advantage of the ease of nanobody formatting, multivalent IL23 nanobodies were assembled with properly designed linkers flanking an antihuman serum albumin nanobody, with improved hIL23 neutralization capacity in vitro and in vivo, as compared to the monovalent nanobodies. These constructs with long exposure time are excellent candidates for further developments targeting Crohn’s disease, rheumatoid arthritis, and psoriasis.

  10. Neutralization of Human Interleukin 23 by Multivalent Nanobodies Explained by the Structure of Cytokine–Nanobody Complex

    Science.gov (United States)

    Desmyter, Aline; Spinelli, Silvia; Boutton, Carlo; Saunders, Michael; Blachetot, Christophe; de Haard, Hans; Denecker, Geertrui; Van Roy, Maarten; Cambillau, Christian; Rommelaere, Heidi

    2017-01-01

    The heterodimeric cytokine interleukin (IL) 23 comprises the IL12-shared p40 subunit and an IL23-specific subunit, p19. Together with IL12 and IL27, IL23 sits at the apex of the regulatory mechanisms shaping adaptive immune responses. IL23, together with IL17, plays an important role in the development of chronic inflammation and autoimmune inflammatory diseases. In this context, we generated monovalent antihuman IL23 variable heavy chain domain of llama heavy chain antibody (VHH) domains (Nanobodies®) with low nanomolar affinity for human interleukin (hIL) 23. The crystal structure of a quaternary complex assembling hIL23 and several nanobodies against p19 and p40 subunits allowed identification of distinct epitopes and enabled rational design of a multivalent IL23-specific blocking nanobody. Taking advantage of the ease of nanobody formatting, multivalent IL23 nanobodies were assembled with properly designed linkers flanking an antihuman serum albumin nanobody, with improved hIL23 neutralization capacity in vitro and in vivo, as compared to the monovalent nanobodies. These constructs with long exposure time are excellent candidates for further developments targeting Crohn’s disease, rheumatoid arthritis, and psoriasis. PMID:28871249

  11. Ultraviolet spectroscopy of planetary nebulae in the Magellanic Clouds

    International Nuclear Information System (INIS)

    Maran, S.P.; Aller, L.H.; Gull, T.R.; Stecher, T.P.

    1982-01-01

    Ultraviolet spectra of three high excitation planetary nebulae in the Magellanic Clouds (LMC P40, SMC N2, SMC N5) were obtained with the International Ultraviolet Explorer. The results are analyzed together with new visual wavelength spectrophotometry of LMC P40 and published data on SMC N2 and SMC N5 to investigate chemical composition and in particular to make the first reliable estimates of the carbon abundance in extragalactic planetary nebulae. Although carbon is at most only slightly less abundant in the LMC and SMC planetary nebulae than in galactic planetaries, it is almost 40 times more abundant in the SMC planetaries than in the SMC interstellar medium, and is about 6 times more abundant in the LMC planetary than in the LMC interstellar medium. According to our limited sample, the net result of carbon synthesis and convective dredgeup in the progenitors of planetary nebulae, as reflected in the nebular carbon abundance, is roughly the same in the Galaxy, the LMC, and the SMC

  12. Dysregulated Homeostasis of Acetylcholine Levels in Immune Cells of RR-Multiple Sclerosis Patients

    Directory of Open Access Journals (Sweden)

    Maria Di Bari

    2016-11-01

    Full Text Available Multiple sclerosis (MS is characterized by pro-inflammatory cytokine production. Acetylcholine (ACh contributes to the modulation of central and peripheral inflammation. We studied the homeostasis of the cholinergic system in relation to cytokine levels in immune cells and sera of relapsing remitting-MS (RR-MS patients. We demonstrated that lower ACh levels in serum of RR-MS patients were inversely correlated with the increased activity of the hydrolyzing enzymes acetylcholinesterase (AChE and butyrylcholinesterase (BuChE. Interestingly, the expression of the ACh biosynthetic enzyme and the protein carriers involved in non-vesicular ACh release were found overexpressed in peripheral blood mononuclear cells of MS patients. The inflammatory state of the MS patients was confirmed by increased levels of TNFα, IL-12/IL-23p40, IL-18. The lower circulating ACh levels in sera of MS patients are dependent on the higher activity of cholinergic hydrolyzing enzymes. The smaller ratio of ACh to TNFα, IL-12/IL-23p40 and IL-18 in MS patients, with respect to healthy donors (HD, is indicative of an inflammatory environment probably related to the alteration of cholinergic system homeostasis.

  13. Long-Term Effects of Maternal Deprivation on Redox Regulation in Rat Brain: Involvement of NADPH Oxidase

    Directory of Open Access Journals (Sweden)

    Branka Marković

    2017-01-01

    Full Text Available Maternal deprivation (MD causes perinatal stress, with subsequent behavioral changes which resemble the symptoms of schizophrenia. The NADPH oxidase is one of the major generators of reactive oxygen species, known to play a role in stress response in different tissues. The aim of this study was to elucidate the long-term effects of MD on the expression of NADPH oxidase subunits (gp91phox, p22phox, p67phox, p47phox, and p40phox. Activities of cytochrome C oxidase and respiratory chain Complex I, as well as the oxidative stress parameters using appropriate spectrophotometric techniques were analyzed. Nine-day-old Wistar rats were exposed to a 24 h maternal deprivation and sacrificed at young adult age. The structures affected by perinatal stress, cortex, hippocampus, thalamus, and caudate nuclei were investigated. The most prominent findings were increased expressions of gp91phox in the cortex and hippocampus, increased expression of p22phox and p40phox, and decreased expression of gp91phox, p22phox, and p47phox in the caudate nuclei. Complex I activity was increased in all structures except cortex. Content of reduced glutathione was decreased in all sections while region-specific changes of other oxidative stress parameters were found. Our results indicate the presence of long-term redox alterations in MD rats.

  14. Ovarian follicular dynamics and plasma steroid concentrations are not significantly different in ewes given intravaginal sponges containing either 20 or 40 mg of fluorogestone acetate.

    Science.gov (United States)

    Letelier, C A; Contreras-Solis, I; García-Fernández, R A; Ariznavarreta, C; Tresguerres, J A F; Flores, J M; Gonzalez-Bulnes, A

    2009-03-01

    Although various progestagens are often used to induce and synchronize estrus and ovulation in ruminants, concerns regarding residues are the impetus to develop alternative approaches, including reduced doses of progestagens. Therefore, the objective was to determine whether ovarian function was affected by halving the dose of fluorogestone acetate in intravaginal sponges for synchronizing ovulation in sheep during the physiologic breeding season. Twenty Manchega ewes, 4-6-year-old, were randomly allocated to receive an intravaginal sponge containing either 20mg (P20, n=10) or 40 mg of fluorogestone acetate (P40, n=10). Cloprostenol (125 microg) was given at sponge insertion, and all sponges were removed after 6d. Ovarian follicular dynamics (monitored by daily ultrasonography) and other aspects of ovarian function did not differ significantly between the two groups. Ovulatory follicles (OF) grew at a similar growth rate (r=0.62; Pprogesterone concentrations (3.8+/-0.35 ng/mL for P20 and 3.9+/-0.38 ng/mL for P40) were similar. In conclusion, reducing the dose of fluorogestone acetate from 40 to 20mg did not affect significantly ovarian follicular dynamics or other aspects of ovarian function.

  15. DEPRESIÓN EN VIGOR POR ENDOGAMIA Y HETEROSIS PARA EL RENDIMIENTO Y SUS COMPONENTES EN ZAPALLO Cucurbita moschata Duch. Ex Poir INBREEDING DEPRESSION AND HETEROSIS FOR YIELD AND ITS COMPONENTS IN PUMPKIN Cucurbita moschata Duch. Ex Poir

    Directory of Open Access Journals (Sweden)

    Miguel Mariano Espitia Camacho

    2006-06-01

    Full Text Available El estudio tuvo como objetivos estimar la depresión por endogamia (DE y cuatro tipos de heterosis: promedio general (HP, promedio de progenitores (HM, heterobeltiosis (HB y útil (HU, en dos dialélos [uno entre cinco variedades (V y el otro entre cinco líneas endogamicas S1 (LS1, derivadas de éstas], para el rendimiento por planta (PFP, número de frutos por planta (NFP y peso promedio de fruto (PPF. Los 30 genotipos se evaluaron en el municipio de Candelaria (Valle del Cauca, Colombia, en un diseño de bloques completos al azar con cinco repeticiones. Se presentaron diferencias significativas (p 40 % y HU (>60 % en PFP.With the goal of estimating inbreeding depression (DE and the four types of heterosis: general average (HP, mean (HM, heterobeltiosis (HB and standard (HU, in two diallelic [one among five cross pollinated varieties (VAR and the other among five self-pollinated lines S1(LS1, derived from these], for yield/plant (PFP, number of fruits/plant (NFP and weight/fruit (PPF. The 30 genotypes were evaluated using a complete randomized design with five replicates in Candelaria (Valle del Cauca, Colombia . Significant differences (p 40 % and HU (>60 % in PFP.

  16. Effect of Low-Level Laser therapy on the fungal proliferation of Candida albicans

    Science.gov (United States)

    Carneiro, Vanda S. M.; Araújo, Natália C.; Menezes, Rebeca F. d.; Moreno, Lara M.; Santos-Neto, Alexandrino d. P.; Gerbi, Marleny Elizabeth M.

    2016-03-01

    Candida albicans plays an important role in triggering infections in HIV+ patients. The indiscriminate use of antifungals has led to resistance to Candida albicans, which requires new treatment alternatives for oral candidiasis. Low-level laser therapy promotes a considerable improvement in the healing of wounds and in curing illnesses caused by microorganisms. The aim of the present study was to assess the effect of laser radiation on the cell proliferation of Candida albicans in immunosuppressed patients. Six Candida albicans strains that had been isolated from immunosuppressed patients were divided into a control group and experimental groups, which received eight sessions of laser therapy (InGaAlP, λ685nm, P = 30mW, CW, Φ~6 mm and GaAlAs, λ830nm, P = 40mW, CW, Φ~6 mm) using dosimetries of 6J/cm2, 8J/cm2, 10J/cm2 and 12J/cm2 for each wavelength and power. The results were not statistically significant (Kruskal Wallis, p > 0.05), although the proliferation of Candida albicans was lower in some of the experimental groups. The dosimetry of 6J/cm2 (GaAlAs, λ830nm, P = 40mW) provided lower mean scores than the other groups for the growth of Candida. Further studies are required to confirm whetehr laser therapy is a viable option in the treatment of fungal infections.

  17. Th1 Differentiation Drives the Accumulation of Intravascular, Non-protective CD4 T Cells during Tuberculosis.

    Science.gov (United States)

    Sallin, Michelle A; Sakai, Shunsuke; Kauffman, Keith D; Young, Howard A; Zhu, Jinfang; Barber, Daniel L

    2017-03-28

    Recent data indicate that the differentiation state of Th1 cells determines their protective capacity against tuberculosis. Therefore, we examined the role of Th1-polarizing factors in the generation of protective and non-protective subsets of Mtb-specific Th1 cells. We find that IL-12/23p40 promotes Th1 cell expansion and maturation beyond the CD73 + CXCR3 + T-bet dim stage, and T-bet prevents deviation of Th1 cells into Th17 cells. Nevertheless, IL- 12/23p40 and T-bet are also essential for the production of a prominent subset of intravascular CX3CR1 + KLRG1 + Th1 cells that persists poorly and can neither migrate into the lung parenchyma nor control Mtb growth. Furthermore, T-bet suppresses development of CD69 + CD103 + tissue resident phenotype effectors in lung. In contrast, Th1-cell-derived IFN-γ inhibits the accumulation of intravascular CX3CR1 + KLRG1 + Th1 cells. Thus, although IL-12 and T-bet are essential host survival factors, they simultaneously oppose lung CD4 T cell responses at several levels, demonstrating the dual nature of Th1 polarization in tuberculosis. Published by Elsevier Inc.

  18. Sendai virosomal infusion of an adeno-associated virus-derived construct containing neuropeptide Y into primary rat brain cultures.

    Science.gov (United States)

    Wu, P; de Fiebre, C M; Millard, W J; Elmstrom, K; Gao, Y; Meyer, E M

    1995-05-05

    A novel neuronal gene-delivery system was investigated in primary neuron-enriched cultures with respect to driving the expression of neuropeptide Y (NPY). This delivery system consists of an adeno-associated virus-derived (AAV) plasmid, pJDT95npy, encapsulated in reconstituted Sendai virosomes. pJDT95npy contains full length rat NPY cDNA inserted downstream from the P40 promoter in a cap-gene deleted AAV-derived construct. The rep-sequences under control of the P5 and P19 promoters are intact. Virosomally encapsulated pJDT95npy drove the expression of NPY mRNAs, predominantly by P40. Total cellular NPY immunoreactivity and release in the presence of depolarization increased following pJDT95npy-transfection. Neither empty virosomes nor virosomes containing pJDT95 affected NPY mRNA expression or immunoreactivity. This study demonstrates that an AAV-derived plasmid can drive exogenous gene expression in intact neurons after infusion by Sendai virosomes.

  19. PAH assessment in the main Brazilian offshore oil and gas production area using semi-permeable membrane devices (SPMD) and transplanted bivalves

    Science.gov (United States)

    André Lourenço, Rafael; Francisco de Oliveira, Fábio; Haddad Nudi, Adriana; Rebello Wagener, Ângela de Luca; Guadalupe Meniconi, Maria de Fátima; Francioni, Eleine

    2015-06-01

    The Campos Basin is Brazil's main oil and gas production area. In 2013, more than 50 million cubic meters of produced water (PW) was discharged into these offshore waters. Despite the large volumes of PW that are discharged in the Campos Basin each day, the ecological concern of the chemicals in the PW are not completely understood. Polycyclic aromatic hydrocarbons (PAH) are the most important contributors to the ecological hazards that are posed by discharged PW. This study aimed to evaluate the potential bioaccumulation of PAH using transplanted bivalves (Nodipecten nodosus) and semi-permeable membrane devices (SPMD). The study was conducted in two platforms that discharge PW (P19 and P40). Another platform that does not discharge PW (P25) was investigated for comparison with the obtained results. Time-integrated hydrocarbon concentrations using SPMD and transplanted bivalves were estimated from the seawater near the three platforms. The bioaccumulation of the PAH in the transplanted bivalves at platforms P19 and P40 were up to fivefold greater than the bioaccumulation of the PAH at platform P25. The lowest PAH concentrations were estimated for platform P25 (4.3-6.2 ng L-1), and the highest PAH concentrations were estimated for platform P19 (9.2-37.3 ng L-1). Both techniques were effective for determining the bioavailability of the PAH and for providing time-integrated hydrocarbon concentrations regarding oil and gas production activities.

  20. Th1 Differentiation Drives the Accumulation of Intravascular, Non-protective CD4 T Cells during Tuberculosis

    Directory of Open Access Journals (Sweden)

    Michelle A. Sallin

    2017-03-01

    Full Text Available Recent data indicate that the differentiation state of Th1 cells determines their protective capacity against tuberculosis. Therefore, we examined the role of Th1-polarizing factors in the generation of protective and non-protective subsets of Mtb-specific Th1 cells. We find that IL-12/23p40 promotes Th1 cell expansion and maturation beyond the CD73+CXCR3+T-betdim stage, and T-bet prevents deviation of Th1 cells into Th17 cells. Nevertheless, IL- 12/23p40 and T-bet are also essential for the production of a prominent subset of intravascular CX3CR1+KLRG1+ Th1 cells that persists poorly and can neither migrate into the lung parenchyma nor control Mtb growth. Furthermore, T-bet suppresses development of CD69+CD103+ tissue resident phenotype effectors in lung. In contrast, Th1-cell-derived IFN-γ inhibits the accumulation of intravascular CX3CR1+KLRG1+ Th1 cells. Thus, although IL-12 and T-bet are essential host survival factors, they simultaneously oppose lung CD4 T cell responses at several levels, demonstrating the dual nature of Th1 polarization in tuberculosis.

  1. Haloperidol Suppresses NF-kappaB to Inhibit Lipopolysaccharide-Induced Pro-Inflammatory Response in RAW 264 Cells.

    Science.gov (United States)

    Yamamoto, Shunsuke; Ohta, Noriyuki; Matsumoto, Atsuhiro; Horiguchi, Yu; Koide, Moe; Fujino, Yuji

    2016-02-04

    BACKGROUND Haloperidol, a tranquilizing agent, is administered both to treat symptoms of psychotic disorders and to sedate agitated and delirious patients. Notably, haloperidol has been suggested to inhibit the immune response through unknown mechanisms. We hypothesized that the sedative modulates the immune response via NF-κB. MATERIAL AND METHODS Using flow cytometry, we analyzed the effects of haloperidol on expression CD80 and CD86 in RAW 264 cells and in primary macrophages derived from bone marrow. Secretion of interleukin (IL)-1β, IL-6, and IL-12 p40 was measured by enzyme-linked immunosorbent assay. In addition, NF-κB activation was evaluated using a reporter assay based on secretory embryonic alkaline phosphatase. Finally, synthetic antagonists were used to identify the dopamine receptor that mediates the effects of haloperidol. RESULTS Haloperidol inhibited NF-κB activation, and thereby suppressed expression of CD80, as well as secretion of IL-1β, IL-6, and IL-12 p40. CD80 and IL-6 levels were similarly attenuated by a D2-like receptor antagonist, but not by a D1-like receptor antagonist. CONCLUSIONS The data strongly suggest that haloperidol inhibits the immune response by suppressing NF-kB signaling via the dopamine D2 receptor.

  2. Partial purification of elicitors from Lentinula edodes basidiocarps protecting cucumber seedlings against Colletotrichum lagenarium

    Directory of Open Access Journals (Sweden)

    Di Piero Robson M.

    2006-01-01

    Full Text Available The shiitake mushroom (Lentinula edodes has been used in research involving the prevention and the control of human and plant diseases. In cucumber plants, treated with aqueous extracts from mushroom basidiocarps, there was a reduction in anthracnose severity caused by Colletotrichum lagenarium, and an increase in peroxidase activity in the leaves. With the aim of obtaining molecules of agronomic interest, the crude aqueous extract from L. edodes basidiocarp was fractioned with ammonium sulfate. The fraction corresponding to 40-80% of saturation (p40-80, the most effective in reducing anthracnose on cucumber cotyledons, was submitted to anion exchange chromatography (AEC. After AEC, six protein peaks were obtained and the peak V, containing 34% of the proteins present in p40-80, induced peroxidase increase in the cucumber cotyledons besides reducing anthracnose severity. Separation of peak V proteins by SDS-gel electrophoresis revealed the presence of more than one band in the gel. Thus, a partial purification of elicitors present in the L. edodes basidiocarp was achieved.

  3. Targeted Disruption of ALK Reveals a Potential Role in Hypogonadotropic Hypogonadism.

    Directory of Open Access Journals (Sweden)

    Barbara Witek

    Full Text Available Mice lacking ALK activity have previously been reported to exhibit subtle behavioral phenotypes. In this study of ALK of loss of function mice we present data supporting a role for ALK in hypogonadotropic hypogonadism in male mice. We observed lower level of serum testosterone at P40 in ALK knock-out males, accompanied by mild disorganization of seminiferous tubules exhibiting decreased numbers of GATA4 expressing cells. These observations highlight a role for ALK in testis function and are further supported by experiments in which chemical inhibition of ALK activity with the ALK TKI crizotinib was employed. Oral administration of crizotinib resulted in a decrease of serum testosterone levels in adult wild type male mice, which reverted to normal levels after cessation of treatment. Analysis of GnRH expression in neurons of the hypothalamus revealed a significant decrease in the number of GnRH positive neurons in ALK knock-out mice at P40 when compared with control littermates. Thus, ALK appears to be involved in hypogonadotropic hypogonadism by regulating the timing of pubertal onset and testis function at the upper levels of the hypothalamic-pituitary gonadal axis.

  4. Protective Effect of Laminaria japonica with Probiotics on Murine Colitis

    Directory of Open Access Journals (Sweden)

    Seok-Jae Ko

    2014-01-01

    Full Text Available Inflammatory bowel disease (IBD is a chronically relapsing inflammatory disorder of the gastrointestinal tract. Most IBD treatments are unsatisfactory; therefore, various dietary supplements have emerged as promising interventions. Laminaria japonica (LJ is an edible seaweed used to regulate digestive symptoms. Probiotics have been reported to improve digestive problems and their simultaneous administration with seaweeds has been shown to produce synergistic therapeutic effects. Here, we investigated the effect of LJ combination with probiotics on dextran sodium sulfate-induced colitis model in mice. Aqueous LJ extracts (LJE at doses from 100 to 300 mg/kg and probiotics at a dose of 300 mg/kg were orally administered for 7 days. Body weight, colon length, histological score, macroscopic damage, and the levels of cytokines IFN-γ, IL-1β, IL-6, IL-10, IL-12 (P40, IL-12 (P70, IL-17, and TNF-α were assessed. LJE alone caused a significant improvement of colitis signs such as colon length, histological score, and IL-1β and IL-6 production. LJE and probiotics demonstrated a synergistic effect by the histological score and levels of IL-1β, IL-6, and IL-12 (P40 but not IFN-γ, IL-10, and IL-12 (P70. In conclusion, LJE was effective in inducing protection against colitis in mice and acted synergistically with probiotics.

  5. Activation of liver X receptor suppresses the production of the IL-12 family of cytokines by blocking nuclear translocation of NF-κBp50.

    Science.gov (United States)

    Canavan, Mary; McCarthy, Ciara; Larbi, Nadia Ben; Dowling, Jennifer K; Collins, Laura; O'Sullivan, Finbarr; Hurley, Grainne; Murphy, Carola; Quinlan, Aoife; Moloney, Gerry; Darby, Trevor; MacSharry, John; Kagechika, Hiroyuki; Moynagh, Paul; Melgar, Silvia; Loscher, Christine E

    2014-10-01

    There is now convincing evidence that liver X receptor (LXR) is an important modulator of the inflammatory response; however, its mechanism of action remains unclear. This study aimed to examine the effect of LXR on the IL-12 family of cytokines and examined the mechanism by which LXR exerted this effect. We first demonstrated that activation of murine-derived dendritic cells (DC) with a specific agonist to LXR enhanced expression of LXR following activation with LPS, suggesting a role in inflammation. Furthermore, we showed LXR expression to be increased in vivo in dextrane sulphate sodium-induced colitis. LXR activation also suppressed production of IL-12p40, IL-12p70, IL-27 and IL-23 in murine-derived DC following stimulation with LPS, and specifically targeted the p35, p40 and EBI3 subunits of the IL-12 cytokine family, which are under the control of the NF-κB subunit p50 (NF-κBp50). Finally, we demonstrated that LXR can associate with NF-κBp50 in DC and that LXR activation prevents translocation of the p50 subunit into the nucleus. In summary, our study indicates that LXR can specifically suppress the IL-12 family of cytokines though its association with NF-κBp50 and highlights its potential as a therapeutic target for chronic inflammatory diseases. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  6. The effects of concentrate added to pineapple (Ananas comosus Linn. Mer.) waste silage in differing ratios to form complete diets, on digestion, excretion of urinary purine derivatives and blood metabolites in growing, male, Thai swamp buffaloes.

    Science.gov (United States)

    Jetana, T; Suthikrai, W; Usawang, S; Vongpipatana, C; Sophon, S; Liang, J B

    2009-04-01

    Four, male, growing Thai swamp buffaloes (197 +/- 5.3 kg and all 1 year old) were used to evaluate the effects of concentrate added to pineapple waste silage in differing ratios, to form a complete diet, studying in vivo digestion, the rate of passage, microbial protein synthesis and blood metabolites. Animals were fed ad libitum with 4 diets, using four combinations of pineapple waste silage (P) and concentrate (C), in the proportions (on a dry matter basis) of 0.8:0.2 (P80:C20), 0.6:0.4 (P60:C40), 0.4:0.6 (P40:C60) and 0.2:0.8 (P20:C80). The results showed that the intakes of dry matter (DM), organic matter (OM), nitrogen (N), the N-balance, urinary purine derivatives (PD) excretion, the ratios of allantoin to creatinine (CR), PD to CR, the plasma urea-N (PUN) and insulin increased in the animals, but the intake of neutral detergent fiber (NDF), the coefficient of whole tract, apparent digestibility of NDF, the transit time (TT) and the mean retention time (TMRT) decreased, when the proportion of concentrate in the diet increased. This study indicated that the proportion of P40:C60 in the diet produced the best efficiency of urinary PD excretion (mmol) per digestible OM intake (kg DOMI).

  7. Th1 differentiation drives the accumulation of intravascular, non-protective CD4 T cells during tuberculosis

    Science.gov (United States)

    Sallin, Michelle A.; Sakai, Shunsuke; Kauffman, Keith D.; Young, Howard A.; Zhu, Jinfang; Barber, Daniel L.

    2017-01-01

    SUMMARY Recent data indicate that the differentiation state of Th1 cells determines their protective capacity against tuberculosis. Therefore, we examined the role of Th1 polarizing factors in the generation of protective and non-protective subsets of Mtb-specific Th1 cells. We find IL-12/23p40 promotes Th1 cell expansion and maturation beyond the CD73+CXCR3+T-betdim stage, and T-bet prevents deviation of Th1 cells into Th17 cells. Nevertheless, IL-12/23p40 and T-bet are also essential for the production of a prominent subset of intravascular CX3CR1+KLRG1+ Th1 cells that persists poorly and can neither migrate into the lung parenchyma nor control Mtb growth. Furthermore, T-bet suppresses development of CD69+CD103+ tissue resident phenotype effectors in lung. In contrast, Th1 cell-derived IFNγ inhibits the accumulation of intravascular CX3CR1+KLRG1+ Th1 cells. Thus, although IL-12 and T-bet are essential host survival factors, they simultaneously oppose lung CD4 T cell responses at several levels, demonstrating the dual nature of Th1 polarization in tuberculosis. PMID:28355562

  8. Evaluation of viremia, proviral load and cytokine profile in naturally feline immunodeficiency virus infected cats treated with two different protocols of recombinant feline interferon omega.

    Science.gov (United States)

    Leal, Rodolfo O; Gil, Solange; Duarte, Ana; McGahie, David; Sepúlveda, Nuno; Niza, Maria M R E; Tavares, Luís

    2015-04-01

    This study assesses viremia, provirus and blood cytokine profile in naturally FIV-infected cats treated with two distinct protocols of interferon omega (rFeIFN-ω). Samples from FIV-cats previously submitted to two single-arm studies were used: 7/18 received the licensed/subcutaneous protocol (SC) while 11/18 were treated orally (PO). Viremia, provirus and blood mRNA expression of interleukin (IL)-1, IL-4, IL-6, IL-10, IL-12p40, Interferon-γ and Tumor Necrosis Factor-α were monitored by Real-Time qPCR. Concurrent plasma levels of IL-6, IL-12p40 and IL-4 were assessed by ELISA. IL-6 plasma levels decreased in the SC group (p = 0.031). IL-6 mRNA expression (p = 0.037) decreased in the PO group, albeit not sufficiently to change concurrent plasma levels. Neither viremia nor other measured cytokines changed with therapy. Proviral load increased in the SC group (p = 0.031), which can be justified by a clinically irrelevant increase of lymphocyte count. Independently of the protocol, rFeIFN-ω seems to act on innate immunity by reducing pro-inflammatory stimulus. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Tristetraprolin regulation of interleukin 23 mRNA stability prevents a spontaneous inflammatory disease.

    Science.gov (United States)

    Molle, Céline; Zhang, Tong; Ysebrant de Lendonck, Laure; Gueydan, Cyril; Andrianne, Mathieu; Sherer, Félicie; Van Simaeys, Gaetan; Blackshear, Perry J; Leo, Oberdan; Goriely, Stanislas

    2013-08-26

    Interleukin (IL) 12 and IL23 are two related heterodimeric cytokines produced by antigen-presenting cells. The balance between these two cytokines plays a crucial role in the control of Th1/Th17 responses and autoimmune inflammation. Most studies focused on their transcriptional regulation. Herein, we explored the role of the adenine and uridine-rich element (ARE)-binding protein tristetraprolin (TTP) in influencing mRNA stability of IL12p35, IL12/23p40, and IL23p19 subunits. LPS-stimulated bone marrow-derived dendritic cells (BMDCs) from TTP(-/-) mice produced normal levels of IL12/23p40. Production of IL12p70 was modestly increased in these conditions. In contrast, we observed a strong impact of TTP on IL23 production and IL23p19 mRNA stability through several AREs in the 3' untranslated region. TTP(-/-) mice spontaneously develop an inflammatory syndrome characterized by cachexia, myeloid hyperplasia, dermatitis, and erosive arthritis. We observed IL23p19 expression within skin lesions associated with exacerbated IL17A and IL22 production by infiltrating γδ T cells and draining lymph node CD4 T cells. We demonstrate that the clinical and immunological parameters associated with TTP deficiency were completely dependent on the IL23-IL17A axis. We conclude that tight control of IL23 mRNA stability by TTP is critical to avoid severe inflammation.

  10. Targeted Disruption of ALK Reveals a Potential Role in Hypogonadotropic Hypogonadism

    Science.gov (United States)

    Nord, Christoffer; Ahlgren, Ulf; Eriksson, Maria; Vernersson-Lindahl, Emma; Helland, Åslaug; Alexeyev, Oleg A.; Hallberg, Bengt; Palmer, Ruth H.

    2015-01-01

    Mice lacking ALK activity have previously been reported to exhibit subtle behavioral phenotypes. In this study of ALK of loss of function mice we present data supporting a role for ALK in hypogonadotropic hypogonadism in male mice. We observed lower level of serum testosterone at P40 in ALK knock-out males, accompanied by mild disorganization of seminiferous tubules exhibiting decreased numbers of GATA4 expressing cells. These observations highlight a role for ALK in testis function and are further supported by experiments in which chemical inhibition of ALK activity with the ALK TKI crizotinib was employed. Oral administration of crizotinib resulted in a decrease of serum testosterone levels in adult wild type male mice, which reverted to normal levels after cessation of treatment. Analysis of GnRH expression in neurons of the hypothalamus revealed a significant decrease in the number of GnRH positive neurons in ALK knock-out mice at P40 when compared with control littermates. Thus, ALK appears to be involved in hypogonadotropic hypogonadism by regulating the timing of pubertal onset and testis function at the upper levels of the hypothalamic-pituitary gonadal axis. PMID:25955180

  11. Serum cytokine profile and clinicopathological findings in oral lichen planus, oral lichenoid lesions and stomatitis

    Science.gov (United States)

    Johansen, Jeanne Duus; Reibel, Jesper; Zachariae, Claus; Pedersen, Anne Marie Lynge

    2017-01-01

    Abstract The objective of this study was to examine if clinical and histopathological variables in patients with oral lichen planus (OLP), oral lichenoid lesions (OLL), and generalized stomatitis display different cytokine profiles and if concomitant contact allergy influences this profile. Forty‐nine patients and 29 healthy age‐ and gender‐matched subjects were included. Demographic and clinical data immunohistochemical findings in mucosal specimens, results of contact allergy testing, and serum levels of tumor necrosis factor‐α, interferon‐γ, interleukin (IL)‐6, IL‐10, IL‐12p40, and IL‐12p70 were analyzed and compared between groups. Nineteen patients had OLP, primarily with ulcerative lesions on the buccal mucosa, 19 patients had OLL, and 11 patients had generalized stomatitis. All patients had oral symptoms, mainly stinging and burning. Nineteen patients and 10 healthy subjects had contact allergies, primarily to fragrance ingredients. Patient groups did not differ with regard to oral symptoms, clinical pattern of the lesions, or contact allergy. Serum cytokine levels did not differ between the different patient groups and were not related to histopathological findings. The patients had higher levels of IL‐6 than the healthy subjects. Interferon‐γ, IL‐12p40, and IL‐12p70 were below detection limit. Our findings indicate that OLP, OLL, and generalized stomatitis cannot be discriminated by means of the selected serum cytokines, and that the presence of concomitant contact allergy does not influence the cytokine expression. PMID:29744205

  12. Radiation Hardness tests with neutron flux on different Silicon photomultiplier devices

    Science.gov (United States)

    Cattaneo, P. W.; Cervi, T.; Menegolli, A.; Oddone, M.; Prata, M.; Prata, M. C.; Rossella, M.

    2017-07-01

    Radiation hardness is an important requirement for solid state readout devices operating in high radiation environments common in particle physics experiments. The MEG II experiment, at PSI, Switzerland, investigates the forbidden decay μ+ → e+ γ. Exploiting the most intense muon beam of the world. A significant flux of non-thermal neutrons (kinetic energy Ek>= 0.5 MeV) is present in the experimental hall produced along the beam-line and in the hall itself. We present the effects of neutron fluxes comparable to the MEG II expected doses on several Silicon Photomultiplier (SiPMs). The tested models are: AdvanSiD ASD-NUV3S-P50 (used in MEG II experiment), AdvanSiD ASD-NUV3S-P40, AdvanSiD ASD-RGB3S-P40, Hamamatsu and Excelitas C30742-33-050-X. The neutron source is the thermal Sub-critical Multiplication complex (SM1) moderated with water, located at the University of Pavia (Italy). We report the change of SiPMs most important electric parameters: dark current, dark pulse frequency, gain, direct bias resistance, as a function of the integrated neutron fluency.

  13. 2',3-dihydroxy-5-methoxybiphenyl suppresses fMLP-induced superoxide anion production and cathepsin G release by targeting the β-subunit of G-protein in human neutrophils.

    Science.gov (United States)

    Liao, Hsiang-Ruei; Chen, Ih-Sheng; Liu, Fu-Chao; Lin, Shinn-Zhi; Tseng, Ching-Ping

    2018-06-15

    This study investigates the effect and the underlying mechanism of 2',3-dihydroxy-5-methoxybiphenyl (RIR-2), a lignan extracted from the roots of Rhaphiolepis indica (L.) Lindl. ex Ker var. tashiroi Hayata ex Matsum. & Hayata (Rosaceae), on N-formyl-L-methionyl-L-leucyl-L-phenylalanine (fMLP)-induced respiratory burst and cathepsin G in human neutrophils. Signaling pathways regulated by RIR-2 which modulated fMLP-induced respiratory burst were evaluated by an interaction between β subunit of G-protein (Gβ) with downstream signaling induced by fMLP and by immunoblotting analysis of the downstream targets of Gβ-protein. RIR-2 inhibited fMLP-induced superoxide anion production (IC 50 :2.57 ± 0.22 μM), cathepsin G release (IC 50 :18.72 ± 3.76 μM) and migration in a concentration dependent manner. RIR-2 specifically suppresses fMLP-induced Src family kinases phosphorylation by inhibiting the interaction between Gβ-protein with Src kinases without inhibiting Src kinases activities, therefore, RIR-2 attenuated the downstream targets of Src kinase, such as phosphorylation of Raf/ERK, AKT, P38, PLCγ2, PKC and translocation Tec, p47 ph ° x and P40 ph ° x from the cytosol to the inner leaflet of the plasma membrane. Furthermore, RIR-2 attenuated fMLP-induced intracellular calcium mobilization by inhibiting the interaction between Gβ-protein with PLCβ2. RIR-2 was not a competitive or allosteric antagonist of fMLP. On the contrary, phorbol 12-myristate 13-acetate (PMA)-induced phosphorylation of Src, AKT, P38, PKC and membrane localization of p47 ph ° x and P40 ph ° x remained unaffected. RIR-2 specifically modulates fMLP-mediated neutrophil superoxide anion production and cathepsin G release by inhibiting the interaction between Gβ-protein with downstream signaling which subsequently interferes with the activation of intracellular calcium, PLCγ2, AKT, p38, PKC, ERK, p47 ph ° x and p40 phox . Copyright © 2018 Elsevier B.V. All rights reserved.

  14. The role of IL 23 in the treatment of psoriasis.

    Science.gov (United States)

    Puig, Lluís

    2017-06-01

    The IL-23/IL-17 axis is currently considered to be crucial in the pathogenesis of psoriasis. Human IL-23 is primarily produced by antigen-presenting cells and induces and maintains differentiation of Th17 cells and Th22 cells, a primary cellular source of proinflammatory cytokines such as IL-17 and IL-22, which mediate the epidermal hyperplasia, keratinocyte immune activation and tissue inflammation inherent in psoriasis. Agents that target the p40 subunit common to both IL-12 and IL-23 have shown robust clinical activity, but selectivity for IL-23p19 could offer advantages in efficacy and safety with respect to anti-p40 blockade. Areas covered: Relevant references regarding the role of the IL-23/IL-17 pathway in the pathogenesis of psoriasis/psoriatic arthritis and clinical trials with IL-23p40 and IL-23p19 blocking agents were obtained through a literature search in MEDLINE/Pubmed for articles published until November 2016. Moreover, ongoing registered clinical trials (RCTs) of moderate-to-severe psoriasis and psoriatic arthritis were searched through clinicaltrials.gov website, and a manual search was made for pertinent communications at the 2016 American Academy of Dermatology and European Academy of Dermatology and Venereology meetings. Expert commentary: There are potential advantages in selective blockade of the IL23-specific p19 subunit with respect to distal blockade of IL-17A or its receptor. Acting upstream in the IL-23/IL-17 cytokine pathway is likely to reduce the expression of multiple pro-inflammatory cytokines acting on keratinocytes -including IL-17F, IL-21 and IL-22-, in addition to IL-17A. On the other hand, safety data thus far suggest that these drugs might be devoid of some adverse effects of IL-17A blockade that seem to be class related, such as mucocutaneous Candida infections or triggering or worsening of inflammatory bowel disease. Specific IL-23p19 blockade with high-affinity monoclonal antibodies seems to be able to induce long

  15. Utilização de dados parciais na seleção de codornas de corte para produção de ovos

    Directory of Open Access Journals (Sweden)

    Bruno Bastos Teixeira

    2013-05-01

    Full Text Available O objetivo deste trabalho foi verificar a possibilidade de uso de dados parciais na seleção de codornas de corte para produção de ovos. Foram avaliados os grupos genéticos de codornas de corte UFV1 e UFV2, de origens distintas. Utilizaram-se informações de 1.632 matrizes, das quais 816 provieram do grupo genético UFV1, e 816 do grupo UFV2. Os parâmetros genéticos foram obtidos nos períodos parciais da 6ª semana até a 24ª (P24, a 32ª (P32, a 40ª (P40 e a 48ª (P48 semanas, e no período total de produção de ovos(P52, da 6ª à 52ª semana. Os componentes de variância e covariância e os parâmetros genéticos foram estimados pelo método da máxima verossimilhança restrita, pelo modelo animal unicaracterístico. A produção parcial e a total de ovos foram estimadas pelo modelo animal multicaracterístico, por meio do aplicativo Wombat. Para UFV1, os valores de herdabilidade foram: 0,09, P24; 0,09, P32; 0,09, P40; 0,08, P48; e 0,07 para P52; as correlações genéticas variaram de 0,79 a 0,99. Para UFV2, os valores de herdabilidade foram: 0,09, P24; 0,09, P32; 0,10, P40; 0,11, P48; e 0,13 para P52; as correlações variaram de 0,70 a 0,99. Para a seleção de UFV1, recomenda-se considerar a produção de ovos até a 40ª semana e, para UFV2, até a 48ª semana. As baixas estimativas de herdabilidade indicam que se devem fazer mudanças de manejo para controlar os efeitos de ambiente.

  16. Immuno-modulatory activity of Ganoderma lucidum-derived polysacharide on human monocytoid dendritic cells pulsed with Der p 1 allergen

    Directory of Open Access Journals (Sweden)

    Lo Shih-Yen

    2011-05-01

    Full Text Available Abstract Background Ganoderma lucidum-derived polysaccharide (PS-G can rapidly and effectively promote the activation and maturation of immature dendritic cells (DCs, suggesting that PS-G possesses the capacity to regulate immune responses. This study aimed to clarify the immunologic effect of PS-G on monocyte-derived dendritic cells (MD-DCs from asthmatic children allergic to house dust mites. The MD-DCs were stimulated for 24 h with the related allergen, Der p 1, in the presence or absence of PS-G. Cell surface markers and phagocytic capacity were assessed by FACS analysis, and key polarizing cytokines (IL-12 p40, IL-12 p70, IL-6, IL-23, and IL-10 were quantified. The subsequent regulatory effect of pulsed MD-DCs on naïve T cells was evaluated by determining the T-cell cytokine profile. Results PS-G induced the maturation of MD-DCs and decreased phagocytic capacity, even if pulsed with Der p 1. After incubation with PS-G and Der p 1, MD-DCs produced higher amounts of IL-12 p70, IL-12 p40, IL-6, IL-23, and IL10 than Der p 1-pulsed DCs. Furthermore, type 1 helper T (Th1 cell cytokine (INF-γ production was highly increased when naïve autologous T cells were co-cultured with Der p 1-pulsed MD-DCs. Naïve T cells stimulated by MD-DCs pulsed with Der p 1 failed to produce proliferation of T-cells, whereas the addition of PS-G to Der p 1 induced a significant proliferation of T-cells similar to that observed with PS-G alone. Conclusion The presence of PS-G in an allergen pulse promoted allergic MD-DCs to produce IL-12 p70, IL-12 p40, IL-6, IL-23, and IL-10, and exerted an effect on shifting the immune balance towards Th1 in children with allergic asthma.

  17. Cytokine concentration in aqueous humour of eyes with exudative age-related macular degeneration.

    Science.gov (United States)

    Jonas, Jost B; Tao, Yong; Neumaier, Michael; Findeisen, Peter

    2012-08-01

    To measure the concentration of cytokines in the aqueous humour of eyes with exudative age-related macular degeneration (AMD). The clinical interventional study included a study group of 18 patients with exudative AMD and a control group of 20 patients undergoing routine cataract surgery. Age did not vary significantly (p = 0.36) between study group (80.8 ± 6.4 years) and control group (77.0 ± 9.9 years), nor did gender (p = 0.75). During the interventions, aqueous humour samples were obtained, in which the concentration of cytokines was measured using a solid-phase chemiluminescence immunoassay. Macular thickness was measured by optical coherence tomography (OCT). In the study group as compared to the control group, significantly higher concentrations were measured for epithelial growth factor (EGF) (p = 0.017), human growth factor (HGF) (p= 0.048), intercellular adhesion molecule-1 (ICAM1) (p = 0.028), interleukin 12p40 (IL12p40) (p = 0.009), interleukin 1a2 (IL1a2) (p = 0.01), interleukin 3 (IL3) (p = 0.02), interleukin 6 (IL6) (p = 0.006), interleukin 8 (IL8) (p = 0.02), monocyte chemoattractant protein-1 (MCP-1) (p = 0.048), monokine induced by interferon gamma (MIG) (p = 0.016), matrix metalloproteinase 9 (MMP9) (p = 0.004) and plasminogen activator inhibitor 1 (PAI1) (p = 0.006). Macular thickness was significantly associated with the concentrations of EGF (p = 0.001), HGF (p = 0.02), ICAM1 (p = 0.001), interleukin 12p40 (p = 0.006), IL 1a2 (p = 0.002), MIG (p = 0.001), MMP9 (p < 0.001) and PAI1 (p = 0.01). Interleukin 6 and MCP-1 showed significant associations with the height of retinal pigment epithelium detachment. Numerous cytokines are associated with the presence and the amount of exudative AMD. © 2012 The Authors. Acta Ophthalmologica © 2012 Acta Ophthalmologica Scandinavica Foundation.

  18. UVB induces IL-12 transcription in human keratinocytes in vivo and in vitro

    International Nuclear Information System (INIS)

    Enk, C.D.; Blauvet, A.; Katz, S.I.; Mahanty, S.

    1996-01-01

    Human epidermal cells produce a wide range of cytokines, including those characteristic of Th2-like responses such as interleukin (IL)-4 and IL-10. As well, keratinocytes have recently been shown to produce Th1-like cytokines such as IL-12. Exposure to UVB has profound effects on the skin and systemic immune system, which is in part mediated by secretion of tumor necrosis factor (TNF)-α by epidermal cells. Because IL-12 induces production of TNF-α by certain cells of the immune system, we sought to determine whether UVB is an inducer of IL-12 gene expression in epidermal cells. Human epidermal cells were exposed to UVB radiation in vivo, isolated by suction blister technique and trypsinization and transcription of the IL-12 p35 and p40 chains was examined by RT-PCR. (Author)

  19. Absolute spectroscopy near 7.8 μm with a comb-locked extended-cavity quantum-cascade-laser

    KAUST Repository

    Lamperti, Marco; Alsaif, Bidoor; Gatti, Davide; Fermann, Martin; Laporta, Paolo; Farooq, Aamir; Marangoni, Marco

    2018-01-01

    We report for the first time the frequency locking of an extended-cavity quantum-cascade-laser (EC-QCL) to a near-infrared frequency comb. The locked laser source is exploited to carry out molecular spectroscopy around 7.8 μm with a line-centre frequency combined uncertainty of ~63 kHz. The strength of the approach, in view of an accurate retrieval of line centre frequencies over a spectral range as large as 100 cm-1, is demonstrated on the P(40), P(18) and R(31) lines of the fundamental rovibrational band of N2O covering the centre and edges of the P and R branches. The spectrometer has the potential to be straightforwardly extended to other spectral ranges, till 12 μm, which is the current wavelength limit for commercial cw EC-QCLs.

  20. Enzymatic protein hydrolysates from high pressure-pretreated isolated pea proteins have better antioxidant properties than similar hydrolysates produced from heat pretreatment.

    Science.gov (United States)

    Girgih, Abraham T; Chao, Dongfang; Lin, Lin; He, Rong; Jung, Stephanie; Aluko, Rotimi E

    2015-12-01

    Isolated pea protein (IPP) dispersions (1%, w/v) were pretreated with high pressure (HP) of 200, 400, or 600 MPa for 5 min at 24 °C or high temperature (HT) for 30 min at 100 °C prior to hydrolysis with 1% (w/w) Alcalase. HP pretreatment of IPP at 400 and 600 MPa levels led to significantly (P40%) oxygen radical absorption capacity (ORAC) of hydrolysates. 2,2-Diphenyl-1-picrylhydrazyl, superoxide radical and hydroxyl radical scavenging activities of pea protein hydrolysates were also significantly (PProtein hydrolysates from HT IPP showed no ORAC, superoxide or hydroxyl scavenging activity but had significantly (Pprotein hydrolysates had weaker antioxidant properties than glutathione but overall, the HP pretreatment was superior to HT pretreatment in facilitating enzymatic release of antioxidant peptides from IPP. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Blood Glucose Reduction by Diabetic Drugs with Minimal Hypoglycemia Risk for Cardiovascular Outcomes

    DEFF Research Database (Denmark)

    Huang, Chi-Jung; Wang, Wei-Ting; Sung, Shih-Hsien

    2018-01-01

    of antidiabetic drugs with less hypoglycemia risk were comprehensively searched in MEDLINE, Embase, and the Cochrane Library up to January 27, 2018. Mixed-effects meta-regression analysis was conducted to explore the relationship between haemoglobin A1c (HbA1c) reduction and the risk of major adverse...... concentration was 0.42% lower (median, 0.27-0.86%) for participants given antihyperglycemic agents than those given placebo. The meta-regression analysis demonstrated that HbA1c reduction was significantly associated with a decreased risk of MACE (β value, -0.39 to -0.55; P...-40%) for MACE. By contrast, the meta-regression analysis for trials using conventional agents failed to demonstrate a significant relationship between achieved HbA1c difference and MACE risk (P>0.74). CONCLUSIONS: Compared with placebo, newer T2D agents with less hypoglycemic hazard significantly reduced...

  2. A new saponin from Acanthopanax koreanum with anti-inflammatory activity.

    Science.gov (United States)

    Dat, Le Duc; Thao, Nguyen Phuong; Luyen, Bui Thi Thuy; Tai, Bui Huu; Woo, Mi Hee; Manzoor, Zahid; Ali, Irshad; Koh, Young Sang; Kim, Young Ho

    2017-03-01

    Twelve saponins were isolated from the leaves of Acanthopanax koreanum, including one new lupane-type triterpene glycoside, named acankoreoside R (1), together with 11 known triterpenoid saponins (2-12). Their structures were elucidated by 1D and 2D nuclear magnetic resonance (NMR), mass spectroscopic data (MS). All of the fractions and isolated saponins were evaluated for anti-inflammatory activities in lipopolysaccharide (LPS)-stimulated bone marrow-derived dendritic cells (BMDCs) by ELISA. Among them, compounds 1-5, 7, 10, and 12 showed strong inhibitions towards interleukin-12 (IL-12) production with IC 50 values ranging from 1.59 to 5.46 µM. Other compounds were weak or inactive toward IL-12 p40 production.

  3. Ferriittinen ruostumaton teräs syvävetoprosessissa

    OpenAIRE

    Oksanen, Kyösti

    2011-01-01

    Tämä opinnäytetyö käsittelee ferriittisen ruostumattoman teräksen soveltamista syvävetoprosessiin. Työ tehdään Stala Oy:lle. Työn tarkoituksena on tutkia mahdollisuutta soveltaa hinnaltaan edullisempaa ferriittistä ruostumatonta terästä nyt käytetyn austeniittisen laadun sijasta. Sovelluskohteena on Stala P40R -allaskomponentti. Ferriittinen materiaali on tyypiltään EN 1.4509. Opinnäytetyön ensimmäinen osio käsittelee Stala Oy – yritystä, syvävetämisen teoriaa ja EN 1.4509 ominaisuuksis...

  4. Risk factors for sternal wound infections and application of the STS score in coronary artery bypass graft surgery Fatores de risco para infecção de ferida esternal e aplicação do escore da STS em pacientes submetidos à cirurgia de revascularização miocárdica

    Directory of Open Access Journals (Sweden)

    Pedro Silvio Farsky

    2011-12-01

    Full Text Available BACKGROUND: Sternal wound infection (SWI after coronary artery bypass graft (CABG surgery is a major complication. Identifying patients at risk of SWI is essential for the application of preventive measures. OBJECTIVE: To identify the pre- and intra-operative risk factors, apply the STS risk score and determine the correlation between the risk score and microorganisms isolated from surgical wounds in a Brazilian hospital. METHODS: This is a retrospective analysis of a database of all CABG surgeries performed in a single institution from 2006 to 2008. Chi-square analysis was used for categorical variables and Student's t-test was used for quantitative variables. Multivariate logistic regression model was used to identify independent risk factors for SWI. P 40 kg/m² (OR 6.27, 95%CI 2.53-15.48; P40 kg/m², number of affected coronary arteries and use of bilateral internal thoracic artery were associated with a higher risk of infection. The STS risk score can be successfully used and there was no correlation between microorganisms, the score and risk factors at our institution.FUNDAMENTO: A infecção de ferida operatória esternal após cirurgia de revascularização miocárdica (CRM é uma grave complicação. Identificar pacientes com risco elevado é fundamental para introdução de medidas de preventivas. OBJETIVO: Identificar os fatores de risco pré e intra-operatórios, avaliar o escore de risco da STS e correlação entre o escore e os microorganismos isolados em ferida operatória em hospital brasileiro. MÉTODOS: Análise retrospectiva de um banco de dados prospectivamente coletado de todas as CRM realizadas em centro único, no período de 2006 a 2008. Teste do qui-quadrado foi utilizado para variáveis categóricas e teste t-Student, para variáveis quantitativas. Modelo multivariado por regressão logística foi utilizado para identificação de fatores de risco independente para infecção de ferida esternal. P40 kg/m² (OR 5,38; IC

  5. Absolute spectroscopy near 7.8 μm with a comb-locked extended-cavity quantum-cascade-laser.

    Science.gov (United States)

    Lamperti, Marco; AlSaif, Bidoor; Gatti, Davide; Fermann, Martin; Laporta, Paolo; Farooq, Aamir; Marangoni, Marco

    2018-01-22

    We report for the first time the frequency locking of an extended-cavity quantum-cascade-laser (EC-QCL) to a near-infrared frequency comb. The locked laser source is exploited to carry out molecular spectroscopy around 7.8 μm with a line-centre frequency combined uncertainty of ~63 kHz. The strength of the approach, in view of an accurate retrieval of line centre frequencies over a spectral range as large as 100 cm -1 , is demonstrated on the P(40), P(18) and R(31) lines of the fundamental rovibrational band of N 2 O covering the centre and edges of the P and R branches. The spectrometer has the potential to be straightforwardly extended to other spectral ranges, till 12 μm, which is the current wavelength limit for commercial cw EC-QCLs.

  6. Synchronous gastric and duodenal metastases from head and neck squamous cell carcinoma: a unique presentation of upper gastrointestinal bleeding.

    Science.gov (United States)

    Tarangelo, Nicholas P; Kistler, C Andrew; Daitch, Zachary; Jiang, Wei; Quirk, Daniel M

    2018-01-01

    Metastatic disease to the stomach or duodenum is an infrequent diagnosis, and head and neck squamous cell carcinoma (HNSCC) is one of the least common primary malignancies that lead to gastric or duodenal metastases. We report the case of a 65-year-old man with human immunodeficiency virus infection and previously diagnosed HNSCC who presented with melena. The patient had a percutaneous endoscopic gastrostomy tube placed 3 months prior to his presentation. Laboratory testing was significant for normocytic anemia and a digital rectal examination was positive for melena. Esophagogastroduodenoscopy revealed numerous cratered nodules with contact bleeding in the stomach as well as the duodenum that appeared malignant. Biopsies of the gastric and duodenal nodules were positive for p40 and CK 5/6, consistent with metastatic squamous cell carcinoma.

  7. Maggot secretions skew monocyte-macrophage differentiation away from a pro-inflammatory to a pro-angiogenic type

    DEFF Research Database (Denmark)

    van der Plas, Mariena J A; van Dissel, Jaap T; Nibbering, Peter H

    2009-01-01

    BACKGROUND: Maggots of the blowfly Lucilia sericata are used for the treatment of chronic wounds. Earlier we reported maggot secretions to inhibit pro-inflammatory responses of human monocytes. The aim of this study was to investigate the effect of maggot secretions on the differentiation...... for 18 h. The expression of cell surface molecules and the levels of cytokines, chemokines and growth factors in supernatants were measured. Our results showed secretions to affect monocyte-macrophage differentiation leading to MØ-1 with a partial MØ-2-like morphology but lacking CD163, which...... is characteristic for MØ-2. In response to LPS or LTA, secretions-differentiated MØ-1 produced less pro-inflammatory cytokines (TNF-alpha, IL-12p40 and MIF) than control cells. Similar results were observed for MØ-2 when stimulated with low concentrations of LPS. Furthermore, secretions dose-dependently led to MØ-1...

  8. A global fit to determine the pseudoscalar mixing angle and the gluonium content of the η' meson

    International Nuclear Information System (INIS)

    Ambrosino, F.; Antonelli, A.; Antonelli, M.; Bencivenni, G.; Bertolucci, S.; Bloise, C.; Bossi, F.; Capon, G.; Capussela, T.; Ciambrone, P.; De Lucia, E.; De Simone, P.; Archilli, F.; Beltrame, P.; Bini, C.; De Santis, A.; De Zorzi, G.; Bocchetta, S.; Ceradini, F.; Branchini, P.

    2009-01-01

    We update the values of the η-η' mixing angle and of the η' gluonium content by fitting our measurement R φ = BR(φ → η'γ)/BR(φ → ηγ) together with several vector meson radiative decays to pseudoscalars (V → Pγ), pseudoscalar mesons radiative decays to vectors (P → Vγ) and the η' → γγ, π 0 → γγ widths. From the fit we extract a gluonium fraction of Z G 2 = 0.12±0.04, the pseudoscalar mixing angle ψ P = (40.4±0.6) 0 and the φ-ω mixing angle ψ V = (3.32±0.09) 0 . Z G 2 and ψ P are fairly consistent with those previously published. We also evaluate the impact on the η' gluonium content determination of future experimental improvements of the η' branching ratios and decay width.

  9. The Effectiveness of a Nondiet Multidisciplinary Weight Reduction Program for Severe Overweight Patients with Psychological Comorbidities

    Directory of Open Access Journals (Sweden)

    Bettina Bannert

    2011-01-01

    Full Text Available Objective. For successful sustainable weight reduction, a multimodal program including behaviour therapy is needed. Lifestyle modification is mostly used for obesity BMI 40 kg/m2 with psychological comorbidity. Research Methods and Procedere. A retrospective data analysis of 99 participants who passed the program based on moderate activity, healthy and regular food intake over metabolic rate and behaviour therapy was conducted. Results. 64 had a BMI >40 kg/m2 (mean value 49.99±8.74. The relative weight reduction was −6.9 ± 3.9%; (Friedman test P40 kg/m2 may achieve significant changes of weight reduction and psychological symptoms. However, the primary outcome should not be weight reduction. It is necessary to identify the benefits of lifestyle modification on changing risk profiles and emotional regulation of food intake.

  10. The challenge of non-invasive cognitive physiology of the human brain: how to negotiate the irrelevant background noise without spoiling the recorded data through electronic averaging.

    Science.gov (United States)

    Tomberg, C; Desmedt, J E

    1999-07-29

    Brain mechanisms involved in selective attention in humans can be studied by measures of regional blood flow and metabolism (by positron emission tomography) which help identify the various locations with enhanced activities over a period of time of seconds. The physiological measures provided by scalp-recorded brain electrical potentials have a better resolution (milliseconds) and can reveal the actual sequences of distinct neural events and their precise timing. We studied selective attention to sensory inputs from fingers because the brain somatic representations are deployed over the brain convexity under the scalp thereby making it possible to assess distinct stages of cortical processing and representation through their characteristic scalp topographies. In the electrical response to a finger input attended by the subject, the well-known P300 manifests a widespread inhibitory mechanism which is released after a target stimulus has been identified. P300 is preceded by distinct cognitive electrogeneses such as P40, P100 and N140 which can be differentiated from the control (obligatory) profile by superimposition or electronic subtraction. The first cortical response N20 is stable across conditions, suggesting that the first afferent thalamocortical volley is not affected by selective attention. At the next stage of modality-specific cortex in which the sensory features are processed and represented, responses were enhanced (cognitive P40) only a very few milliseconds after arrival of the afferent volley at the cortex, thus documenting a remarkable precocity of attention gain control in the somatic modality. The physiology of selective attention also provides useful cues in relation to non-target inputs which the subject must differentiate in order to perform the task. When having to tell fingers apart, the brain strategy for non-target fingers is not to inhibit or filter them out, but rather to submit their input to several processing operations that are

  11. Utilizing thin-film solid-phase extraction to assess the effect of organic carbon amendments on the bioavailability of DDT and dieldrin to earthworms

    Science.gov (United States)

    Andrade, Natasha A.; Centofanti, Tiziana; McConnell, Laura L.; Hapeman, Cathleen J.; Torrents, Alba; Anh, Nguyen; Beyer, W. Nelson; Chaney, Rufus L.; Novak, Jeffrey M.; Anderson, Marya O.; Cantrell, Keri B.

    2014-01-01

    Improved approaches are needed to assess bioavailability of hydrophobic organic compounds in contaminated soils. Performance of thin-film solid-phase extraction (TF-SPE) using vials coated with ethylene vinyl acetate was compared to earthworm bioassay (Lumbricus terrestris). A DDT and dieldrin contaminated soil was amended with four organic carbon materials to assess the change in bioavailability. Addition of organic carbon significantly lowered bioavailability for all compounds except for 4,4′-DDT. Equilibrium concentrations of compounds in the polymer were correlated with uptake by earthworms after 48d exposure (R2 = 0.97; p 40yr of aging. Results show that TF-SPE can be useful in examining potential risks associated with contaminated soils and to test effectiveness of remediation efforts.

  12. Radioisotope-pharmacodynamic studies without exposure to radiation

    International Nuclear Information System (INIS)

    Graul, H.

    1983-01-01

    On the basis of a clinico-pharmacological study using a new diuretic combination it is shown that not only the RIA determination, but also the measurement of the total amount of potassium in the body with the aid of the 40 K potassium-nuclide confirmed therapeutic efficacy. Furosemide (30 mg) and the combination furosemide-retard (30 mg) and triamterene (50 mg) influence the plasmarenin-aldosterone system (PRA-system) differently. After both furosemide alone and the combination, the plasma-renin activity increased significantly (p 40 /K potassium nuclide - decreased after 8 days of treatment with the combination of furosemide-retard and triamterene. Both methods have proved of value in the clinico-pharmacological examination of diuretics. They are of great importance, easy to apply, involve no exposure to radiation, and are inexpensive. (orig.) [de

  13. Compensatory enlargement of the left main coronary artery: insights from the PROSPECT study.

    Science.gov (United States)

    Inaba, Shinji; Mintz, Gary S; Shimizu, Takehisa; Weisz, Giora; Mehran, Roxana; Marso, Steven P; Xu, Ke; de Bruyne, Bernard; Serruys, Patrick W; Stone, Gregg W; Maehara, Akiko

    2014-03-01

    Glagov proposed that remodeling delayed development of significant coronary artery stenoses until plaque occupied, on average, 40% of arterial area (40% plaque burden). The aim of the current study was to confirm the previously proposed concept of coronary remodeling as first described by Glagov who studied postmortem left main coronary arteries (LMCAs). Using the in-vivo intravascular ultrasound data from the Providing Regional Observations to Study Predictors of Events in the Coronary Tree (PROSPECT) study, we evaluated 552 LMCAs in 552 patients. External elastic membrane cross-sectional areas (CSAs) increased in proportion to the increase in plaque and media CSAs (r=0.61, P40% plaque burden), there was an inverse relationship between lumen CSA and plaque burden (r=-0.57, PPROSPECT study patients. In addition, the present study suggested that plaque phenotype worsened with increasing LMCA plaque growth.

  14. Success of uterus-preserving treatments for abnormal uterine bleeding, chronic pelvic pain, and symptomatic fibroids: age and bridges to menopause.

    Science.gov (United States)

    Learman, Lee A; Nakagawa, Sanae; Gregorich, Steven E; Jackson, Rebecca A; Jacoby, Alison; Kuppermann, Miriam

    2011-03-01

    The purpose of this study was to determine whether age at first uterus-preserving treatment (UPT) predicts symptom resolution among women with common pelvic problems. We conducted an analysis of 557 participants in the Study of Pelvic Problems, Hysterectomy and Intervention Alternatives cohort who reported having undergone a UPT. We performed multivariable regression modeling age at first UPT, hysterectomy, menopause, and other covariates to predict symptom resolution. Mean ± SD age at enrollment was 42.7 ± 4.7 years; mean follow-up time was 4.4 ± 2.7 years. Sixteen percent of the women underwent hysterectomy; 37% of the women entered menopause. Hysterectomy was a strong predictor of symptom resolution (P 40 years old. Copyright © 2011 Mosby, Inc. All rights reserved.

  15. Core antigen and circulating anti-core antibody in hepatitis B infection

    Energy Technology Data Exchange (ETDEWEB)

    Howard, C R; Zuckerman, A J [London School of Hygiene and Tropical Medicine (UK)

    1977-02-01

    Core antigen was obtained from the sera of persistent chronic carriers of hepatitis B virus by centrifugation and treatment with Nonidet P40 and 2-mercaptoethanol. The separated core antigen was radiolabelled and identified as a nucleoprotein structure of buoyant density 1.36 g/cm/sup 3/ and possessing an isoelectric point of 4.4. This material was employed in a radioimmnoassay procedure of high sensitivity for the detection of core antibody. In a series of sera from patients with acute type B hepatitis, core antibody was demonstrated 2 to 3 weeks after the onset of jaundice during the period of surface antigenaemia. The presence of core antibody may therefore provide an accurate serological marker for the detection of active or recent virus replication in future epidemiological studies of hepatitis B infection.

  16. Structure damage of GaP monocrystals induced by heavy ions

    International Nuclear Information System (INIS)

    Asherov, K.; Otto, G.; Bugrov, V.N.; Karamyan, S.A.

    1983-01-01

    GaP crystals were irradiated with 1 H, 4 He, 20 Ne, 22 Ne, 31 P, 40 Ar ions at the energy interval from 0.3 up to 8 MeV/nucleon and the dose density from 10 13 up to 10 18 cm -2 . Their damage at the irradiation was controlled using the blocking effect for ion elastic scattering. Damaged monocrystalline samples are analysed by one Kossel effect on the proton beam and the increase of the interplane distance in the crystal lattice is determined as a function of the dose density. On the base of the measured values a correlation is found between the ion damage action on the single crystal and the nuclear stopping power of the ion in the medium

  17. Hippocampal Neurogenesis and the Brain Repair Response to Brief Stereotaxic Insertion of a Microneedle

    Directory of Open Access Journals (Sweden)

    Shijie Song

    2013-01-01

    Full Text Available We tested the hypothesis that transient microinjury to the brain elicits cellular and humoral responses that stimulate hippocampal neurogenesis. Brief stereotaxic insertion and removal of a microneedle into the right hippocampus resulted in (a significantly increased expression of granulocyte-colony stimulating factor (G-CSF, the chemokine MIP-1a, and the proinflammatory cytokine IL12p40; (b pronounced activation of microglia and astrocytes; and (c increase in hippocampal neurogenesis. This study describes immediate and early humoral and cellular mechanisms of the brain’s response to microinjury that will be useful for the investigation of potential neuroprotective and deleterious effects of deep brain stimulation in various neuropsychiatric disorders.

  18. Tissue-specific down-regulation of RIPK 2 in Mycobacterium leprae-infected nu/nu mice

    Directory of Open Access Journals (Sweden)

    Gue-Tae Chae

    1992-01-01

    Full Text Available RIPK 2 is adapter molecule in the signal pathway involved in Toll-like receptors. However, there has been no reported association between receptor-interacting serine/threonine kinase 2 (RIPK 2 expression and the infectious diseases involving mycobacterial infection. This study found that its expression was down-regulated in the footpads and skin but was up-regulated in the liver of Mycobacterium leprae-infected nu/nu mice compared with those of the M. leprae non-infected nu/nu mice. It was observed that the interlukin-12p40 and interferon-γ genes involved in the susceptibility of M. leprae were down-regulated in the skin but were up-regulated in the liver. Overall, this suggests that regulation of RIPK 2 expression is tissue-specifically associated with M. leprae infection.

  19. Magnetic field of the U-120M isochronous cyclotron

    International Nuclear Information System (INIS)

    Alenitskij, Yu.G.; Vasilevskaya, D.P.; Zaplatin, N.L.; Ivashkevich, S.A.; Li Zun; Morozov, N.A.; Shishlyannikov, P.T.

    1976-01-01

    The main results of formation and analysis of accelerator magnetic field are presented for three levels of excitation of the main electromagnet winding, Isub(0)=610,350,175A, corresponding to obtaining the maximum proton energy, Esub(k)=39.9; 30.0; 13.0 MeV on the terminal radius, r=51 cm. Distributions of currents in concentric windings are calculated, which provide acceleration of d, He 3 2 and α particles up to energies of 8,15,20 MeV; 17,40,54 MeV; 17,30,41 MeV, correspondingly. Physical starting and studies of two operation regimes (Esub(p)=40 MeV and Esub(p)=30 MeV) have shown that the magnetic field formed satisfies all the requirements for the given accelerator

  20. An investigation of relativistic microscopic optical potential in terms of relativistic Brueckner-Bethe-Goldstone equation

    International Nuclear Information System (INIS)

    Chen Baoqiu; Ma Zhongyu

    1992-01-01

    Relativistic microscopic optical potential of nucleon-nucleus is derived from the relativistic Brueckner-Bethe-Goldstone (RBBG) equation. The complex effective mass of a nucleon is determined by a fit to 200 MeV p- 40 Ca scattering data. The relativistic microscopic optical potentials with this effective mass are obtained from RBBG for p- 16O , 40 Ca, 90 Zr and 208 Pb scattering in energy range from 160 to 800 MeV. The microscopic optical potential is used to study the proton- 40 Ca scattering problem at 200 MeV. The results, such as differential cross section, analyzing power and spin rotation function are compared with those calculated from phenomenological relativistic optical potential

  1. Finite-size-scaling analysis of subsystem data in the dilute Ising model

    International Nuclear Information System (INIS)

    Hennecke, M.

    1993-01-01

    Monte Carlo simulation results for the magnetization of subsystems of finite lattices are used to determine the critical temperature and a critical exponent of the simple-cubic Ising model with quenched site dilution, at a concentration of p=40%. Particular attention is paid to the effect of the finite size of the systems from which the subsystem results are obtained. This finiteness of the lattices involved is shown to be a source of large deviations of critical temperatures and exponents estimated from subsystem data from their values in the thermodynamic limit. By the use of different lattice sizes, the results T c (40%)=1.209±0.002 and ν(40%)=0.78±0.01 could be extrapolated

  2. Combined effect of radiation and environmental contaminants on DNA repair mechanisms

    International Nuclear Information System (INIS)

    Altmann, H.

    1975-11-01

    Investigations on the influence of various environmental contamination agents on DNA repair (in combination with irradiation) were reviewed. The agents tested were: detergents (Tween 80, Nonidel P40, Cremophor), aflatoxin B 1 , furocumarines, drugs (indometacin, cyclophosphamide, vincristine, vinblastine, procarbacine), fluorides, irradiated food constituents, food additives (saccharin), metal ions (Cd, Hg), pesticides (2,4,5-trichlorophenoxyethanol) and infective agents (mycoplasmas). Most of the tests were carried out in vitro with γ-irradiated mouse spleen cells. The detergents and aflatoxin were tested also on E. coli, and irradiated glucose solutions were tested in vivo on Swiss albino mice injected with Salmonella typhimurium TA 1530. Most of the tested agents showed some kind of inhibitory or mutagenic effect. The experiments and results are explained briefly with references to earlier investigations

  3. Absolute spectroscopy near 7.8 μm with a comb-locked extended-cavity quantum-cascade-laser

    KAUST Repository

    Lamperti, Marco

    2018-01-16

    We report for the first time the frequency locking of an extended-cavity quantum-cascade-laser (EC-QCL) to a near-infrared frequency comb. The locked laser source is exploited to carry out molecular spectroscopy around 7.8 μm with a line-centre frequency combined uncertainty of ~63 kHz. The strength of the approach, in view of an accurate retrieval of line centre frequencies over a spectral range as large as 100 cm-1, is demonstrated on the P(40), P(18) and R(31) lines of the fundamental rovibrational band of N2O covering the centre and edges of the P and R branches. The spectrometer has the potential to be straightforwardly extended to other spectral ranges, till 12 μm, which is the current wavelength limit for commercial cw EC-QCLs.

  4. Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR

    Science.gov (United States)

    Eberle, Kirsten C.; Venn-Watson, Stephanie K.; Jensen, Eric D.; Porter, Tracy J.; Waters, Theresa E.; Sacco, Randy E.

    2017-01-01

    Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus) health. Quantitative PCR (qPCR) can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC). This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL) and concanavalin A (1 μg/mL) for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α). Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies. PMID:29272269

  5. Seroprevalence of Enterovirus A71 and Coxsackievirus A16 in Healthy People in Shandong Province, China.

    Directory of Open Access Journals (Sweden)

    Jian-Xing Wang

    Full Text Available Hand, foot, and mouth disease has become very common in mainland of China in recent years, and enterovirus A71 and coxsackievirus A16 are its major etiologic factors. Here we investigated the seroprevalence of enterovirus A71 and coxsackievirus A16 based on a large group of healthy individuals in Shandong province, China.A total of 1378 healthy individuals were tested for serum neutralizing antibodies against enterovirus A71 and coxsackievirus A16 using a micro neutralization test.The overall seroprevalence of enterovirus A71 neutralizing antibodies was 74.75%. It increased significantly from 48.84% in children aged 0-1 years old to 88.64% in those aged 20-29 years (p 40 years old with a significant gender-specific difference (p 40 years without a gender-specific difference. Nearly 50% of the children <1 year were susceptible to enterovirus A71 infection versus 40% to coxsackievirus A16 infection. Sample collection time and place also played a role in the enterovirus A71 and coxsackievirus A16 positive rates. The overall rates in January were significantly lower than those in April and August (p < 0.01; enterovirus A71 positive rates in Jinan city (capital city of Shandong province were lower than those in Jining city and Zibo city (p < 0.05; and oxsackievirus A16 positive rates in Jining city were significantly higher than those in Jinan city and Zibo city (p < 0.01.There were significant differences among age groups, locations, and time points in the seroprevalence rates of enterovirus A71 and coxsackievirus A16 neutralizing antibodies in healthy people in Shandong province.

  6. Sex-specific effects of early life stress on social interaction and prefrontal cortex dendritic morphology in young rats.

    Science.gov (United States)

    Farrell, M R; Holland, F H; Shansky, R M; Brenhouse, H C

    2016-09-01

    Early life stress has been linked to depression, anxiety, and behavior disorders in adolescence and adulthood. The medial prefrontal cortex (mPFC) is implicated in stress-related psychopathology, is a target for stress hormones, and mediates social behavior. The present study investigated sex differences in early-life stress effects on juvenile social interaction and adolescent mPFC dendritic morphology in rats using a maternal separation (MS) paradigm. Half of the rat pups of each sex were separated from their mother for 4h a day between postnatal days 2 and 21, while the other half remained with their mother in the animal facilities and were exposed to minimal handling. At postnatal day 25 (P25; juvenility), rats underwent a social interaction test with an age and sex matched conspecific. Distance from conspecific, approach and avoidance behaviors, nose-to-nose contacts, and general locomotion were measured. Rats were euthanized at postnatal day 40 (P40; adolescence), and randomly selected infralimbic pyramidal neurons were filled with Lucifer yellow using iontophoretic microinjections, imaged in 3D, and then analyzed for dendritic arborization, spine density, and spine morphology. Early-life stress increased the latency to make nose-to-nose contact at P25 in females but not males. At P40, early-life stress increased infralimbic apical dendritic branch number and length and decreased thin spine density in stressed female rats. These results indicate that MS during the postnatal period influenced juvenile social behavior and mPFC dendritic arborization in a sex-specific manner. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Effect of Delta-9-tetrahydrocannabinol on mouse resistance to systemic Candida albicans infection.

    Directory of Open Access Journals (Sweden)

    Gideon W Blumstein

    Full Text Available Delta-9-tetrahydrocannabinol (Δ9-THC, the psychoactive component of marijuana, is known to suppress the immune responses to bacterial, viral and protozoan infections, but its effects on fungal infections have not been studied. Therefore, we investigated the effects of chronic Δ9-THC treatment on mouse resistance to systemic Candida albicans (C. albicans infection. To determine the outcome of chronic Δ9-THC treatment on primary, acute systemic candidiasis, c57BL/6 mice were given vehicle or Δ9-THC (16 mg/kg in vehicle on days 1-4, 8-11 and 15-18. On day 19, mice were infected with 5×10(5 C. albicans. We also determined the effect of chronic Δ9-THC (4-64 mg/kg treatment on mice infected with a non-lethal dose of 7.5×10(4 C. albicans on day 2, followed by a higher challenge with 5×10(5 C. albicans on day 19. Mouse resistance to the infection was assessed by survival and tissue fungal load. Serum cytokine levels were determine to evaluate the immune responses. In the acute infection, chronic Δ9-THC treatment had no effect on mouse survival or tissue fungal load when compared to vehicle treated mice. However, Δ9-THC significantly suppressed IL-12p70 and IL-12p40 as well as marginally suppressed IL-17 versus vehicle treated mice. In comparison, when mice were given a secondary yeast infection, Δ9-THC significantly decreased survival, increased tissue fungal burden and suppressed serum IFN-γ and IL-12p40 levels compared to vehicle treated mice. The data showed that chronic Δ9-THC treatment decreased the efficacy of the memory immune response to candida infection, which correlated with a decrease in IFN-γ that was only observed after the secondary candida challenge.

  8. Curcumin Modulates Macrophage Polarization Through the Inhibition of the Toll-Like Receptor 4 Expression and its Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Yaoyao Zhou

    2015-05-01

    Full Text Available Background: Curcumin, the active ingredient in curcuma rhizomes, has a wide range of therapeutic effects. However, its atheroprotective activity in human acute monocytic leukemia THP-1 cells remains unclear. We investigated the activity and molecular mechanism of action of curcumin in polarized macrophages. Methods: Phorbol myristate acetate (PMA-treated THP-1 cells were differentiated to macrophages, which were further polarized to M1 cells by lipopolysaccharide (LPS; 1 µg/ml and interferon (IFN-γ (20 ng/ml and treated with varying curcumin concentrations. [3H]thymidine (3H-TdR incorporation assays were utilized to measure curcumin-induced growth inhibition. The expression of tumor necrosis factor-a (TNF-a, interleukin (IL-6, and IL-12B (p40 were measured by quantitative real-time polymerase chain reaction (PCR and enzyme-linked immunosorbent assay (ELISA. Macrophage polarization and its mechanism were evaluated by flow cytometry and western blot. Additionally, toll-like receptor 4 (TLR4 small interfering RNA and mitogen-activated protein kinase (MAPK inhibitors were used to further confirm the molecular mechanism of curcumin on macrophage polarization. Results: Curcumin dose-dependently inhibited M1 macrophage polarization and the production of TNF-a, IL-6, and IL-12B (p40. It also decreased TLR4 expression, which regulates M1 macrophage polarization. Furthermore, curcumin significantly inhibited the phosphorylation of ERK, JNK, p38, and nuclear factor (NF-γB. In contrast, SiTLR4 in combination with p-JNK, p-ERK, and p-p38 inhibition reduced the effect of curcumin on polarization. Conclusions: Curcumin can modulate macrophage polarization through TLR4-mediated signaling pathway inhibition, indicating that its effect on macrophage polarization is related to its anti-inflammatory and atheroprotective effects. Our data suggest that curcumin could be used as a therapeutic agent in atherosclerosis.

  9. Furosemide Prescription During the Dry State Is a Predictor of Long-Term Survival of Stable, Optimally Medicated Patients With Systolic Heart Failure.

    Science.gov (United States)

    Sargento, Luis; Simões, Andre Vicente; Longo, Susana; Lousada, Nuno; Reis, Roberto Palma Dos

    2017-05-01

    Furosemide is associated with poor prognosis in patients with heart failure and reduced ejection fraction (HFrEF). To evaluate the association between daily furosemide dose prescribed during the dry state and long-term survival in stable, optimally medicated outpatients with HFrEF. Two hundred sixty-six consecutive outpatients with left ventricular ejection fraction failure therapy, were followed up for 3 years in a heart failure unit. The end point was all-cause death. There were no changes in New York Heart Association class and therapeutics, including diuretics, and no decompensation or hospitalization during 6 months. Furosemide doses were categorized as low or none (0-40 mg/d), intermediate (41-80 mg/d), and high (>80 mg). Cox regression was adjusted for significant confounders. The 3-year mortality rate was 33.8%. Mean dose of furosemide was 57.3 ± 21.4 mg/d. A total of 47.6% of patients received the low dose, 42.1% the intermediate dose, and 2.3% the high dose. Receiver operating characteristics for death associated with furosemide dose showed an area under the curve of 0.74 (95% confidence interval [CI]: 0.68-0.79; P 40 mg/d. An increasing daily dose of furosemide was associated with worse prognosis. Those receiving the intermediate dose (hazard ratio [HR] = 4.1; 95% CI: 2.57-6.64; P 40 mg/d, in a propensity score-matched cohort, had a greater risk of mortality than those receiving a low dose (HR = 4.02; 95% CI: 1.8-8.8; P = .001) and those not receiving furosemide (HR = 3.9; 95% CI: 0.07-14.2; P = .039). Furosemide administration during the dry state in stable, optimally medicated outpatients with HFrEF is unfavorably associated with long-term survival. The threshold dose was 40 mg/d.

  10. [Relationship between hypertension and percentage of body fat, in children of Anhui province].

    Science.gov (United States)

    Tao, R W; Wan, Y H; Zhang, H; Wang, Y F; Wang, B; Xu, L; Zuo, A Z; Tong, S L; Tao, F B

    2016-02-01

    To study the situation of hypertension among children in Anhui province and to analyze its association with the percentage of body fat. A total of 8 890 aged 7-17 years old children, were tested for blood pressure and thickness of skin fold in Anhui province. Hypertension in children was diagnosed referring to the 2010 Chinese guidelines for the management of hypertension (revised in 2010). The percentage of body fat was calculated according to the thickness of skin fold and specific formulas. METHODS used for statistics analysis would include t test, χ(2) test while logistic regression was used to analyze the relationship between percentage of body fat in children and adolescents. In total, 8 890 subjects aged 7-17 years were recruited, in Anhui province. The prevalence of hypertension in Children aged 7-17 was 13.6%, with the total number of hypertension as 1 210, in Anhui province. There were significant differences in the prevalence of hypertension among urban and rural children. Both prevalence of hypertension among boys and girls in urban area appeared higher than those in the rural area. In the urban areas, the prevalence rates of hypertension in both boys and girls were higher than the ones in rural area (χ(2) values were 36.36, 7.79, 42.10 and 13.77, respectively, and Pfat between boys and girls from the rural or urban areas were both significant.OR values of the boys and girls of group P(40)- and P(60)-were 1.65 and 1.75, respectively. Risks of hypertension in boys and girls showed significantly increase by P(40) and P(60), respectively. The prevalence of hypertension in both boys and girls increased along with the increase of the percentage on body fat. Since higher percentage of body fat could increase the risk of hypertension, reduction of body fat content would be beneficial to the success of prevention and control of hypertension in children.

  11. Characterisation of enterocolitis in the piroxicam-accelerated interleukin-10 knock out mouse--a model mimicking inflammatory bowel disease.

    Science.gov (United States)

    Holgersen, Kristine; Kvist, Peter Helding; Markholst, Helle; Hansen, Axel Kornerup; Holm, Thomas Lindebo

    2014-02-01

    In inflammatory bowel disease a defective mucosal barrier, a dysregulated immune response and an excessive reactivity against the gut microbiota are assumed to cause a breakdown of the intestinal homeostasis and lead to chronic inflammation. Piroxicam treatment is a method for induction of colitis in IL-10 k.o. mice, which integrates a dysfunction of both the intestinal barrier and the immune system. However, the translational value of this model has not been thoroughly clarified. To characterise the piroxicam-accelerated colitis (PAC) IL-10 k.o. model with respect to clinical features, pathogenic mechanisms and its ability to respond to existing therapies. The PAC IL-10k.o. model was established on a C57BL/6J background and the clinical manifestations, immunological mechanisms and efficacy of ampicillin and anti-IL-12/23p40 treatment were assessed. The PAC IL-10 k.o. mice developed weight loss and diarrhoea, and colonoscopy revealed a thickened granulomatous mucosa. Histological evaluation of ileum and colon showed Crohn's disease-like changes with pronounced hyperplasia and focal transmural inflammation. Ileitis was also observed in piroxicam treated wild type mice. The total number of neutrophils, monocytes and natural killer cells was elevated in the blood compared to IL-10 k.o. and wild type mice, indicating a role of the innate immune system in the pathogenesis. These findings were supported by analyses of the intestinal cytokine profile. Ampicillin and anti-IL-12/23p40 treatment significantly suppressed disease in the model. The PAC IL-10 k.o. model resembles several features of Crohn's disease and could be a useful in vivo model in preclinical research. © 2013 Elsevier B.V. All rights reserved.

  12. Predictive validity and immune cell involvement in the pathogenesis of piroxicam-accelerated colitis in interleukin-10 knockout mice.

    Science.gov (United States)

    Holgersen, Kristine; Kvist, Peter Helding; Hansen, Axel Kornerup; Holm, Thomas Lindebo

    2014-07-01

    Piroxicam administration is a method for induction of enterocolitis in interleukin-10 knockout (IL-10 k.o.) mice. The piroxicam-accelerated colitis (PAC) IL-10 k.o. model combines a dysregulated immune response against the gut microbiota with a decreased mucosal integrity. The predictive validity and pathogenic mechanisms of the model have not been thoroughly investigated. In this study, IL-10 k.o. mice received piroxicam in the chow, and model qualification was performed by examining the efficacy of prophylactic anti-IL-12/23p40 monoclonal antibody (mAb), anti-TNFα mAb, cyclosporine A (CsA) and oral prednisolone treatment. To evaluate cell involvement in the disease pathogenesis, specific cell subsets were depleted by treatment with anti-CD4 mAb, anti-CD8 mAb or clodronate-encapsulated liposomes. T cell receptor co-stimulation was blocked by CTLA4-Ig. Cytokine profiling ELISAs and calprotectin immunohistochemistry were performed on colon tissue. Treatments with anti-IL-12/23p40 mAb and CsA prevented disease in PAC IL-10 k.o. mice and reduced IFNγ, IL-17A, MPO and calprotectin levels in colon. Anti-TNFα mAb treatment caused amelioration of selected clinical parameters. No effect of prednisolone was detected. Depletion of CD8(+) cells tended to increase mortality, whereas treatment with anti-CD4 mAb or CTLA4-Ig had no significant effect on disease development. Clodronate liposome treatment induced a loss of body weight; nevertheless macrophage depletion was associated with a significant reduction in colonic pathology. In conclusion, reference drugs with known efficacy in severe inflammatory bowel disease were efficacious in the PAC IL-10 k.o. model. Our data indicate that in this model macrophages are a main driver of colitis, whereas CD4(+) cells are not. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Peculiarities of Japanese millet growing on radionuclide contaminated territories

    International Nuclear Information System (INIS)

    Sedukova, G.V.; Samusev, A.M.; Yurchenko, N.V.

    2010-01-01

    In the conditions of the Republic of Belarus on the lands polluted with radionuclides there were presented results of field experiments directed to study of the influence of mineral fertilizers on the yield, 137Cs and 90Sr transfer parameters, and economical viability of Indian barnyard millet or Japanese millet (Echinochloa frumentacea) growing. There were three variants of the test: control variant (without any fertilizers), variants with entering of N70P40K80 and N90P60K100 kg/ha. Research results showed that entering of N70P40K80 increased Japanese millet yield till 450-500 c/ha. Maximum productivity of green mass, minimum radionuclide transfer factors and the highest profitability were after application of entering of N70P60K100. Entering of N90K60K100 increased the green mass yield in phase of heads appearing in 80 c/ha, in milk-wax stage – in 53 c/ha. Zootechnical quality of millet green mass was defined. Parameters of 137Cs and 90Sr transition were 0,03 and 2,6-6,4 Bq/kg:kBq/m2 correspondingly. Contamination densities of sod-podzolic loamy soils were determined to assure regulatory clean millet green mass production to be used as fodder for milk stock in order to produce whole milk and raw milk for processing. Japanese millet green mass grown for cattle feeding with purpose of milk getting could be produced at density 90Sr pollution of 0,2 Ci/km2. Sod-podzolic sandy soils with density 90Sr pollution less 1,5Ci/km2 were suitable for getting processing milk

  14. Alterations in NMDA receptor expression during retinal degeneration in the RCS rat.

    Science.gov (United States)

    Gründer, T; Kohler, K; Guenther, E

    2001-01-01

    To determine how a progressive loss of photoreceptor cells and the concomitant loss of glutamatergic input to second-order neurons can affect inner-retinal signaling, glutamate receptor expression was analyzed in the Royal College of Surgeons (RCS) rat, an animal model of retinitis pigmentosa. Immunohistochemistry was performed on retinal sections of RCS rats and congenic controls between postnatal (P) day 3 and the aged adult (up to P350) using specific antibodies against N-methyl-D-aspartate (NMDA) subunits. All NMDA subunits (NR1, NR2A-2D) were expressed in control and dystrophic retinas at all ages, and distinct patterns of labeling were found in horizontal cells, subpopulations of amacrine cells and ganglion cells, as well as in the outer and inner plexiform layer (IPL). NRI immunoreactivity in the inner plexiform layer of adult control retinas was concentrated in two distinct bands, indicating a synaptic localization of NMDA receptors in the OFF and ON signal pathways. In the RCS retina, these bands of NRI immunoreactivity in the IPL were much weaker in animals older than P40. In parallel, NR2B immunoreactivity in the outer plexiform layer (OPL) of RCS rats was always reduced compared to controls and vanished between P40 and P120. The most striking alteration observed in the degenerating retina, however, was a strong expression of NRI immunoreactivity in Müller cell processes in the inner retina which was not observed in control animals and which was present prior to any visible sign of photoreceptor degeneration. The results suggest functional changes in glutamatergic receptor signaling in the dystrophic retina and a possible involvement of Müller cells in early processes of this disease.

  15. Radiation-induced XRCC4 association with chromatin DNA analyzed by biochemical fractionation

    International Nuclear Information System (INIS)

    Kamdar, R.P.; Matsumoto, Yoshihisa

    2010-01-01

    XRCC4, in association with DNA ligase IV, is thought to play a critical role in the ligation of two DNA ends in DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ) pathway. In the present study, we captured radiation-induced chromatin-recruitment of XRCC4 by biochemical fractionation using detergent Nonidet P-40. A subpopulation of XRCC4 changed into a form that is resistant to the extraction with 0.5% Nonidet P-40-containing buffer after irradiation. This form of XRCC4 was liberated by micrococcal nuclease treatment, indicating that it had been tethered to chromatin DNA. This chromatin-recruitment of XRCC4 could be seen immediately (<0.1 hr) after irradiation and remained up to 4 hr after 20 Gy irradiation. It was seen even after irradiation of small doses, id est (i.e.), 2 Gy, but the residence of XRCC4 on chromatin was very transient after 2 Gy irradiation, returning to near normal level in 0.2-0.5 hr after irradiation. The chromatin-bound XRCC4 represented only -1% of total XRCC4 molecules even after 20 Gy irradiation and the quantitative analysis using purified protein as the reference suggested that only a few XRCC4-DNA ligase IV complexes were recruited to each DNA end. We further show that the chromatin-recruitment of XRCC4 was not attenuated by wortmannin, an inhibitor of DNA-PK, or siRNA-mediated knockdown of the DNA-PK catalytic subunit (DNA-PKcs), indicating that this process does not require DNA-PKcs. These results would provide us with useful experimental tools and important insights to understand the DNA repair process through NHEJ pathway. (author)

  16. Investigations on the mechanisms change and growth of mammary gland tumor cells under the influence of antiestrogenic drugs and low-frequency magnetic fields; Untersuchung des Wirkungsmechanismus fuer die Veraenderung des Wachstums von Brustkrebszellen unter dem Einfluss von Onkostatika und niederfrequenten Magnetfeldern

    Energy Technology Data Exchange (ETDEWEB)

    Girgert, R.; Gruendker, C.; Hanf, V.

    2012-10-15

    In the present project we investigated the molecular mechanism of the decreased antiproliferative effect of the antiestrogenic drug Tamoxifen and the pineal gland hormone Melatonin on breast cancer cells in the presence of low-frequency electromagnetic fields. New unique incubators were developed for the exposure of the cells to controlled, highly homogenous magnetic fields. MCF-7 p40 cells exposed to 1.2 {mu}T expressed 20 genes more than two times stronger than control cells, MCF-7p181 cells 61 genes. 16 genes were expressed weaker in MCF-7p40 cells, 41 genes in MCF-7p181. The increased expression of the particularly interesting coactivators, AIB1 and SRC-1, and of urokinase plasminogen activator and plasminogen-activator inhibitor was confirmed using RT-PCR and Western blot. The corepressors, N-Cor and SMRT, and various metastasis-suppressor genes were expressed lower in the exposed cells. Investigations of signal transduction revealed only MAP-kinase Erk1 being more strongly activated after one hour exposure to the magnetic field, while stress-activated MAP-kinases, junK and p38, were not activated by the magnetic field or even slightly deactivated. Experiments on Melatonin action in the magnetic field showed that expression of the two Melatonin receptors, MT1 and RZR{alpha}, was only marginally altered at 1,2 {mu}T. Of the target genes of Melatonin expression of tumorsuppressors p53 and p21waf was decreased in the magnetic field whereas the decrease in expression of BRCA1 and c-myc by Melatonin was less strong in the magnetic field.

  17. LL-37 directs macrophage differentiation toward macrophages with a proinflammatory signature.

    Science.gov (United States)

    van der Does, Anne M; Beekhuizen, Henry; Ravensbergen, Bep; Vos, Tim; Ottenhoff, Tom H M; van Dissel, Jaap T; Drijfhout, Jan W; Hiemstra, Pieter S; Nibbering, Peter H

    2010-08-01

    The human cathelicidin LL-37 has broad-spectrum antimicrobial activity. It also participates at the interface of innate and adaptive immunity by chemoattracting immune effector cells, modulating the production of a variety of inflammatory mediators by different cell types, and regulating the differentiation of monocytes into dendritic cells. In this study, we investigated the effects of LL-37 on the differentiation of human monocytes into anti-inflammatory macrophages (MPhi-2; driven by M-CSF) versus proinflammatory macrophages (MPhi-1; driven by GM-CSF) as well as on fully differentiated MPhi-1 and MPhi-2. Results revealed that monocytes cultured with M-CSF in the presence of LL-37 resulted in macrophages displaying a proinflammatory signature, namely, low expression of CD163 and little IL-10 and profound IL-12p40 production on LPS stimulation. The effects of LL-37 on M-CSF-driven macrophage differentiation were dose- and time-dependent with maximal effects observed at 10 microg/ml when the peptide was present from the start of the cultures. The peptide enhanced the GM-CSF-driven macrophage differentiation. Exposure of fully differentiated MPhi-2 to LL-37 for 6 d resulted in macrophages that produced less IL-10 and more IL-12p40 on LPS stimulation than control MPhi-2. In contrast, LL-37 had no effect on fully differentiated MPhi-1. Peptide mapping using a set of 16 overlapping 22-mer peptides covering the complete LL-37 sequence revealed that the C-terminal portion of LL-37 is responsible for directing macrophage differentiation. Our results furthermore indicate that the effects of LL-37 on macrophage differentiation required internalization of the peptide. Together, we conclude that LL-37 directs macrophage differentiation toward macrophages with a proinflammatory signature.

  18. [DIFFERENCES IN PHYSICAL ACTIVITY AND IN PHYSICAL CONDITION BETWEEN SCHOOL AGE STUDENTS OF TWO PUBLIC CURRICULUM PROGRAMS IN BOGOTA, COLOMBIA].

    Science.gov (United States)

    Carrillo Cubides, Raúl; Aldana Alarcón, Luis Gonzalo; Gutiérrez Galvis, Adriana Rocío

    2015-11-01

    During the past five decades there has been an increased in the prevalence of obesity and over weight, also in physical inactivity and /or low cardiorespiratory fitness within the population in school age from diverse regions of the planet, including Bogota-Colombia. The general objective of this study was to compare the physical condition and the levels of physical activity from students who belonged to two curriculum programs of the Public Schools Network from Bogota, one of which includes two sessions per week, each session of 90 minutes of physical activity. We developed a research of unlike cross-sectional groups. There were 178 children evaluated from the regular curriculum and 170 kids belonging to the program 40 x 40. The physical condition was evaluated applying the protocol of high priority from the ALPHA -Fitness test Battery. The weight, height, body mass index, the waist circumference, the standing long jump, the handgrip in both hands and the motor fitness 20 meter shuttle run test were developed under standardized conditions. The Global School Health Survey (GSHS) was used to evaluate the levels of AF. No significant statistical differences were founded between P-40x40 and the regular curriculum regarding: weight, height, the body mass index, the waist circumference, the handgrip in both hands and the explosive strength in lower limbs. Nevertheless the cardiorespiratory fitness was significantly lower within de P-40x40. In conclusion the participation in the curricular program 40 x 40 was not associated with better levels of physical condition. Copyright AULA MEDICA EDICIONES 2014. Published by AULA MEDICA. All rights reserved.

  19. Sodium methyldithiocarbamate inhibits MAP kinase activation through toll-like receptor 4, alters cytokine production by mouse peritoneal macrophages, and suppresses innate immunity.

    Science.gov (United States)

    Pruett, Stephen B; Zheng, Qiang; Schwab, Carlton; Fan, Ruping

    2005-09-01

    Sodium methyldithiocarbamate (SMD; trade name, Metam Sodium) is an abundantly used soil fumigant that can cause adverse health effects in humans, including some immunological manifestations. The mechanisms by which SMD acts, and its targets within the immune system are not fully understood. Initial experiments demonstrated that SMD administered by oral gavage substantially decreased IL-12 production and increased IL-10 production induced by lipopolysaccharide in mice. The present study was conducted to further characterize these effects and to evaluate our working hypothesis that the mechanism for these effects involves alteration in signaling through toll-like receptor 4 and that this would suppress innate immunity to infection. SMD decreased the activation of MAP kinases and AP-1 but not NF-kappaB in peritoneal macrophages. The expression of mRNA for IL-1alpha, IL-1beta, IL-18, IFN-gamma, IL-12 p35, IL-12 p40, and macrophage migration inhibitory factor (MIF) was inhibited by SMD, whereas mRNA for IL-10 was increased. SMD increased the IL-10 concentration in the peritoneal cavity and serum and decreased the concentration of IL-12 p40 in the serum, peritoneal cavity, and intracellularly in peritoneal cells (which are >80% macrophages). Similar effects on LPS-induced cytokine production were observed following dermal administration of SMD. The major breakdown product of SMD, methylisothiocyanate (MITC), caused similar effects on cytokine production at dosages as low as 17 mg/kg, a dosage relevant to human exposure levels associated with agricultural use of SMD. Treatment of mice with SMD decreased survival following challenge with non-pathogenic Escherichia coli within 24-48 h, demonstrating suppression of innate immunity.

  20. Comparison of serum testosterone and estradiol measurements in 3174 European men using platform immunoassay and mass spectrometry; relevance for the diagnostics in aging men.

    Science.gov (United States)

    Huhtaniemi, Ilpo T; Tajar, Abdelouahid; Lee, David M; O'Neill, Terence W; Finn, Joseph D; Bartfai, György; Boonen, Steven; Casanueva, Felipe F; Giwercman, Aleksander; Han, Thang S; Kula, Krzysztof; Labrie, Fernand; Lean, Michael E J; Pendleton, Neil; Punab, Margus; Silman, Alan J; Vanderschueren, Dirk; Forti, Gianni; Wu, Frederick C W

    2012-06-01

    The limitations of serum testosterone and estradiol (E(2)) measurements using non-extraction platform immunoassays (IAs) are widely recognized. Switching to more specific mass spectrometry (MS)-based methods has been advocated, but directly comparative data on the two methods are scarce. We compared serum testosterone and E(2) measurements in a large sample of middle-aged/elderly men using a common platform IA and a gas chromatography (GC)-MS method, in order to assess their limitations and advantages, and to diagnose male hypogonadism. Of subjects from the European Male Aging Study (n=3174; age 40-79 years), peripheral serum testosterone and E(2) were analyzed using established commercial platform IAs (Roche Diagnostics E170) and in-house GC-MS methods. Over a broad concentration range, serum testosterone concentration measured by IA and MS showed high correlation (R=0.93, PIA/MS correlation was weaker in E(2) measurements (R=0.32, P40.8 pmol/l, and R=0.74, P40.8 pmol/l). Using MS as the comparator method, IA ascertained low testosterone compatible with hypogonadism (IA for the detection of low E(2) (40.7 pmol/l) were 13.3 and 99.3%, and for high E(2) (>120 pmol/l) 88.4 and 88.6%. A validated platform IA is sufficient to detect subnormal testosterone concentrations in the diagnosis of male hypogonadism. The IA used for E(2) measurements showed poor correlation with MS and may only be suitable for the detection of high E(2) in men.

  1. Monitoring bottlenose dolphin leukocyte cytokine mRNA responsiveness by qPCR.

    Directory of Open Access Journals (Sweden)

    Amelia Ruth Hofstetter

    Full Text Available Both veterinarians caring for dolphins in managed populations and researchers monitoring wild populations use blood-based diagnostics to monitor bottlenose dolphin (Tursiops truncatus health. Quantitative PCR (qPCR can be used to assess cytokine transcription patterns of peripheral blood mononuclear cells (PBMC. This can supplement currently available blood tests with information on immune status. Full realization of this potential requires establishment of normal ranges of cytokine gene transcription levels in bottlenose dolphins. We surveyed four dolphins over the span of seven months by serial bleeds. PBMC were stimulated with phytohaemagglutinin (1, 5, and 10 μg/mL and concanavalin A (1 μg/mL for 48 H in vitro. RNA from these cultures was probed by qPCR using Tursiops truncatus-specific primers (IL-1α, IL-1β, IL-1RA, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-13, IL-18, IFN-γ and TNF-α. Two blood samples from an additional bottlenose dolphin diagnosed with acute pulmonary disease add further perspective to the data. We observed that mitogen choice made a significant difference in the magnitude of gene transcription observed. On the other hand, most cytokines tested exhibited limited intra-animal variation. However, IL-6 and IL-12p40 differed between older and younger dolphins. Furthermore, the magnitude of mitogenic response clusters the tested cytokines into three groups. The data provide a reference for the selection of target cytokine mRNAs and their expected range of mitogen-stimulated cytokine gene transcription for future studies.

  2. Identification of serum biomarkers for aging and anabolic response

    Directory of Open Access Journals (Sweden)

    Urban Randall J

    2011-06-01

    Full Text Available Abstract Objective With the progressive aging of the human population, there is an inexorable decline in muscle mass, strength and function. Anabolic supplementation with testosterone has been shown to effectively restore muscle mass in both young and elderly men. In this study, we were interested in identifying serum factors that change with age in two distinct age groups of healthy men, and whether these factors were affected by testosterone supplementation. Methods We measured the protein levels of a number of serum biomarkers using a combination of banked serum samples from older men (60 to 75 years and younger men (ages 18 to 35, as well as new serum specimens obtained through collaboration. We compared baseline levels of all biomarkers between young and older men. In addition, we evaluated potential changes in these biomarker levels in association with testosterone dose (low dose defined as 125 mg per week or below compared to high dose defined as 300 mg per week or above in our banked specimens. Results We identified nine serum biomarkers that differed between the young and older subjects. These age-associated biomarkers included: insulin-like growth factor (IGF1, N-terminal propeptide of type III collagen (PIIINP, monokine induced by gamma interferon (MIG, epithelial-derived neutrophil-activating peptide 78 (ENA78, interleukin 7 (IL-7, p40 subunit of interleukin 12 (IL-12p40, macrophage inflammatory protein 1β (MIP-1β, platelet derived growth factor β (PDGFβ and interferon-inducible protein 10 (IP-10. We further observed testosterone dose-associated changes in some but not all age related markers: IGF1, PIIINP, leptin, MIG and ENA78. Gains in lean mass were confirmed by dual energy X-ray absorptiometry (DEXA. Conclusions Results from this study suggest that there are potential phenotypic biomarkers in serum that can be associated with healthy aging and that some but not all of these biomarkers reflect gains in muscle mass upon

  3. Suppression of IL-12p70 formation by IL-2 or following macrophage depletion causes T-cell autoreactivity leading to CNS demyelination in HSV-1-infected mice.

    Directory of Open Access Journals (Sweden)

    Dhong Hyun Lee

    2017-05-01

    Full Text Available We have established two mouse models of central nervous system (CNS demyelination that differ from most other available models of multiple sclerosis (MS in that they represent a mixture of viral and immune triggers. In the first model, ocular infection of different strains of mice with a recombinant HSV-1 that expresses murine IL-2 constitutively (HSV-IL-2 causes CNS demyelination. In the second model, depletion of macrophages causes CNS demyelination in mice that are ocularly infected with wild-type (WT HSV-1. In the present study, we found that the demyelination in macrophage-intact mice infected with HSV-IL-2 was blocked by depletion of FoxP3-expressing cells, while concurrent depletion of macrophages restored demyelination. In contrast, demyelination was blocked in the macrophage-depleted mice infected with wild-type HSV-1 following depletion of FoxP3-expressing cells. In macrophage-depleted HSV-IL-2-infected mice, demyelination was associated with the activity of both CD4+ and CD8+ T cells, whereas in macrophage-depleted mice infected with WT HSV-1, demyelination was associated with CD4+ T cells. Macrophage depletion or infection with HSV-IL-2 caused an imbalance of T cells and TH1 responses as well as alterations in IL-12p35 and IL-12p40 but not other members of the IL-12 family or their receptors. Demyelination was blocked by adoptive transfer of macrophages that were infected with HSV-IL-12p70 or HSV-IL-12p40 but not by HSV-IL-12p35. These results indicate that suppression of IL-12p70 formation by IL-2 or following macrophage depletion causes T-cell autoreactivity leading to CNS demyelination in HSV-1-infected mice.

  4. Ex vivo testing of immune responses in precision-cut lung slices

    International Nuclear Information System (INIS)

    Henjakovic, M.; Sewald, K.; Switalla, S.; Kaiser, D.; Mueller, M.; Veres, T.Z.; Martin, C.; Uhlig, S.; Krug, N.; Braun, A.

    2008-01-01

    The aim of this study was the establishment of precision-cut lung slices (PCLS) as a suitable ex vivo alternative approach to animal experiments for investigation of immunomodulatory effects. For this purpose we characterized the changes of cytokine production and the expression of cell surface markers after incubation of PCLS with immunoactive substances lipopolysaccharide (LPS), macrophage-activating lipopeptide-2 (MALP-2), interferon γ (IFNγ), and dexamethasone. Viability of PCLS from wild-type and CD11c-enhanced yellow fluorescent protein (CD11-EYFP)-transgenic mice was controlled by measurement of lactate dehydrogenase (LDH) enzyme activity and live/dead fluorescence staining using confocal microscopy. Cytokines and chemokines were detected with Luminex technology and ELISA. Antigen presenting cell (APC) markers were investigated in living mouse PCLS in situ using confocal microscopy. LPS triggered profound pro-inflammatory effects in PCLS. Dexamethasone prevented LPS-induced production of cytokines/chemokines such as interleukin (IL)-5, IL-1α, TNFα, IL-12(p40), and RANTES in PCLS. Surface expression of MHC class II, CD40, and CD11c, but not CD86 was present in APCs of naive PCLS. Incubation with LPS enhanced specifically the expression of MHC class II on diverse cells. MALP-2 only failed to alter cytokine or chemokine levels, but was highly effective in combination with IFNγ resulting in increased levels of TNFα, IL-12(p40), RANTES, and IL-1α. PCLS showed characteristic responses to typical pro-inflammatory stimuli and may thus provide a suitable ex vivo technique to predict the immunomodulatory potency of inhaled substances

  5. A idade como fator prognóstico in vitro The age as a predictive factor in in vitro fertilization cycles

    Directory of Open Access Journals (Sweden)

    Luiz Mauro Oliveira Gomes

    2009-05-01

    Full Text Available OBJETIVO: avaliar a idade da paciente como fator indicador de resultados em um programa de fertilização in vitro. MÉTODOS: estudo transversal que incluiu 302 mulheres, com idade variando entre 24 e 46 anos, submetidas ao tratamento com fertilização in vitro (FIV, no período de Maio de 2005 a Julho de 2007. As pacientes foram divididas em três grupos, de acordo com a faixa etária: G40 (n=52. Foram avaliados: número de oócitos aspirados, taxas de fertilização, número de embriões transferidos, qualidade embrionária e taxas de gravidez. A análise estatística foi realizada pela análise de variância de Kruskal-Wallis e pelo teste do χ2. RESULTADOS: no Grupo G40, 1,6 oócitos por paciente. O número de oócitos obtidos no Grupo G>40 foi significantemente menor que nos Grupos G40, havendo redução estatisticamente significante no Grupo G>40 (p40 apresentou taxa de 9,6%, resultado significantemente inferior (p=0,0339 aos Grupos GPURPOSE: to evaluate the patient's age as an outcome predictor in an in vitro fertilization (IVF program. METHODS: transversal study, which has included 302 women with ages varying from 24 to 46 years old, submitted to IVF, from May 2005 to July 2007. The patients were divided in three groups, according to their age: G40 (n=52. The number of collected oocytes, the fertilization rates, the number of transferred embryos, the embryonary quality and the pregnancy rate were evaluated. Statistical analysis was realized through Kruskal-Wallis variance analysis and χ2 test. RESULTS: in the G40 group, 1.6. The number of oocytes obtained in G>40 group was significantly lower than in the other two groups (p40, respectively, with statistically significant decrease in the G>40 group (p40 group has presented a rate of 9.6%, a result which is significantly lower (p=0.0330 than the one presented by the G<35 and G 36-39 groups (26.1 e 27.0%, respectively, with no significant difference between themselves. CONCLUSIONS: though

  6. Immunological characterization and transcription profiling of peripheral blood (PB monocytes in children with autism spectrum disorders (ASD and specific polysaccharide antibody deficiency (SPAD: case study

    Directory of Open Access Journals (Sweden)

    Jyonouchi Harumi

    2012-01-01

    Full Text Available Abstract Introduction There exists a small subset of children with autism spectrum disorders (ASD characterized by fluctuating behavioral symptoms and cognitive skills following immune insults. Some of these children also exhibit specific polysaccharide antibody deficiency (SPAD, resulting in frequent infection caused by encapsulated organisms, and they often require supplemental intravenous immunoglobulin (IVIG (ASD/SPAD. This study assessed whether these ASD/SPAD children have distinct immunological findings in comparison with ASD/non-SPAD or non-ASD/SPAD children. Case description We describe 8 ASD/SPAD children with worsening behavioral symptoms/cognitive skills that are triggered by immune insults. These ASD/SPAD children exhibited delayed type food allergy (5/8, treatment-resistant seizure disorders (4/8, and chronic gastrointestinal (GI symptoms (5/8 at high frequencies. Control subjects included ASD children without SPAD (N = 39, normal controls (N = 37, and non-ASD children with SPAD (N = 12. Discussion and Evaluation We assessed their innate and adaptive immune responses, by measuring the production of pro-inflammatory and counter-regulatory cytokines by peripheral blood mononuclear cells (PBMCs in responses to agonists of toll like receptors (TLR, stimuli of innate immunity, and T cell stimulants. Transcription profiling of PB monocytes was also assessed. ASD/SPAD PBMCs produced less proinflammatory cytokines with agonists of TLR7/8 (IL-6, IL-23, TLR2/6 (IL-6, TLR4 (IL-12p40, and without stimuli (IL-1ß, IL-6, and TNF-α than normal controls. In addition, cytokine production of ASD/SPAD PBMCs in response to T cell mitogens (IFN-γ, IL-17, and IL-12p40 and candida antigen (Ag (IL-10, IL-12p40 were less than normal controls. ASD/non-SPAD PBMDs revealed similar results as normal controls, while non-ASD/SPAD PBMCs revealed lower production of IL-6, IL-10 and IL-23 with a TLR4 agonist. Only common features observed between ASD/SPAD and non

  7. Characterization of cleavage events in the multifunctional cilium adhesin Mhp684 (P146) reveals a mechanism by which Mycoplasma hyopneumoniae regulates surface topography.

    Science.gov (United States)

    Bogema, Daniel R; Deutscher, Ania T; Woolley, Lauren K; Seymour, Lisa M; Raymond, Benjamin B A; Tacchi, Jessica L; Padula, Matthew P; Dixon, Nicholas E; Minion, F Chris; Jenkins, Cheryl; Walker, Mark J; Djordjevic, Steven P

    2012-01-01

    Mycoplasma hyopneumoniae causes enormous economic losses to swine production worldwide by colonizing the ciliated epithelium in the porcine respiratory tract, resulting in widespread damage to the mucociliary escalator, prolonged inflammation, reduced weight gain, and secondary infections. Protein Mhp684 (P146) comprises 1,317 amino acids, and while the N-terminal 400 residues display significant sequence identity to the archetype cilium adhesin P97, the remainder of the molecule is novel and displays unusual motifs. Proteome analysis shows that P146 preprotein is endogenously cleaved into three major fragments identified here as P50(P146), P40(P146), and P85(P146) that reside on the cell surface. Liquid chromatography with tandem mass spectrometry (LC-MS/MS) identified a semitryptic peptide that delineated a major cleavage site in Mhp684. Cleavage occurred at the phenylalanine residue within sequence (672)ATEF↓QQ(677), consistent with a cleavage motif resembling S/T-X-F↓X-D/E recently identified in Mhp683 and other P97/P102 family members. Biotinylated surface proteins recovered by avidin chromatography and separated by two-dimensional gel electrophoresis (2-D GE) showed that more-extensive endoproteolytic cleavage of P146 occurs. Recombinant fragments F1(P146)-F3(P146) that mimic P50(P146), P40(P146), and P85(P146) were constructed and shown to bind porcine epithelial cilia and biotinylated heparin with physiologically relevant affinity. Recombinant versions of F3(P146) generated from M. hyopneumoniae strain J and 232 sequences strongly bind porcine plasminogen, and the removal of their respective C-terminal lysine and arginine residues significantly reduces this interaction. These data reveal that P146 is an extensively processed, multifunctional adhesin of M. hyopneumoniae. Extensive cleavage coupled with variable cleavage efficiency provides a mechanism by which M. hyopneumoniae regulates protein topography. Vaccines used to control Mycoplasma

  8. Cuantificación de citocinas caninas mediante reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real

    Directory of Open Access Journals (Sweden)

    Omar A. Saldarriaga

    2006-10-01

    Full Text Available Introducción. Los caninos son el principal reservorio domestico de la leishmaniasis visceral en el Nuevo y Viejo mundo. La reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real para la medición de citocinas caninas no ha sido implementada para el estudio de la leishmaniasis visceral. Objetivo. Estandarizar la cuantificación relativa de IFN-g, IL-4, IL-10, IL-12p40 y IL-12p35 caninas utilizando reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real. Materiales y métodos. Células mononucleares de sangre periférica de perros Fox-Hound fueron estimuladas con ConA, LPS y extracto de Staphylococcus aureus. El ARN fue utilizado en la reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real de un solo paso para optimizar las concentraciones de iniciadores y sondas especificas de cada citocina, generar curvas estándar, confirmar la eficiencia de amplificación de las citocinas y del normalizador (18S ARNr y cuantificar la expresión de ARN. El método comparativo Ct fue utilizado para determinar los niveles relativos de expresión de ARN en las muestras, expresado como el incremento en el número de veces comparado con los controles. Resultados. El coeficiente de regresión para las curvas estándar y las eficiencias de amplificación de las citocinas y el normalizador, indicaron que la cuantificación fue confiable en un amplio rango de concentraciones de ARN. La activación de células mononucleares de sangre periférica resultó en un incremento en la expresión de IFN-g (132, IL-4 (8.8, IL-10 (7,2, y IL-12p40 (275, relativo a células control. La expresión basal de IL-12p35 fue también detectada. Conclusión. Esta metodología, comparada con los métodos convencionales disponibles para la medición de citocinas, ofrece varias ventajas y podría ser utilizada en estudios sobre inmunopatogenia e inmunidad en leishmaniasis visceral canina.

  9. Immunomodulator expression in trophoblasts from the feline immunodeficiency virus (FIV-infected cat

    Directory of Open Access Journals (Sweden)

    Donaldson Janet R

    2011-07-01

    Full Text Available Abstract Background FIV infection frequently compromises pregnancy under experimental conditions and is accompanied by aberrant expression of some placental cytokines. Trophoblasts produce numerous immunomodulators that play a role in placental development and pregnancy maintenance. We hypothesized that FIV infection may cause dysregulation of trophoblast immunomodulator expression, and aberrant expression of these molecules may potentiate inflammation and compromise pregnancy. The purpose of this project was to evaluate the expression of representative pro-(TNF-α, IFN-γ, IL-1β, IL-2, IL-6, IL-12p35, IL-12p40, IL-18, and GM-CSF and anti-inflammatory cytokines (IL-4, IL-5, and IL-10; CD134, a secondary co-stimulatory molecule expressed on activated T cells (FIV primary receptor; the chemokine receptor CXCR4 (FIV co-receptor; SDF-1α, the chemokine ligand to CXCR4; and FIV gag in trophoblasts from early-and late-term pregnancy. Methods We used an anti-cytokeratin antibody in immunohistochemistry to identify trophoblasts selectively, collected these cells using laser capture microdissection, and extracted total RNA from the captured cell populations. Real time, reverse transcription-PCR was used to quantify gene expression. Results We detected IL-4, IL-5, IL-6, IL-1β, IL-12p35, IL-12p40, and CXCR4 in trophoblasts from early-and late-term pregnancy. Expression of cytokines increased from early to late pregnancy in normal tissues. A clear, pro-inflammatory microenvironment was not evident in trophoblasts from FIV-infected queens at either stage of pregnancy. Reproductive failure was accompanied by down-regulation of both pro-and anti-inflammatory cytokines. CD134 was not detected in trophoblasts, and FIV gag was detected in only one of ten trophoblast specimens collected from FIV-infected queens. Conclusion Feline trophoblasts express an array of pro-and anti-inflammatory immunomodulators whose expression increases from early to late pregnancy in

  10. TLR2−/− Mice Display Decreased Severity of Giardiasis via Enhanced Proinflammatory Cytokines Production Dependent on AKT Signal Pathway

    Directory of Open Access Journals (Sweden)

    Xin Li

    2017-09-01

    Full Text Available Giardia infection is one of the most common causes of waterborne diarrheal disease in a wide array of mammalian hosts, including humans globally. Although numerous studies have indicated that adaptive immune responses are important for Giardia defense, however, whether the host innate immune system such as TLRs recognizes Giardia remains poorly understood. TLR2 plays a crucial role in pathogen recognition, innate immunity activation, and the eventual pathogen elimination. In this study, we investigated the role of TLR2 as a non-protective inflammatory response on controlling the severity of giardiasis. RT-PCR analysis suggested that TLR2 expression was increased in vitro. We demonstrated that Giardia lamblia-induced cytokines expression by the activation of p38 and ERK pathways via TLR2. Interestingly, the expression of IL-12 p40, TNF-α, and IL-6, but not IFN-γ, was enhanced in TLR2-blocked and TLR2−/− mouse macrophages exposed to G. lamblia trophozoites compared with wild-type (WT mouse macrophages. Further analysis demonstrated that G. lamblia trophozoites reduced cytokines secretion by activating AKT pathway in WT mouse macrophages. Immunohistochemical staining in G. lamblia cysts infected TLR2−/− and WT mice showed that TLR2 was highly expressed in duodenum in infected WT mice. Also, infected TLR2−/− and AKT-blocked mice showed an increased production of IL-12 p40 and IFN-γ compared with infected WT mice at the early stage during infection. Interestingly, infected TLR2−/− and AKT-blocked mice displayed a decreased parasite burden, an increased weight gain rate, and short parasite persistence. Histological morphometry showed shortened villus length, hyperplastic crypt and decreased ratio of villus height/crypt depth in infected WT mice compared with in infected TLR2−/− and AKT-blocked mice. Together, our results suggested that TLR2 deficiency leads to alleviation of giardiasis and reduction of parasite burden through

  11. Oral immunization with F4 fimbriae and CpG formulated with carboxymethyl starch enhances F4-specific mucosal immune response and modulates Th1 and Th2 cytokines in weaned pigs.

    Science.gov (United States)

    Delisle, Benjamin; Calinescu, Carmen; Mateescu, Mircea Alexandru; Fairbrother, John Morris; Nadeau, Éric

    2012-01-01

    F4 fimbriae are a potential candidate for an oral subunit vaccine for prevention of post-weaning diarrhea in swine due to infection with F4-positive enterotoxigenic Escherichia coli. However, large quantities of F4 fimbriae are required to induce a specific antibody response. The aim of the present study was to evaluate the effect of supplementation of F4 fimbriae with Cytosine-phosphate-Guanosine-oligodeoxynucleotide (CpG-A D19) or with complete cholera toxin (CT) as adjuvants on the F4-specific antibody response and cytokine production in weaned pigs following oral administration of F4 fimbrial antigen formulated with Carboxymethyl Starch (CMS). Oral dosage forms of F4 fimbriae alone or supplemented with CpG-A D19 or with CT were formulated with CMS as monolithic tablets, obtained by direct compression, and administered to weaned pigs. Blood and faecal samples were collected to determine the systemic and mucosal immune status of animals at various times until necropsy. During necropsy, contents of the jejunum and ileum were collected for determination of mucosal F4 specific antibodies. Segments of jejunum and ileum were also used to measure mRNA cytokine production. The presence of CpG in the formulation of the fimbriae significantly increased F4-specific immunoglobulin (Ig) IgM and IgG levels in intestinal secretions, and enhanced Th1 (Interferon-gamma / IFN-γ, Tumour Necrosis Factor-alpha / TNF-α, Interleukin-12p40 / IL-12p40, IL-1β) and Th2 (IL-4, IL-6) cytokine production in intestinal tissues. Supplementation with CT did not result in induction of F4-specific antibodies in secretions, although a significant Th1 response (IFN-α, IFN-γ, IL-18) was detected in tissues. Neither F4-specific systemic antibodies, nor intestinally secreted IgA were detected throughout the immunization trial for all groups. CpG-A D19 appeared to be a promising adjuvant for an oral F4 subunit vaccine formulated with CMS excipient as monolithic tablets. This matrix afforded gastro

  12. An ultrasonic therapeutic transducers using lead-free Na0.5K0.5NbO3-CuNb2O6 ceramics

    International Nuclear Information System (INIS)

    Yang, Ming-Ru; Chu, Sheng-Yuan; Tsai, Cheng-Che

    2010-01-01

    Research highlights: → In this paper, CN was added to NKN ceramics to decrease the sintering temperature and to improve the density and piezoelectric characteristics. The influence of CuNb 2 O 6 (CN) content on the microstructure, electrical properties, temperature stability, and mechanical properties of the synthesized samples was investigated. Results show that the samples synthesized with CN-doped not only improved the density but also exhibited superior piezoelectric characteristic, temperature stability of resonance frequency (TCF), and elastic stiffness coefficient than those of pure NKN piezoelectric ceramics. → The bulk density (4.47 g/cm 3 ), k p (40%), k t (45%), Q m (1642), C 33 D (19.64 x 10 10 N/m 2 ), TCF (-0.011%/ o C) and TCC (0.135%/ o C) values for NKN-01CN ceramics obtained from experiments show excellent 'hard' piezoelectric properties. Furthermore, a lead-free NKN-01CN ultrasonic therapeutic transducer was successfully driven by a self-tuning circuit. - Abstract: In this work, we reports on the CuNb 2 O 6 (CN) modified lead-free Na 0.5 K 0.5 NbO 3 (NKN) based piezoelectric ceramics were synthesized by solid-state reaction methods and sintered at 1075 o C for 3 h. A secondary phase of K 4 CuNb 8 O 23 was found in the XRD pattern of NKN-based ceramics as the CN dopants is 1 mol%. Microstructural analyses of un-doped and CN-doped ceramics were performed in a scanning electron microscope. The influence of CN content on the microstructure, electrical properties, temperature stability, and mechanical properties of the synthesized ceramics was investigated. The results show that the synthesized ceramics with CN-doped not only had improved density but also exhibited superior piezoelectric characteristics, temperature stability of resonance frequency (TCF), and a better elastic stiffness coefficient than those of pure NKN piezoelectric ceramics. The bulk density (4.47 g/cm 3 ), k p (40%), k t (45%), Q m (1642), C 33 D (19.64 x 10 10 N/m 2 ), TCF (-0

  13. TLR2 and TLR4 signaling pathways are required for recombinant Brucella abortus BCSP31-induced cytokine production, functional upregulation of mouse macrophages, and the Th1 immune response in vivo and in vitro.

    Science.gov (United States)

    Li, Jia-Yun; Liu, Yuan; Gao, Xiao-Xue; Gao, Xiang; Cai, Hong

    2014-09-01

    Brucella abortus is a zoonotic Gram-negative pathogen that causes brucelosis in ruminants and humans. Toll-like receptors (TLRs) recognize Brucella abortus and initiate antigen-presenting cell activities that affect both innate and adaptive immunity. In this study, we focused on recombinant Brucella cell-surface protein 31 (rBCSP31) to determine its effects on mouse macrophages. Our results demonstrated that rBCSP31 induced TNF-α, IL-6 and IL-12p40 production, which depended on the activation of mitogen-activated protein kinases (MAPKs) by stimulating the rapid phosphorylation of p38 and JNK and the activation of transcription factor NF-κB in macrophages. In addition, continuous exposure (>24 h) of RAW264.7 cells to rBCSP31 significantly enhanced IFN-γ-induced expression of MHC-II and the ability to present rBCSP31 peptide to CD4(+) T cells. Furthermore, we found that rBCSP31 could interact with both TLR2 and TLR4. The rBCSP31-induced cytokine production by macrophages from TLR2(-/-) and TLR4(-/-) mice was lower than that from C57BL/6 macrophages, and the activation of NF-κB and MAPKs was attenuated in macrophages from TLR2(-/-) and TLR4(-/-) mice. In addition, CD4(+) T cells from C57BL/6 mice immunized with rBCSP31 produced higher levels of IFN-γ and IL-2 compared with CD4(+) T cells from TLR2(-/-) and TLR4(-/-) mice. Macrophages from immunized C57BL/6 mice produced higher levels of IL-12p40 than those from TLR2(-/-) and TLR4(-/-) mice. Furthermore, immunization with rBCSP31 provided better protection in C57BL/6 mice than in TLR2(-/-) and TLR4(-/-) mice after B. abortus 2308 challenge. These results indicate that rBCSP31 is a TLR2 and TLR4 agonist that induces cytokine production, upregulates macrophage function and induces the Th1 immune response.

  14. Human stem cell based corneal tissue mimicking structures using laser-assisted 3D bioprinting and functional bioinks.

    Science.gov (United States)

    Sorkio, Anni; Koch, Lothar; Koivusalo, Laura; Deiwick, Andrea; Miettinen, Susanna; Chichkov, Boris; Skottman, Heli

    2018-07-01

    There is a high demand for developing methods to produce more native-like 3D corneal structures. In the present study, we produced 3D cornea-mimicking tissues using human stem cells and laser-assisted bioprinting (LaBP). Human embryonic stem cell derived limbal epithelial stem cells (hESC-LESC) were used as a cell source for printing epithelium-mimicking structures, whereas human adipose tissue derived stem cells (hASCs) were used for constructing layered stroma-mimicking structures. The development and optimization of functional bioinks was a crucial step towards successful bioprinting of 3D corneal structures. Recombinant human laminin and human sourced collagen I served as the bases for the functional bioinks. We used two previously established LaBP setups based on laser induced forward transfer, with different laser wavelengths and appropriate absorption layers. We bioprinted three types of corneal structures: stratified corneal epithelium using hESC-LESCs, lamellar corneal stroma using alternating acellular layers of bioink and layers with hASCs, and finally structures with both a stromal and epithelial part. The printed constructs were evaluated for their microstructure, cell viability and proliferation, and key protein expression (Ki67, p63α, p40, CK3, CK15, collagen type I, VWF). The 3D printed stromal constructs were also implanted into porcine corneal organ cultures. Both cell types maintained good viability after printing. Laser-printed hESC-LESCs showed epithelial cell morphology, expression of Ki67 proliferation marker and co-expression of corneal progenitor markers p63α and p40. Importantly, the printed hESC-LESCs formed a stratified epithelium with apical expression of CK3 and basal expression of the progenitor markers. The structure of the 3D bioprinted stroma demonstrated that the hASCs had organized horizontally as in the native corneal stroma and showed positive labeling for collagen I. After 7 days in porcine organ cultures, the 3D bioprinted

  15. Inflammatory Macrophage Phenotype in BTBR T+tf/J Mice

    Directory of Open Access Journals (Sweden)

    Paul eAshwood

    2013-09-01

    Full Text Available Although autism is a behaviorally defined disorder, many studies report an association with increased pro-inflammatory cytokine production. Recent characterization of the BTBR T+tf/J (BTBR inbred mouse strain has revealed several behavioral characteristics including social deficits, repetitive behavior, and atypical vocalizations which may be relevant to autism. We therefore hypothesized that asocial BTBR mice, which exhibit autism-like behaviors, may have an inflammatory immune profile similar to that observed in children with autism. The objectives of this study were to characterize the myeloid immune profile of BTBR mice and to explore their associations with autism-relevant behaviors. C57BL/6J (C57 mice and BTBR mice were tested for social interest and repetitive self-grooming behavior. Cytokine production was measured in bone-marrow derived macrophages incubated for 24 hours in either growth media alone, LPS, IL-4/ LPS, or IFNγ/ LPS to ascertain any M1/M2 skewing. After LPS stimulation, BTBR macrophages produced higher levels of IL-6, MCP-1, and MIP-1α and lower IL-10 (p<0.01 that C57 mice, suggesting an exaggerated inflammatory profile. After exposure to IL-4/LPS BTBR macrophages produced less IL-10 than C57 macrophages and more IL-12p40 (p<0.01 suggesting poor M2 polarization. Levels of IL-12(p70 (p<0.05 were higher in BTBR macrophages after IFNγ/LPS stimulation, suggesting enhanced M1 polarization. We further observed a positive correlation between grooming frequency, and production of IL-12(p40, IL-12p70, IL-6, and TNFα (p<0.05 after treatment with IFNγ/LPS across both strains. Collectively, these data suggest that the asocial BTBR mouse strain exhibits a more inflammatory, or M1, macrophage profile in comparison to social C57 strain. We have further demonstrated a relationship between this relative increase in inflammation and repetitive grooming behavior, which may have relevance to repetitive and stereotyped behavior of autism.

  16. Pro-Inflammatory Cytokines Predict Relapse-Free Survival after One Month of Interferon-α but Not Observation in Intermediate Risk Melanoma Patients.

    Directory of Open Access Journals (Sweden)

    Ahmad A Tarhini

    Full Text Available E1697 was a phase III trial of adjuvant interferon (IFN-α2b for one month (Arm B versus observation (Arm A in patients with resected melanoma at intermediate risk. We evaluated the levels of candidate serum cytokines, the HLA genotype, polymorphisms of CTLA4 and FOXP3 genes and the development of autoantibodies for their association with relapse free survival (RFS in Arm A and Arm B among 268 patients with banked biospecimens.ELISA was used to test 5 autoantibodies. Luminex/One Lambda LABTypeRSSO was used for HLA Genotyping. Selected CTLA4 and FOXP3 Single nucleotide polymorphisms (SNPs and microsatellites were tested for by polymerase chain reaction (PCR. Sixteen serum cytokines were tested at baseline and one month by Luminex xMAP multiplex technology. Cox Proportional Hazards model was applied and the Wald test was used to test the marginal association of each individual marker and RFS. We used the Lasso approach to select the markers to be included in a multi-marker Cox Proportional Hazards model. The ability of the resulting models to predict one year RFS was evaluated by the time-dependent ROC curve. The leave-one-out method of cross validation (LOOCV was used to avoid over-fitting of the data.In the multi-marker modeling analysis conducted in Arm B, one month serum IL2Rα, IL-12p40 and IFNα levels predicted one year RFS with LOOCV AUC = 82%. Among the three markers selected, IL2Rα and IFNα were the most stable (selected in all the cross validation cycles. The risk score (linear combination of the 3 markers separated the RFS curves of low and high risk groups well (p = 0.05. This model did not hold for Arm A, indicating a differential marker profile in Arm B linked to the intervention (adjuvant therapy.Early on-treatment proinflammatory serum markers (IL2Rα, IL-12p40, IFNα significantly predict RFS in our cohort of patients treated with adjuvant IFN-α2b and warrant further study.

  17. Biodegradable PLGA85/15 nanoparticles as a delivery vehicle for Chlamydia trachomatis recombinant MOMP-187 peptide

    International Nuclear Information System (INIS)

    Taha, Murtada A; Singh, Shree R; Dennis, Vida A

    2012-01-01

    Development of a Chlamydia trachomatis vaccine has been a formidable task partly because of an ineffective delivery system. Our laboratory has generated a recombinant peptide of C. trachomatis major outer membrane protein (MOMP) (rMOMP-187) and demonstrated that it induced at 20 μg ml −1 maximal interleukin (IL)-6 and IL-12p40 Th1 cytokines in mouse J774 macrophages. In a continuous pursuit of a C. trachomatis effective vaccine-delivery system, we encapsulated rMOMP-187 in poly(d,l-lactic-co-glycolic acid) (PLGA, 85:15 PLA/PGA ratio) to serve as a nanovaccine candidate. Physiochemical characterizations were assessed by Fourier transform-infrared spectroscopy, atomic force microscopy, Zetasizer, Zeta potential, transmission electron microcopy and differential scanning calorimetry. The encapsulated rMOMP-187 was small (∼200 nm) with an apparently smooth uniform oval structure, thermally stable (54 °C), negatively charged ( − 27.00 mV) and exhibited minimal toxicity at concentrations −1 to eukaryotic cells (>95% viable cells) over a 24–72 h period. We achieved a high encapsulation efficiency of rMOMP-187 (∼98%) in PLGA, a loading peptide capacity of 2.7% and a slow release of the encapsulated peptide. Stimulation of J774 macrophages with a concentration as low as 1 μg ml −1 of encapsulated rMOMP-187 evoked high production levels of the Th1 cytokines IL-6 (874 pg ml −1 ) and IL-12p40 (674 pg ml −1 ) as well as nitric oxide (8 μM) at 24 h post-stimulation, and in a dose-response and time-kinetics manner. Our data indicate the successful encapsulation and characterization of rMOMP-187 in PLGA and, more importantly, that PLGA enhanced the capacity of the peptide to induce Th1 cytokines and NO in vitro. These findings make this nanovaccine an attractive candidate in pursuit of an efficacious vaccine against C. trachomatis. (paper)

  18. Telopéptido carboxilo terminal del colágeno tipo I (b-CTX sérico y compromiso óseo en la insuficiencia renal crónica Serum b-Type I collagen carboxyterminal telopeptide (b-CTXs and bone involvement in chronic renal failure

    Directory of Open Access Journals (Sweden)

    Beatriz Oliveri

    2005-08-01

    Full Text Available La osteodistrofia renal (ODR se caracteriza por alteraciones óseas. Se evaluaron métodos bioquímicos alternativos a la biopsia ósea en pacientes renales para determinar cambios rápidos del remodelamiento óseo en 43 pacientes predialíticos (PD y 49 hemodializados (HD. Los PD presentaron fosfatemia, fosfatasa alcalina ósea (FAO, hormona paratiroidea intacta (PTHi y b-telopéptido carboxilo terminal del colágeno tipo I (bCTXs mayores y clearence de creatinina (Ccr menores (p40 ml/min. En PD, bCTXs (pAn increase in parathyroid hormone (PTH levels in chronic renal failure (CRF induces bone abnormalities known as renal osteodystrophy (ROD. The aim of the present study was to evaluate alternative biochemical methods to bone biopsy, to evaluate changes in bone remodeling in renal patients. Intact PTH (iPTH and bone markers were measured in 43 predialysis (PD, 49 hemodialysis patients (HD and 185 controls. bCTXs, bone alkaline phosphatase (bAL, iPTH were higher and creatinine clearance (Ccr was lower in PD and HD compared with controls (p40 ml/min. bCTXs (p<0.05 in PD and bCTXs and bAL in HD patients were higher than controls, even when iPTH was within normal range (<65 pg/ml. Patients with severe secondary hyperparathyroidism showed higher bone markers than patients with normal or moderately increased iPTH (p<0.001. These results suggest that even when there is no increase in iPTH, bone remodeling increases (possibly due to other factors exhibiting higher bone resorption, and bCTXs would seem to be an adequate non-invasive tool to assess early bone changes in CRF and prevent future fractures. Bone marker measurements in ROD would be useful to identify patients who may require bone biopsy. However, further studies comparing both methods must be performed before replacing bone biopsy with serum b-CTX.

  19. Ureaplasma Species Differentially Modulate Pro- and Anti-Inflammatory Cytokine Responses in Newborn and Adult Human Monocytes Pushing the State Toward Pro-Inflammation

    Science.gov (United States)

    Glaser, Kirsten; Silwedel, Christine; Fehrholz, Markus; Waaga-Gasser, Ana M.; Henrich, Birgit; Claus, Heike; Speer, Christian P.

    2017-01-01

    Background: Ureaplasma species have been associated with chorioamnionitis and preterm birth and have been implicated in the pathogenesis of neonatal short and long-term morbidity. However, being mostly commensal bacteria, controversy remains on the pro-inflammatory capacity of Ureaplasma. Discussions are ongoing on the incidence and impact of prenatal, perinatal, and postnatal infection. The present study addressed the impact of Ureaplasma isolates on monocyte-driven inflammation. Methods: Cord blood monocytes of term neonates and adult monocytes, either native or LPS-primed, were cultured with Ureaplasma urealyticum (U. urealyticum) serovar 8 (Uu8) and Ureaplasma parvum serovar 3 (Up3). Using qRT-PCR, cytokine flow cytometry, and multi-analyte immunoassay, we assessed mRNA and protein expression of tumor necrosis factor (TNF)-α, interleukin (IL)-1β, IL-8, IL-12p40, IL-10, and IL-1 receptor antagonist (IL-1ra) as well as Toll-like receptor (TLR) 2 and TLR4. Results: Uu8 and Up3 induced mRNA expression and protein release of TNF-α, IL-1β and IL-8 in term neonatal and adult monocytes (p Ureaplasma-stimulated cells paralleled those results. Ureaplasma-induced cytokine levels did not significantly differ from LPS-mediated levels except for lower intracellular IL-1β in adult monocytes (Uu8: p ureaplasmas did not induce IL-12p40 response and promoted lower amounts of anti-inflammatory IL-10 and IL-1ra than LPS, provoking a cytokine imbalance more in favor of pro-inflammation (IL-1β/IL-10, IL-8/IL-10 and IL-8/IL-1ra: p Ureaplasma isolates in human monocytes. Stimulating pro-inflammatory cytokine responses while hardly inducing immunomodulatory and anti-inflammatory cytokines, ureaplasmas might push monocyte immune responses toward pro-inflammation. Inhibition of LPS-induced cytokines in adult monocytes in contrast to sustained inflammation in term neonatal monocytes indicates a differential modulation of host immune responses to a second stimulus. Modification of

  20. Índices de onda P na predição de recorrência de fibrilação atrial após isolamento da veia pulmonar

    Directory of Open Access Journals (Sweden)

    Ahmed Salah

    2013-12-01

    Full Text Available FUNDAMENTO: Índices de ondas P são marcadores interessantes para prever recorrências de fibrilação atrial (FA pós ablação. OBJETIVO: Esse estudo avalia o valor dos índices de onda P para prever recorrências após isolamento da veia pulmonar (IVP em pacientes com fibrilação atrial paroxística. MÉTODOS: Foram selecionados 198 pacientes (57 ± 8 anos, 150 homens com FA paroxística sintomática refratária a medicamentos submetidos ao IVP em nosso hospital. Um eletrocardiograma de 12 derivações foi utilizado para medir a duração da onda P na derivação II, a força terminal de P (FTP na derivação V1, o eixo e a dispersão da onda P. RESULTADOS: No acompanhamento de 9 ± 3 meses, as recorrências ocorreram em 60 (30,3% pacientes. Os pacientes que apresentaram recorrência de FA tiveram maior duração média de onda P (122,9 ± 10,3 versus 104,3 ± 14,2 ms, p 125 ms apresenta 60% de sensibilidade, especificidade de 90%, valor preditivo positivo (VPP de 72% e valor preditivo negativo (VPN de 83,7%, enquanto a dispersão da onda P > 40 ms tem 78% de sensibilidade, 67% de especificidade, PPV 51% e VPN de 87,6%. 48/66 (72,7% dos pacientes com FTP -0,04 mm/segundo tiveram recorrência de FA (p 125 ms, a dispersão da onda P > 40 ms e FTP em V1 < -0,04 mm/sec são bons preditores clínicos das recorrências de FA pós IVP em pacientes com fibrilação atrial paroxística; contudo, eles não foram independentes do tamanho do átrio esquerdo e da idade.

  1. Gallic Acid Is the Major Active Component of Cortex Moutan in Inhibiting Immune Maturation of Human Monocyte-Derived Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Ben Chung Lap Chan

    2015-09-01

    Full Text Available Atopic dermatitis (AD is a widely prevalent and chronically relapsing inflammatory skin disease. Penta Herbs Formula (PHF is efficacious in improving the quality of life and reducing topical corticosteroid used in children with AD and one of the active herbs it contains is Cortex Moutan. Recent studies showed that altered functions of dendritic cells (DC were observed in atopic individuals, suggesting that DC might play a major role in the generation and maintenance of inflammation by their production of pro-inflammatory cytokines. Hence, the aims of the present study were to identify the major active component(s of Cortex Moutan, which might inhibit DC functions and to investigate their possible interactions with conventional corticosteroid on inhibiting the development of DC from monocytes. Monocyte-derived dendritic cells (moDC culture model coupled with the high-speed counter-current chromatography (HSCCC, high pressure liquid chromatography (HPLC and Liquid Chromatography-Mass Spectrometry (LCMS analyses were used. Gallic acid was the major active component from Cortex Moutan which could dose dependently inhibit interleukin (IL-12 p40 and the functional cluster of differentiation (CD surface markers CD40, CD80, CD83 and CD86 expression from cytokine cocktail-activated moDC. Gallic acid could also lower the concentration of hydrocortisone required to inhibit the activation of DC.

  2. IL-23 Is Essential for the Development of Elastase-Induced Pulmonary Inflammation and Emphysema.

    Science.gov (United States)

    Fujii, Utako; Miyahara, Nobuaki; Taniguchi, Akihiko; Waseda, Koichi; Morichika, Daisuke; Kurimoto, Etsuko; Koga, Hikari; Kataoka, Mikio; Gelfand, Erwin W; Cua, Daniel J; Yoshimura, Akihiko; Tanimoto, Mitsune; Kanehiro, Arihiko

    2016-11-01

    We recently reported that IL-17A plays a critical role in the development of porcine pancreatic elastase (PPE)-induced emphysema. The proliferation of T-helper type 17 (Th17) cells was induced by IL-23. To determine the contribution of IL-23 to the development of pulmonary emphysema, a mouse model of PPE-induced emphysema was used in which responses of IL-23p19-deficient (IL-23 -/- ) and wild-type (WT) mice were compared. Intratracheal instillation of PPE induced emphysematous changes in the lungs and was associated with increased levels of IL-23 in lung homogenates. Compared with WT mice, IL-23 -/- mice developed significantly lower static compliance values and markedly reduced emphysematous changes on histological analyses after PPE instillation. These changes were associated with lower levels of IL-17A and fewer Th17 cells in the lung. The neutrophilia seen in bronchoalveolar lavage fluid of WT mice was attenuated in IL-23 -/- mice, and the reduction was associated with decreased levels of keratinocyte-derived cytokine and macrophage inflammatory protein-2 in bronchoalveolar lavage fluid. Treatment with anti-IL-23p40 monoclonal antibody significantly attenuated PPE-induced emphysematous changes in the lungs of WT mice. These data identify the important contributions of IL-23 to the development of elastase-induced pulmonary inflammation and emphysema, mediated through an IL-23/IL-17 pathway. Targeting IL-23 in emphysema is a potential therapeutic strategy for delaying disease progression.

  3. Perinatal Fluoxetine Exposure Impairs the CO2 Chemoreflex. Implications for Sudden Infant Death Syndrome.

    Science.gov (United States)

    Bravo, Karina; Eugenín, Jaime L; Llona, Isabel

    2016-09-01

    High serotonin levels during pregnancy affect central nervous system development. Whether a commonly used antidepressant such as fluoxetine (a selective serotonin reuptake inhibitor) taken during pregnancy may adversely affect respiratory control in offspring has not been determined. The objective was to determine the effect of prenatal-perinatal fluoxetine exposure on the respiratory neural network in offspring, particularly on central chemoreception. Osmotic minipumps implanted into CF-1 mice on Days 5-7 of pregnancy delivered 7 milligrams per kilogram per day of fluoxetine, achieving plasma levels within the range found in patients. Ventilation was assessed in offspring at postnatal Days 0-40 using head-out body plethysmography. Neuronal activation was evaluated in the raphe nuclei and in the nucleus tractus solitarius by c-Fos immunohistochemistry during normoxic eucapnia and hypercapnia (10% CO2). Respiratory responses to acidosis were evaluated in brainstem slices. Prenatal-perinatal fluoxetine did not affect litter size, birth weight, or the postnatal growth curve. Ventilation under eucapnic normoxic conditions was similar to that of control offspring. Fluoxetine exposure reduced ventilatory responses to hypercapnia at P8-P40 (P Fluoxetine applied acutely on control slices did not modify their respiratory response to acidosis. We concluded that prenatal-perinatal fluoxetine treatment impairs central respiratory chemoreception during postnatal life. These results are relevant in understanding the pathogenesis of respiratory failures, such as sudden infant death syndrome, associated with brainstem serotonin abnormalities and the failure of respiratory chemoreflexes.

  4. Solubilization and purification of the glucosyltransferase involved in the biosynthesis of teichuronic acid by fragments of Micrococcus luteus cell membranes

    International Nuclear Information System (INIS)

    Hildebrandt, K.M.; Anderson, J.S.

    1987-01-01

    Enzymes involved in the biosynthesis of teichuronic acid have been demonstrated in cytoplasmic membrane fragments recovered from lysozyme treated Micrococcus luteus cells. Solubilization of the glucosyltransferase activity was effected with aqueous solutions of Triton X-100, Nonidet P-40, Tween 20, or Thesit. Thesit proved most amenable for recovery of glucosyltransferase activity as well as spectrophotometric protein determinations. Recovery of the glucosyltranferase activity was aided during purification by inclusion of 15% glycerol, 0.75% Thesit, 20 mM magnesium ion and 2 mM 2-mercaptoethanol in all buffers. Glucosyltransferase activity was monitored by the transfer of [ 14 C]glucose from UDP-[ 14 C]glucose to an artificial acceptor. Although the natural acceptor is presumed to be an undecaprenyl diphosphate-activated oligosaccharide, alternate acceptors such as isolated cell wall fractions containing teichuronic acid served equally well. Highly purified teichuronic acid devoid of peptidoglycan was the most effective alternate acceptor. The glucosyltransferase was purified by ammonium sulfate precipitation followed by ion exchange chromatography on DEAE-cellulose yielding an overall 200-fold increase in specific activity

  5. Effects of physical activity at work and life-style on sleep in workers from an Amazonian Extractivist Reserve

    Directory of Open Access Journals (Sweden)

    Andressa Juliane Martins

    2016-10-01

    Full Text Available Physical activity has been recommended as a strategy for improving sleep. Nevertheless, physical effort at work might not be not the ideal type of activity to promote sleep quality. The aim of this study was to evaluate the effects of type of job (low vs. high physical effort and life-style on sleep of workers from an Amazonian Extractivist Reserve, Brazil. A cross-sectional study of 148 low physical activity (factory workers and 340 high physical activity (rubber tappers was conducted between September and November 2011. The workers filled out questionnaires collecting data on demographics (sex, age, occupation, marital status and children, health (reported morbidities, sleep disturbances, musculoskeletal pain and body mass index and life-style (smoking, alcohol use and practice of leisure-time physical activity. Logistic regression models were applied with the presence of sleep disturbances as the primary outcome variable. The prevalence of sleep disturbances among factory workers and rubber tappers was 15.5% and 27.9%, respectively. The following independent variables of the analysis were selected based on a univariate model (p40 years, and having musculoskeletal pain (≥5 symptoms. Rubber tapper work, owing to greater physical effort, pain and musculoskeletal fatigue, was associated with sleep disturbances. Being female and older than 40 years were also predictors of poor sleep. In short, these findings suggest that demanding physical exertion at work may not improve sleep quality.

  6. Yellow fever vaccine YF-17D activates multiple dendritic cell subsets via TLR2, 7, 8, and 9 to stimulate polyvalent immunity.

    Science.gov (United States)

    Querec, Troy; Bennouna, Soumaya; Alkan, Sefik; Laouar, Yasmina; Gorden, Keith; Flavell, Richard; Akira, Shizuo; Ahmed, Rafi; Pulendran, Bali

    2006-02-20

    The live attenuated yellow fever vaccine 17D (YF-17D) is one of the most effective vaccines available, with a 65-yr history of use in >400 million people globally. Despite this efficacy, there is presently no information about the immunological mechanisms by which YF-17D acts. Here, we present data that suggest that YF-17D activates multiple Toll-like receptors (TLRs) on dendritic cells (DCs) to elicit a broad spectrum of innate and adaptive immune responses. Specifically, YF-17D activates multiple DC subsets via TLRs 2, 7, 8, and 9 to elicit the proinflammatory cytokines interleukin (IL)-12p40, IL-6, and interferon-alpha. Interestingly, the resulting adaptive immune responses are characterized by a mixed T helper cell (Th)1/Th2 cytokine profile and antigen-specific CD8+ T cells. Furthermore, distinct TLRs appear to differentially control the Th1/Th2 balance; thus, whilst MyD88-deficient mice show a profound impairment of Th1 cytokines, TLR2-deficient mice show greatly enhanced Th1 and Tc1 responses to YF-17D. Together, these data enhance our understanding of the molecular mechanism of action of YF-17D, and highlight the potential of vaccination strategies that use combinations of different TLR ligands to stimulate polyvalent immune responses.

  7. Effect of 16-hour duty periods on patient care and resident education.

    Science.gov (United States)

    McCoy, Christopher P; Halvorsen, Andrew J; Loftus, Conor G; McDonald, Furman S; Oxentenko, Amy S

    2011-03-01

    To measure the effect of duty periods no longer than 16 hours on patient care and resident education. As part of our Educational Innovations Project, we piloted a novel resident schedule for an inpatient service that eliminated shifts longer than 16 hours without increased staffing or decreased patient admissions on 2 gastroenterology services from August 29 to November 27, 2009. Patient care variables were obtained through medical record review. Resident well-being and educational variables were collected by weekly surveys, end of rotation evaluations, and an electronic card-swipe system. Patient care metrics, including 30-day mortality, 30-day readmission rate, and length of stay, were unchanged for the 196 patient care episodes in the 5-week intervention month compared with the 274 episodes in the 8 weeks of control months. However, residents felt less prepared to manage cross-cover of patients (P = .006). There was a nonsignificant trend toward decreased perception of quality of education and balance of personal and professional life during the intervention month. Residents reported working fewer weekly hours overall during the intervention (64.3 vs 68.9 hours; P = .40), but they had significantly more episodes with fewer than 10 hours off between shifts (24 vs 2 episodes; P = .004). Inpatient hospital services can be staffed with residents working shifts less than 16 hours without additional residents. However, cross-cover of care, quality of education, and time off between shifts may be adversely affected.

  8. Mixed pituitary adenoma/craniopharyngioma: clinical, morphological, immunohistochemical and ultrastructural study of a case, review of the literature, and pathogenetic and nosological considerations.

    Science.gov (United States)

    Finzi, Giovanna; Cerati, Michele; Marando, Alessandro; Zoia, Cesare; Ferreli, Fabio; Tomei, Giustino; Castelnuovo, Paolo; La Rosa, Stefano; Capella, Carlo

    2014-02-01

    Mixed pituitary adenoma/craniopharyngiomas are very rare tumors. Their pathogenesis is still unclear and it is not known whether they are collision tumors derived from independent stem cells or whether they originate from a single stem cell undergoing divergent differentiation. The latter hypothesis is supported by the close commixture between the two tumor components with transition areas that has been previously described. However, "hybrid" cells with both pituitary adenoma and craniopharyngioma features have never been described. In this paper we report a case of mixed pituitary adenoma/craniopharyngioma observed in a 75-year-old woman presenting with diplopia and slight increase of serum prolactin, who underwent endoscopic endonasal trans-sphenoidal tumor resection. Histologically, the tumor was composed of a typical pituitary silent subtype 2 ACTH cell adenoma admixed with islands of adamantinomatous craniopharyngioma. Electron microscopy showed that, in addition to distinct silent subtype 2 ACTH and craniopharyngioma cells, there were "hybrid" cells, showing characteristics of both pituitary adenoma and craniopharyngioma, consisting of small dense secretory granules, bundles of cytoplasmic filaments, and desmosomes. This ultrastructural finding was also confirmed by the presence of cells showing nuclear p40 expression and chromogranin A immunoreactivity. The close commixture between the two components and the ultrastructural and immunohistochemical findings demonstrate a common histogenesis of the two components and support the classification of the neoplasm as a mixed tumor. The patient completely recovered and, 10 months after surgery, head MR confirmed the complete resection of the lesion.

  9. [Strategy for molecular testing in pulmonary carcinoma].

    Science.gov (United States)

    Penault-Llorca, Frédérique; Tixier, Lucie; Perrot, Loïc; Cayre, Anne

    2016-01-01

    Nowadays, the analysis of theranostic molecular markers is central in the management of lung cancer. As those tumors are diagnosed in two third of the cases at an advanced stage, molecular screening is frequently performed on "small samples". The screening strategy starts by an accurate histopathological characterization, including on biopsies or cytological specimens. WHO 2015 provided a new classification for small biopsy and cytology, defining categories such as non-small cell carcinoma (NSCC), favor adenocarcinoma (TTF1 positive), or favor squamous cell carcinoma (p40 positive). Only the NSCC tumors, non-squamous, are eligible to molecular testing. A strategy aiming at tissue sparing for the small biopsies has to be organized. Tests corresponding to available drugs are prioritized. Blank slides will be prepared for immunohistochemistry and in situ hybridization based tests such as ALK. DNA will then be extracted for the other tests, EGFR mutation screening first associated or not to KRAS. Then, the emerging biomarkers (HER2, ROS1, RET, BRAF…) as well as potentially other markers in case of clinical trials, can been tested. The spread of next generation sequencing technologies, with a very sensitive all-in-one approach will allow the identification of minority clones. Eventually, the development of liquid biopsies will provide the opportunity to monitor the apparition of resistance clones during treatment. This non-invasive approach allows patients with a contraindication to perform biopsy or with non-relevant biopsies to access to molecular screening. Copyright © 2016. Published by Elsevier Masson SAS.

  10. Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

    Energy Technology Data Exchange (ETDEWEB)

    Warburton, P.E.; Gosden, J.; Lawson, D. [Western General Hospital, Edinburgh (United Kingdom)] [and others

    1996-04-15

    Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize and spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.

  11. New estimation of secondary particle multiplicity of nuclear interactions in proton therapy using multicollisional plus evaporation Monte Carlo calculations

    International Nuclear Information System (INIS)

    Mesa, J.; Rodrigues, T. E.; Garcia-Trapaga, C. E.; Arruda-Neto, J. D. T.; Shtejer, K. . Email. jmesa@ibb.unesp.br

    2007-01-01

    Secondary particles contribute to dose deposition in critical organs outside the irradiated target volume. However, the literature regarding specifically to neutron dose and other secondary particles from proton therapy is limited. This issue is of special relevance for young patients, particularly when life expectancy is long, fundamentally if we consider that the art of cancer treatment is finding the right balance between tumor control and injury to normal tissues. In this work we have obtained spectra and multiplicities for neutrons and other secondary particles emitted in the reactions of protons: p+ 12 C, p+ 16 O, p+ 40 Ca and p+ 14 N, for proton energies from 100 to 200 MeV. In this sense, we have used a quite sophisticate multicollisional Monte Carlo code (MCMC) for pre-equilibrium emission, plus de-excitation of residual nucleus by two ways: evaporation of particles (mainly nucleons, but also composites) and possibly fission in the case of heavy residues. The code was developed in our group, with very recently improvements that take into account Pauli-blocking effects in a novel and more precise way, as well as a more rigorous energy balance, an energy stopping time criterion for pre-equilibrium emission, and the inclusion of deuteron, triton and 3 He emissions in the evaporation step

  12. Underwater striling engine design with modified one-dimensional model

    Directory of Open Access Journals (Sweden)

    Daijin Li

    2015-05-01

    Full Text Available Stirling engines are regarded as an efficient and promising power system for underwater devices. Currently, many researches on one-dimensional model is used to evaluate thermodynamic performance of Stirling engine, but in which there are still some aspects which cannot be modeled with proper mathematical models such as mechanical loss or auxiliary power. In this paper, a four-cylinder double-acting Stirling engine for Unmanned Underwater Vehicles (UUVs is discussed. And a one-dimensional model incorporated with empirical equations of mechanical loss and auxiliary power obtained from experiments is derived while referring to the Stirling engine computer model of National Aeronautics and Space Administration (NASA. The P-40 Stirling engine with sufficient testing results from NASA is utilized to validate the accuracy of this one-dimensional model. It shows that the maximum error of output power of theoretical analysis results is less than 18% over testing results, and the maximum error of input power is no more than 9%. Finally, a Stirling engine for UUVs is designed with Schmidt analysis method and the modified one-dimensional model, and the results indicate this designed engine is capable of showing desired output power.

  13. Physical activity staging distribution: establishing a heuristic using multiple studies.

    Science.gov (United States)

    Nigg, C; Hellsten, L; Norman, G; Braun, L; Breger, R; Burbank, P; Coday, M; Elliot, D; Garber, C; Greaney, M; Keteyian, S; Lees, F; Matthews, C; Moe, E; Resnick, B; Riebe, D; Rossi, J; Toobert, D; Wang, T; Welk, G; Williams, G

    2005-04-01

    The purpose of this study was to identify the population prevalence across the stages of change (SoC) for regular physical activity and to establish the prevalence of people at risk. With support from the National Institutes of Health, the American Heart Association, and the Robert Wood Johnson Foundation, nine Behavior Change Consortium studies with a common physical activity SoC measure agreed to collaborate and share data. The distribution pattern identified in these predominantly reactively recruited studies was Precontemplation (PC) = 5% (+/- 10), Contemplation (C) = 10% (+/- 10), Preparation (P) = 40% (+/- 10), Action = 10% (+/- 10), and Maintenance = 35% (+/- 10). With reactively recruited studies, it can be anticipated that there will be a higher percentage of the sample that is ready to change and a greater percentage of currently active people compared to random representative samples. The at-risk stage distribution (i.e., those not at criteria or PC, C, and P) was approximately 10% PC, 20% C, and 70% P in specific samples and approximately 20% PC, 10% C, and 70% P in the clinical samples. Knowing SoC heuristics can inform public health practitioners and policymakers about the population's motivation for physical activity, help track changes over time, and assist in the allocation of resources.

  14. Determination of Microbial Nitrogen Production by Using Urinary Allantoin and Blood Metabolite Concentrate in Growing Brahman Cattle Fed the Different Proportion of Roughage and Concentrate in Diets

    International Nuclear Information System (INIS)

    Suthikrai, Wanvipa; Usawang, Sungwon; Kijsamrej, Suriya; Sophon, Sunpetch; Jetana, Thongsuk

    2003-06-01

    Determination of microbial nitrogen synthesis by using urinary allantoin and blood metabolite for evaluating the efficiency of feed utilization, in this study was conducted by using four Brahman bulls (about 1 year old). Animals were fed ad libitum with 4 fixed diets of four combinations of pineapple fibre (P) and concentrate (C) in the proportions, on dry matter basis of 0.8:0.2 (P80:C20), 0.6:0.04(P60:C40), 0.4:0.6(P40:C60) and 0.2:0.8 (P20:C80). The experiment was designed as a 4x4 Latin square design The Results showed that increasing in the proportion of concentrate linearly increased the rumen microbial nitrogen production (p<0.001), the concentrations of Insulin and urea-N in plasma and the concentration of urea-N in the urine, but not affected on the concentrations of glucose and creatinine in plasma. In conclusion, the using of allantoin urinary associated with blood metabolite can evaluate the accuracy in evaluation of feed utilization in Brahman cattle

  15. Transcriptional Regulation of Δ6-Desaturase by Peroxisome Proliferative-Activated Receptor δ Agonist in Human Pancreatic Cancer Cells: Role of MEK/ERK1/2 Pathway

    Directory of Open Access Journals (Sweden)

    Maryam Darabi

    2013-01-01

    Full Text Available The Δ6-desaturase (Δ6D, also known as fatty acid desaturase 2, is a regulatory enzyme in de novo fatty acid synthesis, which has been linked to obesity and diabetes. The aim of the present study was to investigate the effect of peroxisome proliferative-activated receptor δ (PPARδ agonist and MEK/ERK1/2-dependent pathway on the expression of Δ6D in human pancreatic carcinoma cell line PANC-1. PANC-1 cells cultured in RPMI-1640 were exposed to the commonly used ERK1/2 pathway inhibitor PD98059 and PPARδ agonist GW0742. Changes in mRNA and protein expression of Δ6D were then determined using real-time RT-PCR and Western blot, respectively. The expression of Δ6D (P40%, P25%, P<0.05 pretreatment. PPARδ and MEK/ERK1/2 signaling pathways affect differentially the expression of Δ6D in pancreatic cancer cells. Furthermore, there may be an inhibitory crosstalk between these two regulatory pathways on the mRNA expression of Δ6D and subsequently on Δ6D protein expression.

  16. Reducing Greenhouse Gas Emissions in Grassland Ecosystems of the Central Lithuania: Multi-Criteria Evaluation on a Basis of the ARAS Method

    Directory of Open Access Journals (Sweden)

    Ligita Balezentiene

    2012-01-01

    Full Text Available N2O, CH4, and CO2 are potential greenhouse gas (GHG contributing to climate change; therefore, solutions have to be sought to reduce their emission from agriculture. This work evaluates GHG emission from grasslands submitted to different mineral fertilizers during vegetation period (June–September in two experimental sites, namely, seminatural grassland (8 treatments of mineral fertilizers and cultural pasture (intensively managed in the Training Farm of the Lithuanian University of Agriculture. Chamber method was applied for evaluation of GHG emissions on the field scale. As a result, soil chemical composition, compactness, temperature, and gravimetric moisture as well as biomass yield of fresh and dry biomass and botanical composition, were assessed during the research. Furthermore, a simulation of multi-criteria assessment of sustainable fertilizers management was carried out on a basis of ARAS method. The multicriteria analysis of different fertilizing regimes was based on a system of environmental and productivity indices. Consequently, agroecosystems of cultural pasture (N180P120K150 and seminatural grassland fertilizing rates N180P120K150 and N60P40K50 were evaluated as the most sustainable alternatives leading to reduction of emissions between biosphere-atmosphere and human-induced biogenic pollution in grassland ecosystems, thus contributing to improvement of countryside environment.

  17. Tracheostomy Complications as a Trigger for an Airway Rapid Response: Analysis and Quality Improvement Considerations.

    Science.gov (United States)

    Rassekh, Christopher H; Zhao, Jing; Martin, Niels D; Chalian, Ara A; Atkins, Joshua H

    2015-12-01

    To analyze the subset of airway rapid response (ARR) calls related to tracheostomy identified over a 46-month period from August 2011 to May 2015 to determine proximate cause, intervention, and outcome and to develop process improvement initiatives. Single-institution multidisciplinary retrospective cohort study. Tertiary care academic medical center in a large urban setting. Hospital inpatients with an in situ tracheostomy or laryngectomy who experienced an ARR. Detailed review of operator, hospital, and patient records related to ARR system activations over a 46-month period. ARR was activated for 28 patients with existing tracheostomy. The cohort included open tracheostomy (n = 14), percutaneous tracheostomy (n = 8), laryngectomy stoma (n = 3), and indeterminate technique (n = 3). The most frequent triggers for emergency airway intervention were decannulation (n = 16), followed by mucus plugging (n = 4). The mean body mass index of ARR patients was higher than that of a comparator tracheostomy cohort (32.9 vs 26.3, P 40 in 9 ARR patients. There was 1 mortality in the series. Tracheostomy is a major trigger for ARR with potential fatal outcome. Factors that may contribute to tracheostomy emergencies include high body mass index, surgical technique for open tracheostomy or percutaneous tracheostomy, tracheostomy tube size, and bedside tracheostomy management. Results have triggered a hospital-wide practice improvement plan focused on tracheostomy awareness and documentation, discrete process changes, and implementation of guidelines for emergency management. © American Academy of Otolaryngology—Head and Neck Surgery Foundation 2015.

  18. Cerebrospinal Fluid Cytokine Expression Profile in Multiple Sclerosis and Chronic Inflammatory Demyelinating Polyneuropathy.

    Science.gov (United States)

    Bonin, Serena; Zanotta, Nunzia; Sartori, Arianna; Bratina, Alessio; Manganotti, Paolo; Trevisan, Giusto; Comar, Manola

    2018-02-01

    Cerebrospinal fluid (CSF) analysis in patients with particular neurologic disorders is a powerful tool to evaluate specific central nervous system inflammatory markers for diagnostic needs, because CSF represents the specific immune micro-environment to the central nervous system. CSF samples from 49 patients with multiple sclerosis (MS), chronic inflammatory demyelinating polyneuropathy (CIDP), and non-inflammatory neurologic disorders (NIND) as controls were submitted to protein expression profiles of 47 inflammatory biomarkers by multiplex Luminex bead assay to investigate possible differences in the inflammatory process for MS and CIDP. Our results showed differences in CSF cytokine levels in MS and CIDP; in particular, IL12 (p40) was significantly highly expressed in MS in comparison with CIDP and NIND, while SDF-1α and SCGF-β were significantly highly expressed in CIDP cohort when compared to MS and NIND. IL-9, IL-13, and IL-17 had higher expression levels in NIND if compared with the other groups. Our study showed that, despite some common pathogenic mechanisms, central and peripheral nervous system demyelinating diseases, such as MS and CIDP, differ in some specific inflammatory soluble proteins in CSF, underlining differences in the immune response involved in those autoimmune diseases.

  19. Acculturation is Not Related to Physical Activity Stage of Change for Children in Hawai'i.

    Science.gov (United States)

    Rotter, Markus; Nigg, Claudio R; Renda, Gloria A; Novotny, Rachel

    2016-02-01

    The relationship between acculturation and physical activity stages of change is unexplored. Stages of change conceptualize behavior change as a progression through a series of five stages indicating the readiness to change behavior. The level of acculturation can be assessed using the Ethnocultural Identity Behavioral Index (EIBI) which is based on three factors: Cultural Activities, Social Interaction and Language Opportunities. The purpose of this project was to explore the relationship between parental acculturation and physical activity stages of change in Hawai'i children. Participants (N = 85; 62% female; aged 5-8 years; 22% Native Hawaiian or Other Pacific Islanders, 42% Asian, 25% White, and 11% Other) completed the EIBI and a physical activity stages of change measure. Acculturation factor means were: Cultural Activities = 4 (SD = 1.26), Social Interaction = 3 (SD = 1.04), and Language Opportunities = 4 (SD = 1.29). The physical activity stages of change distribution was Precontemplation = 11 (13%), Contemplation/Preparation = 15 (18%), and Action/Maintenance = 59 (69%). Analysis of covariance (ANCOVA) for Cultural Activities F(3, 81) = 0.77, P = .47, Social Interaction F(3, 81) = 0.93, P = .40; and Language Opportunities F(3, 81) = 1.34, P = .27 showed no significant differences between physical activity stages of change. The results of our study do not show an association between acculturation and readiness to change for physical activity. The lack of differences may be due to participants being moderately acculturated, possibly lessening the differentiation of acculturation by physical activity stages of change.

  20. High accuracy line positions of the ν 1 fundamental band of 14 N 2 16 O

    KAUST Repository

    Alsaif, Bidoor

    2018-03-08

    The ν1 fundamental band of N2O is examined by a novel spectrometer that relies on the frequency locking of an external-cavity quantum cascade laser around 7.8 μm to a near-infrared Tm:based frequency comb at 1.9 μm. Due to the large tunability, nearly 70 lines in the 1240 – 1310 cm−1 range of the ν1 band of N2O, from P(40) to R(31), are for the first time measured with an absolute frequency calibration and an uncertainty from 62 to 180 kHz, depending on the line. Accurate values of the spectroscopic constants of the upper state are derived from a fit of the line centers (rms ≈ 4.8 × 10−6 cm−1 or 144 kHz). The ν1 transitions presently measured in a Doppler regime validate high accuracy predictions based on sub-Doppler measurements of the ν3 and ν3-ν1 transitions.

  1. Malignant Ewing-Like Neoplasm With an EWSR1-KLF15 Fusion: At the Crossroads of a Myoepithelial Carcinoma and a Ewing-Like Sarcoma. A Case Report With Treatment Options.

    Science.gov (United States)

    Stevens, Todd M; Qarmali, Morad; Morlote, Diana; Mikhail, Fady M; Swensen, Jeffrey; Gatalica, Zoran; Siegal, Gene P; Conry, Robert M

    2018-01-01

    We present a case of a malignant Ewing-like neoplasm of the parotid gland in a 20-year-old woman with an EWSR1-KLF15 gene fusion that presented with pulmonary metastasis. Despite the fact that the tumor was essentially immunohistochemically negative for keratins, p63, and p40, we interpret this neoplasm as an unusual form of a high-grade myoepithelial carcinoma based on its focal plasmacytoid cytology, chondromyxoid matrix, SOX10, S100 protein, and calponin expression, and the knowledge that the EWSR1-KLF15 gene fusion has, to date, only been identified in 2 tumors, both myoepithelial carcinomas of the kidney. We also present a cytogenetic analysis of this unusual tumor. This "Ewing-like myoepithelial carcinoma" initially did not respond to 2 cycles of ifosfamide and etoposide alternated with a cycle of cytoxan, adriamycin, and vincristine, a standard regimen for Ewing sarcoma. Subsequent oral pazopanib therapy did result in a reduction of the patient's pulmonary and nodal disease.

  2. Reduced Pro-Inflammatory Cytokines after Eight Weeks of Low-Dose Naltrexone for Fibromyalgia

    Directory of Open Access Journals (Sweden)

    Luke Parkitny

    2017-04-01

    Full Text Available Fibromyalgia (FM is a complex, multi-symptom condition that predominantly affects women. The majority of those affected are unlikely to gain significant symptomatic control from the few treatments that are approved for FM. In this 10-week, single-blind, crossover trial we tested the immune effects of eight weeks of oral administration of low-dose naltrexone (LDN. We enrolled eight women with an average age of 46 years, symptom severity of 62 out of 100, and symptom duration of 14 years. We found that LDN was associated with reduced plasma concentrations of interleukin (IL-1β, IL-1Ra, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p40, IL-12p70, IL-15, IL-17A, IL-27, interferon (IFN-α, transforming growth factor (TGF-α, TGF-β, tumor necrosis factor (TNF-α, and granulocyte-colony stimulating factor (G-CSF. We also found a 15% reduction of FM-associated pain and an 18% reduction in overall symptoms. The findings of this pilot trial suggest that LDN treatment in fibromyalgia is associated with a reduction of several key pro-inflammatory cytokines and symptoms. The potential role of LDN as an atypical anti-inflammatory medication should be explored further.

  3. An ethanol extract of Piper betle Linn. mediates its anti-inflammatory activity via down-regulation of nitric oxide.

    Science.gov (United States)

    Ganguly, Sudipto; Mula, Soumyaditya; Chattopadhyay, Subrata; Chatterjee, Mitali

    2007-05-01

    The leaves of Piper betle (locally known as Paan) have long been in use in the Indian indigenous system of medicine for the relief of pain; however, the underlying molecular mechanisms of this effect have not been elucidated. The anti-inflammatory and immunomodulatory effects of an ethanolic extract of the leaves of P. betle (100 mg kg(-1); PB) were demonstrated in a complete Freund's adjuvant-induced model of arthritis in rats with dexamethasone (0.1 mg kg(-1)) as the positive control. At non-toxic concentrations of PB (5-25 microg mL(-1)), a dose-dependent decrease in extracellular production of nitric oxide in murine peritoneal macrophages was measured by the Griess assay and corroborated by flow cytometry using the nitric oxide specific probe, 4,5-diaminofluorescein-2 diacetate. This decreased generation of reactive nitrogen species was mediated by PB progressively down-regulating transcription of inducible nitric oxide synthase in macrophages, and concomitantly causing a dose-dependent decrease in the expression of interleukin-12 p40, indicating the ability of PB to down-regulate T-helper 1 pro-inflammatory responses. Taken together, the anti-inflammatory and anti-arthrotic activity of PB is attributable to its ability to down-regulate the generation of reactive nitrogen species, thus meriting further pharmacological investigation.

  4. Clinicopathologic Correlations of E-cadherin and Prrx-1 Expression Loss in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Kijong Yi

    2016-09-01

    Full Text Available Background Developing predictive markers for hepatocellular carcinoma (HCC is important, because many patients experience recurrence and metastasis. Epithelial to mesenchymal transition (EMT is a developmental process that plays an important role during embryogenesis and also during cancer metastasis. Paired-related homeobox protein 1 (Prrx-1 is an EMT inducer that has recently been introduced, and its prognostic significance in HCC is largely unknown. Methods Tissue microarray was constructed using surgically resected primary HCCs from 244 cases. Immunohistochemical staining of E-cadherin and Prrx-1 was performed. The correlation between E-cadherin loss and Prrx-1 expression, as well as other clinicopathologic factors, was evaluated. Results E-cadherin expression was decreased in 96 cases (39.4%. Loss of E-cadherin correlated with a higher recurrence rate (p 40% were independent prognostic factors for shorter overall survival. Conclusions Prrx-1 was expressed in small portions of HCCs but not in normal livers. Additional studies with a large number of Prrx-1-positive cases are required to confirm the results of this study.

  5. Demographic profile and epidemiology of injury in Mthatha, South Africa.

    Science.gov (United States)

    Dhaffala, A; Longo-Mbenza, B; Kingu, J H; Peden, M; Kafuko-Bwoye, A; Clarke, M; Mazwai, E L

    2013-12-01

    To determine the magnitude, socio-demographic and epidemiological characteristics of injury at a Provincial referral hospital. This review was conducted on all trauma patients admitted at the Mthatha Hospital Complex and Nelson Mandela Academic Hospital from the 1(st) January 1997 to the 31(st) December 2000. The incident rate of injuries was 3.2% (n=2460/75,833 total admissions). Injured patients were mostly black (80%) and males (ratio: 5 men: 1 woman). Only 8.1% of injured patients were transported to hospital by ambulances. The leading causes of injuries were inter-personal violence accounting for 60% of cases, and motor vehicle accidents accounting for 19%; of them 38% were due to poor visibility, over speeding, and fatigue. The overall mortality was 33% (n=821) independently predicted by poverty (OR=8.2 95%CI 6-11.1; P40 years(OR=7.8 95%CI 7.7-12.1;P<0.0001). The burden of injury is a mass issue that warrants regional attention with quality of care and training.

  6. DEVELOPING VERIFICATION SYSTEMS FOR BUILDING INFORMATION MODELS OF HERITAGE BUILDINGS WITH HETEROGENEOUS DATASETS

    Directory of Open Access Journals (Sweden)

    L. Chow

    2017-08-01

    Full Text Available The digitization and abstraction of existing buildings into building information models requires the translation of heterogeneous datasets that may include CAD, technical reports, historic texts, archival drawings, terrestrial laser scanning, and photogrammetry into model elements. In this paper, we discuss a project undertaken by the Carleton Immersive Media Studio (CIMS that explored the synthesis of heterogeneous datasets for the development of a building information model (BIM for one of Canada’s most significant heritage assets – the Centre Block of the Parliament Hill National Historic Site. The scope of the project included the development of an as-found model of the century-old, six-story building in anticipation of specific model uses for an extensive rehabilitation program. The as-found Centre Block model was developed in Revit using primarily point cloud data from terrestrial laser scanning. The data was captured by CIMS in partnership with Heritage Conservation Services (HCS, Public Services and Procurement Canada (PSPC, using a Leica C10 and P40 (exterior and large interior spaces and a Faro Focus (small to mid-sized interior spaces. Secondary sources such as archival drawings, photographs, and technical reports were referenced in cases where point cloud data was not available. As a result of working with heterogeneous data sets, a verification system was introduced in order to communicate to model users/viewers the source of information for each building element within the model.

  7. Consultant input in acute medical admissions and patient outcomes in hospitals in England: a multivariate analysis.

    Science.gov (United States)

    Bell, Derek; Lambourne, Adrian; Percival, Frances; Laverty, Anthony A; Ward, David K

    2013-01-01

    Recent recommendations for physicians in the UK outline key aspects of care that should improve patient outcomes and experience in acute hospital care. Included in these recommendations are Consultant patterns of work to improve timeliness of clinical review and improve continuity of care. This study used a contemporaneous validated survey compared with clinical outcomes derived from Hospital Episode Statistics, between April 2009 and March 2010 from 91 acute hospital sites in England to evaluate systems of consultant cover for acute medical admissions. Clinical outcomes studied included adjusted case fatality rates (aCFR), including the ratio of weekend to weekday mortality, length of stay and readmission rates. Hospitals that had an admitting Consultant presence within the Acute Medicine Unit (AMU, or equivalent) for a minimum of 4 hours per day (65% of study group) had a lower aCFR compared with hospitals that had Consultant presence for less than 4 hours per day (p40 acute medical admissions per day had a lower aCFR compared to hospitals with fewer than 40 admissions per day (pstudy is the first large study to explore the potential relationships between systems of providing acute medical care and clinical outcomes. The results show an association between well-designed systems of Consultant working practices, which promote increased patient contact, and improved patient outcomes in the acute hospital setting.

  8. Metastatic Breast Carcinoma to the Prostate Gland

    Directory of Open Access Journals (Sweden)

    Meghan E. Kapp

    2016-01-01

    Full Text Available Cancer of the male breast is an uncommon event with metastases to the breast occurring even less frequently. Prostate carcinoma has been reported as the most frequent primary to metastasize to the breast; however, the reverse has not been previously reported. Herein, we present, for the first time, a case of breast carcinoma metastasizing to the prostate gland. Prostate needle core biopsy revealed infiltrative nests of neoplastic epithelioid cells, demonstrated by immunohistochemistry (IHC to be positive for GATA3 and ER and negative for PSA and P501S. A prostate cocktail by IHC study demonstrated lack of basal cells (p63 and CK903 and no expression of P501S. The patient’s previous breast needle core biopsy showed strong ER positivity and negative staining for PR and HER2. Similar to the prostate, the breast was negative for CK5/6, p63, and p40. This case demonstrates the importance of considering a broad differential diagnosis and comparing histology and IHC to prior known malignancies in the setting of atypical presentation or rare tumors.

  9. Detection of Mogibacterium timidum in subgingival biofilm of aggressive and non-diabetic and diabetic chronic periodontitis patients

    Directory of Open Access Journals (Sweden)

    Renato Corrêa Viana Casarin

    2012-09-01

    Full Text Available The aim of the present study was to evaluate the frequency of detection of Mogibacterium timidum in subgingival samples of subjects with generalized aggressive periodontitis (GAgP and uncontrolled diabetic and non-diabetic subjects with generalized chronic periodontitis (GChP. 48 patients with GAgP, 50 non-diabetic and 39 uncontrolled (glycated hemoglobin >7% type 2 diabetic subjects with GChP were enrolled in this study. Subgingival biofilm were collected from deep pockets (probing depth > 7 mm. After DNA extraction, M. timidum was detected by Nested Polymerase Chain Reaction and chi-square test was used to data analysis (p>0.05. There were no differences in the frequency of detection of M. timidum between subjects with GAgP (35% and non-diabetic subjects with GChP (40% (p>0.05. The frequency of detection of M. timidum was significantly higher in deep pockets of diabetic subjects with GChP (56% when compared to GAgP (p0.05. The frequency of detection of M. timidum was higher in subjects GChP presenting uncontrolled type 2 diabetes mellitus, when compared to GAgP subjects.

  10. Detection of Mogibacterium timidum in subgingival biofilm of aggressive and non-diabetic and diabetic chronic periodontitis patients.

    Science.gov (United States)

    Casarin, Renato Corrêa Viana; Saito, Daniel; Santos, Vanessa Renata; Pimentel, Suzana Peres; Duarte, Poliana Mendes; Casati, Márcio Zaffalon; Gonçalves, Reginaldo Bruno

    2012-07-01

    The aim of the present study was to evaluate the frequency of detection of Mogibacterium timidum in subgingival samples of subjects with generalized aggressive periodontitis (GAgP) and uncontrolled diabetic and non-diabetic subjects with generalized chronic periodontitis (GChP). 48 patients with GAgP, 50 non-diabetic and 39 uncontrolled (glycated hemoglobin >7%) type 2 diabetic subjects with GChP were enrolled in this study. Subgingival biofilm were collected from deep pockets (probing depth > 7 mm). After DNA extraction, M. timidum was detected by Nested Polymerase Chain Reaction and chi-square test was used to data analysis (p>0.05). There were no differences in the frequency of detection of M. timidum between subjects with GAgP (35%) and non-diabetic subjects with GChP (40%) (p>0.05). The frequency of detection of M. timidum was significantly higher in deep pockets of diabetic subjects with GChP (56%) when compared to GAgP (pGChP (p>0.05). The frequency of detection of M. timidum was higher in subjects GChP presenting uncontrolled type 2 diabetes mellitus, when compared to GAgP subjects.

  11. Blood lactate clearance after maximal exercise depends on active recovery intensity.

    Science.gov (United States)

    Devlin, J; Paton, B; Poole, L; Sun, W; Ferguson, C; Wilson, J; Kemi, O J

    2014-06-01

    High-intensity exercise is time-limited by onset of fatigue, marked by accumulation of blood lactate. This is accentuated at maximal, all-out exercise that rapidly accumulates high blood lactate. The optimal active recovery intensity for clearing lactate after such maximal, all-out exercise remains unknown. Thus, we studied the intensity-dependence of lactate clearance during active recovery after maximal exercise. We constructed a standardized maximal, all-out treadmill exercise protocol that predictably lead to voluntary exhaustion and blood lactate concentration>10 mM. Next, subjects ran series of all-out bouts that increased blood lactate concentration to 11.5±0.2 mM, followed by recovery exercises ranging 0% (passive)-100% of the lactate threshold. Repeated measurements showed faster lactate clearance during active versus passive recovery (P40%>passive recovery, Pexercise clears accumulated blood lactate faster than passive recovery in an intensity-dependent manner, with maximum clearance occurring at active recovery of 80% of lactate threshold.

  12. Differences in Acinetobacter baumannii strains and host innate immune response determine morbidity and mortality in experimental pneumonia.

    Directory of Open Access Journals (Sweden)

    Anna de Breij

    Full Text Available Despite many reports documenting its epidemicity, little is known on the interaction of Acinetobacter baumannii with its host. To deepen our insight into this relationship, we studied persistence of and host response to different A. baumannii strains including representatives of the European (EU clones I-III in a mouse pneumonia model. Neutropenic mice were inoculated intratracheally with five A. baumannii strains and an A. junii strain and at several days morbidity, mortality, bacterial counts, airway inflammation, and chemo- and cytokine production in lungs and blood were determined. A. baumannii RUH875 and RUH134 (EU clone I and II, respectively and sporadic strain LUH8326 resulted in high morbidity/mortality, whereas A. baumannii LUH5875 (EU clone III, which is less widespread than clone I and II caused less symptoms. A. baumannii type strain RUH3023(T and A. junii LUH5851 did not cause disease. All strains, except A. baumannii RUH3023(T and A. junii LUH5851, survived and multiplied in the lungs for several days. Morbidity and mortality were associated with the severity of lung pathology and a specific immune response characterized by low levels of anti-inflammatory (IL-10 and specific pro-inflammatory (IL-12p40 and IL-23 cytokines at the first day of infection. Altogether, a striking difference in behaviour among the A. baumannii strains was observed with the clone I and II strains being most virulent, whereas the A. baumannii type strain, which is frequently used in virulence studies appeared harmless.

  13. Can We Measure the Heel Bump? Radiographic Evaluation of Haglund's Deformity.

    Science.gov (United States)

    Bulstra, Gythe H; van Rheenen, Thijs A; Scholtes, Vanessa A B

    2015-01-01

    Haglund's deformity is a symptomatic posterosuperior deformity of the heel. The lateral radiograph of the ankle will show a prominent, large, posterosuperior part of the calcaneus, which can be measured using the Fowler and Philips angle (FPA, the angle between the posterior and plantar surface of the calcaneus) and the calcaneal pitch angle (CPA, the angle between the sole of the foot and the plantar part of the calcaneus). Although these angles are commonly used, these radiographic angle measurements have never shown a relationship with Haglund's deformity. In 78 patients (51% male) with symptomatic Haglund's deformity and a control group of 100 patients (41% male) with no heel complaints, we measured the FPA and CPA on weightbearing lateral radiographs of the foot. Using an unpaired t tests, no significant difference was found between the 2 groups in the FPA (p = .40). We measured a significant difference in the CPA between the Haglund group and the control group (p = .014). Subgroup analysis showed that this difference was mainly found in females (p verticalization of the calcaneus. This change in position results in extra traction on the Achilles tendon and can eventually cause tendinitis and bursitis. Radiographic measurement should be used as an auxiliary tool. If the calcaneus tends to change position, it would be interesting to understand this process, which could eventually lead to improvement in the treatment of Haglund's deformity. Copyright © 2015 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  14. [The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation].

    Science.gov (United States)

    Stasia, Marie-José

    2007-05-01

    Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

  15. Cumulative effect of gibberellic acid and phosphorus on crop productivity, biochemical activities and trigonelline production in Trigonella foenum-graecum L.

    Directory of Open Access Journals (Sweden)

    Tariq Ahmad Dar

    2015-12-01

    Full Text Available Fenugreek (Trigonella foenum-graecum L. is an antidiabetic plant. Its bioactive compound, trigonelline, is known to counter diabetes through insulin secretion, modulation of β cell regeneration and quick activity of glucose metabolism related enzymes. A pot experiment was conducted in the natural conditions of net house of the Department of Botany, Aligarh Muslim University, Aligarh (UP, India, to evaluate the effect of four concentrations of GA3 (0, 10−7 M, 10−6 M and 10−5 M, alone and in combination with phosphorus (40 kg P ha−1, on growth, biochemical and yield attributes of fenugreek. Compared to control, the combination of GA3 and phosphorus (P40 + 10−6 M GA3 significantly increased the activities of nitrate reductase (30.8% and carbonic anhydrase (30.7% enzymes; it also enhanced the seed yield (140.6% and the content of total chlorophyll (28.5% and carotenoids (26%. There was also significant increase (19.51% in the content of seed trigonelline.

  16. The ontogenetic development of neurons containing calcium-binding proteins in the septum of the guinea pig: Late onset of parvalbumin immunoreactivity versus calbindin and calretinin.

    Science.gov (United States)

    Hermanowicz-Sobieraj, Beata; Robak, Anna

    2017-01-01

    The study describes the immunoreactivity of calbindin (CB), calretinin (CR) and parvalbumin (PV), their distribution pattern and the co-distribution of CB and CR as well as CB and PV in the septum of the guinea pig during development. Immunohistochemistry was conducted on embryonic (E40, E50, E60), newborn (P0) and postnatal (P5, P10, P20, P40, P100) guinea pig brains. The presence of both CB and CR was detected at E40, while PV began to be observed at E60. Immunoreactivity for CB was constant throughout ontogeny. In contrast to CR immunoreactivity, PV immunoreactivity was higher in the postnatal stages than in the prenatal and newborn stages. Double immunostaining showed that CB co-localized with CR from E40 onwards, while with PV from P5 onwards, suggesting that CB co-operates with these proteins in the guinea pig septum during different periods of ontogeny. Our results also indicate that among the studied CaBPs, CB exhibited the highest immunoreactivity during both embryonic and postnatal development. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Lactobacillus casei BL23 Produces Microvesicles Carrying Proteins That Have Been Associated with Its Probiotic Effect

    Directory of Open Access Journals (Sweden)

    A. Paula Domínguez Rubio

    2017-09-01

    Full Text Available Archaea, bacteria, and eukarya secrete membrane microvesicles (MVs as a mechanism for intercellular communication. We report the isolation and characterization of MVs from the probiotic strain Lactobacillus casei BL23. MVs were characterized using analytical high performance techniques, DLS, AFM and TEM. Similar to what has been described for other Gram-positive bacteria, MVs were on the nanometric size range (30–50 nm. MVs carried cytoplasmic components such as DNA, RNA and proteins. Using a proteomic approach (LC-MS, we identified a total of 103 proteins; 13 exclusively present in the MVs. The MVs content included cell envelope associated and secretory proteins, heat and cold shock proteins, several metabolic enzymes, proteases, structural components of the ribosome, membrane transporters, cell wall-associated hydrolases and phage related proteins. In particular, we identified proteins described as mediators of Lactobacillus’ probiotic effects such as p40, p75 and the product of LCABL_31160, annotated as an adhesion protein. The presence of these proteins suggests a role for the MVs in the bacteria-gastrointestinal cells interface. The expression and further encapsulation of proteins into MVs of GRAS (Generally Recognized as Safe bacteria could represent a scientific novelty, with applications in food, nutraceuticals and clinical therapies.

  18. Isolation and characterization of biosurfactant-producing Alcanivorax strains: hydrocarbon accession strategies and alkane hydroxylase gene analysis.

    Science.gov (United States)

    Olivera, Nelda L; Nievas, Marina L; Lozada, Mariana; Del Prado, Guillermo; Dionisi, Hebe M; Siñeriz, Faustino

    2009-01-01

    Biosurfactant-producing bacteria belonging to the genera Alcanivorax, Cobetia and Halomonas were isolated from marine sediments with a history of hydrocarbon exposure (Aristizábal and Gravina Peninsulas, Argentina). Two Alcanivorax isolates were found to form naturally occurring consortia with strains closely related to Pseudomonas putida and Microbacterium esteraromaticum. Alkane hydroxylase gene analysis in these two Alcanivorax strains resulted in the identification of two novel alkB genes, showing 86% and 60% deduced amino acid sequence identity with those of Alcanivorax sp. A-11-3 and Alcanivorax dieselolei P40, respectively. In addition, a gene homologous to alkB2 from Alcanivorax borkumensis was present in one of the strains. The consortium formed by this strain, Alcanivorax sp. PA2 (98.9% 16S rRNA gene sequence identity with A. borkumensis SK2(T)) and P. putida PA1 was characterized in detail. These strains form cell aggregates when growing as mixed culture, though only PA2 was responsible for biosurfactant activity. During exponential growth phase of PA2, cells showed high hydrophobicity and adherence to hydrocarbon droplets. Biosurfactant production was only detectable at late growth and stationary phases, suggesting that it is not involved in initiating oil degradation and that direct interfacial adhesion is the main hydrocarbon accession mode of PA2. This strain could be useful for biotechnological applications due to its biosurfactant production, catabolic and aggregation properties.

  19. A medium-chain fatty acid receptor Gpr84 in zebrafish: expression pattern and roles in immune regulation.

    Science.gov (United States)

    Huang, Qiaoyan; Feng, Dong; Liu, Kai; Wang, Peng; Xiao, Hongyan; Wang, Ying; Zhang, Shicui; Liu, Zhenhui

    2014-08-01

    Gpr84 was recently identified as a receptor for medium-chain fatty acids, but its functions remain to be clarified. We reported the identification of a zebrafish Gpr84 homologue (zGpr84), which has a higher gene expression in the tissues of intestine, heart and liver. During embryogenesis, zGpr84 is maternally expressed and a significant increase is observed at segmentation period, and it is mainly restricted to the head region, pectoral fins, branchial arches, intestine and lateral line neuromast. Fasting or treatment with lipopolysaccharide (LPS) can induce significant up-regulation of zGpr84. We further demonstrated that zGpr84 is involved in the accumulation of lipid droplets in cells. Moreover, undecanoic acid (UA) can amplify LPS induced production of the proinflammatory cytokine IL-12 p40 through zGpr84, supporting the proposal that Gpr84 may play a role in directly linking fatty acid metabolism to immunological regulation. The resulting data in fish lay a foundation for a comprehensive exploration of the functions and evolution of Gpr84. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Medium-chain fatty acids as ligands for orphan G protein-coupled receptor GPR84.

    Science.gov (United States)

    Wang, Jinghong; Wu, Xiaosu; Simonavicius, Nicole; Tian, Hui; Ling, Lei

    2006-11-10

    Free fatty acids (FFAs) play important physiological roles in many tissues as an energy source and as signaling molecules in various cellular processes. Elevated levels of circulating FFAs are associated with obesity, dyslipidemia, and diabetes. Here we show that GPR84, a previously orphan G protein-coupled receptor, functions as a receptor for medium-chain FFAs with carbon chain lengths of 9-14. Medium-chain FFAs elicit calcium mobilization, inhibit 3',5'-cyclic AMP production, and stimulate [35S]guanosine 5'-O-(3-thiotriphosphate) binding in a GPR84-dependent manner. The activation of GPR84 by medium-chain FFAs couples primarily to a pertussis toxin-sensitive G(i/o) pathway. In addition, we show that GPR84 is selectively expressed in leukocytes and markedly induced in monocytes/macrophages upon activation by lipopolysaccharide. Furthermore, we demonstrate that medium-chain FFAs amplify lipopolysaccharide-stimulated production of the proinflammatory cytokine interleukin-12 p40 through GPR84. Our results indicate a role for GPR84 in directly linking fatty acid metabolism to immunological regulation.

  1. Utilizing thin-film solid-phase extraction to assess the effect of organic carbon amendments on the bioavailability of DDT and dieldrin to earthworms

    International Nuclear Information System (INIS)

    Andrade, Natasha A.; Centofanti, Tiziana; McConnell, Laura L.; Hapeman, Cathleen J.; Torrents, Alba; Nguyen, Anh; Beyer, W. Nelson; Chaney, Rufus L.; Novak, Jeffrey M.; Anderson, Marya O.; Cantrell, Keri B.

    2014-01-01

    Improved approaches are needed to assess bioavailability of hydrophobic organic compounds in contaminated soils. Performance of thin-film solid-phase extraction (TF-SPE) using vials coated with ethylene vinyl acetate was compared to earthworm bioassay (Lumbricus terrestris). A DDT and dieldrin contaminated soil was amended with four organic carbon materials to assess the change in bioavailability. Addition of organic carbon significantly lowered bioavailability for all compounds except for 4,4′-DDT. Equilibrium concentrations of compounds in the polymer were correlated with uptake by earthworms after 48d exposure (R 2 = 0.97; p 40yr of aging. Results show that TF-SPE can be useful in examining potential risks associated with contaminated soils and to test effectiveness of remediation efforts. -- Highlights: • Bioavailability of pesticides in soil were assessed using TF-SPE and earthworms. • Soil from a historical orchard was used to examine aged residues of dieldrin and DDT. • TF-SPE results were strongly correlated with earthworm bioaccumulation factors. • Ethylene vinyl acetate polymer has sorptive capacity similar to earthworm lipid. • TF-SPE useful to estimate bioavailability of hydrophobic organic pesticides in soil. -- Capsule A thin-film polymer sampler proved to be efficient in estimating the differences in bioavailability to earthworms in a soil treated with organic amendments

  2. Neuromuscular adjustments of the quadriceps muscle after repeated cycling sprints.

    Directory of Open Access Journals (Sweden)

    Olivier Girard

    Full Text Available PURPOSE: This study investigated the supraspinal processes of fatigue of the quadriceps muscle in response to repeated cycling sprints. METHODS: Twelve active individuals performed 10 × 6-s "all-out" sprints on a cycle ergometer (recovery = 30 s, followed 6 min later by 5 × 6-s sprints (recovery = 30 s. Transcranial magnetic and electrical femoral nerve stimulations during brief (5-s and sustained (30-s isometric contractions of the knee extensors were performed before and 3 min post-exercise. RESULTS: Maximal strength of the knee extensors decreased during brief and sustained contractions (~11% and 9%, respectively; P0.05. While cortical voluntary activation declined (P 40% reduced (P<0.001 following exercise. CONCLUSION: The capacity of the motor cortex to optimally drive the knee extensors following a repeated-sprint test was shown in sustained, but not brief, maximal isometric contractions. Additionally, peripheral factors were largely involved in the exercise-induced impairment in neuromuscular function, while corticospinal excitability was well-preserved.

  3. Colitis susceptibility in p47(phox-/-) mice is mediated by the microbiome.

    Science.gov (United States)

    Falcone, E Liana; Abusleme, Loreto; Swamydas, Muthulekha; Lionakis, Michail S; Ding, Li; Hsu, Amy P; Zelazny, Adrian M; Moutsopoulos, Niki M; Kuhns, Douglas B; Deming, Clay; Quiñones, Mariam; Segre, Julia A; Bryant, Clare E; Holland, Steven M

    2016-04-05

    Chronic granulomatous disease (CGD) is caused by defects in nicotinamide adenine dinucleotide phosphate oxidase 2 (NOX2) complex subunits (gp91(phox) (a.k.a. Nox2), p47(phox), p67(phox), p22(phox), p40(phox)) leading to reduced phagocyte-derived reactive oxygen species production. Almost half of patients with CGD develop inflammatory bowel disease, and the involvement of the intestinal microbiome in relation to this predisposing immunodeficiency has not been explored. Although CGD mice do not spontaneously develop colitis, we demonstrate that p47(phox-/-) mice have increased susceptibility to dextran sodium sulfate colitis in association with a distinct colonic transcript and microbiome signature. Neither restoring NOX2 reactive oxygen species production nor normalizing the microbiome using cohoused adult p47(phox-/-) with B6Tac (wild type) mice reversed this phenotype. However, breeding p47(phox+/-) mice and standardizing the microflora between littermate p47(phox-/-) and B6Tac mice from birth significantly reduced dextran sodium sulfate colitis susceptibility in p47(phox-/-) mice. We found similarly decreased colitis susceptibility in littermate p47(phox-/-) and B6Tac mice treated with Citrobacter rodentium. Our findings suggest that the microbiome signature established at birth may play a bigger role than phagocyte-derived reactive oxygen species in mediating colitis susceptibility in CGD mice. These data further support bacteria-related disease in CGD colitis.

  4. DNA-repair after irradiation of cells with gamma-rays and neutrons

    International Nuclear Information System (INIS)

    Altmann, H.

    1975-11-01

    The structural alterations of calf thymus DNA produced by neutron or gamma irradiation were observed by absorption spectra, sedimentation rate and viscosity measurements. Mixed neutron-gamma irradiation produced fewer single and double strand breaks compared with pure gamma irradiation. RBE-values for mixed neutron-gamma radiation were less than 1, and DNA damage decreased with increasing neutron dose rate. Repair processes of DNA occuring after irradiation were measured in mouse spleen suspensions and human lymphocytes using autoradiographic methods and gradient centrifugations. The number of labelled cells was smaller after mixed neutron-gamma irradiation than after gamma irradiation. The rejoining of strand breaks in alkaline and neutral sucrose was more efficient after gamma irradiation than after mixed neutron-gamma irradiation. Finally, the effect of detergents Tween 80 and Nonident P40 on unscheduled DNA synthesis was studied by autoradiography after mixed neutron-gamma irradiation (Dn=5 krad). The results showed that the DNA synthesis was inhibited by detergent solutions of 0.002%

  5. Dendritic cell activation and maturation induced by recombinant calreticulin fragment 39-272.

    Science.gov (United States)

    Li, Yue; Zeng, Xiaoli; He, Lijuan; Yuan, Hui

    2015-01-01

    Dendritic cells (DC) are the most potent antigen-presenting cells for initiating immune responses. DC maturation can be induced by exposing of immature DC to pathogen products or pro-inflammatory factor, which dramatically enhances the ability of DC to activate Ag-specific T cells. In this study, a recombinant calreticulin fragment 39-272 (rCRT/39-272) covering the lectin-like N domain and partial P domain of murine CRT has been expressed and purified in Escherichia coli. Functional analysis studies revealed that rCRT/39-272 has potent immunostimulatory activities in both activating human monocytes and B cells to secrete cytokines. rCRT/39-272 can drive the activation of bone marrow derived DC in TLR4/CD14 dependent way, as indicated by secretion of cytokines IL-12/IL-23 (p40) and IL-1β. Exposure of DC to rCRT/39-272 induces P-Akt, suggesting that rCRT/39-272 induces maturation of DC through PI3K/Akt signaling pathway. The results suggest that soluble rCRT/39-272 is a potent stimulatory agent to DC maturation in TLR4/CD14 and PI3K/Akt dependent pathway. It may play important roles in initiating cellular immunity in vivo and the T cell response in vitro. Thus it could be used for study of DC-based tumor vaccines.

  6. Selective inhibition of extracellular oxidants liberated from human neutrophils--A new mechanism potentially involved in the anti-inflammatory activity of hydroxychloroquine.

    Science.gov (United States)

    Jančinová, Viera; Pažoureková, Silvia; Lucová, Marianna; Perečko, Tomáš; Mihalová, Danica; Bauerová, Katarína; Nosáľ, Radomír; Drábiková, Katarína

    2015-09-01

    Hydroxychloroquine is used in the therapy of rheumatoid arthritis or lupus erythematosus. Although these diseases are often accompanied by activation of neutrophils, there are still few data relating to the impact of hydroxychloroquine on these cells. We investigated the effect of orally administered hydroxychloroquine on neutrophil oxidative burst in rats with adjuvant arthritis. In human neutrophils, extra- and intracellular formation of oxidants, mobilisation of intracellular calcium and the phosphorylation of proteins regulating NADPH oxidase assembly were analysed. Administration of hydroxychloroquine decreased the concentration of oxidants in blood of arthritic rats. The inhibition was comparable with the reference drug methotrexate, yet it was not accompanied by a reduction in neutrophil count. When both drugs were co-applied, the effect became more pronounced. In isolated human neutrophils, treatment with hydroxychloroquine resulted in reduced mobilisation of intracellular calcium, diminished concentration of external oxidants and in decreased phosphorylation of Ca(2+)-dependent protein kinase C isoforms PKCα and PKCβII, which regulate activation of NADPH oxidase on plasma membrane. On the other hand, no reduction was observed in intracellular oxidants or in the phosphorylation of p40(phox) and PKCδ, two proteins directing the oxidase assembly to intracellular membranes. Hydroxychloroquine reduced neutrophil-derived oxidants potentially involved in tissue damage and protected those capable to suppress inflammation. The observed effects may represent a new mechanism involved in the anti-inflammatory activity of this drug. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Resistin enhances the expansion of regulatory T cells through modulation of dendritic cells

    Directory of Open Access Journals (Sweden)

    Han Seung

    2010-06-01

    Full Text Available Abstract Background Resistin, a member of adipokine family, is known to be involved in the modulation of immune responses including inflammatory activity. Interestingly, resistin is secreted by adipocytes in mice and rats whereas it is secreted by leukocytes in humans. However, the mechanism behind the effect of resistin on the expansion of regulatory T cells (Tregs remains poorly understood. Therefore, we examined regulatory effect of resistin on the induction and cellular modification of Tregs. Results Both protein and mRNA expression of FoxP3, a representative marker of Tregs, increased in a dose-dependent manner when peripheral blood mononuclear cells were treated with resistin. At the same time, resistin had no direct effect on the induction of FoxP3 in CD4+ T cells, suggesting an indirect role through other cells type(s. Since DCs are an important player in the differentiation of T cells, we focused on the role of DCs in the modulation of Tregs by resistin. Resistin suppressed the expression of interferon regulatory factor (IRF-1 and its target cytokines, IL-6, IL-23p19 and IL-12p40, in DCs. Furthermore, FoxP3 expression is increased in CD4+ T cells when co-cultured with DCs and concomitantly treated with resistin. Conclusion Our results suggest that resistin induces expansion of functional Tregs only when co-cultured with DCs.

  8. Risk Factors and Types of Urinary Incontinence among Middle-Aged and Older Male and Female Primary Care Patients in Kaunas Region of Lithuania: Cross Sectional Study.

    Science.gov (United States)

    Aniuliene, Rosita; Aniulis, Povilas; Steibliene, Vesta

    2016-03-05

    The aims of the study were to evaluate the incidences, types of urinary incontinence (UI) and its risk factors among middle-aged and older (> 40 years) men and women visiting a general practitioner (GP). This is a descriptive and cross-sectional comparative study using a questionnaire-based survey included 172 male and female patients who consecutively visited a primary care center in Kaunas region of Lithuania. All 86 women (100%) and 65 men (75.58%) had symptoms of UI (P urinary incontinence (SUI) and 60% of men urge urinary incontinence (UUI) (P risk factors for women with SUI were: age below 60 years (odds ratio [OR] = 2.89, 95% confidence interval [CI]: 1.89-4.43; P pregnancies. The UUI was associated with age over 60 years (OR in men = 2.93, 95% CI: 1.15-7.51; P = .022, in women OR = 8.76, 95% CI: 2.37-32.33; P 40 years visiting GP and affected more women of the same age range. SUI was more prevalent among women, while more men had UUI. Age below 60, being married, pregnancy and delivery history, concomitant illnesses were significant risk factors for women' SUI and older age and menopause for UUI. The only risk factor for men' UUI was age over 60 years.

  9. Ustekinumab in treatment of Crohn’s disease: design, development, and potential place in therapy

    Directory of Open Access Journals (Sweden)

    Deepak P

    2016-11-01

    Full Text Available Parakkal Deepak, Edward V Loftus Jr Division of Gastroenterology and Hepatology, Mayo Clinic College of Medicine, Rochester, MN, USA Abstract: Crohn’s disease is characterized by a dysregulation of both innate and adaptive immunity responses. Interleukin-12/23 (IL-12/23 pathway has been found to be a major driver of inflammation in adaptive immune responses. Ustekinumab is a fully human immunoglobulin G1 kappa monoclonal antibody that blocks the p40 subunit of IL-12 and IL-23 and prevents their interaction with their cell surface receptor and further cytokine activation. It is currently approved in the management of plaque psoriasis and psoriatic arthritis. Very promising data have emerged through phase II and phase III trials (UNITI-1, UNITI-2, and IM-UNITI for both induction and maintenance of clinical response and remission in moderate-to-severe Crohn’s disease, resulting in approval by the Food and Drug Administration for this condition. This article reviews the immunology of the IL-12/23 pathway, available data regarding the initial designing of ustekinumab, drug development through clinical trials including pharmacokinetics, efficacy, and safety, and its potential place in the treatment of Crohn’s disease.Keywords: ustekinumab, Crohn’s disease, inflammatory bowel disease, interleukin-12/23 monoclonal antibody, interleukin-12, interleukin-23

  10. Batf3 and Id2 have a synergistic effect on Irf8-directed classical CD8α+ dendritic cell development

    KAUST Repository

    Jaiswal, Hemant

    2013-11-13

    Dendritic cells (DCs) are heterogeneous cell populations represented by different subtypes, each varying in terms of gene expression patterns and specific functions. Recent studies identified transcription factors essential for the development of different DC subtypes, yet molecular mechanisms for the developmental program and functions remain poorly understood. In this study, we developed and characterized a mouse DC progenitor-like cell line, designated DC9, from Irf8-/- bone marrow cells as a model for DC development and function. Expression of Irf8 in DC9 cells led to plasmacytoid DCs and CD8α+ DC-like cells, with a concomitant increase in plasmacytoid DC- and CD8α+ DC-specific gene transcripts and induction of type I IFNs and IL12p40 following TLR ligand stimulation. Irf8 expression in DC9 cells led to an increase in Id2 and Batf3 transcript levels, transcription factors shown to be important for the development of CD8α+ DCs. We show that, without Irf8 , expression of Id2 and Batf3 was not sufficient for directing classical CD8α+ DC development. When coexpressed with Irf8, Batf3 and Id2 had a synergistic effect on classical CD8α+ DC development. We demonstrate that Irf8 is upstream of Batf3 and Id2 in the classical CD8α+ DC developmental program and define the hierarchical relationship of transcription factors important for classical CD8α+ DC development.

  11. Chemical Composition and Anti-Inflammatory Effect of Ethanolic Extract of Brazilian Green Propolis on Activated J774A.1 Macrophages

    Directory of Open Access Journals (Sweden)

    Ewelina Szliszka

    2013-01-01

    Full Text Available The aim of this study was to investigate the chemical composition and anti-inflammatory effect of ethanolic extract of Brazilian green propolis (EEP-B on LPS + IFN-γ or PMA stimulated J774A.1 macrophages. The identification and quantification of phenolic compounds in green propolis extract were performed using HPLC-DAD and UPLC-Q-TOF-MS methods. The cell viability was evaluated by MTT and LDH assays. The radical scavenging ability was determined using DPPH• and ABTS•+. ROS and RNS generation was analyzed by chemiluminescence. NO concentration was detected by the Griess reaction. The release of various cytokines by activated J774A.1 cells was measured in the culture supernatants using a multiplex bead array system based on xMAP technology. Artepillin C, kaempferide, and their derivatives were the main phenolics found in green propolis. At the tested concentrations, the EEP-B did not decrease the cell viability and did not cause the cytotoxicity. EEP-B exerted strong antioxidant activity and significantly inhibited the production of ROS, RNS, NO, cytokine IL-1α, IL-1β, IL-4, IL-6, IL-12p40, IL-13, TNF-α, G-CSF, GM-CSF, MCP-1, MIP-1α, MIP-1β, and RANTES in stimulated J774A.1 macrophages. Our findings provide new insights for understanding the anti-inflammatory mechanism of action of Brazilian green propolis extract and support its application in complementary and alternative medicine.

  12. High accuracy line positions of the ν1 fundamental band of 14N216O

    Science.gov (United States)

    AlSaif, Bidoor; Lamperti, Marco; Gatti, Davide; Laporta, Paolo; Fermann, Martin; Farooq, Aamir; Lyulin, Oleg; Campargue, Alain; Marangoni, Marco

    2018-05-01

    The ν1 fundamental band of N2O is examined by a novel spectrometer that relies on the frequency locking of an external-cavity quantum cascade laser around 7.8 μm to a near-infrared Tm:based frequency comb at 1.9 μm. Due to the large tunability, nearly 70 lines in the 1240-1310 cm-1 range of the ν1 band of N2O, from P(40) to R(31), are for the first time measured with an absolute frequency calibration and an uncertainty from 62 to 180 kHz, depending on the line. Accurate values of the spectroscopic constants of the upper state are derived from a fit of the line centers (rms ≈ 4.8 × 10-6 cm-1 or 144 kHz). The ν1 transitions presently measured in a Doppler regime validate high accuracy predictions based on sub-Doppler measurements of the ν3 and ν3-ν1 transitions.

  13. Ultrafast detection in particle physics and positron emission tomography using SiPMs

    Science.gov (United States)

    Dolenec, R.; Korpar, S.; Križan, P.; Pestotnik, R.

    2017-12-01

    Silicon photomultiplier (SiPM) photodetectors perform well in many particle and medical physics applications, especially where good efficiency, insensitivity to magnetic field and precise timing are required. In Cherenkov time-of-flight positron emission tomography the requirements for photodetector performance are especially high. On average only a couple of photons are available for detection and the best possible timing resolution is needed. Using SiPMs as photodetectors enables good detection efficiency, but the large sensitive area devices needed have somewhat limited time resolution for single photons. We have observed an additional degradation of the timing at very low light intensities due to delayed events in distribution of signals resulting from multiple fired micro cells. In this work we present the timing properties of AdvanSiD ASD-NUV3S-P-40 SiPM at single photon level picosecond laser illumination and a simple modification of the time-walk correction algorithm, that resulted in reduced degradation of timing resolution due to the delayed events.

  14. Anti-Inflammatory Activities of a Chinese Herbal Formula IBS-20 In Vitro and In Vivo

    Directory of Open Access Journals (Sweden)

    Zhonghan Yang

    2012-01-01

    Full Text Available Irritable bowel syndrome (IBS is a functional bowel disorder and the etiology is not well understood. Currently there is no cure for IBS and no existing medication induces symptom relief in all patients. IBS-20 is a 20-herb Chinese medicinal formula that offers beneficial effects in patients with IBS; however, the underlying mechanisms are largely unknown. This study showed that IBS-20 potently inhibited LPS- or IFNΓ-stimulated expression of pro-inflammatory cytokines, as well as classically activated macrophage marker nitric oxide synthase 2. Similarly, IBS-20 or the component herb Coptis chinensis decreased LPS-stimulated pro-inflammatory cytokine secretion from JAWS II dendritic cells. IBS-20 or the component herbs also blocked or attenuated the IFNΓ-induced drop in transepithelial electric resistance, an index of permeability, in fully differentiated Caco-2 monolayer. Finally, the up-regulation of key inflammatory cytokines in inflamed colon from TNBS-treated mice was suppressed significantly by orally administrated IBS-20, including IFNΓ and IL-12p40. These data indicate that the anti-inflammatory activities of IBS-20 may contribute to the beneficial effects of the herbal extract in patients with IBS, providing a potential mechanism of action for IBS-20. In addition, IBS-20 may be a potential therapeutic agent against other Th1-dominant gut pathologies such as inflammatory bowel disease.

  15. Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type I receptor family.

    Science.gov (United States)

    Elson, G C; Graber, P; Losberger, C; Herren, S; Gretener, D; Menoud, L N; Wells, T N; Kosco-Vilbois, M H; Gauchat, J F

    1998-08-01

    In this report we describe the identification, cloning, and expression pattern of human cytokine-like factor 1 (hCLF-1) and the identification and cloning of its murine homologue. They were identified from expressed sequence tags using amino acid sequences from conserved regions of the cytokine type I receptor family. Human CLF-1 and murine CLF-1 shared 96% amino acid identity and significant homology with many cytokine type I receptors. CLF-1 is a secreted protein, suggesting that it is either a soluble subunit within a cytokine receptor complex, like the soluble form of the IL-6R alpha-chain, or a subunit of a multimeric cytokine, e.g., IL-12 p40. The highest levels of hCLF-1 mRNA were observed in lymph node, spleen, thymus, appendix, placenta, stomach, bone marrow, and fetal lung, with constitutive expression of CLF-1 mRNA detected in a human kidney fibroblastic cell line. In fibroblast primary cell cultures, CLF-1 mRNA was up-regulated by TNF-alpha, IL-6, and IFN-gamma. Western blot analysis of recombinant forms of hCLF-1 showed that the protein has the tendency to form covalently linked di- and tetramers. These results suggest that CLF-1 is a novel soluble cytokine receptor subunit or part of a novel cytokine complex, possibly playing a regulatory role in the immune system and during fetal development.

  16. Synthesis and Piezoelectric Properties of Li, Ca and Mn-codoped BaTiO3 by a Solvothermal Approach

    International Nuclear Information System (INIS)

    Kimura, T; Dong, Q; Yin, S; Sato, T; Hashimoto, T; Sasaki, A; Aisawa, S

    2013-01-01

    3 at.% Li-doped (Ba 1-x Ca x )(Ti 1-y Mn y )O 3 particles with the Ca 2+ mole fraction, x, of 0–0.09 and Mn mole fraction, y, of 0 and 0.0005 were synthesized by a solvothermal approach at 200°C. The products consisted of nanoparticles of 50–100 nm in diameter, and did not change very much depending on the amount of Li, Ca and Mn-codoping. The change in relative dielectric constant, Δε r , in around room temperature decreased by doping Ca 2+ , and the lowest Δε r (4.51%) could be realized at x value of 0.03. The mechanical quality factor, Q m , of 3 at.% Li-doped (Ba 0.97 Ca 0.03 )(Ti 0.9995 Mn 0.0005 )O 3 increased to 521, and Δε r decreased to 1.72%, while the piezoelectric constant, d 33 (234pC/N), and electromechanical coupling factor, k p (40.0%), did not change very much compared with 3 at.% Li-doped BaTiO 3

  17. Genetics of Psoriasis and Pharmacogenetics of Biological Drugs

    Directory of Open Access Journals (Sweden)

    Rocío Prieto-Pérez

    2013-01-01

    Full Text Available Psoriasis is a chronic inflammatory disease of the skin. The causes of psoriasis are unknown, although family and twin studies have shown genetic factors to play a key role in its development. The many genes associated with psoriasis and the immune response include TNFα, IL23, and IL12. Advances in knowledge of the pathogenesis of psoriasis have enabled the development of new drugs that target cytokines (e.g., etanercept, adalimumab, and infliximab, which target TNFα, and ustekinumab, which targets the p40 subunit of IL23 and IL12. These drugs have improved the safety and efficacy of treatment in comparison with previous therapies. However, not all patients respond equally to treatment, possibly owing to interindividual genetic variability. In this review, we describe the genes associated with psoriasis and the immune response, the biological drugs used to treat chronic severe plaque psoriasis, new drugs in phase II and III trials, and current knowledge on the implications of pharmacogenomics in predicting response to these treatments.

  18. Relativistic few body calculations

    International Nuclear Information System (INIS)

    Gross, F.

    1988-01-01

    A modern treatment of the nuclear few-body problem must take into account both the quark structure of baryons and mesons, which should be important at short range, and the relativistic exchange of mesons, which describes the long range, peripheral interactions. A way to model both of these aspects is described. The long range, peripheral interactions are calculated using the spectator model, a general approach in which the spectators to nucleon interactions are put on their mass-shell. Recent numerical results for a relativistic OBE model of the NN interaction, obtained by solving a relativistic equation with one-particle on mass-shell, will be presented and discussed. Two meson exchange models, one with only four mesons (π,σ,/rho/,ω) but with a 25% admixture of γ 5 coupling for the pion, and a second with six mesons (π,σ,/rho/,ω,δ,/eta/) but pure γ 5 γ/sup μ/ pion coupling, are shown to give very good quantitative fits to the NN scattering phase shifts below 400 MeV, and also a good description of the /rvec p/ 40 Ca elastic scattering observables. Applications of this model to electromagnetic interactions of the two body system, with emphasis on the determination of relativistic current operators consistent with the dynamics and the exact treatment of current conservation in the presence of phenomenological form factors, will be described. 18 refs., 8 figs

  19. Obesity Related Alterations in Plasma Cytokines and Metabolic Hormones in Chimpanzees

    Directory of Open Access Journals (Sweden)

    Pramod Nehete

    2014-01-01

    Full Text Available Obesity is characterized by chronic low-grade inflammation and serves as a major risk factor for hypertension, coronary artery disease, dyslipidemias, and type-2 diabetes. The purpose of this study was to examine changes in metabolic hormones, inflammatory cytokines, and immune function, in lean, overweight, and obese chimpanzees in a controlled environment. We observed increased plasma circulating levels of proinflammatory TH-1 cytokines, Interferon gamma, interleukin-6, interleukin-12p40, tumor necrosis factor, soluble CD40 ligand, and Interleukin-1β and anti-inflammatory TH-2 cytokines, Interleukin-4, Interleukin-RA, Interleukin-10, and Interleukin-13 in overweight and obese chimpanzees. We also observed increased levels of metabolic hormones glucagon-like-peptide-1, glucagon, connecting peptide, insulin, pancreatic peptide YY3–36, and leptin in the plasma of overweight and obese chimpanzees. Chemokine, eotaxin, fractalkine, and monocyte chemoattractant protein-1 were higher in lean compared to obese chimpanzees, while chemokine ligand 8 increased in plasma of obese chimpanzees. We also observed an obesity-related effect on immune function as demonstrated by lower mitogen induced proliferation, and natural killer activity and higher production of IFN-γ by PBMC in Elispot assay, These findings suggest that lean, overweight, and obese chimpanzees share circulating inflammatory cytokines and metabolic hormone levels with humans and that chimpanzees can serve as a useful animal model for human studies.

  20. Reduced expression of IL-12 p35 by SJL/J macrophages responding to Theiler's virus infection is associated with constitutive activation of IRF-3

    International Nuclear Information System (INIS)

    Dahlberg, Angela; Auble, Mark R.; Petro, Thomas M.

    2006-01-01

    Macrophages responding to viral infections may contribute to autoimmune demyelinating diseases (ADD). Macrophages from ADD-susceptible SJL/J mice responding to Theiler's Virus (TMEV) infection, the TLR7 agonist loxoribine, or the TLR4 agonist-LPS expressed less IL-12 p35 but more IL-12/23 p40 and IFN-β than macrophages from ADD-resistant B10.S mice. While expression of IRF-1 and -7 was similar between B10.S and SJL/J TMEV-infected macrophages, SJL/J but not B10.S macrophages exhibited constitutively active IRF-3. In contrast to overexpressed IRF-1, IRF-5, and IRF-7, which stimulated p35 promoter reporter activity, overexpressed IRF-3 repressed p35 promoter activity in response to TMEV infection, loxoribine, IFN-γ/LPS, but not IFN-γ alone. IRF-3 lessened but did not eliminate IRF-1-stimulated p35 promoter activity. Repression by IRF-3 required bp -172 to -122 of the p35 promoter. The data suggest that pre-activated IRF-3 is a major factor in the differences in IL-12 production between B10.S and SJL/J macrophages responding to TMEV

  1. Serum cytokine profile and clinicopathological findings in oral lichen planus, oral lichenoid lesions and stomatitis

    DEFF Research Database (Denmark)

    Larsen, Kristine Røn; Johansen, Jeanne Duus; Reibel, Jesper

    2017-01-01

    The objective of this study was to examine if clinical and histopathological variables in patients with oral lichen planus (OLP), oral lichenoid lesions (OLL), and generalized stomatitis display different cytokine profiles and if concomitant contact allergy influences this profile. Forty-nine pat......The objective of this study was to examine if clinical and histopathological variables in patients with oral lichen planus (OLP), oral lichenoid lesions (OLL), and generalized stomatitis display different cytokine profiles and if concomitant contact allergy influences this profile. Forty...... analyzed and compared between groups. Nineteen patients had OLP, primarily with ulcerative lesions on the buccal mucosa, 19 patients had OLL, and 11 patients had generalized stomatitis. All patients had oral symptoms, mainly stinging and burning. Nineteen patients and 10 healthy subjects had contact...... higher levels of IL-6 than the healthy subjects. Interferon-γ, IL-12p40, and IL-12p70 were below detection limit. Our findings indicate that OLP, OLL, and generalized stomatitis cannot be discriminated by means of the selected serum cytokines, and that the presence of concomitant contact allergy does...

  2. Cytokine mRNA profiles in bronchoalveolar cells of piglets experimentally infected in utero with porcine reproductive and respiratory syndrome virus: Association of sustained expression of IFN-gamma and IL-10 after viral clearance

    DEFF Research Database (Denmark)

    Johnsen, C. K.; Bøtner, Anette; Kamstrup, Søren

    2002-01-01

    An experimental model was used to investigate mRNA cytokine profiles in bronchoalvolar cells (BALC) from piglets, infected in utero with porcine reproductive and respiratory syndrome virus (PRRSV). The BALC's were analyzed for the cytokines TNF-alpha, IFN-gamma, IL-8, IL-10, and IL-12(p40) by real......-time TaqMan polymerase chain reaction in 2-, 4-, and 6-week-old piglets, respectively. High levels of IFN-gamma mRNA was detected in all piglets, while IL-10 was upregulated in 2-week-old piglets, was at normal levels in 4-week-old piglets, and elevated again in 6-week-old piglets. IL-12 was weakly...... elevated in all three age groups. Virus was reduced by 50% in 4-week-old piglets and cleared by 6 weeks of age. The sustained expression of IFNgamma and reduction of IL-10 production indicate an important role for these cytokines in immunity to PRRSV....

  3. Predictors of Outcome in Ulcerative Colitis.

    Science.gov (United States)

    Waterman, Matti; Knight, Jo; Dinani, Amreen; Xu, Wei; Stempak, Joanne M; Croitoru, Kenneth; Nguyen, Geoffrey C; Cohen, Zane; McLeod, Robin S; Greenberg, Gordon R; Steinhart, A Hillary; Silverberg, Mark S

    2015-09-01

    Approximately 80% of patients with ulcerative colitis (UC) have intermittently active disease and up to 20% will require a colectomy, but little data available on predictors of poor disease course. The aim of this study was to identify clinical and genetic markers that can predict prognosis. Medical records of patients with UC with ≥5 years of follow-up and available DNA and serum were retrospectively assessed. Immunochip was used to genotype loci associated with immune mediated inflammatory disorders (IMIDs), inflammatory bowel diseases, and other single nucleotide polypmorphisms previously associated with disease severity. Serum levels of pANCA, ASCA, CBir1, and OmpC were also evaluated. Requirement for colectomy, medication, and hospitalization were used to group patients into 3 prognostic groups. Six hundred one patients with UC were classified as mild (n = 78), moderate (n = 273), or severe disease (n = 250). Proximal disease location frequencies at diagnosis were 13%, 21%, and 30% for mild, moderate, and severe UC, respectively (P = 0.001). Disease severity was associated with greater proximal extension rates on follow-up (P 40 and proximal disease location were associated with severe UC (odds ratios = 1.94 and 2.12, respectively). None of the single nucleotide polypmorphisms or serum markers tested was associated with severe UC, proximal disease extension or colectomy. Older age and proximal disease location at diagnosis, but not genetic and serum markers, were associated with a more severe course. Further work is required to identify biomarkers that will predict outcomes in UC.

  4. Correlations of secondary pions produced in multinucleon interactions of π- mesons with carbon nuclei at 40 GeV/c

    International Nuclear Information System (INIS)

    Batskovich, S.; Grishin, V.G.; Jenik, L.; Kanarek, T.

    1979-01-01

    Values of correlation functions are obtained for two-and three particle inclusive processes in π - p, π - n and π -12 C collisions at p=40 GeV/c. The results are obtained while analyzing 9940 π - p, 3590 π - n and approximately 11000 π 12 C inelastic interactions. Correlation values are obtained for various combinations of charged particles. Correlation value at different values of Q is also given for π -12 C events, Q being equal to the difference of positive and negative pions in the given event. Azimuthal correlations are studied for π + π + , π + π - and π - π - pairs, produced in π - p, π - n and π -12 C interactions. The correlations were studied in various ranges of particle rates and at various values of Q. Experimental data on azimuthal correlations are tabulated. The results of correlation measurements over rates and azimuthal angle in π -12 C collisions confirm predictions of the additive quark model and contradict the eikonal model. Measurements of correlation functions is emphasized to be the most sensitive way providing a possibility to find out the source of correlation on nuclei

  5. miR-223 is upregulated in monocytes from patients with tuberculosis and regulates function of monocyte-derived macrophages.

    Science.gov (United States)

    Liu, Yanhua; Wang, Ruo; Jiang, Jing; Yang, Bingfen; Cao, Zhihong; Cheng, Xiaoxing

    2015-10-01

    Tuberculosis (TB) is a serious infectious disease that most commonly affects the lungs. Macrophages are among the first line defenders against establishment of Mycobacterium tuberculosis infection in the lungs. In this study, we found that activation and cytokine production in monocyte-derived macrophages (MDM) from patients with active TB was impaired. miR-223 expression was significantly elevated in monocytes and MDM from patients with TB compared with healthy controls. To determine the functional role of miR-223 in macrophages, stable miR-223-expressing and miR-223 antisense-expressing U937 cells were established. Compared with empty vector controls, expression of IL-1β, IL-6, TNF-α and IL-12p40 genes was significantly higher in miR-223 antisense-expressing U937 cells, but lower in miR-223-expressing U937 cells. miR-223 can negatively regulate activation of NF-κB by inhibition of p65 phosphorylation and nuclear translocation. It is concluded that miR-223 can regulate macrophage function by inhibition of cytokine production and NF-κB activation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Peripheral Inflammatory Markers Contributing to Comorbidities in Autism

    Directory of Open Access Journals (Sweden)

    Martha Cecilia Inga Jácome

    2016-12-01

    Full Text Available This study evaluates the contribution of peripheral biomarkers to comorbidities and clinical findings in autism. Seventeen autistic children and age-matched typically developing (AMTD, between three to nine years old were evaluated. The diagnostic followed the Diagnostic and Statistical Manual of Mental Disorders 4th Edition (DMS-IV and the Childhood Autism Rating Scale (CARS was applied to classify the severity. Cytokine profile was evaluated in plasma using a sandwich type ELISA. Paraclinical events included electroencephalography (EEG record. Statistical analysis was done to explore significant differences in cytokine profile between autism and AMTD groups and respect clinical and paraclinical parameters. Significant differences were found to IL-1β, IL-6, IL-17, IL-12p40, and IL-12p70 cytokines in individuals with autism compared with AMTD (p < 0.05. All autistic patients showed interictalepileptiform activity at EEG, however, only 37.5% suffered epilepsy. There was not a regional focalization of the abnormalities that were detectable with EEG in autistic patients with history of epilepsy. A higher IL-6 level was observed in patients without history of epilepsy with interictalepileptiform activity in the frontal brain region, p < 0.05. In conclusion, peripheral inflammatory markers might be useful as potential biomarkers to predict comorbidities in autism as well as reinforce and aid informed decision-making related to EEG findings in children with Autism spectrum disorders (ASD.

  7. T cell-dependence of Lassa fever pathogenesis.

    Directory of Open Access Journals (Sweden)

    Lukas Flatz

    2010-03-01

    Full Text Available Lassa virus (LASV, the causative agent of Lassa fever (LF, is endemic in West Africa, accounting for substantial morbidity and mortality. In spite of ongoing research efforts, LF pathogenesis and mechanisms of LASV immune control remain poorly understood. While normal laboratory mice are resistant to LASV, we report that mice expressing humanized instead of murine MHC class I (MHC-I failed to control LASV infection and develop severe LF. Infection of MHC-I knockout mice confirmed a key role for MHC-I-restricted T cell responses in controlling LASV. Intriguingly we found that T cell depletion in LASV-infected HHD mice prevented disease, irrespective of high-level viremia. Widespread activation of monocyte/macrophage lineage cells, manifest through inducible NO synthase expression, and elevated IL-12p40 serum levels indicated a systemic inflammatory condition. The absence of extensive monocyte/macrophage activation in T cell-depleted mice suggested that T cell responses contribute to deleterious innate inflammatory reactions and LF pathogenesis. Our observations in mice indicate a dual role for T cells, not only protecting from LASV, but also enhancing LF pathogenesis. The possibility of T cell-driven enhancement and immunopathogenesis should be given consideration in future LF vaccine development.

  8. Swelling of biological and semiflexible polyelectrolytes.

    Science.gov (United States)

    Dobrynin, Andrey V; Carrillo, Jan-Michael Y

    2009-10-21

    We have developed a theoretical model of swelling of semiflexible (biological) polyelectrolytes in salt solutions. Our approach is based on separation of length scales which allowed us to split a chain's electrostatic energy into two parts that describe local and remote electrostatic interactions along the polymer backbone. The local part takes into account interactions between charged monomers that are separated by distances along the polymer backbone shorter than the chain's persistence length. These electrostatic interactions renormalize chain persistence length. The second part includes electrostatic interactions between remote charged pairs along the polymer backbone located at distances larger than the chain persistence length. These interactions are responsible for chain swelling. In the framework of this approach we calculated effective chain persistence length and chain size as a function of the Debye screening length, chain degree of ionization, bare persistence length and chain degree of polymerization. Our crossover expression for the effective chain's persistence length is in good quantitative agreement with the experimental data on DNA. We have been able to fit experimental datasets by using two adjustable parameters: DNA ionization degree (α = 0.15-0.17) and a bare persistence length (l(p) = 40-44 nm).

  9. Long term efficacy and safety of etanercept in the treatment of psoriasis and psoriatic arthritis

    Directory of Open Access Journals (Sweden)

    Kivelevitch D

    2014-04-01

    Full Text Available Dario Kivelevitch, Bobbak Mansouri, Alan Menter Department of Dermatology, Baylor University Medical Center, Dallas, TX, USA Abstract: Psoriasis is a chronic, immune-mediated inflammatory disease affecting both the skin and joints. Approximately 20% of patients suffer a moderate to severe form of skin disease and up to 30% have joint involvement. Standard therapies for psoriasis include topical medications, phototherapy, and both oral systemic and biological therapies whereas therapies for psoriatic arthritis include nonsteroidal anti-inflammatory drugs followed by disease modifying antirheumatic drugs and/or tumor necrosis factor (TNF-α inhibitors and interleukin-12/23p40 inhibitors. Treatment of both diseases is typically driven by disease severity. In the past decade, major advances in the understanding of the immunopathogenesis of psoriasis and psoriatic arthritis have led to the development of numerous biological therapies, which have revolutionized the treatment for moderate to severe plaque psoriasis and psoriatic arthritis. Anti-TNF-α agents are currently considered as first line biological therapies for the treatment of moderate to severe psoriasis and psoriatic arthritis. Currently approved anti-TNF-α agents include etanercept, adalimumab, and infliximab for psoriasis and psoriatic arthritis as well as golimumab and certolizumab for psoriatic arthritis. In this article, we aim to evaluate the long term safety and efficacy of etanercept in psoriasis and psoriatic arthritis. Keywords: psoriasis, psoriatic arthritis, etanercept, biological therapy, tumor necrosis factor, safety

  10. Genetic and biochemical characterization of the cell wall hydrolase activity of the major secreted protein of Lactobacillus rhamnosus GG.

    Directory of Open Access Journals (Sweden)

    Ingmar J J Claes

    Full Text Available Lactobacillus rhamnosus GG (LGG produces two major secreted proteins, designated here Msp1 (LGG_00324 or p75 and Msp2 (LGG_00031 or p40, which have been reported to promote the survival and growth of intestinal epithelial cells. Intriguingly, although each of these proteins shares homology with cell wall hydrolases, a physiological function that correlates with such an enzymatic activity remained to be substantiated in LGG. To investigate the bacterial function, we constructed knock-out mutants in the corresponding genes aiming to establish a genotype to phenotype relation. Microscopic examination of the msp1 mutant showed the presence of rather long and overly extended cell chains, which suggests that normal daughter cell separation is hampered. Subsequent observation of the LGG wild-type cells by immunofluorescence microscopy revealed that the Msp1 protein accumulates at the septum of exponential-phase cells. The cell wall hydrolyzing activity of the Msp1 protein was confirmed by zymogram analysis. Subsequent analysis by RP-HPLC and mass spectrometry of the digestion products of LGG peptidoglycan (PG by Msp1 indicated that the Msp1 protein has D-glutamyl-L-lysyl endopeptidase activity. Immunofluorescence microscopy and the failure to construct a knock-out mutant suggest an indispensable role for Msp2 in priming septum formation in LGG.

  11. The role of maintenance thalidomide therapy in multiple myeloma: MRC Myeloma IX results and meta-analysis.

    Science.gov (United States)

    Morgan, Gareth J; Gregory, Walter M; Davies, Faith E; Bell, Sue E; Szubert, Alexander J; Brown, Julia M; Coy, Nuria N; Cook, Gordon; Russell, Nigel H; Rudin, Claudius; Roddie, Huw; Drayson, Mark T; Owen, Roger G; Ross, Fiona M; Jackson, Graham H; Child, J Anthony

    2012-01-05

    Thalidomide maintenance has the potential to modulate residual multiple myeloma (MM) after an initial response. This trial compared the effect of thalidomide maintenance and no maintenance on progression-free survival (PFS) and overall survival (OS) in MM patients. After intensive or nonintensive induction therapy, 820 newly diagnosed MM patients were randomized to open-label thalidomide maintenance until progression, or no maintenance. Interphase FISH (iFISH) analysis was performed at study entry. Median PFS was significantly longer with thalidomide maintenance (log-rank P < .001). Median OS was similar between regimens (log-rank P = .40). Patients with favorable iFISH showed improved PFS (P = .004) and a trend toward a late survival benefit. Patients with adverse iFISH receiving thalidomide showed no significant PFS benefit and worse OS (P = .009). Effective relapse therapy enhanced survival after progression, translating into a significant OS benefit. Meta-analysis of this and other studies show a significant late OS benefit (P < .001, 7-year difference hazard ratio = 12.3; 95% confidence interval, 5.5-19.0). Thalidomide maintenance significantly improves PFS and can be associated with improved OS. iFISH testing is important in assessing the clinical impact of maintenance therapy. Overview analysis demonstrated that thalidomide maintenance was associated with a significant late OS benefit. This trial was registered at www.isrctn.org as #ISRCTN68454111.

  12. Sintomas, complicações e alterações hemodinâmicas associadas a ecocardiografia de estresse com dobutamina

    Directory of Open Access Journals (Sweden)

    Pinton Rita

    1997-01-01

    Full Text Available OBJETIVO: Avaliar a segurança e efeitos hemodinâmicos da ecocardiografia de estresse com dobutamina. MÉTODOS: Estudo prospectivo de 735 pacientes consecutivos, submetidos a ecocardiografia de estresse com dobutamina, para avaliar doença coronária e ou miocardiopatia. Inicialmente, a dobutamina foi administrada via endovenosa com doses progressivas de 5, 10, 20, 30µg/kg/min a intervalos de 3min. O protocolo foi modificado para atingir a dose máxima de 40µg/kg/min, e, finalmente, até o limite de 50µg/kg/min. RESULTADOS: A dobutamina aumentou significantemente a freqüência cardíaca (FC (de 72±12bpm para 117±23bpm, p40µg/kg/min não provocam resposta cronotrópica adicional, o que torna questionável a validade do protocolo de ecocardiografia de estresse com doses de dobutamina >40µg/kg/min.

  13. Investigation of fission properties and evaporation residue measurement in the reactions using 238U target nucleus

    Directory of Open Access Journals (Sweden)

    Saro S.

    2011-10-01

    Full Text Available Fragment mass distributions for fission after full momentum transfer were measured in the reactions of 30Si,34,36 S,31P,40Ar + 238U at bombarding energies around the Coulomb barrier. Mass distributions change significantly as a function of incident beam energy. The asymmetric fission probability increases at sub-barrier energy. The phenomenon is interpreted as an enhanced quasifission probability owing to orientation effects on fusion and/or quasifission. The evaporation residue (ER cross sections were measured in the reactions of 30Si + 238U and 34S + 238U to obtain information on fusion. In the latter reaction, significant suppression of fusion was implied. This suggests that fission events different from compound nucleus are included in the masssymmetric fragments. The results are supported by a model calculation based on a dynamical calculation using Langevin equation, in which the mass distribution for fusion-fission and quasifission fragments are separately determined.

  14. Identification of human pulmonary alkaline phosphatase isoenzymes.

    Science.gov (United States)

    Capelli, A; Cerutti, C G; Lusuardi, M; Donner, C F

    1997-04-01

    An increase of alkaline phosphatase (ALP) activity has been observed in the bronchoalveolar lavage fluid (BALF) of patients affected by pulmonary fibrosis in chronic interstitial lung disorders. To characterize the ALP isoenzymes in such cases, we used gel filtration, agarose gel electrophoresis, heat and amino acid inhibition assays, wheat-germ agglutinin (WGA) precipitation, and an immunoassay specific for the bone-isoform of ALP. Only one anodic band representing a high-molecular-weight isoform of ALP (Mr approximately 2,000 kDa) was observed on electrophoresis of BALF. The inhibition assay results were consistent for a tissue-nonspecific isoenzyme sensitive to a temperature of 56 degrees C (71.9 +/- 2.5% inhibition) and to homoarginine (65.7 +/- 1.9%), and resistant to L-phenylalanine and L-leucine. Less than 13% of ALP activity was heat-stable. After incubation of BALF specimens with glycosyl-phosphatidylinositol-phospholipase D plus Nonidet P-40, or with phosphatidylinositol-phospholipase C alone, an electrophoretic cathodic band (Mr approximately 220 kDa) appeared near the bone band of a standard serum. With the WGA assay, 84.4 +/- 3.3% of ALP precipitated and the band disappeared. After immunoassay for the bone isoform, a mean of less than 5% enzyme activity was measured. We conclude that the ALP found in BALF is a pulmonary isoform of a tissue nonspecific isoenzyme.

  15. Developing Verification Systems for Building Information Models of Heritage Buildings with Heterogeneous Datasets

    Science.gov (United States)

    Chow, L.; Fai, S.

    2017-08-01

    The digitization and abstraction of existing buildings into building information models requires the translation of heterogeneous datasets that may include CAD, technical reports, historic texts, archival drawings, terrestrial laser scanning, and photogrammetry into model elements. In this paper, we discuss a project undertaken by the Carleton Immersive Media Studio (CIMS) that explored the synthesis of heterogeneous datasets for the development of a building information model (BIM) for one of Canada's most significant heritage assets - the Centre Block of the Parliament Hill National Historic Site. The scope of the project included the development of an as-found model of the century-old, six-story building in anticipation of specific model uses for an extensive rehabilitation program. The as-found Centre Block model was developed in Revit using primarily point cloud data from terrestrial laser scanning. The data was captured by CIMS in partnership with Heritage Conservation Services (HCS), Public Services and Procurement Canada (PSPC), using a Leica C10 and P40 (exterior and large interior spaces) and a Faro Focus (small to mid-sized interior spaces). Secondary sources such as archival drawings, photographs, and technical reports were referenced in cases where point cloud data was not available. As a result of working with heterogeneous data sets, a verification system was introduced in order to communicate to model users/viewers the source of information for each building element within the model.

  16. Economically important species dominate aboveground carbon storage in forests of southwestern Amazonia

    Directory of Open Access Journals (Sweden)

    N. Galia Selaya

    2017-06-01

    Full Text Available Tree species in tropical forests provide economically important goods and ecosystem services. In submontane forests of southwestern Amazonia, we investigated the degree to which tree species important for subsistence and trade contribute to aboveground carbon storage (AGC. We used 41 1-hectare plots to determine the species abundance, basal area, and AGC of stems > 10 cm diameter at breast height (dbh. Economically important taxa were classified using ethnobotanical studies and according to their stem density. These taxa (n = 263 accounted for 45% of total stems, 53% of total basal area, and 56% of total AGC, significantly more than taxa with minor or unknown uses (Welch test at p 40 cm and few stems in regeneration classes of dbh < 10 to 20 cm (e.g., Bertholletia excelsa, Cariniana spp., Cedrelinga spp., Ceiba spp., Dipteryx spp., whereas dominant Tetragastris spp., and Pseudolmedia spp. had most stems in low diameter classes and a median diameter of < 30 cm. Bertholletia excelsa, with 1.5 stems per hectare, showed the highest basal area of any species and accounted for 9% of AGC (11 Mg/ha, twice that of the second-ranking species. Our study shows that economic importance and carbon stocks in trees are closely linked in southwestern Amazonia. Unplanned harvests can disrupt synergistic dual roles altering carbon stocks temporally or permanently. Precautionary measures based on species ecology, demography, and regeneration traits should be at the forefront of REDD+ to reconcile maximum harvesting limits, biodiversity conservation, and sustainable forest management.

  17. Next generation of biologics for the treatment of Crohn’s disease: an evidence-based review on ustekinumab

    Directory of Open Access Journals (Sweden)

    Jauregui-Amezaga A

    2017-11-01

    Full Text Available Aranzazu Jauregui-Amezaga, Michael Somers, Heiko De Schepper, Elisabeth Macken Department of Gastroenterology, Universitair Ziekenhuis Antwerpen, University of Antwerp, Antwerp, Belgium Abstract: The limited efficacy of the currently available medical therapies in a proportion of patients with Crohn’s disease has led to the research and development of molecules that can block new inflammatory pathways. Ustekinumab is a fully human IgG1 monoclonal antibody which targets the common p40 subunit of the cytokines interleukin-12 as well as interleukin-23. Consequently, the Th1 and Th17 inflammatory responses are inhibited. Ustekinumab has been recently approved for its use in patients with Crohn’s disease. Its efficacy and safety was initially proved in patients with psoriasis and psoriatic arthritis. More recently, three Phase III trials have confirmed its efficacy in patients with Crohn’s disease refractory to anti-tumor necrosis factor therapy. This biologic agent appears safe, with no increased risk of infectious or malignant complications, and a low immunogenic profile. Keywords: ustekinumab, interleukin-12, interleukin-23, biologic therapy, inflammatory bowel disease, Crohn’s disease

  18. Central hemodynamics, vegetative status, and 40K excretion in children from regions with radioactive contamination

    International Nuclear Information System (INIS)

    Korovina, N.A.; Korenkov, I.P.; Zaplatnikov, A.A.

    1996-01-01

    Metabolism of potassium and natural radionuclide 40 K in children with functional disorders of circulatory organs, permanently living in areas with radiation contamination as a result of the Chernobyl accident is studied. Health status, cardiovascular function, vegetative homeostasis, and metabolism of stable potassium and 40 K were studied by clinical and instrumental methods in 61 children aged 10 t 14 years living in regions with radionuclide contamination in the Bryansk district (density of radiation contamination with 137 Cs 15 to 40 Ci/km 2 , level of 137 Cs incorporation up to 0.15 mkCi per organism. It was stated that six to seven years after the Chernobyl accident 58.3 to 62.5 % of children permanently living in regions with radionuclide contamination developed functional changes of the bioelectrical activity of the myocardium,, presenting as specific heart rhythm, conductivity, and repolarization process involving no disorders of the central hemodynamics; vegetative dysfunction was observed in 78.3 % children (p 40 K in different groups of children with functional disorders of the circulatory organs. 14 refs.; 3 tabs

  19. Growth Modeling of the Maternal Cytokine Milieu throughout Normal Pregnancy: Macrophage-Derived Chemokine Decreases as Inflammation/Counterregulation Increases

    Directory of Open Access Journals (Sweden)

    Shernan G. Holtan

    2015-01-01

    Full Text Available Several recent studies have shown differences in the maternal immune milieu at different phases of pregnancy, but most studies have been cross-sectional or of relatively few time points. Levels of 42 cytokines were determined using a multiplex bead-based assay on archived serum from a cohort of pregnant women N=16 at median of 18 time points tested, from the first trimester through to parturition, per woman. Unconditional growth modeling was then used to determine time-dependent changes in levels of these cytokines. Macrophage-derived chemokine (MDC, aka CCL22 decreases as pregnancy progresses. IL-1β, IL-6, IL-8, IL-12p70, IL-13, IL-15, IP-10, and FLT3-ligand increase as a function of gestational weeks, and IFNα2, IL-1ra, IL-3, IL-9, IL-12p40, and soluble CD40 ligand increase as a function of trimester. As pregnancy normally progresses, a maternal shift away from a type 2-biased immune response and toward an inflammatory/counterregulatory response is observed.

  20. [Decellularized fish skin: characteristics that support tissue repair].

    Science.gov (United States)

    Magnússon, Skúli; Baldursson, Baldur Tumi; Kjartansson, Hilmar; Thorlacius, Guðný Ella; Axelsson, Ívar; Rolfsson, Óttar; Petersen, Pétur Henry; Sigurjónsson, Guðmundur Fertram

    2015-12-01

    Acellular fish skin of the Atlantic cod (Gadus morhua) is being used to treat chronic wounds. The prevalence of diabetes and the comorbidity of chronic wounds is increasing globally. The aim of the study was to assess the biocompatibility and biological characteristics of acellular fish skin, important for tissue repair. The structure of the acellular fish skin was examined with microscopy. Biocompatibility of the graft was conducted by a specialized certified laboratory. Protein extracts from the material were analyzed using gel electrophoresis. Cytokine levels were measured with an enzyme linked immunosorbent assay (ELISA). Angiogenic properties were assessed with a chick chorioallantoic membrane (chick CAM) assay. The structure of acellular fish skin is porous and the material is biocompatible. Electrophoresis revealed proteins around the size 115-130 kDa, indicative of collagens. The material did not have significant effect on IL-10, IL-12p40, IL-6 or TNF-α secretion from monocytes or macrophages. Acellular fish skin has significant effect on angiogenesis in the chick CAM assay. The acellular fish skin is not toxic and is not likely to promote inflammatory responses. The graft contains collagen I, promotes angiogenesis and supports cellular ingrowth. Compared to similar products made from mammalian sources, acellular fish skin does not confer a disease risk and contains more bioactive compounds, due to less severe processing.

  1. Critical roles for LIGHT and its receptors in generating T cell-mediated immunity during Leishmania donovani infection.

    Directory of Open Access Journals (Sweden)

    Amanda C Stanley

    2011-10-01

    Full Text Available LIGHT (TNFSF14 is a member of the TNF superfamily involved in inflammation and defence against infection. LIGHT signals via two cell-bound receptors; herpes virus entry mediator (HVEM and lymphotoxin-beta receptor (LTβR. We found that LIGHT is critical for control of hepatic parasite growth in mice with visceral leishmaniasis (VL caused by infection with the protozoan parasite Leishmania donovani. LIGHT-HVEM signalling is essential for early dendritic cell IL-12/IL-23p40 production, and the generation of IFNγ- and TNF-producing T cells that control hepatic infection. However, we also discovered that LIGHT-LTβR interactions suppress anti-parasitic immunity in the liver in the first 7 days of infection by mechanisms that restrict both CD4(+ T cell function and TNF-dependent microbicidal mechanisms. Thus, we have identified distinct roles for LIGHT in infection, and show that manipulation of interactions between LIGHT and its receptors may be used for therapeutic advantage.

  2. Evidence for the involvement of a 66 kDa membrane protein in the synthesis of sterolglucoside in ''Saccharomyces cerevisiae''

    International Nuclear Information System (INIS)

    Lenart, U.; Palamarczyk, G.

    1995-01-01

    The membrane-bound sterolglucoside synthase from the yeast ''Saccharomyces cerevisiae'' has been solubilized by nonionic detergent, Nonidet P-40, Triton X-100, and partially purified by DEAE-cellulose column chromatography and ammonium sulfate fractionation. SDS/PAGE of the purified fraction revealed the presence of two protein bands of molecular mass 66 kDa and 54 kDa. In an attempt to identify further the polypeptide chain of sterolglucoside synthase, the partially purified enzyme was treated with [di- 125 I]-5-[3-(p-azidosalicylamide)]allyl-UDPglucose, a photoactive analogue of UDPglucose, which is a substrate for this enzyme. Upon photolysis the 125 I-labelled probe was shown to link covalently to the 66 kDa protein. The photoinsertion was competed out by the presence of unlabeled UDPglucose thus suggesting that this protein contains substrate binding site for UDPglucose. Since photoinsertion of the probe to protein of 66 kDa correlated with the molecular mass of the protein visualized upon enzyme purification we postulate that the 66 kDa protein is involved in sterolglucoside synthesis in yeast. (author). 10 refs, 5 figs, 1 tab

  3. Psoriasis and Nonalcoholic Fatty Liver Disease.

    Science.gov (United States)

    Carrascosa, J M; Bonanad, C; Dauden, E; Botella, R; Olveira-Martín, A

    Nonalcoholic fatty liver disease (NAFLD) is the most prevalent liver condition in the West. The prevalence and severity of NAFLD is higher and the prognosis worse in patients with psoriasis. The pathogenic link between psoriasis and NAFLD is chronic inflammation and peripheral insulin resistance, a common finding in diseases associated with psoriasis. NAFLD should therefore be ruled out during the initial evaluation of patients with psoriasis, in particular if they show signs of metabolic syndrome and require systemic treatment. Concomitant psoriasis and NAFLD and the likelihood of synergy between them place limitations on general recommendations and treatment for these patients given the potential for liver toxicity. As hepatotoxic risk is associated with some of the conventional drugs used in this setting (e.g., acitretin, methotrexate, and ciclosporin), patients prescribed these treatments should be monitored as appropriate. Anti-tumor necrosis factor agents hold the promise of potential benefits based on their effects on the inflammatory process and improving peripheral insulin resistance. However, cases of liver toxicity have also been reported in relation to these biologics. No evidence has emerged to suggest that anti-p40 or anti-interleukin 17 agents provide benefits or have adverse effects. Copyright © 2017 AEDV. Publicado por Elsevier España, S.L.U. All rights reserved.

  4. Apo-9′-Fucoxanthinone, Isolated from Sargassum muticum, Inhibits CpG-Induced Inflammatory Response by Attenuating the Mitogen-Activated Protein Kinase Pathway

    Directory of Open Access Journals (Sweden)

    Young-Sang Koh

    2013-08-01

    Full Text Available Sargassum muticum (S. muticum is a brown edible alga and widely distributed in Korea. This report was designed to evaluate the anti-inflammatory properties of apo-9′-fucoxanthinone (APO-9′ isolated from S. muticum on pro-inflammatory cytokine production. S. muticum extract (SME exhibited significant inhibitory effects on pro-inflammatory cytokine production in bone marrow-derived macrophages (BMDMs and dendritic cells (BMDCs. APO-9′ pre-treatment in the CpG DNA-stimulated BMDMs and BMDCs showed a strong dose-dependent inhibitory effect on interleukin (IL-12 p40, IL-6 and tumor necrosis factor (TNF-α production with IC50 values ranging from 5.31 to 13.79. It exhibited a strong inhibitory effect on the phosphorylation of ERK1/2 and on activator protein (AP-1 reporter activity. APO-9′ pre-treatment exhibited significant inhibition of CpG DNA-induced production of inducible nitric oxide synthase. Taken together, these data suggest that SME and APO-9′ have a significant anti-inflammatory property and warrant further studies concerning the potentials of SME and APO-9′ for medicinal use.

  5. Is there an association between bruxism and intestinal parasitic infestation in children?

    Science.gov (United States)

    Díaz-Serrano, Kranya Victoria; da Silva, Carolina Brunelli Alvares; de Albuquerque, Sérgio; Pereira Saraiva, Maria da Conceição; Nelson-Filho, Paulo

    2008-01-01

    Multiple factors have been considered in the etiology of bruxism in pediatric patients, among which are infestations by intestinal parasites suggested by some authors. No empirical evidence exists, however, of such association. Therefore, this study's purpose was to investigate the existence of an association between bruxism and intestinal parasitic infestation in children. Fifty-seven 6- to 11-year-olds (30 cases and 27 controls) who had not used anthelminthics 2 months before the baseline examination were enrolled in the study. A diagnosis of bruxism was based on an intraoral clinical examination performed by a single trained examiner and on the parent/guardian's report of any perceived parafunctional habits (questionnaire-based interview). Bruxism cases were defined as those children with a report of currently perceived habits of eccentric or centric bruxism (tooth-grinding and tooth-clenching, respectively) combined with clinical evidence of nonphysiologic wear facets. The volunteers were required to collect 3 fecal samples (1 every 2 to 3 days). Parasitologic analysis was performed using the spontaneous sedimentation method. Data gathered from the intraoral clinical examination, questionnaire, and parasitologic analysis were tabulated and submitted to statistical analysis using the chi-square test and student's t test. Intestinal parasitic infestation was observed in 30% (N=9) of cases and 41% (N=11) of controls, but no statistically significant association was observed (P=.40). This study's findings do not support the existence of an association between intestinal parasitic infestation and bruxism among the evaluated pediatric population.

  6. Prediction Of Abrasive And Diffusive Tool Wear Mechanisms In Machining

    Science.gov (United States)

    Rizzuti, S.; Umbrello, D.

    2011-01-01

    Tool wear prediction is regarded as very important task in order to maximize tool performance, minimize cutting costs and improve the quality of workpiece in cutting. In this research work, an experimental campaign was carried out at the varying of cutting conditions with the aim to measure both crater and flank tool wear, during machining of an AISI 1045 with an uncoated carbide tool P40. Parallel a FEM-based analysis was developed in order to study the tool wear mechanisms, taking also into account the influence of the cutting conditions and the temperature reached on the tool surfaces. The results show that, when the temperature of the tool rake surface is lower than the activation temperature of the diffusive phenomenon, the wear rate can be estimated applying an abrasive model. In contrast, in the tool area where the temperature is higher than the diffusive activation temperature, the wear rate can be evaluated applying a diffusive model. Finally, for a temperature ranges within the above cited values an adopted abrasive-diffusive wear model furnished the possibility to correctly evaluate the tool wear phenomena.

  7. Dosimetric comparison between RapidArc and fixed gantry intensity modulated radiation therapy in treatment of liver carcinoma

    International Nuclear Information System (INIS)

    Ma Changsheng; Yin Yong; Liu Tonghai; Chen Jinhu; Sun Tao; Lin Xiutong

    2010-01-01

    Objective: To compare the dosimetric difference of RapidArc and fixed gantry IMRT for liver carcinoma. Methods: The CT data of 10 liver cancer patients were used to design 3 groups of treatment plan: IMRT plan, single arc RapidArc plan (RA1), and dual arc RapidArc plan (RA2). The planning target volume (PTV) dosimetric distribution, the organs at risk (OAR) dose, the normal tissue dose, mornitor units (MU) and treatment time were compared. Results: The maximum dose of PTV in RA1 and RA2 plans were lower than that of IMRT (Z=-2.0990, -2.666, P 40 of stomach small bowel than IMRT plan, but higher in mean dose of left kidney (Z=-1.988, -2.191, P 5 , V 10 and 15 of healthy tissue in RapidArc plan groups were higher than those in IMRT plan, while the values of V 20 , V 25 and V 30 of healthy tissue in RapidArc plan groups were than those in IMRT plan. The number of computed MU/fraction of Rapid Arc plan was 40% or 46% of IMRT plan and the treatment time was 30% and 40% of IMRT. Conclusions: RapidArc showed improvements in conformity index and healthy tissue sparing with uncompromised target coverage. RapidArc could lead to the less MU and shorter delivery time compared to IMRT. (authors)

  8. Effect of PANI rate percentage on morphology, structure and charge transport mechanism in PANI–PVDF composites above percolation threshold

    International Nuclear Information System (INIS)

    Saïdi, Sami; Bouzitoun, Mouna; Mannaî, Aymen; Gmati, Fethi; Derouiche, Hassen; Mohamed, Abdellatif Belhadj

    2013-01-01

    Polyaniline–Poly(vinylidene) fluoride (PANI–PVDF) composites were prepared by adding PANI to the PVDF by different weight percentages p % (p = 0, 5, 10, 20, … until 100%). The dc and ac electrical conductivity were studied as a function of PANI percentage in the temperature range 303–453 K. The percolation threshold was found to be equal to 2.95%. When the amount of PANI varies from 5 to 30%, the charge transport mechanism was found to be governed by Mott's three-dimensional variable range hopping model and the dc conductivity decreases within this range. For p > 30%, the conductivity increases and the charge transport mechanism are better fitted by a fluctuation induced tunnelling model (FIT). By calculating the distance ‘s’ between two successive clusters (the distance between two active imines centres (=N + H–) of PANI) from the FIT model, we deduce that electron charge transfer is done by inter-chain hopping for the range [p = 40 to 60%] and by intra-chain hopping for p = 70 to 90%. Some insights about the contribution of the ionic charge transport for PANI concentrations in the interval 5% < p < 30% were obtained using impedance measurements at different frequencies. X-ray diffraction measurements, Fourier transform infrared spectroscopy and scanning electron microscopy were used to investigate the effect of PANI on the structure and morphology of composites. (paper)

  9. Searching for answers to clinical questions using google versus evidence-based summary resources: a randomized controlled crossover study.

    Science.gov (United States)

    Kim, Sarang; Noveck, Helaine; Galt, James; Hogshire, Lauren; Willett, Laura; O'Rourke, Kerry

    2014-06-01

    To compare the speed and accuracy of answering clinical questions using Google versus summary resources. In 2011 and 2012, 48 internal medicine interns from two classes at Rutgers University Robert Wood Johnson Medical School, who had been trained to use three evidence-based summary resources, performed four-minute computer searches to answer 10 clinical questions. Half were randomized to initiate searches for answers to questions 1 to 5 using Google; the other half initiated searches using a summary resource. They then crossed over and used the other resource for questions 6 to 10. They documented the time spent searching and the resource where the answer was found. Time to correct response and percentage of correct responses were compared between groups using t test and general estimating equations. Of 480 questions administered, interns found answers for 393 (82%). Interns initiating searches in Google used a wider variety of resources than those starting with summary resources. No significant difference was found in mean time to correct response (138.5 seconds for Google versus 136.1 seconds for summary resource; P = .72). Mean correct response rate was 58.4% for Google versus 61.5% for summary resource (mean difference -3.1%; 95% CI -10.3% to 4.2%; P = .40). The authors found no significant differences in speed or accuracy between searches initiated using Google versus summary resources. Although summary resources are considered to provide the highest quality of evidence, improvements to allow for better speed and accuracy are needed.

  10. Dendritic cell migration assay: a potential prediction model for identification of contact allergens.

    Science.gov (United States)

    Gibbs, Susan; Spiekstra, Sander; Corsini, Emanuela; McLeod, Julie; Reinders, Judith

    2013-04-01

    This manuscript describes methodology and a prediction model for the MUTZ-LC migration assay. The assay represents the physiological change in Langerhans cell (LC) behavior after exposure to a sensitizing chemical, resulting in LC migration from the epidermis to the dermis. MUTZ-LC are derived from the commercially available MUTZ-3 cell line. Upon exposure to a sensitizer MUTZ-LC migrate preferentially towards CXCL12 whereas upon exposure to a non-sensitizer MUTZ-LC migrate towards CCL5. A CXCL12/CCL5 ratio >1.10 in 2/3 independent experiments is indicative of a sensitizer, whereas a CXCL12/CCL5 ratio ≤1.10 is indicative of a non-sensitizer. At non cytotoxic chemical concentrations 9 sensitizers (2,4-dinitrochlorobenzene, paraphenylendiamine, cinnamaldehyde, isoeugenol, nickel-sulfate, tetramethylthiuram disulfide, eugenol, cinnamic-alcohol, ammonium-hexachloroplatinate) were distinguished from 4 non sensitizers (sodium lauryl sulfate, salicylic acid, phenol, octanoic acid). Critical points in assay performance are (i) MUTZ-3 passage number after thawing (p6-p40); (ii) cell viability (>80%); (iii) standard curve to optimize correlation of fluorescence with cell number; and (iv) optimization of the concentration of rhCXCL12 and rhCCL5 in transwell. The protocol has been tested in three European laboratories and results suggest that it may provide working conditions for performing the DC migration assay which is aimed at distinguishing sensitizers from non sensitizers. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model

    Directory of Open Access Journals (Sweden)

    Jafri Hasan S

    2007-10-01

    Full Text Available Abstract Motavizumab (MEDI-524 is a monoclonal antibody with enhanced neutralizing activity against RSV. In mice, motavizumab suppressed RSV replication which resulted in significant reduction of clinical parameters of disease severity. We evaluated the effect of motavizumab on the local and systemic immune response induced by RSV in the mouse model. Balb/c mice were intranasally inoculated with 106.5 PFU RSV A2 or medium. Motavizumab was given once intraperitoneally (1.25 mg/mouse as prophylaxis, 24 h before virus inoculation. Bronchoalveolar lavage (BAL and serum samples were obtained at days 1, 5 (acute and 28 (long-term post inoculation and analyzed with a multiplex assay (Beadlyte Upstate, NY for simultaneous quantitation of 18 cytokines: IL-1α, IL-1β, IL-2, IL-3, IL-4, IL-5, IL-6, KC (similar to human IL-8, IL-10, IL-12p40, IL-12p70, IL-13, IL-17, TNF-α, MCP-1, RANTES, IFN-γ and GM-CSF. Overall, cytokine concentrations were lower in serum than in BAL samples. By day 28, only KC was detected in BAL specimens at low concentrations in all groups. Administration of motavizumab significantly reduced (p

  12. Identification of cellular and viral factors related to anti-hepatitis C virus activity of cyclophilin inhibitor.

    Science.gov (United States)

    Goto, Kaku; Watashi, Koichi; Inoue, Daisuke; Hijikata, Makoto; Shimotohno, Kunitada

    2009-10-01

    We have so far reported that an immunosuppressant cyclosporin A (CsA), a well-known cyclophilin (CyP) inhibitor (CPI), strongly suppressed hepatitis C virus (HCV) replication in cell culture, and that CyPB was a cellular cofactor for viral replication. To further investigate antiviral mechanisms of CPI, we here developed cells carrying CsA-resistant HCV replicons, by culturing the HCV subgenomic replicon cells for 4 weeks in the presence of CsA with G418. Transfection of total RNA from the isolated CsA-resistant cells to naïve Huh7 cells conferred CsA resistance, suggesting that the replicon RNA itself was responsible for the resistant phenotype. Of the identified amino acid mutations, D320E in NS5A conferred the CsA resistance. The replicon carrying the D320E mutation was sensitive to interferon-alpha, but was resistant to CsA and other CPIs including NIM811 and sanglifehrin A. Knockdown of individual CyP subtypes revealed CyP40, in addition to CyPA and CyPB, contributed to viral replication, and CsA-resistant replicons acquired independence from CyPA for efficient replication. These data provide important evidence on the mechanisms underlying the regulation of HCV replication by CyP and for designing novel and specific anti-HCV strategies with CPIs.

  13. Water Remedial Investigation Report, Version 2.2. Volume 2

    Science.gov (United States)

    1989-03-01

    aaa-a M!a 1 ý1!lýlýl 1 l P a~~~ a m-- m m I" ; i4 s: - :a o at lmemot 4 em: W! me Ili -ý Ot At on emt:ý I! ISO -- -t~ -t utmmmm -t -t -t emt -- t eq...mm em mm m1 mmý IN eý 4 "! mý4 ! l 0 emo -- P p 40 ISO ------ a* do 2sgaI- w im 0;C 01O- - - #0’ - - . Is:111 ’t,"ý i 9: t a 4ýWt l "n4i Wt1":7 p...13) Water Level 26143 5175.9 26145 -999.9 27002 5095.3 27003 5098.0 27004 5093.9 27005 5094.1 27006 5094.2 27007 5095.2 27008 5095.3 27009 5095.7

  14. Fasting metabolism modulates the interleukin-12/interleukin-10 cytokine axis.

    Directory of Open Access Journals (Sweden)

    Johannes J Kovarik

    Full Text Available A crucial role of cell metabolism in immune cell differentiation and function has been recently established. Growing evidence indicates that metabolic processes impact both, innate and adaptive immunity. Since a down-stream integrator of metabolic alterations, mammalian target of rapamycin (mTOR, is responsible for controlling the balance between pro-inflammatory interleukin (IL-12 and anti-inflammatory IL-10, we investigated the effect of upstream interference using metabolic modulators on the production of pro- and anti-inflammatory cytokines. Cytokine release and protein expression in human and murine myeloid cells was assessed after toll-like receptor (TLR-activation and glucose-deprivation or co-treatment with 5'-adenosine monophosphate (AMP-activated protein kinase (AMPK activators. Additionally, the impact of metabolic interference was analysed in an in-vivo mouse model. Glucose-deprivation by 2-deoxy-D-glucose (2-DG increased the production of IL-12p40 and IL-23p19 in monocytes, but dose-dependently inhibited the release of anti-inflammatory IL-10. Similar effects have been observed using pharmacological AMPK activation. Consistently, an inhibition of the tuberous sclerosis complex-mTOR pathway was observed. In line with our in vitro observations, glycolysis inhibition with 2-DG showed significantly reduced bacterial burden in a Th2-prone Listeria monocytogenes mouse infection model. In conclusion, we showed that fasting metabolism modulates the IL-12/IL-10 cytokine balance, establishing novel targets for metabolism-based immune-modulation.

  15. Fasting metabolism modulates the interleukin-12/interleukin-10 cytokine axis

    Science.gov (United States)

    Kernbauer, Elisabeth; Hölzl, Markus A.; Hofer, Johannes; Gualdoni, Guido A.; Schmetterer, Klaus G.; Miftari, Fitore; Sobanov, Yury; Meshcheryakova, Anastasia; Mechtcheriakova, Diana; Witzeneder, Nadine; Greiner, Georg; Ohradanova-Repic, Anna; Waidhofer-Söllner, Petra; Säemann, Marcus D.; Decker, Thomas

    2017-01-01

    A crucial role of cell metabolism in immune cell differentiation and function has been recently established. Growing evidence indicates that metabolic processes impact both, innate and adaptive immunity. Since a down-stream integrator of metabolic alterations, mammalian target of rapamycin (mTOR), is responsible for controlling the balance between pro-inflammatory interleukin (IL)-12 and anti-inflammatory IL-10, we investigated the effect of upstream interference using metabolic modulators on the production of pro- and anti-inflammatory cytokines. Cytokine release and protein expression in human and murine myeloid cells was assessed after toll-like receptor (TLR)-activation and glucose-deprivation or co-treatment with 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) activators. Additionally, the impact of metabolic interference was analysed in an in-vivo mouse model. Glucose-deprivation by 2-deoxy-D-glucose (2-DG) increased the production of IL-12p40 and IL-23p19 in monocytes, but dose-dependently inhibited the release of anti-inflammatory IL-10. Similar effects have been observed using pharmacological AMPK activation. Consistently, an inhibition of the tuberous sclerosis complex-mTOR pathway was observed. In line with our in vitro observations, glycolysis inhibition with 2-DG showed significantly reduced bacterial burden in a Th2-prone Listeria monocytogenes mouse infection model. In conclusion, we showed that fasting metabolism modulates the IL-12/IL-10 cytokine balance, establishing novel targets for metabolism-based immune-modulation. PMID:28742108

  16. Light ion reaction mechanisms and nuclear structure

    International Nuclear Information System (INIS)

    Robson, B.A.

    1986-01-01

    Of the many contributions to the subject 'Light ion reaction mechanism and nuclear structure', a few are selected and reviewed which highlight the present state of the field. Some contributions to the conference dealing with nuclear interactions are briefly outlined in the second section following an introductory section. Lane model calculations are compared with data for 9 Be and results are given showing angular distributions of the cross sections, the analyzing powers and the spin-rotation parameters for p - 40 Ca. Real central potential for d + 32 s resulting from the FB-analysis are compared with frozen density folding and delta-function folding. The third section deals with reaction mechanism. Data are cited which show near-side and far-side contributions to the calculated analyzing powers in the 116 Sn(d,p) 117 Sn (11.2 - ) transition. Calculations are compared with experimental A y and -(A yy + 2)/3. Also given are measurements of the cross sections and analyzing powers of the continuum energy spectra for the 58 Ni(p,p'x), along with relations between the analyzing powers and momentum transfer. The fourth section addresses nuclear structure. Cross sections and analyzing powers measured at 22 MeV for the reaction 208 Pb(p,t) 206 Pb(3 2 + ) are cited and considered. (Nogami, K.)

  17. Genetic polymorphism and immune response to tuberculosis in indigenous populations: a brief review

    Directory of Open Access Journals (Sweden)

    Renata Maronna Praça Longhi

    Full Text Available We systematically reviewed studies of the immune response to tuberculosis and the genetic polymorphisms associated with Th1-or Th2-mediated cytokine expression in indigenous populations. A bibliographic search was performed on the Medline and ISI databases and included studies published between January 1980 and October 2011. The search terms were tuberculosis, American Indians, Amerindian, indigenous, Indians, native people, aboriginal, immun*, host immune, immune response, cytokine*, polymorphism*, and gene. Regardless of their design, studies that evaluated immunoglobulin, cytokine levels and genetic polymorphisms that altered cytokine expression were included. Thirteen studies met the inclusion criteria. The majority of studies were performed in Latin America, and five investigated the Warao ethnic group of Venezuela. Most of the investigations indirectly evaluated the immune response. Higher anergy to the tuberculin skin test, higher IgG4 and IgM levels, higher IL-5 production and lower TNF-a, IL-12p40 and IFN-I production were found in the indigenous populations. The studies also reported a predominantly Th2-type response in these populations and a possibly higher susceptibility to tuberculosis. A better understanding of the relevant genetic polymorphisms and their role in immune regulation would help to clarify the immunogenetic mechanisms of TB infection in these populations. This information would be useful for identifying new treatments and preventing infection and progression to active disease.

  18. Estradiol treatment in preadolescent females enhances adolescent spatial memory and differentially modulates hippocampal region-specific phosphorylated ERK labeling.

    Science.gov (United States)

    Wartman, Brianne C; Keeley, Robin J; Holahan, Matthew R

    2012-10-24

    Estrogen levels in rats are positively correlated with enhanced memory function and hippocampal dendritic spine density. There is much less work on the long-term effects of estradiol manipulation in preadolescent rats. The present work examined how injections of estradiol during postnatal days 19-22 (p19-22; preadolescence) affected water maze performance and hippocampal phosphorylated ERK labeling. To investigate this, half of the estradiol- and vehicle-treated female rats were trained on a water maze task 24h after the end of estradiol treatment (p23-27) while the other half was not trained. All female rats were tested on the water maze from p40 to p44 (adolescence) and hippocampal pERK1/2 labeling was assessed as a putative marker of neuronal plasticity. During adolescence, preadolescent-trained groups showed lower latencies than groups without preadolescent training. Retention data revealed lower latencies in both estradiol groups, whether preadolescent trained or not. Immunohistochemical detection of hippocampal pERK1/2 revealed elevations in granule cell labeling associated with the preadolescent trained groups and reductions in CA1 labeling associated with estradiol treatment. These results show a latent beneficial effect of preadolescent estradiol treatment on adolescent spatial performance and suggest an organizational effect of prepubescent exogenously applied estradiol. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. IL-22 is required for Th17 cell-mediated pathology in a mouse model of psoriasis-like skin inflammation.

    Science.gov (United States)

    Ma, Hak-Ling; Liang, Spencer; Li, Jing; Napierata, Lee; Brown, Tom; Benoit, Stephen; Senices, Mayra; Gill, Davinder; Dunussi-Joannopoulos, Kyriaki; Collins, Mary; Nickerson-Nutter, Cheryl; Fouser, Lynette A; Young, Deborah A

    2008-02-01

    Psoriasis is a chronic skin disease resulting from the dysregulated interplay between keratinocytes and infiltrating immune cells. We report on a psoriasis-like disease model, which is induced by the transfer of CD4(+)CD45RB(hi)CD25(-) cells to pathogen-free scid/scid mice. Psoriasis-like lesions had elevated levels of antimicrobial peptide and proinflammatory cytokine mRNA. Also, similar to psoriasis, disease progression in this model was dependent on the p40 common to IL-12 and IL-23. To investigate the role of IL-22, a Th17 cytokine, in disease progression, mice were treated with IL-22-neutralizing antibodies. Neutralization of IL-22 prevented the development of disease, reducing acanthosis (thickening of the skin), inflammatory infiltrates, and expression of Th17 cytokines. Direct administration of IL-22 into the skin of normal mice induced both antimicrobial peptide and proinflammatory cytokine gene expression. Our data suggest that IL-22, which acts on keratinocytes and other nonhematopoietic cells, is required for development of the autoreactive Th17 cell-dependent disease in this model of skin inflammation. We propose that IL-22 antagonism might be a promising therapy for the treatment of human psoriasis.

  20. IL-22 is required for Th17 cell–mediated pathology in a mouse model of psoriasis-like skin inflammation

    Science.gov (United States)

    Ma, Hak-Ling; Liang, Spencer; Li, Jing; Napierata, Lee; Brown, Tom; Benoit, Stephen; Senices, Mayra; Gill, Davinder; Dunussi-Joannopoulos, Kyriaki; Collins, Mary; Nickerson-Nutter, Cheryl; Fouser, Lynette A.; Young, Deborah A.

    2008-01-01

    Psoriasis is a chronic skin disease resulting from the dysregulated interplay between keratinocytes and infiltrating immune cells. We report on a psoriasis-like disease model, which is induced by the transfer of CD4+CD45RBhiCD25– cells to pathogen-free scid/scid mice. Psoriasis-like lesions had elevated levels of antimicrobial peptide and proinflammatory cytokine mRNA. Also, similar to psoriasis, disease progression in this model was dependent on the p40 common to IL-12 and IL-23. To investigate the role of IL-22, a Th17 cytokine, in disease progression, mice were treated with IL-22–neutralizing antibodies. Neutralization of IL-22 prevented the development of disease, reducing acanthosis (thickening of the skin), inflammatory infiltrates, and expression of Th17 cytokines. Direct administration of IL-22 into the skin of normal mice induced both antimicrobial peptide and proinflammatory cytokine gene expression. Our data suggest that IL-22, which acts on keratinocytes and other nonhematopoietic cells, is required for development of the autoreactive Th17 cell–dependent disease in this model of skin inflammation. We propose that IL-22 antagonism might be a promising therapy for the treatment of human psoriasis. PMID:18202747

  1. Selected Chemical Properties of Soybean Rhizosphere Soil as Influenced by Cropping Systems, Rhizobium Inoculation, and the Supply of Phosphorus and Potassium after Two Consecutive Cropping Seasons

    Directory of Open Access Journals (Sweden)

    Daniel Nyoki

    2018-01-01

    Full Text Available The field experiment was carried out in northern Tanzania to assess the effects of intercropping systems, Rhizobium inoculation, and fertilization with P and K on chemical properties of soybean rhizosphere soil. The experiment was laid out in split-split plot design with 2 × 4 × 7 factorial arrangement replicated thrice. The main plots had two inoculation treatments and the subplots were comprised of four cropping systems which were sole maize, sole soybean, and two intercropping at different soybean spacing (75 × 20 and 75 × 40 cm. The fertilizer levels (kg/ha control (0 kg/ha; 20 K; 40 K; 26 P; 52 P; 26 P + 20 K; and 52 P + 40 K were assigned to sub-subplots. Statistical analysis was performed using ANOVA. Least Significant Difference was used to compare treatment means at p=0.05 significance level. The results indicated that rhizosphere soil chemical properties such as pH, organic carbon (OC, and macro- and micronutrients (N, P, Ca, Mg, and Na and Fe, Cu, Mn, and Zn, resp. were significantly increased in the Rhizobium inoculated soybean over the control. The supply of P and K fertilizers significantly increased the rhizosphere content of macronutrients (P, K, Ca, and Mg and also they altered the pH and EC of the rhizosphere soil relative to control.

  2. Heat Transfer and Thermal Stability of Alternative Aircraft Fuels. Volume 2. Appendices.

    Science.gov (United States)

    1983-11-01

    M..?- hiP *f Z 00 0 ca aa o eo caonea c ca ainoa~ P4 tei .. *4 * a "t magma ma m P4s g6. a4 W. .WasI....ft A. ....... ......". ftA ftN " I e o 0 P4 Cd...4N0 N IN*.* w* "INSN* A .1. ftA F*#%*f, N..* N. IN W . W *0 a- ~ oc . a C*-00Cj- yF r. .4L 0 P o 0O n9. 0 z L, .LN *~ ~~~ aoo o oa c a o 00oa e O...a 0 000 ,aCd404I n0 0ap - n 7I nr 4e FMd ~ ~ W d d 0 0 r-aieP40a e Ci.0c 0 4,0 0 . ee . o e.. eo.ee O e NO 4 00OC~P WW C4 W ~ p- * ~ ~ ~~~~1 VO

  3. Intracerebroventricular kainic acid administration to neonatal rats alters interneuron development in the hippocampus.

    Science.gov (United States)

    Dong, Hongxin; Csernansky, Cynthia A; Chu, Yunxiang; Csernansky, John G

    2003-10-10

    The effects of neonatal exposure to excitotoxins on the development of interneurons have not been well characterized, but may be relevant to the pathogenesis of neuropsychiatric disorders. In this study, the excitotoxin, kainic acid (KA) was administered to rats at postnatal day 7 (P7) by intracerebroventricular (i.c.v.) infusion. At P14, P25, P40 and P60, Nissl staining and immunohistochemical studies with the interneuron markers, glutamic acid decarboxylase (GAD-67), calbindin-D28k (CB) and parvalbumin (PV) were performed in the hippocampus. In control animals, the total number of interneurons, as well as the number of interneurons stained with GAD-67, CB and PV, was nearly constant from P14 through P60. In KA-treated rats, Nissl staining, GAD-67 staining, and CB staining revealed a progressive decline in the overall number of interneurons in the CA1 and CA3 subfields from P14 to P60. In contrast, PV staining in KA-treated rats showed initial decreases in the number of interneurons in the CA1 and CA3 subfields at P14 followed by increases that approached control levels by P60. These results suggest that, in general, early exposure to the excitotoxin KA decreases the number of hippocampal interneurons, but has a more variable effect on the specific population of interneurons labeled by PV. The functional impact of these changes may be relevant to the pathogenesis of neuropsychiatric disorders, such as schizophrenia.

  4. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    International Nuclear Information System (INIS)

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus

  5. Cutting edge: A critical functional role for IL-23 in psoriasis.

    Science.gov (United States)

    Tonel, Giulia; Conrad, Curdin; Laggner, Ute; Di Meglio, Paola; Grys, Katarzyna; McClanahan, Terrill K; Blumenschein, Wendy M; Qin, Jian-Zhong; Xin, Hong; Oldham, Elizabeth; Kastelein, Robert; Nickoloff, Brian J; Nestle, Frank O

    2010-11-15

    Interleukin-23 is a key cytokine involved in the generation of Th17 effector cells. Clinical efficacy of an anti-p40 mAb blocking both IL-12 and IL-23 and disease association with single nucleotide polymorphisms in the IL23R gene raise the question of a functional role of IL-23 in psoriasis. In this study, we provide a comprehensive analysis of IL-23 and its receptor in psoriasis and demonstrate its functional importance in a disease-relevant model system. The expression of IL-23 and its receptor was increased in the tissues of patients with psoriasis. Injection of a mAb specifically neutralizing human IL-23 showed IL-23-dependent inhibition of psoriasis development comparable to the use of anti-TNF blockers in a clinically relevant xenotransplant mouse model of psoriasis. Together, our results identify a critical functional role for IL-23 in psoriasis and provide the rationale for new treatment strategies in chronic epithelial inflammatory disorders.

  6. A pragmatic trial in the Rio de Janeiro subway to capture smokers for a quitline: methodological challenges and opportunities.

    Science.gov (United States)

    Szklo, André Salem; da Silva Freire Coutinho, Evandro; Reichenheim, Michael Eduardo

    2012-01-01

    According to the World Health Organization, smoking is an important cause of death worldwide. To encourage smoking cessation, persuasive messages can be used to raise smokers' risk perception. This article discusses challenges and solutions in designing a study to evaluate the effect of two different communication strategies ("gains from quitting" vs. "losses from continuing smoking") in encouraging calls to a quitline. The authors conducted an intervention study in two subway stations for 4 weeks, considering only 1 strategy per station. Large posters containing non-age-specific images and texts, on the basis of the theme"shortness of breath," were displayed on central dividing columns on the boarding platforms. Call rates from the selected stations, and respective rate ratios, overall and per study week, were calculated. Passengers who were smokers, exposed to the positive-content message, called on average 1.7 times more often than did those exposed to the negative-content message (p = .01). Moreover, call rate ratios did not decline over the 4 weeks of the study (p = .40). The effectiveness findings suggest that antismoking campaigns could use positive-content messages in order to recruit a larger smoker population. The proposed methodology can also be used to evaluate effectiveness of messages for "capturing" individuals with other health problems (e.g., alcohol abuse), thereby increasing its potential impact.

  7. The role of oxidative stress and NADPH oxidase in the pathogenesis of atherosclerosis

    Directory of Open Access Journals (Sweden)

    Dorota Bryk

    2017-01-01

    Full Text Available Reactive oxygen species (ROS play a key role in the pathogenesis of atherosclerosis. The main mechanisms which are involved are low-density lipoprotein oxidative modification, inactivation of nitric oxide and modulation of redox-sensitive signaling pathways. ROS contribute to several aspects of atherosclerosis including endothelial cell dysfunction, monocyte/macrophage recruitment and activation, stimulation of inflammation, and inducing smooth muscle cell migration and proliferation. NADPH oxidase is the main source of ROS in the vasculature. This enzyme consists of a membrane-bound heterodimer of gp91phox and p22phox, cytosolic regulatory subunits p47phox, p67phox and p40phox, and small GTP-binding proteins rac1 and rac 2. Seven distinct isoforms of this enzyme have been identified, of which four (NOX1, 2, 4 and 5 may have cardiovascular function. In this paper, we review the current state of knowledge concerning the role of oxidative stress and NOX enzymes in pathogenesis of atherosclerosis. Moreover, we analyze the experimental studies that explore the relationship between the NOX family and atherosclerosis.

  8. The central nervous system environment controls effector CD4+ T cell cytokine profile in experimental allergic encephalomyelitis

    DEFF Research Database (Denmark)

    Krakowski, M L; Owens, T

    1997-01-01

    In experimental allergic encephalomyelitis (EAE), CD4+ T cells infiltrate the central nervous system (CNS). We derived CD4+ T cell lines from SJL/J mice that were specific for encephalitogenic myelin basic protein (MBP) peptides and produced both Th1 and Th2 cytokines. These lines transferred EAE...... to naive mice. Peptide-specific cells re-isolated from the CNS only produced Th1 cytokines, whereas T cells in the lymph nodes produced both Th1 and Th2 cytokines. Mononuclear cells isolated from the CNS, the majority of which were microglia, presented antigen to and stimulated MBP-specific T cell lines...... in vitro. Although CNS antigen-presenting cells (APC) supported increased production of interferon (IFN)-gamma mRNA by these T cells, there was no increase in the interleukin (IL)-4 signal, whereas splenic APC induced increases in both IFN-gamma and IL-4. mRNA for IL-12 (p40 subunit) was up...

  9. Different effects of high- and low-dose phenobarbital on post-stroke seizure suppression and recovery in immature CD1 mice

    Science.gov (United States)

    Markowitz, Geoffrey J.; Kadam, Shilpa D.; Smith, Dani R.; Johnston, Michael V.; Comi, Anne M.

    2011-01-01

    Neonatal stroke presents with seizures that are usually treated with phenobarbital. We hypothesized that anticonvulsants would attenuate ischemic injury, but that the dose-dependent effects of standard anticonvulsants would impact important age-dependent and injury-dependent consequences. In this study, ischemia induced by unilateral carotid ligation in postnatal day 12 (P12) CD1 mice was immediately followed by an i.p. dose of vehicle, low-dose or high-dose phenobarbital. Severity of acute behavioral seizures was scored. 5-bromo-2’-deoxyuridine (BrdU) was administered from P18-P20, behavioral testing performed, and mice perfused at P40. Atrophy quantification and counts of BrdU/NeuN-labeled cells in the dentate gyrus were performed. Blood phenobarbital concentrations were measured. 30 mg/kg phenobarbital reduced acute seizures and chronic brain injury, and restored normal weight gain and exploratory behavior. By comparison, 60 mg/kg was a less efficacious anticonvulsant, was not neuroprotective, did not restore normal weight gain, and impaired behavioral and cognitive recovery. Hippocampal neurogenesis was not different between treatment groups. These results suggest a protective effect of lower-dose phenobarbital, but a lack of this effect at higher concentrations after stroke in P12 mice. PMID:21481568

  10. Murine bone marrow-derived mesenchymal stem cells as vehicles for interleukin-12 gene delivery into Ewing sarcoma tumors.

    Science.gov (United States)

    Duan, Xiaoping; Guan, Hui; Cao, Ying; Kleinerman, Eugenie S

    2009-01-01

    This study evaluated the therapeutic efficacy of interleukin 12 (IL-12) gene therapy in Ewing sarcoma and whether murine mesenchymal stem cells (MSCs) could serve as vehicles for IL-12 gene delivery. MSCs were isolated from murine bone marrow cells. Cells were phenotyped using flow cytometry. Cultured MSCs differentiated into osteocytes and adipocytes using the appropriate media. Freshly isolated MSCs were transfected with adenoviral vectors containing either the beta-galactosidase (Ad:beta-gal) or the IL-12 (Ad:IL-12) gene. Expression of IL-12 was confirmed using reverse transcription polymerase chain reaction. Mice with TC71 Ewing sarcoma tumors were then treated intravenously with MSCs transfected with Ad:beta-gal or Ad:IL-12. Tumors were measured and analyzed by immunohistochemical analysis for expression of IL-12 protein. Expression of both p35 and p40 IL-12 subunits was demonstrated in MSCs transfected in vitro with Ad:IL-12. IL-12 expression was seen in tumors from mice treated with MSCs transfected with Ad:IL-12. Tumor growth was also significantly inhibited compared with that in mice treated with MSCs transfected with Ad:beta-gal. MSCs can be transfected with the IL-12 gene. These transfected cells localize to tumors after intravenous injection and induce local IL-12 protein production and the regression of established tumors. Copyright (c) 2008 American Cancer Society.

  11. Effect of selective hepatic inflow occlusion during liver cancer resection on liver ischemia-reperfusion injury

    Directory of Open Access Journals (Sweden)

    Yin-Tian Deng

    2016-11-01

    Full Text Available Objective: To study the effect of selective hepatic inflow occlusion during liver cancer resection on liver ischemia-reperfusion injury. Methods: A total of 68 patients with primary liver cancer who underwent left liver resection in our hospital between May 2012 and August 2015 were selected for study and divided into group A (selective hepatic inflow occlusion of left liver and group B (Prignle hepatic inflow occlusion according to different intraoperative blood occlusion methods, serum was collected before and after operation to determine liver enzyme content, the removed liver tissue was collected to determine energy metabolism indexes, inflammation indexes and oxidative stress indexes. Results: 1 d, 3 d and 5 d after operation, GPT, GOT, GGT, LDH and ALP content in serum of both groups were significantly higher than those before operation, and GPT, GOT, GGT, LDH and ALP content in serum of group A 1 d, 3 d and 5 d after operation were significantly lower than those of group B; ATP, ADP, AMP, PI3K, AKT, GSK3β, T-AOC, PrxI and Trx content in liver tissue of group A were significantly higher than those of group B while PTEN, IL-12p40, MDA and MPO content were significantly lower than those of group B. Conclusions: Selective hepatic inflow occlusion during liver cancer resection can reduce the liver ischemia-reperfusion injury, improve the energy metabolism of liver cells and inhibit inflammation and oxidative stress in liver tissue.

  12. Free-energy calculations for semi-flexible macromolecules: Applications to DNA knotting and looping

    International Nuclear Information System (INIS)

    Giovan, Stefan M.; Scharein, Robert G.; Hanke, Andreas; Levene, Stephen D.

    2014-01-01

    We present a method to obtain numerically accurate values of configurational free energies of semiflexible macromolecular systems, based on the technique of thermodynamic integration combined with normal-mode analysis of a reference system subject to harmonic constraints. Compared with previous free-energy calculations that depend on a reference state, our approach introduces two innovations, namely, the use of internal coordinates to constrain the reference states and the ability to freely select these reference states. As a consequence, it is possible to explore systems that undergo substantially larger fluctuations than those considered in previous calculations, including semiflexible biopolymers having arbitrary ratios of contour length L to persistence length P. To validate the method, high accuracy is demonstrated for free energies of prime DNA knots with L/P = 20 and L/P = 40, corresponding to DNA lengths of 3000 and 6000 base pairs, respectively. We then apply the method to study the free-energy landscape for a model of a synaptic nucleoprotein complex containing a pair of looped domains, revealing a bifurcation in the location of optimal synapse (crossover) sites. This transition is relevant to target-site selection by DNA-binding proteins that occupy multiple DNA sites separated by large linear distances along the genome, a problem that arises naturally in gene regulation, DNA recombination, and the action of type-II topoisomerases

  13. Free-energy calculations for semi-flexible macromolecules: Applications to DNA knotting and looping

    Energy Technology Data Exchange (ETDEWEB)

    Giovan, Stefan M. [Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, Texas 75083 (United States); Scharein, Robert G. [Hypnagogic Software, Vancouver, British Columbia V6K 1V6 (Canada); Hanke, Andreas [Department of Physics and Astronomy, University of Texas at Brownsville, Brownsville, Texas 78520 (United States); Levene, Stephen D., E-mail: sdlevene@utdallas.edu [Department of Molecular and Cell Biology, University of Texas at Dallas, Richardson, Texas 75083 (United States); Department of Bioengineering, University of Texas at Dallas, Richardson, Texas 75083 (United States); Department of Physics, University of Texas at Dallas, Richardson, Texas 75083 (United States)

    2014-11-07

    We present a method to obtain numerically accurate values of configurational free energies of semiflexible macromolecular systems, based on the technique of thermodynamic integration combined with normal-mode analysis of a reference system subject to harmonic constraints. Compared with previous free-energy calculations that depend on a reference state, our approach introduces two innovations, namely, the use of internal coordinates to constrain the reference states and the ability to freely select these reference states. As a consequence, it is possible to explore systems that undergo substantially larger fluctuations than those considered in previous calculations, including semiflexible biopolymers having arbitrary ratios of contour length L to persistence length P. To validate the method, high accuracy is demonstrated for free energies of prime DNA knots with L/P = 20 and L/P = 40, corresponding to DNA lengths of 3000 and 6000 base pairs, respectively. We then apply the method to study the free-energy landscape for a model of a synaptic nucleoprotein complex containing a pair of looped domains, revealing a bifurcation in the location of optimal synapse (crossover) sites. This transition is relevant to target-site selection by DNA-binding proteins that occupy multiple DNA sites separated by large linear distances along the genome, a problem that arises naturally in gene regulation, DNA recombination, and the action of type-II topoisomerases.

  14. PREVALENCE OF ANAEMIA AMONG RURAL PRE-SCHOOL CHILDREN OF MAHARASHTRA, INDIA

    Directory of Open Access Journals (Sweden)

    N Arlappa

    2012-03-01

    Full Text Available Background: Anaemia continues to be a severe public health nutritional problem in India affecting all physiological groups, even after the National Nutritional Anaemia Prophylaxis Programme has been in operation for more than three decades. Objective: To assess the prevalence of anaemia among rural pre-school (1-5-years children of Maharashtra. Methods: A community based cross-sectional study was carried by National Nutrition Monitoring Bureau (NNMB covering a total of 404 (Boys-243; Girls-161 pre-school children. Information of socio-demographic particulars was obtained and the finger prick blood samples were collected for the estimation of haemoglobin levels by cyanmethmoglobin method. Results: The result shows that 59.2 % (CI: 54.4-64.0 of the rural pre-school children of Maharashtra were anaemic, and the prevalence was significantly (p40% among rural pre-school children of Maharashtra. Therefore, appropriate intervention measures such as supplementary iron & folic acid, periodic deworming and health & nutrition education should be strengthened. The community needs to be encouraged to diversify their diets by consuming iron rich foods.

  15. [Relationships between psychological well-being, lifestyle factors and fertility].

    Science.gov (United States)

    Lakatos, Enikő; Szabó, Gábor; F Szigeti, Judit; Balog, Piroska

    2015-03-22

    10 to 15% of the Hungarian fertile age population struggles with reproductivity problems. Previous researches have shown that psychological well-being and lifestyle factors play a pivotal role in overall health status, which is closely related to fertility. The aim of the study was to examine fertility-related psychological and lifestyle factors in a Hungarian sample. 194 women (115 infertile and 79 fertile) took part in the study. Standardized, validated questionnaires were used for the assessment of psychological factors and self-administered questions were used for exploring lifestyle factors. The results show that infertile women are younger (33.98±4.89 vs. 36.43±5.81 years, pfertile counterparts. The number of their depressive (BDI 14.00±12.21 vs. 7.79±9.17, p40.25±10.65, pfertile women. Findings related to lifestyle factors show that lower level of fluid consumption (1.71±0.67 vs. 1.95±0.68, pfertile group (OR = 1.65, CI = 2.58-1.06), independently of body mass index and age. The results confirm the findings of international researches showing that women struggling with infertility are in worse psychological condition than their fertile counterparts. The authors conclude that the findings demand further investigations and follow-up studies in order to more specifically determine the relationship between fluid consumption and fertility.

  16. Spin-orbit coupling and transport in strongly correlated two-dimensional systems

    Science.gov (United States)

    Huang, Jian; Pfeiffer, L. N.; West, K. W.

    2017-05-01

    Measuring the magnetoresistance (MR) of ultraclean GaAs two-dimensional holes for a large rs range of 20-50, two striking behaviors in relation to the spin-orbit coupling (SOC) emerge in response to strong electron-electron interaction. First, in exact correspondence to the zero-field metal-to-insulator transition (MIT), the sign of the MR switches from being positive in the metallic regime to being negative in the insulating regime when the carrier density crosses the critical density pc of MIT (rs˜39 ). Second, as the SOC-driven correction Δ ρ to the MR decreases with reducing carrier density (or the in-plane wave vector), it exhibits an upturn in the close proximity just above pc where rs is beyond 30, indicating a substantially enhanced SOC effect. This peculiar behavior echoes with a trend of delocalization long suspected for the SOC-interaction interplay. Meanwhile, for p 40 , in contrast to the common belief that a magnet field enhances Wigner crystallization, the negative MR is likely linked to enhanced interaction.

  17. Synthesis and biological investigation of PIM mimics carrying biotin or a fluorescent label for cellular imaging.

    Science.gov (United States)

    Front, Sophie; Bourigault, Marie-Laure; Rose, Stéphanie; Noria, Ségueni; Quesniaux, Valérie F J; Martin, Olivier R

    2013-01-16

    Phosphatidyl inositol mannosides (PIMs) are constituents of the mycobacterial cell wall; these glycolipids are known to exhibit potent inhibitory activity toward the LPS-induced production of cytokines by macrophages, and therefore have potential as anti-inflammatory agents. Recently, heterocyclic analogues of PIMs in which the inositol is replaced by a piperidine (aza-PIM mimics) or a tetrahydropyran moiety (oxa-PIM mimics) have been prepared by short synthetic sequences and shown to retain the biological activity of the parent PIM structures. In this investigation, the aza-PIM analogue was used as a convenient scaffold to link biotin or a fluorescent label (tetramethyl-rhodamine) by way of an aminocaproyl spacer, with the goal of using these conjugates for intracellular localization and for the study of the mechanism of their antiinflammatory action. The synthesis of these compounds is reported, as well as the evaluation of their activities as inhibitors of LPS-induced cytokine production by macrophages (TNFα, IL12p40); preliminary investigations by FACS and confocal microscopy indicated that PIM-biotin conjugate binds to macrophage membranes with rapid kinetics.

  18. [A study concerning how much weight schoolchildren carry in their bags, involving four schools in the metropolitan area of Buenos Aires, Argentina].

    Science.gov (United States)

    Laíño, Fernando A; Santa María, Claudio J; Bazán, Nelio E; Mainero, Daniel D

    2013-01-01

    Determining the weight children carry in their bags to school (absolute and relative values) and the distance walked during home-school routes, involving students from four schools in the metropolitan area of Buenos Aires. The study involved 751 primary (4th to 6th grades) and secondary (1st to 3rd years) level students who were attending three private schools and one public one. Body and bag weights were measured and the children were asked about the distance (in blocks) they walked from school to home. The study involved a descriptive analysis and contrasted the students by gender, educational level, type of school and grade or year. Possible associations between variables were ascertained. The group was divided into those carrying bags weighing less than 10% of their body weight and those who carrying 10% (considered a critical value) and more; frequencies were calculated by the type of bag being used. 68% of the sample were carrying 10% or more of their body weight (P42=10.13%): 66% in male (P44=10.12%) and 60% in female children (P40=10.2%). Private school students carried more weight than public school children (p<0.05) and younger students carried a greater weight than older students (p<0.05) in both educational levels. Most children were carrying relative weights well above that recommended and female students were most affected. Younger students carried higher absolute and relative weights.

  19. Three Gaseous Neurotransmitters, Nitric oxide, Carbon Monoxide, and Hydrogen Sulfide, Are Involved in the Neurogenic Relaxation Responses of the Porcine Internal Anal Sphincter.

    Science.gov (United States)

    Folasire, Oladayo; Mills, Kylie A; Sellers, Donna J; Chess-Williams, Russ

    2016-01-31

    The internal anal sphincter (IAS) plays an important role in maintaining continence and a number of neurotransmitters are known to regulate IAS tone. The aim of this study was to determine the relative importance of the neurotransmitters involved in the relaxant and contractile responses of the porcine IAS. Responses of isolated strips of IAS to electrical field stimulation (EFS) were obtained in the absence and presence of inhibitors of neurotransmitter systems. Contractile responses of the sphincter to EFS were unaffected by the muscarinic receptor antagonist, atropine (1 μM), but were almost completely abolished by the adrenergic neuron blocker guanethidine (10 μM). Contractile responses were also reduced (by 45% at 5 Hz, P 40-50% reduction), zinc protoprophyrin IX (10 μM), an inhibitor of carbon monoxide synthesis (20-40% reduction), and also propargylglycine (30 μM) and aminooxyacetic acid (30 μM), inhibitors of hydrogen sulphide synthesis (15-20% reduction). Stimulation of IAS efferent nerves releases excitatory and inhibitory neurotransmitters: noradrenaline is the predominant contractile transmitter with a smaller component from ATP, whilst 3 gases mediate relaxation responses to EFS, with the combined contributions being nitric oxide > carbon monoxide > hydrogen sulfide.

  20. Neonatal plasmacytoid dendritic cells (pDCs display subset variation but can elicit potent anti-viral innate responses.

    Directory of Open Access Journals (Sweden)

    Xiaoming Zhang

    Full Text Available Neonates are highly susceptible to infectious diseases and defective antiviral pDC immune responses have been proposed to contribute to this phenomenon. Isolated cord blood pDCs innately responded to a variety of TLR7 and TLR9 dependent viruses, including influenza A virus (IAV, human immunodeficiency virus (HIV or herpes-simplex virus (HSV by efficiently producing IFN-α, TNF-α as well as chemokines. Interestingly, following activation by CpGA, but not viruses, cord pDCs tend to survive less efficiently. We found that a hallmark of pDCs in neonates is an extended CD2+pDCs compartment compared to adult pDCs without affecting the antiviral IFN-α response. Within CD2+pDCs, we identified a subpopulation expressing CD5 and responsible for IL-12p40 production, however this population is significantly decreased in cord blood compared to adult blood. Therefore, neonatal pDCs clearly display variation in phenotype and subset composition, but without major consequences for their antiviral responses.

  1. A cohort mortality study of lead-exposed workers in the USA, Finland and the UK.

    Science.gov (United States)

    Steenland, Kyle; Barry, Vaughn; Anttila, Ahti; Sallmén, Markku; McElvenny, Damien; Todd, A C; Straif, Kurt

    2017-11-01

    To investigate further whether inorganic lead is a carcinogen among adults, or associated with increased blood pressure and kidney damage, via a large mortality study. We conducted internal analyses via Cox regression of mortality in three cohorts of lead-exposed workers with blood lead (BL) data (USA, Finland, UK), including over 88 000 workers and over 14 000 deaths. Our exposure metric was maximum BL. We also conducted external analyses using country-specific background rates. The combined cohort had a median BL of 26 µg/dL, a mean first-year BL test of 1990 and was 96% male. Fifty per cent had more than one BL test (mean 7). Significant (p40 µg/dL; for bladder, lung and larynx cancer; and for COPD. In a small subsample of the US cohort (n=115) who were interviewed, we found no association between smoking and BL. We found strong positive mortality trends, with increasing BL level, for several outcomes in internal analysis. Many of these outcomes are associated with smoking, for which we had no data. A borderline trend was found for brain cancer, not associated with smoking. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  2. Biological Characteristics and Medical Treatment of Breast Cancer in Young Women-A Featured Population: Results from the Nora Study

    International Nuclear Information System (INIS)

    Pronzato, P.; Mustacchi, G.; De Matteis, A.; Di Costanzo, F.; Rulli, E.; Floriani, I; Cazzaniga, M.E.

    2011-01-01

    Background. The present paper described the biological characteristics and clinical behavior of young women in the cohort NORA study Patients and Methods. From 2000-2002, patients (N>3500) were enrolled at 77 Italian hospitals. Women aged =50 years (N=1013) were stratified into age groups (=35, 36-40, 41-45, and 46-50 years). The relationship between age and patient characteristics, cancer presentation, and treatment was analyzed. Results. Younger women more frequently had tumors with ER/PgR-negative(x 2 =7.07; P=.008), HER2 amplification (x 2 =5.76; P=.01), and high (≤10%) Ki67 labelling index (x 2 =9.53; P=.002). Positive nodal status, large tumors, and elevated Ki67 all associated with the choice for chemotherapy followed by endocrine therapy in hormone receptor-positive patients (P 40 versus =40, P<.0001, resp.). At multivariate analysis, after adjustment for significant clinical and pathological factors, age remains a significant prognostic variable (HR=0.93, P=.0021). Conclusion. This cohort study suggests that age per se is an important prognostic factor. The restricted role of early diagnosis and the aggressive behavior of cancer in this population make necessary the application of targeted medical strategies crucial. human epidermal growth factor receptor

  3. Polysaccharides from Ganoderma formosanum function as a Th1 adjuvant and stimulate cytotoxic T cell response in vivo.

    Science.gov (United States)

    Pi, Chia-Chen; Chu, Ching-Liang; Lu, Chu-Ying; Zhuang, Yu-Jing; Wang, Cheng-Li; Yu, Yao-Hsuan; Wang, Hui-Yi; Lin, Chih-Chung; Chen, Chun-Jen

    2014-01-09

    The fungus of Ganoderma is a basidiomycete that possesses a variety of pharmacological effects and has been used in traditional Asian medicine for centuries. Ganoderma formosanum is a native Ganoderma species isolated in Taiwan, and we have previously demonstrated that PS-F2, a polysaccharide fraction purified from the submerged culture broth of G. formosanum, exhibits immunostimulatory properties in macrophages. In this study, we further characterized the adjuvant functions of PS-F2. In vitro, PS-F2 stimulated dendritic cells (DCs) to produce proinflammatory cytokines, including TNF-α, interleukin (IL)-6, and IL-12/IL-23 p40. PS-F2 also stimulated DCs to express the maturation markers CD40, CD80, CD86, and MHC class II. In a murine splenocyte culture, PS-F2 treatment resulted in elevated expression of T-bet and interferon (IFN)-γ in T lymphocytes. When used as an adjuvant in vivo with the ovalbumin (OVA) antigen, PS-F2 stimulated OVA-specific antibody production and primed IFN-γ production in OVA-specific T lymphocytes. PS-F2-adjuvated immunization also induced OVA-specific CTLs, which protected mice from a challenge with tumor cells expressing OVA. Collectively, our data show that PS-F2 functions as an adjuvant capable of inducing a Th1-polarized adaptive immune response, which would be useful in vaccines against viruses and tumors. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Production of JET fuel containing molecules of high hydrogen content

    Directory of Open Access Journals (Sweden)

    Tomasek Sz.

    2017-12-01

    Full Text Available The harmful effects of aviation can only be reduced by using alternative fuels with excellent burning properties and a high hydrogen content in the constituent molecules. Due to increasing plastic consumption the amount of the plastic waste is also higher. Despite the fact that landfill plastic waste has been steadily reduced, the present scenario is not satisfactory. Therefore, the aim of this study is to produce JET fuel containing an alternative component made from straight-run kerosene and the waste polyethylene cracking fraction. We carried out our experiments on a commercial NiMo/Al2O3/P catalyst at the following process parameters: T=200-300°C, P=40 bar, LHSV=1.0-3.0 h-1, hydrogen/hydrocarbon ratio= 400 Nm3/m3. We investigated the effects of the feedstocks and the process parameters on the product yields, the hydrodesulfurization and hydrodearomatization efficiencies, and the main product properties. The liquid product yields varied between 99.7-99.8%. As a result of the hydrogenation the sulfur (1-1780 mg/kg and the aromatic contents (9.0-20.5% of the obtained products and the values of their smoke points (26.0-34.7 mm fulfilled the requirements of JET fuel standard. Additionally, the concentration of paraffins increased in the products and the burning properties were also improved. The freezing points of the products were higher than -47°C, therefore product blending is needed.

  5. Thermal stability of nafion membranes under mechanical stress

    Energy Technology Data Exchange (ETDEWEB)

    Quintilii, M; Struis, R [Paul Scherrer Inst. (PSI), Villigen (Switzerland)

    1997-06-01

    The feasibility of adequately modified fluoro-ionomer membranes (NAFION{sup R}) is demonstrated for the selective separation of methanol synthesis products from the raw reactor gas at temperatures around 200{sup o}C. For an economically relevant application of this concept on a technical scale the Nafion membranes should be thin ({approx_equal}10 {mu}m) and thermally stable over a long period of time (1-2 years). In cooperation with industry (Methanol Casale SA, Lugano (CH)), we test the thermal stability of Nafion hollow fibers and supported Nafion thin sheet membranes at temperatures between 160 and 200{sup o}C under mechanical stress by applying a gas pressure difference over the membrane surface ({Delta}P{<=} 40 bar). Tests with the hollow fibers revealed that Nafion has visco-elastic properties. Tests with 50 {mu}m thin Nafion sheets supported by a porous metal carrier at 200{sup o}C and {Delta}P=39 bar showed no mechanical defects over a period of 92 days. (author) 5 figs., 4 refs.

  6. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    Science.gov (United States)

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  7. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Samira Mohammadi

    2017-01-01

    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  8. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients

    Directory of Open Access Journals (Sweden)

    Daniel Eklund

    2013-01-01

    Full Text Available The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB, the bacterium responsible for tuberculosis (TB, has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth.

  9. Role of helminths in regulating mucosal inflammation.

    Science.gov (United States)

    Weinstock, Joel V; Summers, Robert W; Elliott, David E

    2005-09-01

    The rapid rise in prevalence of ulcerative colitis (UC) and Crohn's disease (CD) in highly developed countries suggests that environmental change engenders risk for inflammatory bowel disease (IBD). Eradication of parasitic worms (helminths) through increased hygiene may be one such change that has led to increased prevalence of these diseases. Helminths alter host mucosal and systemic immunity, inhibiting dysregulated inflammatory responses. Animals exposed to helminths are protected from experimental colitis, encephalitis, and diabetes. Patients with CD or UC improve when exposed to whipworm. Lamina propria (LP) mononuclear cells from helminth-colonized mice make less interleukin (IL)-12 p40 and IFN-gamma, but more IL-4, IL-13, IL-10, TGF-beta, and PGE(2) compared to LP mononuclear cells from naive mice. Systemic immune responses show similar skewing toward Th2 and regulatory cytokine production in worm-colonized animal models and humans. Recent reports suggest that helminths induce regulatory T cell activity. These effects by once ubiquitous organisms may have protected individuals from many of the emerging immune-mediated illnesses like IBD, multiple sclerosis, type I diabetes, and asthma.

  10. SMARCB1/INI1/BAF47- deficient pleural malignant mesothelioma with rhabdoid features.

    Science.gov (United States)

    Kimura, Noriko; Hasegawa, Masaru; Hiroshima, Kenzo

    2018-02-01

    Malignant mesothelioma (MM) with rhabdoid features is an MM variant. Fifteen cases have been reported previously, all of which were combined with other types of MM. Herein, we report an autopsy case of pleural MM with monomorphic rhabdoid features. The patient was a 62-year-old male without a history of asbestos exposure. An autopsy revealed a soft, granular tumor that replaced the entire left pleura and had invaded to the diaphragm and lower lobe of the lung. The tumor cells, which had eosinophilic plump cytoplasm and eccentric nuclei, were loosely cohesive. Immunohistochemistry showed that the cells were diffusely positive for calretinin, D2-40, vimentin, CAM5.2, and AE1/AE3; and negative for WT-1, TTF-1, CK7, CEA, desmin, CD34, BCL-2, S100 protein, and p40. Neither homozygous deletion of p16 nor BAP-1 protein loss was observed. Loss of INI1/BAF47 protein, an indicator of malignant rhabdoid tumor, was observed. Therefore, MM with rhabdoid features was confirmed. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  11. Consultant input in acute medical admissions and patient outcomes in hospitals in England: a multivariate analysis.

    Directory of Open Access Journals (Sweden)

    Derek Bell

    Full Text Available Recent recommendations for physicians in the UK outline key aspects of care that should improve patient outcomes and experience in acute hospital care. Included in these recommendations are Consultant patterns of work to improve timeliness of clinical review and improve continuity of care. This study used a contemporaneous validated survey compared with clinical outcomes derived from Hospital Episode Statistics, between April 2009 and March 2010 from 91 acute hospital sites in England to evaluate systems of consultant cover for acute medical admissions. Clinical outcomes studied included adjusted case fatality rates (aCFR, including the ratio of weekend to weekday mortality, length of stay and readmission rates. Hospitals that had an admitting Consultant presence within the Acute Medicine Unit (AMU, or equivalent for a minimum of 4 hours per day (65% of study group had a lower aCFR compared with hospitals that had Consultant presence for less than 4 hours per day (p40 acute medical admissions per day had a lower aCFR compared to hospitals with fewer than 40 admissions per day (p<0.03 and had a lower 7 day re-admission rate (p<0.02. This study is the first large study to explore the potential relationships between systems of providing acute medical care and clinical outcomes. The results show an association between well-designed systems of Consultant working practices, which promote increased patient contact, and improved patient outcomes in the acute hospital setting.

  12. The Natural Stilbenoid Piceatannol Decreases Activity and Accelerates Apoptosis of Human Neutrophils: Involvement of Protein Kinase C

    Directory of Open Access Journals (Sweden)

    Viera Jancinova

    2013-01-01

    Full Text Available Neutrophils are able to release cytotoxic substances and inflammatory mediators, which, along with their delayed apoptosis, have a potential to maintain permanent inflammation. Therefore, treatment of diseases associated with chronic inflammation should be focused on neutrophils; formation of reactive oxygen species and apoptosis of these cells represent two promising targets for pharmacological intervention. Piceatannol, a naturally occurring stilbenoid, has the ability to reduce the toxic action of neutrophils. This substance decreased the amount of oxidants produced by neutrophils both extra- and intracellularly. Radicals formed within neutrophils (fulfilling a regulatory role were reduced to a lesser extent than extracellular oxidants, potentially dangerous for host tissues. Moreover, piceatannol did not affect the phosphorylation of p40phox—a component of NADPH oxidase, responsible for the assembly of functional oxidase in intracellular (granular membranes. The stilbenoid tested elevated the percentage of early apoptotic neutrophils, inhibited the activity of protein kinase C (PKC—the main regulatory enzyme in neutrophils, and reduced phosphorylation of PKC isoforms α, βII, and δ on their catalytic region. The results indicated that piceatannol may be useful as a complementary medicine in states associated with persisting neutrophil activation and with oxidative damage of tissues.

  13. Neural stem cells promote nerve regeneration through IL12-induced Schwann cell differentiation.

    Science.gov (United States)

    Lee, Don-Ching; Chen, Jong-Hang; Hsu, Tai-Yu; Chang, Li-Hsun; Chang, Hsu; Chi, Ya-Hui; Chiu, Ing-Ming

    2017-03-01

    Regeneration of injured peripheral nerves is a slow, complicated process that could be improved by implantation of neural stem cells (NSCs) or nerve conduit. Implantation of NSCs along with conduits promotes the regeneration of damaged nerve, likely because (i) conduit supports and guides axonal growth from one nerve stump to the other, while preventing fibrous tissue ingrowth and retaining neurotrophic factors; and (ii) implanted NSCs differentiate into Schwann cells and maintain a growth factor enriched microenvironment, which promotes nerve regeneration. In this study, we identified IL12p80 (homodimer of IL12p40) in the cell extracts of implanted nerve conduit combined with NSCs by using protein antibody array and Western blotting. Levels of IL12p80 in these conduits are 1.6-fold higher than those in conduits without NSCs. In the sciatic nerve injury mouse model, implantation of NSCs combined with nerve conduit and IL12p80 improves motor recovery and increases the diameter up to 4.5-fold, at the medial site of the regenerated nerve. In vitro study further revealed that IL12p80 stimulates the Schwann cell differentiation of mouse NSCs through the phosphorylation of signal transducer and activator of transcription 3 (Stat3). These results suggest that IL12p80 can trigger Schwann cell differentiation of mouse NSCs through Stat3 phosphorylation and enhance the functional recovery and the diameter of regenerated nerves in a mouse sciatic nerve injury model. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Detergents enhance EspB secretion from Escherichia coli strains harboring the locus for the enterocyte effacement (LEE) gene.

    Science.gov (United States)

    Nakasone, Noboru; Toma, Claudia; Higa, Naomi; Koizumi, Yukiko; Ogura, Yasunori; Suzuki, Toshihiko

    2011-02-01

    The effects of detergents (cholic acid, deoxycholic acid, Triton X-100, and Nonidet P-40) on the secretion of EspB from the locus for enterocyte effacement (LEE) gene-positive Escherichia coli strains were examined. Clinical isolates of eight EPEC strains and seven STEC strains were used to detect EspB after they had been cultivated in Luria-Bertani (LB) broth containing one of the detergents. When the bacteria were cultured in LB broth supplemented with one of the detergents, the amount of EspB produced was increased by 2-32-fold depending on the detergent and the strain used. EspB was detected in all strains when they were cultured in LB broth containing all of the detergents. The results obtained in this study can be applied to immunological diagnostic methods for detecting EspB and also to the production of EspB for research purposes. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. An ultrasonic therapeutic transducers using lead-free Na{sub 0.5}K{sub 0.5}NbO{sub 3}-CuNb{sub 2}O{sub 6} ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Ming-Ru [Department of Electrical Engineering, National Cheng Kung University, Taiwan (China); Chu, Sheng-Yuan, E-mail: chusy@mail.ncku.edu.t [Department of Electrical Engineering, National Cheng Kung University, Taiwan (China); Advanced Optoelectronic Technology Center, National Cheng Kung University, Tainan 701, Taiwan (China); Institute of Nanotechnology and Microsystems Engineering, National Cheng Kung University, Tainan 701, Taiwan (China); Tsai, Cheng-Che [Department of Electronics Engineering and Computer Science, Tung-Fang Institute of Technology, Kaohsiung 829, Taiwan (China)

    2010-10-08

    Research highlights: {yields} In this paper, CN was added to NKN ceramics to decrease the sintering temperature and to improve the density and piezoelectric characteristics. The influence of CuNb{sub 2}O{sub 6} (CN) content on the microstructure, electrical properties, temperature stability, and mechanical properties of the synthesized samples was investigated. Results show that the samples synthesized with CN-doped not only improved the density but also exhibited superior piezoelectric characteristic, temperature stability of resonance frequency (TCF), and elastic stiffness coefficient than those of pure NKN piezoelectric ceramics. {yields} The bulk density (4.47 g/cm{sup 3}), k{sub p} (40%), k{sub t} (45%), Q{sub m} (1642), C{sub 33}{sup D} (19.64 x 10{sup 10} N/m{sup 2}), TCF (-0.011%/{sup o}C) and TCC (0.135%/{sup o}C) values for NKN-01CN ceramics obtained from experiments show excellent 'hard' piezoelectric properties. Furthermore, a lead-free NKN-01CN ultrasonic therapeutic transducer was successfully driven by a self-tuning circuit. - Abstract: In this work, we reports on the CuNb{sub 2}O{sub 6} (CN) modified lead-free Na{sub 0.5}K{sub 0.5}NbO{sub 3} (NKN) based piezoelectric ceramics were synthesized by solid-state reaction methods and sintered at 1075 {sup o}C for 3 h. A secondary phase of K{sub 4}CuNb{sub 8}O{sub 23} was found in the XRD pattern of NKN-based ceramics as the CN dopants is 1 mol%. Microstructural analyses of un-doped and CN-doped ceramics were performed in a scanning electron microscope. The influence of CN content on the microstructure, electrical properties, temperature stability, and mechanical properties of the synthesized ceramics was investigated. The results show that the synthesized ceramics with CN-doped not only had improved density but also exhibited superior piezoelectric characteristics, temperature stability of resonance frequency (TCF), and a better elastic stiffness coefficient than those of pure NKN piezoelectric

  16. KARAKTERISASI GENETIKA RUMPUT LAUT Kappaphycus alvarezii YANG DIBUDIDAYAKAN DI SULAWESI SELATAN

    Directory of Open Access Journals (Sweden)

    Andi Parenrengi

    2016-11-01

    Full Text Available Karakterisasi genetika rumput laut Kappaphycus alvarezii telah dilakukan dengan menggunakan teknik Random Amplified Polymorphic DNA (RAPD dengan tujuan untuk mengetahui variasi genetika rumput laut K. alvarezii dari beberapa lokasi budi daya di Sulawesi Selatan yakni Polmas, Pinrang, Takalar, dan Bantaeng. Sampel dipreservasi dengan menggunakan larutan TNES-Urea sebelum ekstraksi DNA. Ekstraksi genom DNA dilakukan dengan menggunakan metode konvensional fenol-khloroform. Amplifikasi DNA dilakukan dengan teknik Polymerase Chain Reaction (PCR. Untuk dokumentasi riset, hasil PCR dielektroforesis pada agarosa gel dengan menggunakan buffer TBE. Data dianalisis menggunakan program Tools for Population Genetic Analyses (TFPGA. Hasil penelitian menunjukkan bahwa kelima “primers” (P-40, P-50, DALRP, Ca01, dan Ca-02 yang digunakan dapat menghasilkan beberapa fragmen spesifik yang mengindikasikan fragmen spesifik spesies dan lokasi budi daya K. alvarezii. Keragaan genetika intra dan inter lokasi rumput laut menunjukkan variasi yang relatif kecil yang ditandai dengan rendahnya perbedaan jumlah/ukuran fragmen DNA, polimorfisme, indeks similaritas, dan jarak genetikanya. Total fragmen yang didapatkan dari lima primer adalah 47—55 pada ukuran fragmen 175—2.600 bp, sedangkan polimorfisme dan indeks similaritas masing-masing adalah 3,6%—31,0% dan 0,79%—0,99%. Jarak genetika antar beberapa lokasi K. alvarezii berkisar antara 0,1758—0,5689 di mana kekerabatan yang terdekat didapatkan antara Takalar dan Bantaeng. Genetic characterization of seaweed Kappaphycus alvarezii was observed using Random Amplified Polymorphic DNA (RAPD technique to reveal the genetic variability of seaweed from different locations in South Sulawesi. The sample of farmed seaweed K. alvarezii was collected from Polmas, Pinrang, Takalar, and Bantaeng. Genomic DNA was extracted by using the conventional method of phenol-chloroform. Sample was preserved by TNES-Urea buffer prior to

  17. Tratamento do canal arterial persistente em neonatos prematuros: análise de 18 casos Treatment of patent ductus arteriosus in neonate premature: analysis of 18 cases

    Directory of Open Access Journals (Sweden)

    Wagner Ciongoli

    1993-12-01

    Full Text Available A presente investigação tem o propósito de analisar, retrospectivamente, os resultados obtidos em 18 pacientes neonatos prematuros, submetidos a operação para oclusão da PCA, no período entre julho de 1990 e dezembro de 1993 (42 meses, sendo 12 (66,6% pacientes do sexo feminino, com idade que variou entre 10 e 44 (20,8±8,3 dias, idade gestacional entre 26 e 28 (27,2±0,9 semanas. No dia da operação o peso dos pacientes esteve compreendido entre 700 e 1380 (985,8±181,6 gramas. A insuficiência respiratória aguda ocorreu em todos os pacientes sendo a principal indicação cirúrgica, estando em 6 (33,3% pacientes associada à insuficiência cardíaca congestiva. A indometacina endovenosa foi utilizada no período pré-operatório em 9 (50% pacientes na tentativa de se obter o fechamento farmacológico, sem sucesso, do canal arterial e apesar de não influenciar nos resultados pós-operatórios, apresentou como principal efeito secundário a redução significativa da diurese (p 40% 60% (p=0,033. O período de internação hospitalar variou de 43 a 157 (96,0±24,8 dias. Não houve mortalidade operatória, observando-se ainda baixa morbidade com este método. As causas de óbito, no período pós-operatório, não estiveram relacionadas com o tratamento cirúrgico. Pode-se concluir que a ligadura cirúrgica da PCA, nos pacientes neonatos e prematuros, é método eficaz e seguro podendo ser praticado com baixa morbidade e mortalidade.The purpose of our study was to analyse the results obtained in 18 neonate premature patients who underwent surgical closure of the patent ductus arteriosus, between July 1990 and December 1993 (42 months. Twelve (66.6% patients were female, with age between 10 and 44 (20.8±8.3 days, gestacional age ranged from 26 to 28 (27.2±0.9 weeks. In the surgery day the birth weight was between 700 and 1380 (985.8 ±181.6 grams. Acute respiratory insufficiency was present in all patients, as the principal surgical

  18. Circulating cytokines, chemokines and adhesion molecules in normal pregnancy and preeclampsia determined by multiplex suspension array

    Directory of Open Access Journals (Sweden)

    Bekő Gabriella

    2010-12-01

    Full Text Available Abstract Background Preeclampsia is a severe complication of pregnancy characterized by an excessive maternal systemic inflammatory response with activation of both the innate and adaptive arms of the immune system. Cytokines, chemokines and adhesion molecules are central to innate and adaptive immune processes. The purpose of this study was to determine circulating levels of cytokines, chemokines and adhesion molecules in normal pregnancy and preeclampsia in a comprehensive manner, and to investigate their relationship to the clinical features and laboratory parameters of the study participants, including markers of overall inflammation (C-reactive protein, endothelial activation (von Willebrand factor antigen and endothelial injury (fibronectin, oxidative stress (malondialdehyde and trophoblast debris (cell-free fetal DNA. Results Serum levels of interleukin (IL-1beta, IL-1 receptor antagonist (IL-1ra, IL-2, IL-4, IL-6, IL-8, IL-10, IL-12p40, IL-12p70, IL-18, interferon (IFN-gamma, tumor necrosis factor (TNF-alpha, transforming growth factor (TGF-beta1, interferon-gamma-inducible protein (IP-10, monocyte chemotactic protein (MCP-1, intercellular adhesion molecule (ICAM-1 and vascular cell adhesion molecule (VCAM-1 were measured in 60 preeclamptic patients, 60 healthy pregnant women and 59 healthy non-pregnant women by multiplex suspension array and ELISA. In normal pregnancy, the relative abundance of circulating IL-18 over IL-12p70 and the relative deficiency of the bioactive IL-12p70 in relation to IL-12p40 might favour Th2-type immunity. Although decreased IL-1ra, TNF-alpha and MCP-1 concentrations of healthy pregnant relative to non-pregnant women reflect anti-inflammatory changes in circulating cytokine profile, their decreased serum IL-10 and increased IP-10 levels might drive pro-inflammatory responses. In addition to a shift towards Th1-type immunity (expressed by the increased IL-2/IL-4 and IFN-gamma/IL-4 ratios, circulating levels of

  19. Using the Activity-based Anorexia Rodent Model to Study the Neurobiological Basis of Anorexia Nervosa.

    Science.gov (United States)

    Chowdhury, Tara Gunkali; Chen, Yi-Wen; Aoki, Chiye

    2015-10-22

    Anorexia nervosa (AN) is a psychiatric illness characterized by excessively restricted caloric intake and abnormally high levels of physical activity. A challenging illness to treat, due to the lack of understanding of the underlying neurobiology, AN has the highest mortality rate among psychiatric illnesses. To address this need, neuroscientists are using an animal model to study how neural circuits may contribute toward vulnerability to AN and may be affected by AN. Activity-based anorexia (ABA) is a bio-behavioral phenomenon described in rodents that models the key symptoms of anorexia nervosa. When rodents with free access to voluntary exercise on a running wheel experience food restriction, they become hyperactive - running more than animals with free access to food. Here, we describe the procedures by which ABA is induced in adolescent female C57BL/6 mice. On postnatal day 36 (P36), the animal is housed with access to voluntary exercise on a running wheel. After 4 days of acclimation to the running wheel, on P40, all food is removed from the cage. For the next 3 days, food is returned to the cage (allowing animals free food access) for 2 hr daily. After the fourth day of food restriction, free access to food is returned and the running wheel is removed from the cage to allow the animals to recover. Continuous multi-day analysis of running wheel activity shows that mice become hyperactive within 24 hr following the onset of food restriction. The mice run even during the limited time during which they have access to food. Additionally, the circadian pattern of wheel running becomes disrupted by the experience of food restriction. We have been able to correlate neurobiological changes with various aspects of the animals' wheel running behavior to implicate particular brain regions and neurochemical changes with resilience and vulnerability to food-restriction induced hyperactivity.

  20. Review of ustekinumab, an interleukin-12 and interleukin-23 inhibitor used for the treatment of plaque psoriasis

    Directory of Open Access Journals (Sweden)

    Nora Koutruba

    2010-03-01

    Full Text Available Nora Koutruba, Jason Emer, Mark LebwohlMount Sinai School of Medicine, New York, USAAbstract: The pathogenesis of psoriasis is unknown, although it is generally accepted that this chronic inflammatory skin disorder is a complex autoimmune condition similar to other T-cell mediated disorders. Psoriasis imposes a heavy burden on the lifestyle of those affected due to the psychological, arthritic, and cutaneous morbidities; thus significant research has focused on the genetic and immunologic features of psoriasis in anticipation of more targeted, efficacious, and safe therapies. Recently, CD4+ T helper (Th 17 cells and interleukins (IL-12 and -23 have been important in the pathogenesis of T-cell mediated disorders such as psoriasis and has influenced the development of medications that specifically target these key immunological players. Ustekinumab is a monoclonal antibody belonging to a newly developed class of biological, anti-cytokine medications that notably targets the p40 subunit of both IL-12 and -23, both naturally occurring proteins that are important in regulating the immune system and are understood to play a role in immune-mediated inflammatory disorders. Ustekinumab’s safety and efficacy has been evaluated for the treatment of moderate-to-severe plaque psoriasis in 3 phase III clinical trials, 2 placebo-controlled (PHOENIX 1 and 2, and 1 comparator-controlled (ACCEPT study which proved advantageous in patients who were treatment-naive, previously failed other immunosuppressive medications including cyclosporine or methotrexate, were unresponsive to phototherapy, or were unable to use or tolerate other therapies. Ustekinumab has also been investigated for other indications such as psoriatic arthritis, Crohn’s disease, and relapsing/remitting multiple sclerosis. We present a concise review evaluating the evidence that supports the use of ustekinumab in the treatment of plaque psoriasis and other conditions.Keywords: ustekinumab

  1. Effect of temperature of 32P uptake and translocation in varieties and a cross of japonica and indica rice

    International Nuclear Information System (INIS)

    Reddy, P.R.; Madhusudhan Rao, L.

    1976-01-01

    Three genotypes of rice, one in each of japonica, indica, and a japonica-indica cross were grown in half-Hoagland culture solution. 32 P (40 μCi/I) was added to each of these culture jars and placed at 10,20,30 and 40degC in growth chamber for a period of 1,5 and 10 h at each temperature. The actual uptake of 32 P in plant was very low at 10 and 20degC; moderately low at 40degC and very low at 30degC in japonica and the cross. The uptake was higher at 30 and 40degC in indica. This indicates their ability in uptake of fertilizer at these temperatures. The percentage of absorbed ions decreased at 10 and 20degC and increased at 30 and 40degC with increased duration in all the genotypes. The actual uptake of ions was in proportion to the absorbed ions at higher temperatures and inversely proportional at lower temperatures. The percentage of translocation of 32 P to shoot increased with time between 20 and 50degC in indica, whereas it was high only at 30 and 40degC in japonica and the cross. The translocation was low at 10degC in all the genotypes. The uptake of 32 P at different concentrations under different diurnal temperatures (20/10, 30/20 and 40/30degC) was also studied. (author)

  2. A Flow Cytometry Protocol to Estimate DNA Content in the Yellowtail Tetra Astyanax altiparanae

    Directory of Open Access Journals (Sweden)

    Pedro L. P. Xavier

    2017-09-01

    Full Text Available The production of triploid yellowtail tetra Astyanax altiparanae is a key factor to obtain permanently sterile individuals by chromosome set manipulation. Flow cytometric analysis is the main tool for confirmation of the resultant triploids individuals, but very few protocols are specific for A. altiparanae species. The current study has developed a protocol to estimate DNA content in this species. Furthermore, a protocol for long-term storage of dorsal fins used for flow cytometry analysis was established. The combination of five solutions with three detergents (Nonidet P-40 Substitute, Tween 20, and Triton X-100 at 0.1, 0.2, and 0.4% concentration was evaluated. Using the best solution from this first experiment, the addition of trypsin (0.125, 0.25, and 0.5% and sucrose (74 mM and the effects of increased concentrations of the detergents at 0.6 and 1.2% concentration were also evaluated. After adjustment of the protocol for flow cytometry, preservation of somatic tissue or isolated nuclei was also evaluated by freezing (at −20°C and fixation in saturated NaCl solution, acetic methanol (1:3, ethanol, and formalin at 10% for 30 or 60 days of storage at 25°C. Flow cytometry analysis in yellowtail tetra species was optimized using the following conditions: lysis solution: 9.53 mM MgCl2.7H20; 47.67 mM KCl; 15 mM Tris; 74 mM sucrose, 0.6% Triton X-100, pH 8.0; staining solution: Dulbecco's PBS with DAPI 1 μg mL−1; preservation procedure: somatic cells (dorsal fin samples frozen at −20°C. Using this protocol, samples may be stored up to 60 days with good accuracy for flow cytometry analysis.

  3. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  4. Disk-type piezoelectric transformer of a Na0.5K0.5NbO3–CuNb2O6 lead-free ceramic for driving T5 fluorescent lamp

    International Nuclear Information System (INIS)

    Yang, Ming-Ru; Chu, Sheng-Yuan; Chan, I.-Hao; Yang, Song-Ling

    2012-01-01

    Highlights: ► CuNb 2 O 6 dopants were doped into NKN ceramics not only improved the density but also exhibited superior piezoelectric characteristic, temperature stability of resonance frequency. ► Lead-free NKN-01CN piezoelectric transformer was simplified as an equivalent circuit and analyzed using MATLAB. ► An 8W T5 fluorescent lamp was successfully driven by the NKN-01CN piezoelectric transformer. - Abstract: Lead-free (Na 0.5 K 0.5 )NbO 3 (NKN) ceramics doped with 1 mol% CuNb 2 O 6 (CN) ceramics were prepared using the conventional mixed oxide method, with a sintering temperature of 1075 °C. Microstructural analyses of the NKN–01CN ceramics were carried out and compared, using X-ray diffraction (XRD). NKN–01CN ceramics sintered at 1075 °C not only exhibited excellent ‘hard’ piezoelectric properties of k p = 40%, k t = 45%, k 33 = 57%, a ferroelectric property of E c = 23 kV/cm, and an extraordinarily high mechanical quality factor (Q m ) of 1933 but also showed excellent stability with temperature (TCF = −154 ppm/°C). The piezoelectric transformer was simplified, using an equivalent circuit, and analyzed, using MATLAB; the simulation data agreed well with the experimental results. An efficiency of 95.7% was achieved for the NKN–01CN piezoelectric transformer with load resistance of 20 kΩ. An 8 W T5 fluorescent lamp was successfully driven by the NKN–01CN piezoelectric transformer.

  5. Relationship between radiation dose and lung function in patients with lung cancer receiving radiotherapy

    International Nuclear Information System (INIS)

    Harsaker, V.; Dale, E.; Bruland, O.S.; Olsen, D.R.

    2003-01-01

    In patients with inoperable non-small cell lung cancer (NSCLC), radical radiotherapy is the treatment of choice. The dose is limited by consequential pneumonitis and lung fibrosis. Hence, a better understanding of the relationship between the dose-volume distributions and normal tissue side effects is needed. CT is a non-invasive method to monitor the development of fibrosis and pneumonitis, and spirometry is an established tool to measure lung function. NSCLC patients were included in a multicenter trial and treated with megavoltage conformal radiotherapy. In a subgroup comprising 16 patients, a total dose of 59-63 Gy with 1.8-1.9 Gy per fraction was given. Dose-volume histograms were calculated and corrected according to the linear-quadratic formula using alpha/beta=3 Gy. The patients underwent repetitive CT examinations (mean follow-up, 133 days) following radiotherapy, and pre and post treatment spirometry (mean follow-up, 240 days). A significant correlation was demonstrated between local lung dose and changes in CT numbers >30 days after treatment (p 40 Gy Gy there was a sudden increase in CT numbers at 70-90 days. Somewhat unexpectedly, the highest mean lung doses were found in patients with the least reductions in lung function (peak expiratory flow; p<0.001). The correlation between CT numbers, radiation dose and time after treatment show that CT may be used to monitor development of lung fibrosis/pneumonitis after radiotherapy for lung cancer. Paradoxically, the patients with the highest mean lung doses experienced the minimum deterioration of lung function. This may be explained by reduction in the volume of existing tumour masses obstructing the airways, leading to relief of symptoms. This finding stresses the role of radiotherapy for lung cancer, especially where the treatment aim is palliative

  6. Potent neutralizing anti-CD1d antibody reduces lung cytokine release in primate asthma model.

    Science.gov (United States)

    Nambiar, Jonathan; Clarke, Adam W; Shim, Doris; Mabon, David; Tian, Chen; Windloch, Karolina; Buhmann, Chris; Corazon, Beau; Lindgren, Matilda; Pollard, Matthew; Domagala, Teresa; Poulton, Lynn; Doyle, Anthony G

    2015-01-01

    CD1d is a receptor on antigen-presenting cells involved in triggering cell populations, particularly natural killer T (NKT) cells, to release high levels of cytokines. NKT cells are implicated in asthma pathology and blockade of the CD1d/NKT cell pathway may have therapeutic potential. We developed a potent anti-human CD1d antibody (NIB.2) that possesses high affinity for human and cynomolgus macaque CD1d (KD ∼100 pM) and strong neutralizing activity in human primary cell-based assays (IC50 typically <100 pM). By epitope mapping experiments, we showed that NIB.2 binds to CD1d in close proximity to the interface of CD1d and the Type 1 NKT cell receptor β-chain. Together with data showing that NIB.2 inhibited stimulation via CD1d loaded with different glycolipids, this supports a mechanism whereby NIB.2 inhibits NKT cell activation by inhibiting Type 1 NKT cell receptor β-chain interactions with CD1d, independent of the lipid antigen in the CD1d antigen-binding cleft. The strong in vitro potency of NIB.2 was reflected in vivo in an Ascaris suum cynomolgus macaque asthma model. Compared with vehicle control, NIB.2 treatment significantly reduced bronchoalveolar lavage (BAL) levels of Ascaris-induced cytokines IL-5, IL-8 and IL-1 receptor antagonist, and significantly reduced baseline levels of GM-CSF, IL-6, IL-15, IL-12/23p40, MIP-1α, MIP-1β, and VEGF. At a cellular population level NIB.2 also reduced numbers of BAL lymphocytes and macrophages, and blood eosinophils and basophils. We demonstrate that anti-CD1d antibody blockade of the CD1d/NKT pathway modulates inflammatory parameters in vivo in a primate inflammation model, with therapeutic potential for diseases where the local cytokine milieu is critical.

  7. Phosphorus status and sorption characteristics of some calcareous soils of Hamadan, western Iran

    Science.gov (United States)

    Jalali, Mohsen

    2007-10-01

    Phosphorus (P) application in excess of plant requirement may result in contamination of drinking water and eutrophication of surface water bodies. The phosphorous buffer capacity (PBC) of soil is important in plant nutrition and is an important soil property in the determination of the P release potential of soils. Phosphorus sorption greatly affects both plant nutrition and environmental pollution. For better and accurate P fertilizer recommendations, it is necessary to quantify P sorption. This study was conducted to investigate available P and P sorption by calcareous soils in a semi-arid region of Hamadan, western Iran. The soil samples were mainly from cultivated land. Olsen’s biocarbonate extractable P (Olsen P) varied among soils and ranged from 10 to 80 mg kg-1 with a mean of 36 mg kg-1. Half of the soils had an Olsen P > 40 mg kg-1 and >70% of them had a concentration >20 mg kg-1, whereas the critical concentration for most crops is potato (44 kg kg-1) fields than in dry-land wheat farming (24 mg kg-1), pasture (30 mg kg-1), and wheat (24 mg P kg-1) fields. A marked increase in fertilizer P rates applied to agricultural soils has caused P to be accumulated in the surface soil. Phosphate sorption curves were well fitted to the Freundlich equation. The standard P requirement (SPR) of soils, defined as the amount of P sorbed at an equilibrium concentration of 0.2 mg l-1 ranged from 4 to 102 mg kg-1. Phosphorus buffer capacity was relatively high and varied from 16 to 123 l kg-1 with an average of 58 l kg-1. In areas of intensive crop production, continual P applications as P fertilizer and farmyard manure have been used at levels exceeding crop requirements. Surface soil accumulations of P are high enough that loss of P in surface runoff and a high risk for P transfer into groundwater have become priority management concerns.

  8. Prevalence of attention deficit/hyperactivity disorder among adults in obesity treatment

    Directory of Open Access Journals (Sweden)

    Altfas Jules R

    2002-09-01

    Full Text Available Abstract Background Bariatric patients showing poor "focus" during treatment more often failed to lose weight or maintain reduced weight. Evaluation of these patients identified a number having attention deficit/hyperactivity disorder (ADHD, evidently a potent factor limiting successful weight control. After searches found no published reports describing comorbid ADHD and obesity, this report was conceived to begin exploring the prevalence and characteristics of these patients. Method Clinical records of 215 patients receiving obesity treatment during 2000 were reviewed. Data collected and analyzed included age, sex, beginning and ending body mass index (BMI, number of clinic visits, months of treatment, and diagnostic category (ADHD, some ADHD symptoms, non-ADHD. DSM-IV criteria were used, except age of onset was modified to Results Whole sample ADHD prevalence was 27.4% (CI:21.1,32.9, but 42.6% (CI: 36.3% to 48.9% for BMI >= 40. Mean weight loss among obese patients with ADHD (OB+ADHD was 2.6 BMI (kg/m2 vs. 4.0 for non-ADHD (NAD (p = 40, OB+ADHD had BMI loss 2.9 vs. 7.0 (NAD (p Conclusions ADHD was highly prevalent among obese patients and highest in those with extreme obesity. Comorbid obesity and ADHD symptoms rendered treatment less successful compared to NAD counterparts. Reasons for the comorbidity are unknown, but may involve brain dopamine or insulin receptor activity. If replicated in further studies, these findings have important implications for treatment of severe and extreme obesity.

  9. Além do Códex

    Directory of Open Access Journals (Sweden)

    Ana Beatriz Barroso

    2012-07-01

    Full Text Available http://dx.doi.org/10.5007/1807-9288.2012v8n1p40 O artigo explora o transbordamento da escrita e da leitura para fora das páginas. O texto enquanto trama de sentidos e nexos extrapola a dobra, marco fundamental na história do livro. Quando este deixa de ser rolo e passa a ser códex, quando este deixa de ser códex e passa a ser fluxo, quando essas passagens são percebidas mais como sobreposições e convivências de códigos distintos do que como exclusões e viradas radicais, sentimos a sutil flexibilidade dos conceitos fundamentais da cultura. A meta, então, é abordar algumas dessas convivências, observadas principalmente no diálogo entre as artes visuais e este precioso objeto de cultura, o livro. Para tanto, investigaremos algumas experiências artísticas contemporâneas que transitam pela relação do texto escrito com a imagem, bem como pelos escritos e livros de artista. Veremos, então, algumas possibilidades de abertura para o livro-códice na atualidade, quando experimentamos um contato ímpar com a presença massiva dos meios digitais de comunicação. Tal contato demanda uma compreensão renovada do próprio conceito de comunicação.

  10. Food, Feed, or Fuel? Phosphorus Flows Embodied in US Agricultural Production and Trade

    Science.gov (United States)

    MacDonald, G.; Bennett, E.; Carpenter, S.

    2012-12-01

    Agricultural phosphorus (P) use is integral to sustainable food production and water quality regulation. Globalization of agricultural systems, changing diets, and increasing biofuel production pose new challenges for managing non-renewable P reserves, particularly in key agricultural producing regions such as the US. We used a detailed model of the US agricultural system to assess the quantity of mineral P fertilizers used to produce food crops, livestock, and biofuels relative to the P ultimately consumed in domestic diets. We also quantified linkages in fertilizer use between the US and its trading partners globally via agricultural trade. Feed and livestock production drove by far the largest demand for P fertilizers in the US (56% of all P use for domestic and imported products). Of the total mineral P inputs to US domestic agriculture in 2007 (1905 Gg P), 28% were retained in agricultural soils as surplus P, 40% were lost through processing and waste prior to consumption in human diets, while 10% were diverted directly to biofuel production. One quarter of P fertilizer in the US was required to produce exports, particularly major food and feed crops (corn, soybean, and wheat) that drove a large net P flux out of the country (338 Gg P) with strongly crop-specific effects on soil P imbalances nationally. However, US meat consumption involved considerable reliance on P fertilizer use in other countries to produce red meat imports linked primarily to soil P surpluses abroad. We show that changes in domestic farm management and consumer waste could together reduce the P fertilizer needed to produce food consumed in the US by half, which is comparable to the P fertilizer reduction attainable by cutting domestic meat consumption (44%). More effective distribution of P use for major crops nationally and greater recycling of all agricultural wastes is critical to using US phosphate rock reserves as efficiently as possible while maintaining export-oriented agriculture.

  11. Surface coating changes the physiological and biochemical impacts of nano-TiO2 in basil (Ocimum basilicum) plants.

    Science.gov (United States)

    Tan, Wenjuan; Du, Wenchao; Barrios, Ana C; Armendariz, Raul; Zuverza-Mena, Nubia; Ji, Zhaoxia; Chang, Chong Hyun; Zink, Jeffrey I; Hernandez-Viezcas, Jose A; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge L

    2017-03-01

    Little is known about the effects of surface coating on the interaction of engineered nanoparticles (ENPs) with plants. In this study, basil (Ocimum basilicum) was cultivated for 65 days in soil amended with unmodified, hydrophobic (coated with aluminum oxide and dimethicone), and hydrophilic (coated with aluminum oxide and glycerol) titanium dioxide nanoparticles (nano-TiO 2 ) at 125, 250, 500, and 750 mg nano-TiO 2 kg -1 soil. ICP-OES/MS, SPAD meter, and UV/Vis spectrometry were used to determine Ti and essential elements in tissues, relative chlorophyll content, carbohydrates, and antioxidant response, respectively. Compared with control, hydrophobic and hydrophilic nano-TiO 2 significantly reduced seed germination by 41% and 59%, respectively, while unmodified and hydrophobic nano-TiO 2 significantly decreased shoot biomass by 31% and 37%, respectively (p ≤ 0.05). Roots exposed to hydrophobic particles at 750 mg kg -1 had 87% and 40% more Ti than the pristine and hydrophilic nano-TiO 2 ; however, no differences were found in shoots. The three types of particles affected the homeostasis of essential elements: at 500 mg kg - 1 , unmodified particles increased Cu (104%) and Fe (90%); hydrophilic increased Fe (90%); while hydrophobic increased Mn (339%) but reduced Ca (71%), Cu (58%), and P (40%). However, only hydrophobic particles significantly reduced root elongation by 53%. Unmodified, hydrophobic, and hydrophilic particles significantly reduced total sugar by 39%, 38%, and 66%, respectively, compared with control. Moreover, unmodified particles significantly decreased reducing sugar (34%), while hydrophobic particles significantly reduced starch (35%). Although the three particles affected basil plants, coated particles impacted the most its nutritional quality, since they altered more essential elements, starch, and reducing sugars. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Resveratrol strongly enhances the retinoic acid-induced superoxide generating activity via up-regulation of gp91-phox gene expression in U937 cells.

    Science.gov (United States)

    Kikuchi, Hidehiko; Mimuro, Hitomi; Kuribayashi, Futoshi

    2018-01-01

    The membrane bound cytochrome b 558 composed of gp91-phox and p22-phox proteins, and cytosolic proteins p40-, p47-and p67-phox are important components of superoxide (O 2 - )-generating system in phagocytes. Here, we describe that resveratrol, a pleiotropic phytochemical belonging to the stilbenoids, dramatically activates the O 2 - -generating system during retinoic acid (RA)-induced differentiation of human monoblastic leukemia U937 cells to macrophage-like cells. When U937 cells were cultured in the presence of RA and resveratrol, the O 2 - -generating activity increased more than 5-fold compared with that in the absence of the latter. Semiquantitative RT-PCR showed that co-treatment with RA and resveratrol strongly enhanced transcription of the gp91-phox compared with those of the RA-treatment only. On the other hand, immunoblot analysis revealed that co-treatment with RA and resveratrol caused remarkable accumulation of protein levels of gp91-phox (to 4-fold), p22-phox (to 5-fold) and p47-phox (to 4-fold) compared with those of the RA-treatment alone. In addition, ChIP assay suggested that resveratrol participates in enhancing the gene expression of gp91-phox via promoting acetylation of Lys-9 residues and Lys-14 residues of histone H3 within chromatin around the promoter regions of the gene. These results suggested that resveratrol strongly enhances the RA-induced O 2 - -generating activity via up-regulation of gp91-phox gene expression in U937 cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Peptidoglycan Hydrolases of Local Lactic Acid Bacteria from Kazakh Traditional Food

    Directory of Open Access Journals (Sweden)

    Serik Shaikhin

    2014-01-01

    Full Text Available Introduction: Peptidoglycan (PG is a major component of the cell wall of Gram-positive bacteria and is essential for maintaining the integrity of the bacterial cell and its shape. The bacteria synthesize PG hydrolases, which are capable of cleaving the covalent bonds of PG. They also play an important role in modeling PG, which is required for bacterial growth and division. In an era of increasing antibiotic-resistant pathogens, PG hydrolases that destroy these important structures of the cell wall act as a potential source of new antimicrobials. The aim of this study is to identify the main PG hydrolases of local lactic acid bacteria isolated from traditional foods that enhance probiotic activity of a biological preparation. Methods. Lactococcus lactis 17А and Lactococcus garvieae 19А were isolated from the traditional sausage-like meat product called kazy. They were isolated according to standards methods of microbiology. Genetic identification of the isolates were tested by determining the nucleotide sequences of 16S rDNA. The Republican collection of microorganisms took strains of Lactobacillus casei subsp. Rhamnosus 13-P, L. delbrueckii subsp. lactis CG-1 B-RKM 0044 from cheese, Lactobacillus casei subsp. casei B-RKM 0202 from homemade butter. They used the standard technique of renaturating polyacrylamide gel electrophoresis to detect PG hydrolases activity. Results. According to the profiles of PG hydrolase activity on zymograms, the enzymes of Lactococci 17A and 19A in kazy are similar in electrophoretic mobility to major autolysin AcmA, while the lactobacilli of industrial and home-made dairy products have enzymes similar to extracellular proteins p40 and p75, which have probiotic activity. Conclusions. Use of peptidoglycan hydrolases seems to be an interesting approach in the fight against multi-drug resistant strains of bacteria and could be a valuable tool for the treatment of diseases caused by these microorganisms in Kazakhstan.

  14. Clinical utility of ustekinumab in Crohn’s disease

    Directory of Open Access Journals (Sweden)

    Kotze PG

    2018-02-01

    Full Text Available Paulo Gustavo Kotze,1,2 Christopher Ma,1 Abdulelah Almutairdi,1,3 Remo Panaccione1 1Inflammatory Bowel Disease Unit, Division of Gastroenterology and Hepatology, Cumming School of Medicine, University of Calgary, Calgary, AB, Canada; 2Inflammatory Bowel Disease Outpatient Clinics, Colorectal Surgery Unit, Catholic University of Paraná, Curitiba, Brazil; 3Department of Medicine, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia Abstract: The introduction of anti-tumor necrosis factor (TNF therapy marked an important milestone in the management of moderate-to-severe Crohn’s disease (CD. However, there remains a pressing demand for alternative therapeutic options for patients with primary nonresponse, secondary loss of response, or intolerable side effects to conventional treatment and TNF antagonists. Ustekinumab (UST is a fully human IgG1κ monoclonal antibody that inhibits the p40 subunit shared by the proinflammatory cytokines, the interleukin (IL-12 and -23. This blockade leads to dampening of the inflammatory cascade and differentiation of inflammatory T cells. The clinical development program for UST in CD includes dose finding Phase II (Crohn’s Evaluation of Response to Ustekinumab Anti-Interleukin-12/23 for Induction [CERTIFI] and the pivotal Phase III (UNITI trials that demonstrated both the clinical efficacy and safety in anti-TNF-naive and anti-TNF-exposed patients. Real-world evidence has further defined the role of UST in CD management. In this review, we discuss the mechanism of action of UST, describe the results of the randomized controlled trials with this agent, and review the real-world efficacy and safety data from observational cohorts. Finally, we identify areas of future research in the IL-12/23 inflammatory pathway and discuss the positioning of this novel therapeutic option in CD treatment algorithms. Keywords: ustekinumab, Crohn’s disease, interleukin

  15. Chronic stress enhanced fear memories are associated with increased amygdala zif268 mRNA expression and are resistant to reconsolidation.

    Science.gov (United States)

    Hoffman, Ann N; Parga, Alejandro; Paode, Pooja R; Watterson, Lucas R; Nikulina, Ella M; Hammer, Ronald P; Conrad, Cheryl D

    2015-04-01

    The chronically stressed brain may present a vulnerability to develop maladaptive fear-related behaviors in response to a traumatic event. In rodents, chronic stress leads to amygdala hyperresponsivity and dendritic hypertrophy and produces a post traumatic stress disorder (PTSD)-like phenotype that includes exaggerated fear learning following Pavlovian fear conditioning and resistance to extinction. It is unknown whether chronic stress-induced enhanced fear memories are vulnerable to disruption via reconsolidation blockade, as a novel therapeutic approach for attenuating exaggerated fear memories. We used a chronic stress procedure in a rat model (wire mesh restraint for 6h/d/21d) to create a vulnerable brain that leads to a PTSD-like phenotype. We then examined freezing behavior during acquisition, reactivation and after post-reactivation rapamycin administration (i.p., 40mg/kg) in a Pavlovian fear conditioning paradigm to determine its effects on reconsolidation as well as the subsequent functional activation of limbic structures using zif268 mRNA. Chronic stress increased amygdala zif268 mRNA during fear memory retrieval at reactivation. Moreover, these enhanced fear memories were unaffected by post reactivation rapamycin to disrupt long-term fear memory. Also, post-reactivation long term memory processing was also associated with increased amygdala (LA and BA), and decreased hippocampal CA1 zif268 mRNA expression. These results suggest potential challenges for reconsolidation blockade as an effective approach in treating exaggerated fear memories, as in PTSD. Our findings also support chronic stress manipulations combined with fear conditioning as a useful preclinical approach to study a PTSD-like phenotype. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Protein secretory patterns of rat Sertoli and peritubular cells are influenced by culture conditions

    International Nuclear Information System (INIS)

    Kierszenbaum, A.L.; Crowell, J.A.; Shabanowitz, R.B.; DePhilip, R.M.; Tres, L.L.

    1986-01-01

    An approach combining two-dimensional gel electrophoresis and autoradiography was used to correlate patterns of secretory proteins in cultures of Sertoli and peritubular cells with those observed in the incubation medium from segments of seminiferous tubules. Sertoli cells in culture and in seminiferous tubules secreted three proteins designated S70 (Mr 72,000-70,000), S45 (Mr 45,000), and S35 (Mr 35,000). Cultured Sertoli and peritubular cells and incubated seminiferous tubules secreted two proteins designated SP1 (Mr 42,000) and SP2 (Mr 50,000). SP1 and S45 have similar Mr but differ from each other in isoelectric point (pI). Cultured peritubular cells secreted a protein designated P40 (Mr 40,000) that was also seen in intact seminiferous tubules but not in seminiferous tubules lacking the peritubular cell wall. However, a large number of high-Mr proteins were observed only in the medium of cultured peritubular cells but not in the incubation medium of intact seminiferous tubules. Culture conditions influence the morphology and patterns of protein secretion of cultured peritubular cells. Peritubular cells that display a flat-stellate shape transition when placed in culture medium free of serum (with or without hormones and growth factors), accumulate various proteins in the medium that are less apparent when these cells are maintained in medium supplemented with serum. Two secretory proteins stimulated by follicle-stimulating hormone (FSH) (designated SCm1 and SCm2) previously found in the medium of cultured Sertoli cells, were also observed in the incubation medium of seminiferous tubular segments stimulated by FSH. Results of this study show that, although cultured Sertoli and peritubular cells synthesize and secrete proteins also observed in segments of incubated seminiferous tubules anther group of proteins lacks seminiferous tubular correlates

  17. IFN-γ-producing Th1-like regulatory T cells may limit acute cellular renal allograft rejection: Paradoxical post-transplantation effects of IFN-γ.

    Science.gov (United States)

    Xu, Xiaoguang; Huang, Haiyan; Wang, Qiang; Cai, Ming; Qian, Yeyong; Han, Yong; Wang, Xinying; Gao, Yu; Yuan, Ming; Xu, Liang; Yao, Chen; Xiao, Li; Shi, Bingyi

    2017-02-01

    IFN-γ is a protypical proinflammatory cytokine that plays a central role in inflammation and acute graft rejection. Accumulating evidence indicates that IFN-γ can exert previously unexpected immunoregulatory activities. However, little is known about the role of IFN-γ secreted by Th1-like regulatory T cells in human kidney transplantation. To determine the function of IFN-γ in acute T cell-mediated renal allograft rejection (ACR), we examined serum cytokine expression profiles in ACR patients by human cytokine multiplex immunoassay and analyzed the cellular origins of IFN-γ in peripheral blood and renal allograft biopsies from ACR cases and controls by flow cytometry and immunohistochemistry, respectively. The results showed significant reduction in serum concentrations of Th1-inducing cytokines IL-12p70 and IFN-γ as well as Th2-related cytokine IL-4 in ACR patients compared with stable controls. However, levels of several Th1-, Th2- and Th17-related cytokines, such as IL-2, TNF-α, TNF-β, IL-12 (p40), IL-10, IL-15, IL-17, IL-21, and IL-23, as well as the frequencies of Th1 and Th17 cell, did not differ between ACR cases and stable controls. Moreover, we found the levels of IFN-γ were correlated with those of the anti-inflammatory factor, IL-1 receptor antagonist (IL-1Ra) in ACR. Notably, the Th1-like Treg cell-to-Foxp3 - Th1 cell ratio was significantly lower in ACR patients compared with that in stable controls. In graft biopsies from ACR patients, Treg cells and Th1-like Treg cells were less abundant than those without ACR. Our study indicates that IFN-γ secreted from Th1-like Treg cells negatively modulates ACR. Copyright © 2016 Elsevier GmbH. All rights reserved.

  18. Immune defects in active mycobacterial diseases in patients with primary immunodeficiency diseases (PIDs

    Directory of Open Access Journals (Sweden)

    Wen-I Lee

    2011-12-01

    Full Text Available Natural human immunity to the mycobacteria group, including Mycobacterium tuberculosis, Bacille Calmette-Guérin (BCG or nontuberculous mycobacteria (NTM, and/or Salmonella species, relies on the functional IL-12/23-IFN-γ integrity of macrophages (monocyte/dendritic cell connecting to T lymphocyte/NK cells. Patients with severe forms of primary immunodeficiency diseases (PIDs have more profound immune defects involving this impaired circuit in patients with severe combined immunodeficiencies (SCID including complete DiGeorge syndrome, X-linked hyper IgM syndrome (HIGM (CD40L mutation, CD40 deficiency, immunodeficiency with or without anhidrotic ectodermal dysplasia (NEMO and IKBA mutations, chronic granulomatous disease (CGD and hyper IgE recurrent infection syndromes (HIES. The patients with severe PIDs have broader diverse infections rather than mycobacterial infections. In contrast, patients with an isolated inborn error of the IL-12/23-IFN-γ pathway are exclusively prone to low-virulence mycobacterial infections and nontyphoid salmonella infections, known as Mendelian susceptibility to the mycobacterial disease (MSMD phenotype. Restricted defective molecules in the circuit, including IFN-γR1, IFN-γR2, IL-12p40, IL-12R-β1, STAT-1, NEMO, IKBA and the recently discovered CYBB responsible for autophagocytic vacuole and proteolysis, and interferon regulatory factor 8 (IRF8 for dendritic cell immunodeficiency, have been identified in around 60% of patients with the MSMD phenotype. Among all of the patients with PIDs referred for investigation since 1985, we have identified four cases with the specific defect (IFNRG1 for three and IL12RB for one, presenting as both BCG-induced diseases and NTM infections, in addition to some patients with SCID, HIGM, CGD and HIES. Furthermore, manifestations in patients with autoantibodies to IFN-γ (autoAbs-IFN-γ, which is categorized as an anticytokine autoantibody syndrome, can resemble the relatively

  19. Cryptosporidium Priming Is More Effective than Vaccine for Protection against Cryptosporidiosis in a Murine Protein Malnutrition Model

    Science.gov (United States)

    Bartelt, Luther A.; Bolick, David T.; Kolling, Glynis L.; Zaenker, Edna I.; Lara, Ana M.; Noronha, Francisco Jose; Cowardin, Carrie A.; Moore, John H.; Turner, Jerrold R.; Warren, Cirle A.; Buck, Gregory A.; Guerrant, Richard L.

    2016-01-01

    Cryptosporidium is a major cause of severe diarrhea, especially in malnourished children. Using a murine model of C. parvum oocyst challenge that recapitulates clinical features of severe cryptosporidiosis during malnutrition, we interrogated the effect of protein malnutrition (PM) on primary and secondary responses to C. parvum challenge, and tested the differential ability of mucosal priming strategies to overcome the PM-induced susceptibility. We determined that while PM fundamentally alters systemic and mucosal primary immune responses to Cryptosporidium, priming with C. parvum (106 oocysts) provides robust protective immunity against re-challenge despite ongoing PM. C. parvum priming restores mucosal Th1-type effectors (CD3+CD8+CD103+ T-cells) and cytokines (IFNγ, and IL12p40) that otherwise decrease with ongoing PM. Vaccination strategies with Cryptosporidium antigens expressed in the S. Typhi vector 908htr, however, do not enhance Th1-type responses to C. parvum challenge during PM, even though vaccination strongly boosts immunity in challenged fully nourished hosts. Remote non-specific exposures to the attenuated S. Typhi vector alone or the TLR9 agonist CpG ODN-1668 can partially attenuate C. parvum severity during PM, but neither as effectively as viable C. parvum priming. We conclude that although PM interferes with basal and vaccine-boosted immune responses to C. parvum, sustained reductions in disease severity are possible through mucosal activators of host defenses, and specifically C. parvum priming can elicit impressively robust Th1-type protective immunity despite ongoing protein malnutrition. These findings add insight into potential correlates of Cryptosporidium immunity and future vaccine strategies in malnourished children. PMID:27467505

  20. Effect of Docosahexaenoic Acid (DHA) Supplementation on Inflammatory Cytokine Levels in Infants at High Genetic Risk for Type 1 Diabetes

    Science.gov (United States)

    Chase, H. Peter; Boulware, David; Rodriguez, Henry; Donaldson, David; Chritton, Sonia; Rafkin-Mervis, Lisa; Krischer, Jeffrey; Skyler, Jay S.; Clare-Salzler, Michael

    2014-01-01

    OBJECTIVE Type 1 diabetes (T1D) results from the inflammatory destruction of pancreatic β-cells. In the present study, we investigated the effect of docosahexaenoic acid (DHA) supplementation on stimulated inflammatory cytokine production in white blood cells (WBC) from infants with a high genetic risk for T1D. RESEARCH DESIGN AND METHODS This was a multicenter, two-arm, randomized, double blind pilot trial of DHA supplementation, beginning either in the last trimester of pregnancy (41 infants) or in the first five months after birth (57 infants). Levels of DHA in infant and maternal red blood cell (RBC) membranes and in breast milk were analyzed by gas chromatography/mass spectrometry. Inflammatory cytokines were assayed from whole blood culture supernatants using the Luminex Multiplex assay after stimulation with high dose lipopolysaccharide (LPS), 1μg/mL. RESULTS The levels of RBC DHA were increased by 61–100% in treated compared to control infants at ages 6 to 36 months. There were no statistically significant reductions in production of the inflammatory cytokines, IL-1β, TNFα or IL-12p40 at any of the 6 time points measured. The inflammatory marker, hsCRP, was significantly lower in breast-fed DHA-treated infants compared to all formula-fed infants at age 12 months. Three infants (two received DHA) were removed from the study as a result of developing ≥ two persistently positive biochemical islet autoantibodies. CONCLUSIONS This pilot trial showed that supplementation of infant diets with DHA is safe and fulfilled the pre-study goal of increasing infant RBC DHA levels by at least 20%. Inflammatory cytokine production was not consistently reduced. PMID:25039804

  1. Effect of docosahexaenoic acid supplementation on inflammatory cytokine levels in infants at high genetic risk for type 1 diabetes.

    Science.gov (United States)

    Chase, H Peter; Boulware, David; Rodriguez, Henry; Donaldson, David; Chritton, Sonia; Rafkin-Mervis, Lisa; Krischer, Jeffrey; Skyler, Jay S; Clare-Salzler, Michael

    2015-06-01

    Type 1 diabetes (T1D) results from the inflammatory destruction of pancreatic β-cells. In this study, we investigated the effect of docosahexaenoic acid (DHA) supplementation on stimulated inflammatory cytokine production in white blood cells (WBC) from infants with a high genetic risk for T1D. This was a multicenter, two-arm, randomized, double-blind pilot trial of DHA supplementation, beginning either in the last trimester of pregnancy (41 infants) or in the first 5 months after birth (57 infants). Levels of DHA in infant and maternal red blood cell (RBC) membranes and in breast milk were analyzed by gas chromatography/mass spectrometry. Inflammatory cytokines were assayed from whole blood culture supernatants using the Luminex multiplex assay after stimulation with high dose lipopolysaccharide (LPS), 1 µg/mL. The levels of RBC DHA were increased by 61-100% in treated compared to control infants at ages 6-36 months. There were no statistically significant reductions in production of the inflammatory cytokines, IL-1β, TNFα, or IL-12p40 at any of the six timepoints measured. The inflammatory marker, high-sensitivity C-reactive protein (hsCRP), was significantly lower in breast-fed DHA-treated infants compared to all formula-fed infants at the age of 12 months. Three infants (two received DHA) were removed from the study as a result of developing ≥two persistently positive biochemical islet autoantibodies. This pilot trial showed that supplementation of infant diets with DHA is safe and fulfilled the pre-study goal of increasing infant RBC DHA levels by at least 20%. Inflammatory cytokine production was not consistently reduced. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. A bipedal mammalian model for spinal cord injury research: The tammar wallaby [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Norman R. Saunders

    2017-06-01

    Full Text Available Background: Most animal studies of spinal cord injury are conducted in quadrupeds, usually rodents. It is unclear to what extent functional results from such studies can be translated to bipedal species such as humans because bipedal and quadrupedal locomotion involve very different patterns of spinal control of muscle coordination. Bipedalism requires upright trunk stability and coordinated postural muscle control; it has been suggested that peripheral sensory input is less important in humans than quadrupeds for recovery of locomotion following spinal injury. Methods: We used an Australian macropod marsupial, the tammar wallaby (Macropus eugenii, because tammars exhibit an upright trunk posture, human-like alternating hindlimb movement when swimming and bipedal over-ground locomotion. Regulation of their muscle movements is more similar to humans than quadrupeds. At different postnatal (P days (P7–60 tammars received a complete mid-thoracic spinal cord transection. Morphological repair, as well as functional use of hind limbs, was studied up to the time of their pouch exit. Results: Growth of axons across the lesion restored supraspinal innervation in animals injured up to 3 weeks of age but not in animals injured after 6 weeks of age. At initial pouch exit (P180, the young injured at P7-21 were able to hop on their hind limbs similar to age-matched controls and to swim albeit with a different stroke. Those animals injured at P40-45 appeared to be incapable of normal use of hind limbs even while still in the pouch. Conclusions: Data indicate that the characteristic over-ground locomotion of tammars provides a model in which regrowth of supraspinal connections across the site of injury can be studied in a bipedal animal. Forelimb weight-bearing motion and peripheral sensory input appear not to compensate for lack of hindlimb control, as occurs in quadrupeds. Tammars may be a more appropriate model for studies of therapeutic interventions

  3. HST Observations of Astrophysically Important Visual Binaries

    Science.gov (United States)

    Bond, Howard

    2015-10-01

    We propose to continue our long-term program of astrometry of close visual binaries, with the primary goal of determining purely dynamical masses for 3 important main-sequence stars and 9 white dwarfs (WDs). A secondary aim is to set limits on third bodies in the systems down to planetary mass. Three of our targets are naked-eye stars with much fainter companions that are extremely difficult to image from the ground. Our other 2 targets are double WDs, whose small separations and faintness likewise make them difficult to measure using ground-based techniques. Observations have been completed for a 3rd double WD.The bright stars, to be imaged with WFC3, are: (1) Procyon (P = 40.83 yr), containing a bright F star and a much fainter WD companion. With the continued monitoring proposed here, we will obtain masses to an accuracy of better than 1%, providing a testbed for theories of both Sun-like stars and WDs. (2) Sirius (P = 50.14 yr), an A-type star also having a faint WD companion, Sirius B, the nearest and brightest of all WDs. (3) Mu Cas (P = 21.08 yr), a nearby metal-deficient G dwarf for which accurate masses will lead to the stars' helium contents, with cosmological implications. The faint double WDs, to be observed with FGS, are: (1) G 107-70 (P = 18.84 yr), and (2) WD 1818+126 (P = 12.19 yr). Our astrometry of these systems will add 4 accurate masses to the handful of WD masses that are directly known from dynamical measurements. The FGS measurements will also provide precise parallaxes for the systems, a necessary ingredient in the mass determinations.

  4. Urotensin II inhibits skeletal muscle glucose transport signaling pathways via the NADPH oxidase pathway.

    Directory of Open Access Journals (Sweden)

    Hong-Xia Wang

    Full Text Available Our previous studies have demonstrated that the urotensin (UII and its receptor are up-regulated in the skeletal muscle of mice with type II diabetes mellitus (T2DM, but the significance of UII in skeletal muscle insulin resistance remains unknown. The purpose of this study was to investigate the effect of UII on NADPH oxidase and glucose transport signaling pathways in the skeletal muscle of mice with T2DM and in C2C12 mouse myotube cells. KK/upj-AY/J mice (KK mice were divided into the following groups: KK group, with saline treatment for 2 weeks; KK+ urantide group, with daily 30 µg/kg body weight injections over the same time period of urantide, a potent urotensin II antagonist peptide; Non-diabetic C57BL/6J mice were used as normal controls. After urantide treatment, mice were subjected to an intraperitoneal glucose tolerance test, in addition to measurements of the levels of ROS, NADPH oxidase and the phosphorylated AKT, PKC and ERK. C2C12 cells were incubated with serum-free DMEM for 24 hours before conducting the experiments, and then administrated with 100 nM UII for 2 hours or 24 hours. Urantide treatment improved glucose tolerance, decreased the translocation of the NADPH subunits p40-phox and p47-phox, and increased levels of the phosphorylated PKC, AKT and ERK. In contrast, UII treatment increased ROS production and p47-phox and p67-phox translocation, and decreased the phosphorylated AKT, ERK1/2 and p38MAPK; Apocynin abrogated this effect. In conclusion, UII increased ROS production by NADPH oxidase, leading to the inhibition of signaling pathways involving glucose transport, such as AKT/PKC/ERK. Our data imply a role for UII at the molecular level in glucose homeostasis, and possibly in skeletal muscle insulin resistance in T2DM.

  5. Hair as a long-term retrospective cortisol calendar in orang-utans (Pongo spp.): new perspectives for stress monitoring in captive management and conservation.

    Science.gov (United States)

    Carlitz, Esther H D; Kirschbaum, Clemens; Stalder, Tobias; van Schaik, Carolus P

    2014-01-01

    This study examined whether the method of hair cortisol analysis is applicable to orang-utans (Pongo spp.) and can help to advance the objective monitoring of stress in non-human primates. Specifically, we examined whether fundamental prerequisites for hair cortisol analysis are given in orang-utans and, subsequently, whether segmental hair analysis may provide a retrospective calendar of long-term cortisol levels. For this, hair samples were examined from 71 zoo-living orang-utans (38 males, mean age=22.5years; 33 females, mean age=24years) for which detailed records of past living conditions were available. Hair samples were cut from defined body regions and were analyzed either in full length or in segments. Results showed that hair cortisol concentrations (HCC) were unrelated to age or sex of the individual animal. HCC were found to be higher in orang-utans, with perceived long-term stressful periods (mean HCC=43.6±26.5pg/mg, n=13) compared to animals without perceived stressful periods (19.3±5.5pg/mg, n=55, P40cm. The possibility of obtaining a retrospective calendar of stress-related cortisol changes through hair analysis was further supported by data of three case studies showing close correspondence between the segmental HCC results and keeper reports of stress exposure during the respective time periods. Finally, low within-animal variation in HCC from different body regions (CV%: 14.3) suggested that this method may also be applicable to naturally shed hair, e.g., as found in nests of wild orang-utans and other great apes. Therefore, using HCC may provide an ideal non-invasive tool for both captive management as well as conservation in orang-utans and potentially other great apes. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Modulation of the intestinal microbiota alters colitis-associated colorectal cancer susceptibility.

    Directory of Open Access Journals (Sweden)

    Joshua M Uronis

    2009-06-01

    Full Text Available It is well established that the intestinal microbiota plays a key role in the pathogenesis of Crohn's disease (CD and ulcerative colitis (UC collectively referred to as inflammatory bowel disease (IBD. Epidemiological studies have provided strong evidence that IBD patients bear increased risk for the development of colorectal cancer (CRC. However, the impact of the microbiota on the development of colitis-associated cancer (CAC remains largely unknown. In this study, we established a new model of CAC using azoxymethane (AOM-exposed, conventionalized-Il10(-/- mice and have explored the contribution of the host intestinal microbiota and MyD88 signaling to the development of CAC. We show that 8/13 (62% of AOM-Il10(-/- mice developed colon tumors compared to only 3/15 (20% of AOM- wild-type (WT mice. Conventionalized AOM-Il10(-/- mice developed spontaneous colitis and colorectal carcinomas while AOM-WT mice were colitis-free and developed only rare adenomas. Importantly, tumor multiplicity directly correlated with the presence of colitis. Il10(-/- mice mono-associated with the mildly colitogenic bacterium Bacteroides vulgatus displayed significantly reduced colitis and colorectal tumor multiplicity compared to Il10(-/- mice. Germ-free AOM-treated Il10(-/- mice showed normal colon histology and were devoid of tumors. Il10(-/-; Myd88(-/- mice treated with AOM displayed reduced expression of Il12p40 and Tnfalpha mRNA and showed no signs of tumor development. We present the first direct demonstration that manipulation of the intestinal microbiota alters the development of CAC. The TLR/MyD88 pathway is essential for microbiota-induced development of CAC. Unlike findings obtained using the AOM/DSS model, we demonstrate that the severity of chronic colitis directly correlates to colorectal tumor development and that bacterial-induced inflammation drives progression from adenoma to invasive carcinoma.

  7. 'Outbreak Gold Standard' selection to provide optimized threshold for infectious diseases early-alert based on China Infectious Disease Automated-alert and Response System.

    Science.gov (United States)

    Wang, Rui-Ping; Jiang, Yong-Gen; Zhao, Gen-Ming; Guo, Xiao-Qin; Michael, Engelgau

    2017-12-01

    The China Infectious Disease Automated-alert and Response System (CIDARS) was successfully implemented and became operational nationwide in 2008. The CIDARS plays an important role in and has been integrated into the routine outbreak monitoring efforts of the Center for Disease Control (CDC) at all levels in China. In the CIDARS, thresholds are determined using the "Mean+2SD‟ in the early stage which have limitations. This study compared the performance of optimized thresholds defined using the "Mean +2SD‟ method to the performance of 5 novel algorithms to select optimal "Outbreak Gold Standard (OGS)‟ and corresponding thresholds for outbreak detection. Data for infectious disease were organized by calendar week and year. The "Mean+2SD‟, C1, C2, moving average (MA), seasonal model (SM), and cumulative sum (CUSUM) algorithms were applied. Outbreak signals for the predicted value (Px) were calculated using a percentile-based moving window. When the outbreak signals generated by an algorithm were in line with a Px generated outbreak signal for each week, this Px was then defined as the optimized threshold for that algorithm. In this study, six infectious diseases were selected and classified into TYPE A (chickenpox and mumps), TYPE B (influenza and rubella) and TYPE C [hand foot and mouth disease (HFMD) and scarlet fever]. Optimized thresholds for chickenpox (P 55 ), mumps (P 50 ), influenza (P 40 , P 55 , and P 75 ), rubella (P 45 and P 75 ), HFMD (P 65 and P 70 ), and scarlet fever (P 75 and P 80 ) were identified. The C1, C2, CUSUM, SM, and MA algorithms were appropriate for TYPE A. All 6 algorithms were appropriate for TYPE B. C1 and CUSUM algorithms were appropriate for TYPE C. It is critical to incorporate more flexible algorithms as OGS into the CIDRAS and to identify the proper OGS and corresponding recommended optimized threshold by different infectious disease types.

  8. Effect of Co-60 gamma irradiated chitosan and phosphorus fertilizer on growth, yield and trigonelline content of Trigonella foenum-graecum L.

    Directory of Open Access Journals (Sweden)

    Tariq Ahmad Dar

    2015-07-01

    Full Text Available Natural marine polysaccharides such as chitosan, sodium alginate and carrageenan; after depolymerization by different techniques, have shown promising plant growth promoting and other biological activities. Chitosan after irradiation with Co-60 gamma-rays have proven to be a miraculous plant growth promoter in different plants. Trigonelline; an anti-diabetic compound is obtained mainly from the seeds of Fenugreek (Trigonella foenum-graecum L.. Trigonelline counteracts diabetes mellitus (DM through the operation of the mechanisms of insulin secretion, modulation of β-cell regeneration and stimulation of activity of glucose metabolism related enzymes. Considering the medicinal importance a pot experiment was conducted to investigate the effect of foliar application of Co-60 gamma irradiated chitosan (IC with soil applied phosphorus supplement on growth, biochemical and quality attributes of fenugreek. Four concentrations of irradiated chitosan were used (0, 40, 80 and 120 mg L−1 individually as well as in combination with single dose of phosphorus 40 kg ha−1. Un-irradiated chitosan (UN 40 mg L−1 and de-ionized water were used as control. IC significantly affected almost all the parameters including seed yield, trigonelline content and trigonelline yield. There were 10 treatments and among all, P40 + IC 40 mg L−1 proved to be the best, which increased total alkaloid content by 34.9%, seed yield by 125.4%, and trigonelline content by 17.8%. Contents of photosynthetic pigments and activity of nitrate reductase, carbonic anhydrase enzymes were also significantly enhanced.

  9. IL-17/Th17 Pathway Is Activated in Acne Lesions

    Science.gov (United States)

    Kelhälä, Hanna-Leena; Palatsi, Riitta; Fyhrquist, Nanna; Lehtimäki, Sari; Väyrynen, Juha P.; Kallioinen, Matti; Kubin, Minna E.; Greco, Dario; Tasanen, Kaisa; Alenius, Harri; Bertino, Beatrice; Carlavan, Isabelle; Mehul, Bruno; Déret, Sophie; Reiniche, Pascale; Martel, Philippe; Marty, Carine; Blume-Peytavi, Ulrike; Voegel, Johannes J.; Lauerma, Antti

    2014-01-01

    The mechanisms of inflammation in acne are currently subject of intense investigation. This study focused on the activation of adaptive and innate immunity in clinically early visible inflamed acne lesions and was performed in two independent patient populations. Biopsies were collected from lesional and non-lesional skin of acne patients. Using Affymetrix Genechips, we observed significant elevation of the signature cytokines of the Th17 lineage in acne lesions compared to non-lesional skin. The increased expression of IL-17 was confirmed at the RNA and also protein level with real-time PCR (RT-PCR) and Luminex technology. Cytokines involved in Th17 lineage differentiation (IL-1β, IL-6, TGF-β, IL23p19) were remarkably induced at the RNA level. In addition, proinflammatory cytokines and chemokines (TNF-α, IL-8, CSF2 and CCL20), Th1 markers (IL12p40, CXCR3, T-bet, IFN-γ), T regulatory cell markers (Foxp3, IL-10, TGF-β) and IL-17 related antimicrobial peptides (S100A7, S100A9, lipocalin, hBD2, hBD3, hCAP18) were induced. Importantly, immunohistochemistry revealed significantly increased numbers of IL-17A positive T cells and CD83 dendritic cells in the acne lesions. In summary our results demonstrate the presence of IL-17A positive T cells and the activation of Th17-related cytokines in acne lesions, indicating that the Th17 pathway is activated and may play a pivotal role in the disease process, possibly offering new targets of therapy. PMID:25153527

  10. Immunomodulation of murine collagen-induced arthritis by N, N-dimethylglycine and a preparation of Perna canaliculus

    Directory of Open Access Journals (Sweden)

    Davis Paul

    2007-06-01

    Full Text Available Abstract Background Rheumatoid arthritis (RA and its accepted animal model, murine collagen-induced arthritis (CIA, are classic autoimmune inflammatory diseases which require proinflammatory cytokine production for pathogenesis. We and others have previously used N, N-dimethylglycine (DMG and extracts from the New Zealand green-lipped mussel Perna canaliculus (Perna as potent immunomodulators to modify ongoing immune and/or inflammatory responses. Methods In our initial studies, we treated lipopolysaccahride (LPS stimulated THP-1 monocytes in vitro with increasing concentrations of Perna extract or DMG. Additionally, we treated rat peripheral blood neutrophils with increasing concentrations of Perna extract and measured superoxide burst. In subsequent in vivo experiments, CIA was induced by administration of type II collagen; rats were prophylactically treated with either Perna or DMG, and then followed for disease severity. Finally, to test whether Perna and/or DMG could block or inhibit an ongoing pathologic disease process, we induced CIA in mice and treated them therapeutically with either of the two immunomodulators. Results Following LPS stimulation of THP-1 monocytes, we observed dose-dependent reductions in TNF-α and IL-12p40 production in Perna treated cultures. DMG treatment, however, showed significant increases in both of these cytokines in the range of 0.001–1 μM. We also demonstrate that in vitro neutrophil superoxide burst activity is dose-dependently reduced in the presence of Perna. Significant reductions in disease incidence, onset, and severity of CIA in rats were noted following prophylactic treatment with either of the two immunomodulators. More importantly, amelioration of mouse CIA was observed following therapeutic administration of Perna. In contrast, DMG appeared to have little effect in mice and may act in a species-specific manner. Conclusion These data suggest that Perna, and perhaps DMG, may be useful

  11. Reducing the activity and secretion of microbial antioxidants enhances the immunogenicity of BCG.

    Directory of Open Access Journals (Sweden)

    Shanmugalakshmi Sadagopal

    Full Text Available In early clinical studies, the live tuberculosis vaccine Mycobacterium bovis BCG exhibited 80% protective efficacy against pulmonary tuberculosis (TB. Although BCG still exhibits reliable protection against TB meningitis and miliary TB in early childhood it has become less reliable in protecting against pulmonary TB. During decades of in vitro cultivation BCG not only lost some genes due to deletions of regions of the chromosome but also underwent gene duplication and other mutations resulting in increased antioxidant production.To determine whether microbial antioxidants influence vaccine immunogenicity, we eliminated duplicated alleles encoding the oxidative stress sigma factor SigH in BCG Tice and reduced the activity and secretion of iron co-factored superoxide dismutase. We then used assays of gene expression and flow cytometry with intracellular cytokine staining to compare BCG-specific immune responses in mice after vaccination with BCG Tice or the modified BCG vaccine. Compared to BCG, the modified vaccine induced greater IL-12p40, RANTES, and IL-21 mRNA in the spleens of mice at three days post-immunization, more cytokine-producing CD8+ lymphocytes at the peak of the primary immune response, and more IL-2-producing CD4+ lymphocytes during the memory phase. The modified vaccine also induced stronger secondary CD4+ lymphocyte responses and greater clearance of challenge bacilli.We conclude that antioxidants produced by BCG suppress host immune responses. These findings challenge the hypothesis that the failure of extensively cultivated BCG vaccines to prevent pulmonary tuberculosis is due to over-attenuation and suggest instead a new model in which BCG evolved to produce more immunity-suppressing antioxidants. By targeting these antioxidants it may be possible to restore BCG's ability to protect against pulmonary TB.

  12. Anti-inflammatory activity of edible oyster mushroom is mediated through the inhibition of NF-κB and AP-1 signaling

    Directory of Open Access Journals (Sweden)

    Simon James

    2011-05-01

    Full Text Available Abstract Background Mushrooms are well recognized for their culinary properties as well as for their potency to enhance immune response. In the present study, we evaluated anti-inflammatory properties of an edible oyster mushroom (Pleurotus ostreatus in vitro and in vivo. Methods RAW264.7 murine macrophage cell line and murine splenocytes were incubated with the oyster mushroom concentrate (OMC, 0-100 μg/ml in the absence or presence of lipopolysacharide (LPS or concanavalin A (ConA, respectively. Cell proliferation was determined by MTT assay. Expression of cytokines and proteins was measured by ELISA assay and Western blot analysis, respectively. DNA-binding activity was assayed by the gel-shift analysis. Inflammation in mice was induced by intraperitoneal injection of LPS. Results OMC suppressed LPS-induced secretion of tumor necrosis factor-α (TNF-α, interleukin-6 (IL-6, and IL-12p40 from RAW264.7 macrophages. OMC inhibited LPS-induced production of prostaglandin E2 (PGE2 and nitric oxide (NO through the down-regulation of expression of COX-2 and iNOS, respectively. OMC also inhibited LPS-dependent DNA-binding activity of AP-1 and NF-κB in RAW264.7 cells. Oral administration of OMC markedly suppressed secretion of TNF-α and IL-6 in mice challenged with LPS in vivo. Anti-inflammatory activity of OMC was confirmed by the inhibition of proliferation and secretion of interferon-γ (IFN-γ, IL-2, and IL-6 from concanavalin A (ConA-stimulated mouse splenocytes. Conclusions Our study suggests that oyster mushroom possesses anti-inflammatory activities and could be considered a dietary agent against inflammation. The health benefits of the oyster mushroom warrant further clinical studies.

  13. Knowledge about tuberculosis among beneficiaries of homeless shelters and eating houses for poor people located in Katowice

    Directory of Open Access Journals (Sweden)

    Dominka Myśliwiec

    2013-06-01

    Full Text Available Introduction. Tuberculosis (TB is still an important and serious health problem of the XXI century. A group of people that are particularly at risk are the homeless and the poor. Objective. The main objective of this paper was the assessment of knowledge regarding TB of the poor from soup kitchens, homeless emergency shelter, hostels, in the Katowice city. Materials and methods. The examination covered 175 individuals (69.7% men and 30.3% women and was conducted in February 2011 in six institutions which are involved in helping the homeless and those who are in a difficult financial situation. Questionnaire was completed by qualified for the examination subjects on their current life conditions and knowledge regarding TB. Statistical analysis was based on statistical programme Statistica 8.0. assuming that the level of statistical significance was p40.05. Results. The majority of the examined individuals were in their early 60’s (68.0%, homeless (66.9%, unemployed (54.9% with preliminary and vocational background. From TB suffered 8,0%. Most of the subjects (96.6% were aware of this disease and the main information sources on TB have came from families (43.2% and friends (45.6%. Mostly the characteristic symptoms of tuberculosis and the risk factors were defined correctly. In the prophylactic research and the educational programme did not participate 82,3% of subjects. Conclusion. The subjects’ basic knowledge is fairly good, however the more detailed and accurate questions were asked, the more difficult it was for them to answer. There is a significant shortage of health programmes, which aim at prevention and education of the interested parties.

  14. Lipophilic fractions from the marine sponge Halichondria sitiens decrease secretion of pro-inflammatory cytokines by dendritic cells and decrease their ability to induce a Th1 type response by allogeneic CD4+ T cells.

    Science.gov (United States)

    Di, Xiaxia; Oskarsson, Jon T; Omarsdottir, Sesselja; Freysdottir, Jona; Hardardottir, Ingibjorg

    2017-12-01

    Halichondria (Halichondriidae) marine sponges contain components possessing various biological activities, but immunomodulation is not among the ones reported. This study evaluated the immunomodulatory effects of fractions/compounds from Halichondria sitiens Schmidt. Crude dichloromethane/methanol extracts of H. sitiens were subjected to various chromatographic techniques to obtain fractions/compounds with immunomodulatory activity, using bioassay-guided isolation. The effects of the fractions/compounds were determined by measuring secretion of cytokines and expression of surface molecules by dendritic cells (DCs) and their ability to stimulate and modify cytokine secretion by allogeneic CD4 + T cells. The bioactive fractions were chemically analyzed to identify the immunomodulatory constituents by 1D, 2D NMR, and HRMS data. Several lipophilic fractions from H. sitiens at 10 μg/mL decreased secretion of the pro-inflammatory cytokines IL-12p40 and IL-6 by the DCs, with maximum inhibition being 64% and 25%, respectively. In addition, fractions B3b3F and B3b3J decreased the ability of DCs to induce T cell secretion of IFN-γ. Fraction B3b3 induced morphological changes in DCs, characterized by extreme elongation of dendrites and cell clustering. Chemical screening revealed the presence of glycerides and some minor unknown constituents in the biologically active fractions. One new glyceride, 2,3-dihydroxypropyl 2-methylhexadecanoate (1), was isolated from one fraction and two known compounds, 3-[(1-methoxyhexadecyl)oxy]propane-1,2-diol (2) and monoheptadecanoin (3), were identified in another, but none of them had immunomodulatory activity. These results demonstrate that several lipophilic fractions from H. sitiens have anti-inflammatory effects on DCs and decrease their ability to induce a Th1 type immune response.

  15. The Attenuated Brucella abortus Strain 19 Invades, Persists in, and Activates Human Dendritic Cells, and Induces the Secretion of IL-12p70 but Not IL-23

    Science.gov (United States)

    Weinhold, Mario; Eisenblätter, Martin; Jasny, Edith; Fehlings, Michael; Finke, Antje; Gayum, Hermine; Rüschendorf, Ursula; Renner Viveros, Pablo; Moos, Verena; Allers, Kristina; Schneider, Thomas; Schaible, Ulrich E.; Schumann, Ralf R.; Mielke, Martin E.; Ignatius, Ralf

    2013-01-01

    Background Bacterial vectors have been proposed as novel vaccine strategies to induce strong cellular immunity. Attenuated strains of Brucella abortus comprise promising vector candidates since they have the potential to induce strong CD4+ and CD8+ T-cell mediated immune responses in the absence of excessive inflammation as observed with other Gram-negative bacteria. However, some Brucella strains interfere with the maturation of dendritic cells (DCs), which is essential for antigen-specific T-cell priming. In the present study, we investigated the interaction of human monocyte-derived DCs with the smooth attenuated B. abortus strain (S) 19, which has previously been employed successfully to vaccinate cattle. Methodology/Principal findings We first looked into the potential of S19 to hamper the cytokine-induced maturation of DCs; however, infected cells expressed CD25, CD40, CD80, and CD86 to a comparable extent as uninfected, cytokine-matured DCs. Furthermore, S19 activated DCs in the absence of exogeneous stimuli, enhanced the expression of HLA-ABC and HLA-DR, and was able to persist intracellularly without causing cytotoxicity. Thus, DCs provide a cellular niche for persisting brucellae in vivo as a permanent source of antigen. S19-infected DCs produced IL-12/23p40, IL-12p70, and IL-10, but not IL-23. While heat-killed bacteria also activated DCs, soluble mediators were not involved in S19-induced activation of human DCs. HEK 293 transfectants revealed cellular activation by S19 primarily through engagement of Toll-like receptor (TLR)2. Conclusions/Significance Thus, as an immunological prerequisite for vaccine efficacy, B. abortus S19 potently infects and potently activates (most likely via TLR2) human DCs to produce Th1-promoting cytokines. PMID:23805193

  16. Adipose tissue inflammation and reduced insulin sensitivity in ovariectomized mice occurs in the absence of increased adiposity.

    Science.gov (United States)

    Vieira Potter, Victoria J; Strissel, Katherine J; Xie, Chen; Chang, Eugene; Bennett, Grace; Defuria, Jason; Obin, Martin S; Greenberg, Andrew S

    2012-09-01

    Menopause promotes central obesity, adipose tissue (AT) inflammation, and insulin resistance (IR). Both obesity and the loss of estrogen can activate innate and adaptive immune cells (macrophages, T cells). The respective impacts of weight gain and loss of ovarian hormones on AT inflammation and IR are poorly understood. Here we determined the temporal kinetics of fat accretion, AT inflammation, and IR over a 26-wk time course in ovariectomized (OVX) mice, a model of menopause. OVX and sham-operated (SHM) C57BL6 mice were fed a normal chow diet. Weight, body composition (magnetic resonance imaging), total and regional adiposity, activity, food intake, AT crown-like structures, biohumoral measures, and insulin sensitivity (insulin tolerance testing and homeostatic model assessment) were determined at wk 12, 20, and 26. Macrophages and T cells from perigonadal AT were immunophenotyped by fluorescence-associated cell sorting, and perigonadal adipose tissue (PGAT) gene expression was quantified by quantitative PCR. OVX mice (≈ 31 g) became fatter than SHM mice (≈ 26 g) by wk 12, but mice were equally insulin sensitive. PGAT of OVX mice contained more T cells but expressed higher levels of M2-MΦ (arginase-1) and T cell-regulatory (cytotoxic T-lymphocyte antigen 4) genes. At wk 20, both OVX and SHM mice weighed approximately 35 g and were equally insulin sensitive with comparable amounts of PGAT and total body fat. OVX mice became less insulin sensitive than SHM mice by wk 26, coincident with the down-regulation of PGAT arginase-1 (-20-fold) and cytotoxic T-lymphocyte antigen 4 (2-fold) and up-regulation of M1/Th1 genes CD11c (+2-fold), IL12p40 (+2-fold), and interferon-γ (+78-fold). Ovarian hormone loss in mice induces PGAT inflammation and IR by mechanisms that can be uncoupled from OVX-induced obesity.

  17. Genetic contribution of CISH promoter polymorphisms to susceptibility to tuberculosis in Chinese children.

    Directory of Open Access Journals (Sweden)

    Lin Sun

    Full Text Available Tuberculosis (TB is the leading cause of death due to an infectious disease worldwide, particularly in developing countries. A series of candidate genes have been suggested to be associated with development of TB disease. Among them, the human Cytokine-inducible Src homology 2(SH2 domain protein (CISH gene has been very recently reported to be involved in T cell activation and differentiation in response to Mycobacterium tuberculosis infection. Here, we studied the association between CISH promoter polymorphisms and pediatric TB. A case-control study enrolled 352 TB patients and 527 healthy controls, who were of Han Chinese ethnicity and aged from 0.2 to 18 years. CISH gene promoter SNPs rs414171, rs622502 and rs809451 were genotyped in all subjects and transcriptional activity, mRNA level, and plasma cytokine level of subjects with different genotypes were further examined. Carriers with rs414171TT homozygotes and rs809451GC heterozygotes had a 1.78-fold (95% CI,1.16-2.74 and 1.86-fold (95% CI, 1.26-2.74 excess risk of developing TB compared to those with wild-type genotypes. A greater risk of TB disease was observed in population carrying C(-809451-T(-414171-C(-622502 haplotype (OR 3.66, 95% CI:2.12-6.32. The G(-809451-A(-414171-C(-622502-containing CISH promoter drove a 5.43-fold increased reporter expression compared to the C(-809451-T(-414171-C(-622502-containing counterpart in Hela cell lines (P = 0.0009. PBMCs carrying rs414171TT homozygotes and rs809451GC heterozygotes showed a reduced CISH mRNA level compared to cells carrying wild type genotypes. Individuals with the rs414171TT genotype had significantly increased IL-12p40 and IL-10 production. In conclusion, CISH promoter rs414171 and rs809451 polymorphisms may play a vital role in mediating individual susceptibility to tuberculosis.

  18. Genetic contribution of CISH promoter polymorphisms to susceptibility to tuberculosis in Chinese children.

    Science.gov (United States)

    Sun, Lin; Jin, Ya-qiong; Shen, Chen; Qi, Hui; Chu, Ping; Yin, Qing-qin; Li, Jie-qiong; Tian, Jian-ling; Jiao, Wei-wei; Xiao, Jing; Shen, A-dong

    2014-01-01

    Tuberculosis (TB) is the leading cause of death due to an infectious disease worldwide, particularly in developing countries. A series of candidate genes have been suggested to be associated with development of TB disease. Among them, the human Cytokine-inducible Src homology 2(SH2) domain protein (CISH) gene has been very recently reported to be involved in T cell activation and differentiation in response to Mycobacterium tuberculosis infection. Here, we studied the association between CISH promoter polymorphisms and pediatric TB. A case-control study enrolled 352 TB patients and 527 healthy controls, who were of Han Chinese ethnicity and aged from 0.2 to 18 years. CISH gene promoter SNPs rs414171, rs622502 and rs809451 were genotyped in all subjects and transcriptional activity, mRNA level, and plasma cytokine level of subjects with different genotypes were further examined. Carriers with rs414171TT homozygotes and rs809451GC heterozygotes had a 1.78-fold (95% CI,1.16-2.74) and 1.86-fold (95% CI, 1.26-2.74) excess risk of developing TB compared to those with wild-type genotypes. A greater risk of TB disease was observed in population carrying C(-809451)-T(-414171)-C(-622502) haplotype (OR 3.66, 95% CI:2.12-6.32). The G(-809451)-A(-414171)-C(-622502)-containing CISH promoter drove a 5.43-fold increased reporter expression compared to the C(-809451)-T(-414171)-C(-622502)-containing counterpart in Hela cell lines (P = 0.0009). PBMCs carrying rs414171TT homozygotes and rs809451GC heterozygotes showed a reduced CISH mRNA level compared to cells carrying wild type genotypes. Individuals with the rs414171TT genotype had significantly increased IL-12p40 and IL-10 production. In conclusion, CISH promoter rs414171 and rs809451 polymorphisms may play a vital role in mediating individual susceptibility to tuberculosis.

  19. Differential Effect of Viable Versus Necrotic Neutrophils on Mycobacterium tuberculosis Growth and Cytokine Induction in Whole Blood

    Directory of Open Access Journals (Sweden)

    David M. Lowe

    2018-04-01

    Full Text Available Neutrophils exert both positive and negative influences on the host response to tuberculosis, but the mechanisms by which these differential effects are mediated are unknown. We studied the impact of live and dead neutrophils on the control of Mycobacterium tuberculosis using a whole blood bioluminescence-based assay, and assayed supernatant cytokine concentrations using Luminex™ technology and ELISA. CD15+ granulocyte depletion from blood prior to infection with M. tuberculosis-lux impaired control of mycobacteria by 96 h, with a greater effect than depletion of CD4+, CD8+, or CD14+ cells (p < 0.001. Augmentation of blood with viable granulocytes significantly improved control of mycobacteria by 96 h (p = 0.001, but augmentation with necrotic granulocytes had the opposite effect (p = 0.01. Both augmentations decreased supernatant concentrations of tumor necrosis factor and interleukin (IL-12 p40/p70, but necrotic granulocyte augmentation also increased concentrations of IL-10, G-CSF, GM-CSF, and CCL2. Necrotic neutrophil augmentation reduced phagocytosis of FITC-labeled M. bovis BCG by all phagocytes, whereas viable neutrophil augmentation specifically reduced early uptake by CD14+ cells. The immunosuppressive effect of dead neutrophils required necrotic debris rather than supernatant. We conclude that viable neutrophils enhance control of M. tuberculosis in blood, but necrotic neutrophils have the opposite effect—the latter associated with induction of IL-10, growth factors, and chemoattractants. Our findings suggest a mechanism by which necrotic neutrophils may exert detrimental effects on the host response in active tuberculosis.

  20. Análisis de la localización, dinámica intracelular y producción de 02 - por el sistema NADPH oxidasa de las células fagocíticas

    Directory of Open Access Journals (Sweden)

    Pablo Patiño

    2001-04-01

    Full Text Available

    El sistema NADPH oxidasa, un sistema encargado de producir
    anión superóxido (O2 - en las células fagocíticas, está formado por las proteínas: gp91 phox, p22 phox, p47 phox, p67 phox, p40 phox y la proteína Rac. Las células COS-7, una línea celular de riñón de simio, que expresa endógenamente Rac1, y que por transfección estable expresan gp91 phox, p47 phox y p22 phox, pueden ser cotransfectadas adicionalmente con vectores episomales pGFP-N3, pEGFP-C1 y pCDNA3.1zeo(+ que contengan el cDNA tipo silvestre y mutante de la proteína p67 phox obtenidos por mutagénesis sitio-dirigida. Estos vectores contienen el gen de la proteína verde fluorescente (GFP, útil para explorar la localización intracelular y la dinámica de los componentes del sistema oxidasa. Después de la cotransfección, se estimulan las células con PMA y se determina la producción de O2
    - y la señal de fluorescencia generada por GFP de forma directa en células vivas por microscopía confocal.

     

     

  1. Can we identify mothers at-risk for postpartum anxiety in the immediate postpartum period using the State-Trait Anxiety Inventory?

    Science.gov (United States)

    Dennis, Cindy-Lee; Coghlan, Michelle; Vigod, Simone

    2013-09-25

    This study assessed the stability of maternal anxiety and concordance between State-Trait Anxiety Inventory (STAI) scores in the immediate postpartum period to 8 weeks postpartum. A population-based sample of 522 mothers completed the STAI at 1, 4, and 8 weeks postpartum. Sensitivity, specificity, and predictive power of the 1-week STAI in relation to identifying mothers with elevated STAI scores at 4 and 8 weeks was determined. Predictive power of the STAI was further assessed using odds ratios and receiver operator characteristic (ROC) curves. At 1 week postpartum, 22.6% of mothers scored >40 on the STAI, decreasing to 17.2% at 4 weeks and 14.8% at 8 weeks. Using the cut-off score of >40, the 1-week STAI accurately classified 84.0% mothers at 4 weeks and 83.6% at 8 weeks with or without anxiety symptomatology. The 1-week STAI was significantly correlated to the 4-week (r=0.68, p40 were 15.2 times more likely at 4 weeks (95% CI=8.9-26.1) and 14.0 times more likely at 8 weeks (95% CI=7.9-24.8) to exhibit postpartum anxiety symptomatology. Psychiatric interviews were not completed in collaboration with the STAI and specific types of anxiety disorders were not identified. A cut-off score of >40 on the STAI administered early in the postpartum period is recommended in a 2-phase identification program in order to not miss mothers with postpartum anxiety. © 2013 Elsevier B.V. All rights reserved.

  2. Phosphorus transformation in poultry litter and litter-treated Oxisol of Brazil assessed by 31P-NMR and wet chemical fractionation

    Directory of Open Access Journals (Sweden)

    César Roriz de Souza

    2012-11-01

    Full Text Available Large quantities of poultry litter are being produced in Brazil, which contain appreciable amounts of phosphorus (P that could be of environmental concern. To assess the immediate environmental threat, five poultry litters composed of diverse bedding material were incubated for 43 days under greenhouse conditions. The litters consisted of: coffee bean husk (CH; wood chips (WC; rice husk (RH; ground corn cobs (CC and ground napier grass (NG (Pennisetum purpureum Schum., in which the change in forms of soluble P was evaluated using 31P NMR spectroscopy. On average, 80.2 and 19.8 % of the total P in the extract, respectively, accounted for the inorganic and organic forms before incubation and 48 % of the organic P was mineralized to inorganic P in 43 days of incubation. Wide variation in the organic P mineralization rate (from 82 % -WC to 4 % - NG was observed among litters. Inorganic orthophosphate (99.9 % and pyrophosphate (0.1 % were the only inorganic P forms, whereas the organic P forms orthophosphate monoesters (76.3 % and diester (23.7 % were detected. Diester P compounds were mineralized almost completely in all litters, except in the CH litter, within the incubation period. Pyrophosphates contributed with less than 0.5% and remained unaltered during the incubation period. Wood-chip litter had a higher organic P (40 % content and a higher diester: monoester ratio; it was therefore mineralized rapidly, within the first 15 days, achieving steady state by the 29th day. Distinct mineralization patterns were observed in the litter when incubated with a clayey Oxisol. The substantial decrease observed in the organic P fraction (Po of the litter types followed the order: CH (45 % > CC (25 % > RH (13 % ≈ NG (12 % > WC (5 %, whereas the Pi fraction increased. Incubation of RH litter in soil slowed down the mineralization of organic P.

  3. Standard treatment regimens for nongonococcal urethritis have similar but declining cure rates: a randomized controlled trial.

    Science.gov (United States)

    Manhart, Lisa E; Gillespie, Catherine W; Lowens, M Sylvan; Khosropour, Christine M; Colombara, Danny V; Golden, Matthew R; Hakhu, Navneet R; Thomas, Katherine K; Hughes, James P; Jensen, Nicole L; Totten, Patricia A

    2013-04-01

    Azithromycin or doxycycline is recommended for nongonococcal urethritis (NGU); recent evidence suggests their efficacy has declined. We compared azithromycin and doxycycline in men with NGU, hypothesizing that azithromycin was more effective than doxycycline. From January 2007 to July 2011, English-speaking males ≥16 years, attending a sexually transmitted diseases clinic in Seattle, Washington, with NGU (visible urethral discharge or ≥5 polymorphonuclear leukocytes per high-power field [PMNs/HPF]) were eligible for this double-blind, parallel-group superiority trial. Participants received active azithromycin (1 g) + placebo doxycycline or active doxycycline (100 mg twice daily for 7 days) + placebo azithromycin. Urine was tested for Chlamydia trachomatis (CT), Mycoplasma genitalium (MG), Ureaplasma urealyticum biovar 2 (UU-2), and Trichomonas vaginalis (TV) using nucleic acid amplification tests. Clinical cure (urethral symptoms and absence of discharge) and microbiologic cure (negative tests for CT, MG, and/or UU-2) were determined after 3 weeks. Of 606 men, 304 were randomized to azithromycin and 302 to doxycycline; CT, MG, TV, and UU-2 were detected in 24%, 13%, 2%, and 23%, respectively. In modified intent-to-treat analyses, 172 of 216 (80%; 95% confidence interval [CI], 74%-85%) receiving azithromycin and 157 of 206 (76%; 95% CI, 70%-82%) receiving doxycycline experienced clinical cure (P = .40). In pathogen-specific analyses, clinical cure did not differ by arm, nor did microbiologic cure differ for CT (86% vs 90%, P = .56), MG (40% vs 30%, P = .41), or UU-2 (75% vs 70%, P = .50). No unexpected adverse events occurred. Clinical and microbiologic cure rates for NGU were somewhat low and there was no significant difference between azithromycin and doxycycline. Mycoplasma genitalium treatment failure was extremely common. Clinical Trials Registration.NCT00358462.

  4. Effects of different cutting centers on LASIK surgery in myopic patients

    Directory of Open Access Journals (Sweden)

    Yan-Wei Liu

    2017-07-01

    Full Text Available AIM:To investigate the effect of different cutting centers on the visual acuity, refractive diopter and visual quality of patients undergoing laser assisted in situ keratomileusis(LASIK. METHODS: A total of 80 patients(160 eyeswith myopia treated by elective LASIK were divided into two groups. Thirty-six cases(72 eyeswith visual axis corneal reflection point(VACRPas the cutting center were included into the VACRP group while 44 cases(88 eyeswith pupil center(PCas the cutting center were included into the PC group. The uncorrected visual acuity(UCVA, the best corrected visual acuity(BCVA, refractive diopter, corneal aberration \\〖total corneal and anterior corneal surface higher-order aberrations(HOA, spherical aberration(Z40, vertical coma(Z3-1, horizontal coma(totZ31and offset of cutting centers were determined before surgery and 1mo after surgery. RESULTS: There was no difference in the probability of UCVA ≥ 0.1, BCVA and refractive diopter between the two groups at 1mo after surgery(P>0.05. The astigmatism and cutting center deviation of VACRP group were lower than those of PC group(P40, totZ3-1, totZ31, froHOA, froZ3-1、froZ31 and froZ40 were lower in VACRP group than PC group at 1mo after surgery(PCONCLUSION: The UCVA of patients treated with both cutting centers for LASIK is good but VACRP has more advantages in reducing the offset of cutting center and improving postoperative visual quality.

  5. Novel Cell Preservation Technique to Extend Bovine In Vitro White Blood Cell Viability.

    Directory of Open Access Journals (Sweden)

    Emilie L Laurin

    Full Text Available Although cell-mediated immunity based diagnostics can be integral assays for early detection of various diseases of dairy cows, processing of blood samples for these tests is time-sensitive, often within 24 hours of collection, to maintain white blood cell viability. Therefore, to improve utility and practicality of such assays, the objective of this study was to assess the use of a novel white blood cell preservation technology in whole bovine blood. Blood samples from ten healthy cows were each divided into an unpreserved control sample and a test sample preserved with commercially-available cell transport medium. Samples were maintained at room temperature and stimulated with the mitogens pokeweed and concanavalinA, as well as with interleukin-12 p40. Stimulation was completed on days 1, 5, and 8 post-sampling. Viability of white blood cells was assessed through interferon gamma production determined with a commercial enzyme linked immunosorbent assay. In addition, mononuclear cell viability was assessed with propidium iodide flow cytometry. Greater interferon gamma production was observed on days 5 and 8 post-collection in preserved samples, with both pokeweed and concanavalinA stimulating positive interferon gamma production on day 5 post-collection. A greater proportion of the amount of interferon gamma produced on day 1 continued to be produced on days 5 and 8 post-collection with concanavalinA stimulation (with or without interleukin 12 as compared to pokeweed stimulation. Additionally, viable mononuclear cells were still present at eight days post-collection, with a higher mean proportion detected at days 5 and 8 in all stimulated preserved samples. This practical and simple method to extend in vitro white blood cell viability could benefit the efficient utilization of cell-based blood tests in ruminants.

  6. Ginseng Rb fraction protects glia, neurons and cognitive function in a rat model of neurodegeneration.

    Directory of Open Access Journals (Sweden)

    Kangning Xu

    Full Text Available The loss and injury of neurons play an important role in the onset of various neurodegenerative diseases, while both microgliosis and astrocyte loss or dysfunction are significant causes of neuronal degeneration. Previous studies have suggested that an extract enriched panaxadiol saponins from ginseng has more neuroprotective potential than the total saponins of ginseng. The present study investigated whether a fraction of highly purified panaxadiol saponins (termed as Rb fraction was protective for both glia and neurons, especially GABAergic interneurons, against kainic acid (KA-induced excitotoxicity in rats. Rats received Rb fraction at 30 mg/kg (i.p., 40 mg/kg (i.p. or saline followed 40 min later by an intracerebroventricular injection of KA. Acute hippocampal injury was determined at 48 h after KA, and impairment of hippocampus-dependent learning and memory as well as delayed neuronal injury was determined 16 to 21 days later. KA injection produced significant acute hippocampal injuries, including GAD67-positive GABAergic interneuron loss in CA1, paralbumin (PV-positive GABAergic interneuron loss, pyramidal neuron degeneration and astrocyte damage accompanied with reactive microglia in both CA1 and CA3 regions of the hippocampus. There was also a delayed loss of GAD67-positive interneurons in CA1, CA3, hilus and dentate gyrus. Microgliosis also became more severe 21 days later. Accordingly, KA injection resulted in hippocampus-dependent spatial memory impairment. Interestingly, the pretreatment with Rb fraction at 30 or 40 mg/kg significantly protected the pyramidal neurons and GABAergic interneurons against KA-induced acute excitotoxicity and delayed injury. Rb fraction also prevented memory impairments and protected astrocytes from KA-induced acute excitotoxicity. Additionally, microglial activation, especially the delayed microgliosis, was inhibited by Rb fraction. Overall, this study demonstrated that Rb fraction protected both

  7. Clinical Outcome of Degenerative Mitral Regurgitation: Critical Importance of Echocardiographic Quantitative Assessment in Routine Practice.

    Science.gov (United States)

    Antoine, Clemence; Benfari, Giovanni; Michelena, Hector I; Malouf, Joseph F; Nkomo, Vuyisile T; Thapa, Prabin; Enriquez-Sarano, Maurice

    2018-05-31

    Background -Echocardiographic quantitation of degenerative mitral regurgitation (DMR) is recommended whenever possible in clinical guidelines but is criticized and its scalability to routine clinical practice doubted. We hypothesized that echocardiographic DMR quantitation, performed in routine clinical practice by multiple practitioners predicts independently long-term survival, and thus is essential to DMR management. Methods -We included patients diagnosed with isolated mitral-valve-prolapse 2003-2011 and any degree of MR quantified by any physician/sonographer in routine clinical practice. Clinical/echocardiographic data acquired at diagnosis were retrieved electronically. Endpoint was mortality under medical treatment analyzed by Kaplan-Meir method and Proportional-Hazard models. Results -The cohort included 3914 patients (55% male) aged 62±17 years, with left ventricular ejection fraction (LVEF) 63±8% and routinely measured effective regurgitant orifice area (EROA) 19[0-40] mm 2 During follow-up (6.7±3.1 years) 696 patients died under medical management and 1263 underwent mitral surgery. In multivariate analysis, routinely measured EROA was associated with mortality (adjusted-hazard-ratio 1.19[1.13-1.24] p 40 mm 2 threshold. Conclusions -Echocardiographic DMR quantitation is scalable to routine practice and is independently associated with clinical outcome. Routinely measured EROA is strongly associated with long-term survival under medical treatment. Excess mortality vs. the general population appears in the "moderate" DMR range and steadily increases with higher EROA. Hence, individual EROA values should be integrated into therapeutic considerations, additionally to categorical DMR grading.

  8. Recent Self-Reported Cannabis Use Is Associated With the Biometrics of Delta-9-Tetrahydrocannabinol.

    Science.gov (United States)

    Smith, Matthew J; Alden, Eva C; Herrold, Amy A; Roberts, Andrea; Stern, Dan; Jones, Joseph; Barnes, Allan; O'Connor, Kailyn P; Huestis, Marilyn A; Breiter, Hans C

    2018-05-01

    Research typically characterizes cannabis use by self-report of cannabis intake frequency. In an effort to better understand relationships between measures of cannabis use, we evaluated if Δ-9-tetrahydrocannabinol (THC) and metabolite concentrations (biometrics) were associated with a calibrated timeline followback (TLFB) assessment of cannabis use. Participants were 35 young adult male cannabis users who completed a calibrated TLFB measure of cannabis use over the past 30 days, including time of last use. The calibration required participants handling four plastic bags of a cannabis substitute (0.25, 0.5, 1.0, and 3.5 grams) to quantify cannabis consumed. Participants provided blood and urine samples for analysis of THC and metabolites, at two independent laboratories. Participants abstained from cannabis use on the day of sample collection. We tested Pearson correlations between the calibrated TLFB measures and cannabis biometrics. Strong correlations were seen between urine and blood biometrics (all r > .73, all p biometric, including urine 11-nor-9-carboxy-Δ9-tetrahydrocannabinol (THCCOOH) and blood THC, 11-hydroxy-THC (11-OH-THC), THCCOOH, THCCOOH-glucuronide (times of use: r > .48-.61, all p .40-.49, all p biometrics. The calibration of cannabis intake in grams was associated with each biometric, although the simple TLFB measure of times of use produced the strongest relationships with all five biometrics. These findings suggest that combined self-report and biometric data together convey the complexity of cannabis use, but allow that either the use of calibrated TLFB measures or biometrics may be sufficient for assessment of cannabis use in research.

  9. Wearing Quality of Austenitic, Duplex Cast Steel, Gray and Spheroidal Graphite Iron

    Directory of Open Access Journals (Sweden)

    S. Pietrowski

    2012-04-01

    Full Text Available The current work presents the research results of abrasion wear and adhesive wear at rubbing and liquid friction of new austenitic, austenitic-ferritic (“duplex” cast steel and gray cast iron EN-GJL-250, spheroidal graphite iron EN-GJS-600-3, pearlitic with ledeburitic carbides and spheroidal graphite iron with ledeburitic carbides with a microstructure of the metal matrix: pearlitic, upper bainite, mixture of upper and lower bainite, martensitic with austenite, pearlitic-martensitic-bainitic-ausferritic obtained in the raw state. The wearing quality test was carried out on a specially designed and made bench. Resistance to abrasion wear was tested using sand paper P40. Resistance to adhesive wear was tested in interaction with steel C55 normalized, hardened and sulfonitrided. The liquid friction was obtained using CASTROL oil. It was stated that austenitic cast steel and “duplex” are characterized by a similar value of abrasion wear and adhesive wear at rubbing friction. The smallest decrease in mass was shown by the cast steel in interaction with the sulfonitrided steel C55. Austenitic cast steel and “duplex��� in different combinations of friction pairs have a higher wear quality than gray cast iron EN-GJL- 250 and spheroidal graphite iron EN-GJS-600-3. Austenitic cast steel and “duplex” are characterized by a lower wearing quality than the spheroidal graphite iron with bainitic-martensitic microstructure. In the adhesive wear test using CASTROL oil the tested cast steels and cast irons showed a small mass decrease within the range of 1÷2 mg.

  10. Generation of reactive oxygen species (ROS) is a key factor for stimulation of macrophage proliferation by ceramide 1-phosphate

    International Nuclear Information System (INIS)

    Arana, Lide; Gangoiti, Patricia; Ouro, Alberto; Rivera, Io-Guané; Ordoñez, Marta; Trueba, Miguel; Lankalapalli, Ravi S.; Bittman, Robert; Gomez-Muñoz, Antonio

    2012-01-01

    We previously demonstrated that ceramide 1-phosphate (C1P) is mitogenic for fibroblasts and macrophages. However, the mechanisms involved in this action were only partially described. Here, we demonstrate that C1P stimulates reactive oxygen species (ROS) formation in primary bone marrow-derived macrophages, and that ROS are required for the mitogenic effect of C1P. ROS production was dependent upon prior activation of NADPH oxidase by C1P, which was determined by measuring phosphorylation of the p40phox subunit and translocation of p47phox from the cytosol to the plasma membrane. In addition, C1P activated cytosolic calcium-dependent phospholipase A 2 and protein kinase C-α, and NADPH oxidase activation was blocked by selective inhibitors of these enzymes. These inhibitors, and inhibitors of ROS production, blocked the mitogenic effect of C1P. By using BHNB-C1P (a photolabile caged-C1P analog), we demonstrate that all of these C1P actions are caused by intracellular C1P. It can be concluded that the enzyme responsible for C1P-stimulated ROS generation in bone marrow-derived macrophages is NADPH oxidase, and that this enzyme is downstream of PKC-α and cPLA 2 -α in this pathway. -- Highlights: ► Ceramide 1-phosphate (C1P) stimulates reactive oxygen species (ROS) formation. ► The enzyme responsible for ROS generation by C1P in macrophages is NADPH oxidase. ► NADPH oxidase lies downstream of cPLA 2 -α and PKC-α in this pathway. ► ROS generation is essential for the stimulation of macrophage proliferation by C1P.

  11. Effects of abutment diameter, luting agent type, and re-cementation on the retention of implant-supported CAD/CAM metal copings over short abutments.

    Science.gov (United States)

    Safari, Sina; Hosseini Ghavam, Fereshteh; Amini, Parviz; Yaghmaei, Kaveh

    2018-02-01

    The aim of this study was to evaluate the effects of abutment diameter, cement type, and re-cementation on the retention of implant-supported CAD/CAM metal copings over short abutments. Sixty abutments with two different diameters, the height of which was reduced to 3 mm, were vertically mounted in acrylic resin blocks with matching implant analogues. The specimens were divided into 2 diameter groups: 4.5 mm and 5.5 mm (n=30). For each abutment a CAD/CAM metal coping was manufactured, with an occlusal loop. Each group was sub-divided into 3 sub-groups (n=10). In each subgroup, a different cement type was used: resin-modified glass-ionomer, resin cement and zinc-oxide-eugenol. After incubation and thermocycling, the removal force was measured using a universal testing machine at a cross-head speed of 0.5 mm/min. In zinc-oxide-eugenol group, after removal of the coping, the cement remnants were completely cleaned and the copings were re-cemented with resin cement and re-tested. Two-way ANOVA, post hoc Tukey tests, and paired t-test were used to analyze data (α=.05). The highest pulling force was registered in the resin cement group (414.8 N), followed by the re-cementation group (380.5 N). Increasing the diameter improved the retention significantly ( P =.006). The difference in retention between the cemented and recemented copings was not statistically significant ( P =.40). Resin cement provided retention almost twice as strong as that of the RMGI. Increasing the abutment diameter improved retention significantly. Re-cementation with resin cement did not exhibit any difference from the initial cementation with resin cement.

  12. Changes in Weight and Body Composition Among Women With Breast Cancer During and After Adjuvant Treatment: A Prospective Follow-up Study.

    Science.gov (United States)

    Pedersen, Birgith; Delmar, Charlotte; Bendtsen, Mette Dahl; Bosaeus, Ingvar; Carus, Andreas; Falkmer, Ursula; Groenkjaer, Mette

    Antineoplastic adjuvant treatment for breast cancer can cause changes in women's weight and body composition and influence their general health and survival. The aim of this study is to investigate the extent and patterns of change in weight and body composition after current standard adjuvant antineoplastic treatment for breast cancer. Data on weight and body composition from 95 women with breast cancer Stage I to III were obtained during 18 months on a bioelectric impedance analyzer. Changes and odds ratio (OR) were calculated by a linear mixed model and logistic regression. At 18 months, there was an increase in weight of 0.9 kg (95% confidence interval [CI], 0.3-1.5; P = .003) and an average positive association of 0.35 kg/cm increased waist circumference (95% CI, 0.29-0.42 kg; P body fat were observed mainly in premenopausal women receiving chemotherapy (1.4 kg; 95% CI, 0.4-2.4; P = .007). For menopausal status, OR was 2.9 (95% CI, 1.14-7.1; P = .025), and for chemotherapy, OR was 2.6 (95% CI, 1.03-6.41; P = .043). The OR for weight loss in Stage III breast cancer was 12.5 (95% CI, 1.21-128.84; P = .034) and 4.3 (CI, 1.07-17.24; P = .40) for comorbidity. Results demonstrate that weight changes in a pooled sample are overestimated. However, premenopausal women receiving anthracycline-based chemotherapy show a tendency toward a body composition with increasing fat mass. A scheduled assessment of changes in weight and body composition is relevant at 18 months after treatment. To compare future studies, common measuring and cutoff points are needed.

  13. Helicobacter pylori dupA is polymorphic, and its active form induces proinflammatory cytokine secretion by mononuclear cells.

    Science.gov (United States)

    Hussein, Nawfal R; Argent, Richard H; Marx, Christian K; Patel, Sapna R; Robinson, Karen; Atherton, John C

    2010-07-15

    Infection with Helicobacter pylori possessing a newly described virulence factor--duodenal ulcer-promoting gene A (dupA)--has been associated with duodenal ulceration and increased gastric inflammation. The dupA locus of 34 strains was sequenced. A panel of dupA mutants was generated and cocultured with human gastric epithelial cells and peripheral blood mononuclear cells; proinflammatory cytokine release was measured. IL8 expression was measured in human gastric biopsy specimens and related to the dupA and cagA status of infecting strains. Most H. pylori strains had a dupA allele that was longer (1884 bp; dupA1) than previously described dupA alleles, although some had truncated versions (dupA2). Unlike the best-characterized H. pylori virulence determinant, the cag pathogenicity island (cag PaI), neither dupA type induced release of interleukin (IL)-8 from gastric epithelial cells. However, infections due to dupA-positive strains were associated with higher-level mucosal IL-8 messenger RNA expression in the human stomach than were infections due to dupA-negative strains. To explain this paradox, we found that dupA1 (but not dupA2 or the cag PaI) substantially increased H. pylori-induced IL-12p40 and IL-12p70 production from CD14(+) mononuclear cells. Other T helper 1-associated cytokines were also modestly induced. We suggest that virulent H. pylori strains cause inflammation by stimulating epithelial cells through cag-encoded proteins and mononuclear inflammatory cells through dupA1 products.

  14. Functional Assembly of Soluble and Membrane Recombinant Proteins of Mammalian NADPH Oxidase Complex.

    Science.gov (United States)

    Souabni, Hajer; Ezzine, Aymen; Bizouarn, Tania; Baciou, Laura

    2017-01-01

    Activation of phagocyte cells from an innate immune system is associated with a massive consumption of molecular oxygen to generate highly reactive oxygen species (ROS) as microbial weapons. This is achieved by a multiprotein complex, the so-called NADPH oxidase. The activity of phagocyte NADPH oxidase relies on an assembly of more than five proteins, among them the membrane heterodimer named flavocytochrome b 558 (Cytb 558 ), constituted by the tight association of the gp91 phox (also named Nox2) and p22 phox proteins. The Cytb 558 is the membrane catalytic core of the NADPH oxidase complex, through which the reducing equivalent provided by NADPH is transferred via the associated prosthetic groups (one flavin and two hemes) to reduce dioxygen into superoxide anion. The other major proteins (p47 phox , p67 phox , p40 phox , Rac) requisite for the complex activity are cytosolic proteins. Thus, the NADPH oxidase functioning relies on a synergic multi-partner assembly that in vivo can be hardly studied at the molecular level due to the cell complexity. Thus, a cell-free assay method has been developed to study the NADPH oxidase activity that allows measuring and eventually quantifying the ROS generation based on optical techniques following reduction of cytochrome c. This setup is a valuable tool for the identification of protein interactions, of crucial components and additives for a functional enzyme. Recently, this method was improved by the engineering and the production of a complete recombinant NADPH oxidase complex using the combination of purified proteins expressed in bacterial and yeast host cells. The reconstitution into artificial membrane leads to a fully controllable system that permits fine functional studies.

  15. Effect of interleukin 13 on bronchial hyperresponsiveness and the bronchoprotective effect of beta-adrenergic bronchodilators and corticosteroids.

    Science.gov (United States)

    Townley, Robert G; Gendapodi, Pradeep R; Qutna, Nidal; Evans, Joseph; Romero, Francisco A; Abel, Peter

    2009-03-01

    Fluticasone affects airway bronchial hyperresponsiveness (BHR) and enhances bronchodilation and bronchoprotection induced by beta-adrenergic agonists. Interleukin 13 (IL-13), however, induces BHR. To test the hypotheses that fluticasone inhibits BHR after either allergen sensitization or IL-13 administration and that fluticasone restores the bronchodilation and bronchoprotective effects of beta-agonists. The BHR to methacholine induced by IL-13 or ovalbumin was determined in BALB/c mice, and the provocation concentration of methacholine that caused an increase in enhanced pause in expiration of 200% (PC200) was calculated. We compared this response to methacholine in control mice with the response after treatment with IL-13 receptor alpha 2-IgGFc fusion protein (IL-13R alpha 2) (an IL-13 blocker), fluticasone, albuterol, salmeterol, fluticasone-albuterol, and fluticasone-salmeterol. IL-13R alpha 2 (PC200, 17.59) completely blocks the BHR-induced effects of IL-13 (PC200, 7.28; P < .005). After IL-13 therapy (PC200, 5.90; P < .005), 1 mg/mL of albuterol (PC200, 3.38; P = .33), fluticasone (PC200, 4.59; P = .40), or fluticasone plus 50 microg/mL of salmeterol (PC200, 5.59; P = .11) showed no significant bronchoprotection. In nonsensitized mice, fluticasone plus 0.25 microg/mL of salmeterol (PC200, 25.90; P < .005) showed significantly greater bronchoprotection than did salmeterol alone (PC200, 11.08; P = .26). Fluticasone plus 0.3 mg/mL of albuterol and fluticasone plus 1 mg/mL of albuterol were significantly more protective than was fluticasone or albuterol alone in ovalbumin-sensitized mice. The protective effects of fluticasone, beta-agonists, and fluticasone plus beta-agonists are significantly less in IL-13-treated mice than in nonsensitized or ovalbumin-sensitized mice.

  16. Persistent Coxiella burnetii infection in mice overexpressing IL-10: an efficient model for chronic Q fever pathogenesis.

    Directory of Open Access Journals (Sweden)

    Soraya Meghari

    2008-02-01

    Full Text Available Interleukin (IL-10 increases host susceptibility to microorganisms and is involved in intracellular persistence of bacterial pathogens. IL-10 is associated with chronic Q fever, an infectious disease due to the intracellular bacterium Coxiella burnetii. Nevertheless, accurate animal models of chronic C. burnetii infection are lacking. Transgenic mice constitutively expressing IL-10 in macrophages were infected with C. burnetti by intraperitoneal and intratracheal routes and infection was analyzed through real-time PCR and antibody production. Transgenic mice exhibited sustained tissue infection and strong antibody response in contrast to wild-type mice; thus, bacterial persistence was IL-10-dependent as in chronic Q fever. The number of granulomas was low in spleen and liver of transgenic mice infected through the intraperitoneal route, as in patients with chronic Q fever. Macrophages from transgenic mice were unable to kill C. burnetii. C. burnetii-stimulated macrophages were characterized by non-microbicidal transcriptional program consisting of increased expression of arginase-1, mannose receptor, and Ym1/2, in contrast to wild-type macrophages in which expression of inducible NO synthase and inflammatory cytokines was increased. In vivo results emphasized macrophage data. In spleen and liver of transgenic mice infected with C. burnetii by the intraperitoneal route, the expression of arginase-1 was increased while microbicidal pathway consisting of IL-12p40, IL-23p19, and inducible NO synthase was depressed. The overexpression of IL-10 in macrophages prevents anti-infectious competence of host, including the ability to mount granulomatous response and microbicidal pathway in tissues. To our knowledge, this is the first efficient model for chronic Q fever pathogenesis.

  17. Endothelial mineralocorticoid receptor activation mediates endothelial dysfunction in diet-induced obesity.

    Science.gov (United States)

    Schäfer, Nicola; Lohmann, Christine; Winnik, Stephan; van Tits, Lambertus J; Miranda, Melroy X; Vergopoulos, Athanasios; Ruschitzka, Frank; Nussberger, Jürg; Berger, Stefan; Lüscher, Thomas F; Verrey, François; Matter, Christian M

    2013-12-01

    Aldosterone plays a crucial role in cardiovascular disease. 'Systemic' inhibition of its mineralocorticoid receptor (MR) decreases atherosclerosis by reducing inflammation and oxidative stress. Obesity, an important cardiovascular risk factor, is an inflammatory disease associated with increased plasma aldosterone levels. We have investigated the role of the 'endothelial' MR in obesity-induced endothelial dysfunction, the earliest stage in atherogenesis. C57BL/6 mice were exposed to a normal chow diet (ND) or a high-fat diet (HFD) alone or in combination with the MR antagonist eplerenone (200 mg/kg/day) for 14 weeks. Diet-induced obesity impaired endothelium-dependent relaxation in response to acetylcholine, whereas eplerenone treatment of obese mice prevented this. Expression analyses in aortic endothelial cells isolated from these mice revealed that eplerenone attenuated expression of pro-oxidative NADPH oxidase (subunits p22phox, p40phox) and increased expression of antioxidative genes (glutathione peroxidase-1, superoxide dismutase-1 and -3) in obesity. Eplerenone did not affect obesity-induced upregulation of cyclooxygenase (COX)-1 or prostacyclin synthase. Endothelial-specific MR deletion prevented endothelial dysfunction in obese (exhibiting high 'endogenous' aldosterone) and in 'exogenous' aldosterone-infused lean mice. Pre-incubation of aortic rings from aldosterone-treated animals with the COX-inhibitor indomethacin restored endothelial function. Exogenous aldosterone administration induced endothelial expression of p22phox in the presence, but not in the absence of the endothelial MR. Obesity-induced endothelial dysfunction depends on the 'endothelial' MR and is mediated by an imbalance of oxidative stress-modulating mechanisms. Therefore, MR antagonists may represent an attractive therapeutic strategy in the increasing population of obese patients to decrease vascular dysfunction and subsequent atherosclerotic complications.

  18. Dietary habits in women with recurrent idiopathic calcium nephrolithiasis

    Directory of Open Access Journals (Sweden)

    Meschi Tiziana

    2012-03-01

    Full Text Available Abstract Background Nutrition has been widely recognized to influence the risk of kidney stone formation. Therefore the aim of our study was to assess: a whether usual diet of women with idiopathic calcium nephrolithiasis (ICN living in Parma (Northern-Italy is different compared to healthy controls, b how their diet differs from Italian National guidelines and c whether it is related to nephrolithiasis clinical course. Methods 143 women with recurrent ICN (mean age 43 ± 13 ys and 170 healthy women (mean age 42 ± 11 ys were enrolled. All women completed a food frequency questionnaire for the last 60-days and a 3-day dietary diary analysed with a dedicated software. Results Stone formers showed a higher consumption of sausages, ham, meat and sweets than healthy controls (43.1% vs 11.1%, 29.4% vs 13.9%, 21.6% vs 4.2%, 66.7% vs 18.1%, p 40 years, the differences described above were amplified in the class ≤30 years, where nephrolithiasis presented a more serious course (shorter recurrence interval, greater stone-rate. In this age group the intake of fruit and vegetables was notably lower than guideline recommendations. Conclusions We conclude that the usual diet of women with recurrent ICN is different from controls and characterized by low intake of fruits and vegetables and higher consumption of simple sugars and foods with high protein and salt content. This dietary imbalance could play a role in the ICN pathogenesis, especially in younger women. This work was financed by grants from Italian Ministry of University and Research as part of a larger project about the prevention of kidney stones (PRIN 2005063822 and by Fondazione per la Ricerca Scientifica Termale (FoRST. No potential conflict of interest relevant to this paper was reported.

  19. Pronounced susceptibility to infection by Salmonella enterica serovar Typhimurium in mice chronically exposed to lead correlates with a shift to Th2-type immune responses

    International Nuclear Information System (INIS)

    Fernandez-Cabezudo, Maria J.; Ali, Sumaya A.E.; Ullah, Azim; Hasan, Mohammed Y.; Kosanovic, Melita; Fahim, Mohamed A.; Adem, Abdu; Al-Ramadi, Basel K.

    2007-01-01

    Persistent exposure to inorganic lead (Pb) is known to adversely affect the immune system. In the present study, we assessed the effect of chronic Pb exposure on susceptibility to infection by the facultative intracellular pathogen Salmonella enterica serovar Typhimurium. Mice were exposed to 10 mM Pb-acetate in drinking water for ∼ 16 weeks, resulting in a significant level of Pb in the blood (106.2 ± 8.9 μg/dl). Pb exposure rendered mice susceptible to Salmonella infection, manifested by increased bacterial burden in target organs and heightened mortality. Flow cytometric analysis of the splenic cellular composition in normal and Pb-exposed mice revealed no gross alteration in the ratios of B and T lymphocytes or myeloid cells. Similarly, the capacity of B and T cells to upregulate the expression of activation antigens in response to mitogenic or inflammatory stimuli was not hindered by Pb exposure. Analysis of the ability of ex vivo-cultured splenocytes to secrete cytokines demonstrated a marked reduction in IFN-γ and IL-12p40 production associated with Pb exposure. In contrast, secretion of IL-4 by splenocytes of Pb-treated mice was 3- to 3.6-fold higher than in normal mice. The increased capacity to produce IL-4 correlated with a shift in the in vivo anti-Salmonella antibody response from the protective IgG2a isotype to the Th2-induced IgG1 isotype. We conclude that chronic exposure to high levels of Pb results in a state of immunodeficiency which is not due to an overt cytotoxic or immunosuppressive mechanism, but rather is largely caused by a shift in immune responsiveness to Th2-type reactions

  20. Exposure of a distinct PDCA-1+ (CD317 B cell population to agonistic anti-4-1BB (CD137 inhibits T and B cell responses both in vitro and in vivo.

    Directory of Open Access Journals (Sweden)

    Dass S Vinay

    Full Text Available 4-1BB (CD137 is an important T cell activating molecule. Here we report that it also promotes development of a distinct B cell subpopulation co-expressing PDCA-1. 4-1BB is expressed constitutively, and its expression is increased when PDCA-1(+ B cells are activated. We found that despite a high level of surface expression of 4-1BB on PDCA-1(+ B cells, treatment of these cells with agonistic anti-4-1BB mAb stimulated the expression of only a few activation markers (B7-2, MHC II, PD-L2, cytokines (IL-12p40/p70, and chemokines (MCP-1, RANTES, as well as sTNFR1, and the immunosuppressive enzyme, IDO. Although the PDCA-1(+ B cells stimulated by anti-4-1BB expressed MHC II at high levels and took up antigens efficiently, Ig class switching was inhibited when they were pulsed with T-independent (TI or T-dependent (TD Ags and adoptively transferred into syngeneic recipients. Furthermore, when anti-4-1BB-treated PDCA-1(+ B cells were pulsed with OVA peptide and combined with Vα2(+CD4(+ T cells, Ag-specific cell division was inhibited both in vitro and in vivo. Our findings suggest that the 4-1BB signal transforms PDCA-1(+ B cells into propagators of negative immune regulation, and establish an important role for 4-1BB in PDCA-1(+ B cell development and function.

  1. Histone Deacetylase 7 Promotes Toll-like Receptor 4-dependent Proinflammatory Gene Expression in Macrophages*

    Science.gov (United States)

    Shakespear, Melanie R.; Hohenhaus, Daniel M.; Kelly, Greg M.; Kamal, Nabilah A.; Gupta, Praveer; Labzin, Larisa I.; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A.; Reid, Robert C.; Irvine, Katharine M.; Fairlie, David P.; Sweet, Matthew J.

    2013-01-01

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target. PMID:23853092

  2. Histone deacetylase 7 promotes Toll-like receptor 4-dependent proinflammatory gene expression in macrophages.

    Science.gov (United States)

    Shakespear, Melanie R; Hohenhaus, Daniel M; Kelly, Greg M; Kamal, Nabilah A; Gupta, Praveer; Labzin, Larisa I; Schroder, Kate; Garceau, Valerie; Barbero, Sheila; Iyer, Abishek; Hume, David A; Reid, Robert C; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2013-08-30

    Broad-spectrum inhibitors of histone deacetylases (HDACs) constrain Toll-like receptor (TLR)-inducible production of key proinflammatory mediators. Here we investigated HDAC-dependent inflammatory responses in mouse macrophages. Of the classical Hdacs, Hdac7 was expressed at elevated levels in inflammatory macrophages (thioglycollate-elicited peritoneal macrophages) as compared with bone marrow-derived macrophages and the RAW264 cell line. Overexpression of a specific, alternatively spliced isoform of Hdac7 lacking the N-terminal 22 amino acids (Hdac7-u), but not the Refseq Hdac7 (Hdac7-s), promoted LPS-inducible expression of Hdac-dependent genes (Edn1, Il-12p40, and Il-6) in RAW264 cells. A novel class IIa-selective HDAC inhibitor reduced recombinant human HDAC7 enzyme activity as well as TLR-induced production of inflammatory mediators in thioglycollate-elicited peritoneal macrophages. Both LPS and Hdac7-u up-regulated the activity of the Edn1 promoter in an HDAC-dependent fashion in RAW264 cells. A hypoxia-inducible factor (HIF) 1 binding site in this promoter was required for HDAC-dependent TLR-inducible promoter activity and for Hdac7- and HIF-1α-mediated trans-activation. Coimmunoprecipitation assays showed that both Hdac7-u and Hdac7-s interacted with HIF-1α, whereas only Hdac7-s interacted with the transcriptional repressor CtBP1. Thus, Hdac7-u positively regulates HIF-1α-dependent TLR signaling in macrophages, whereas an interaction with CtBP1 likely prevents Hdac7-s from exerting this effect. Hdac7 may represent a potential inflammatory disease target.

  3. Chronic inflammatory disorders of the gastrointestinal tract of companion animals.

    Science.gov (United States)

    Cave, N J

    2003-12-01

    In the inflammatory bowel diseases (IBD) that affect dogs and cats there appears to be dysregulation of normal mucosal immunity, characterised by polyclonal lymphocytic infiltrates which are presumably specific for luminal antigens. There is an absence of a classical polarisation of either T-helper (Th) 1 or Th2 cytokine responses, although increased expression of mRNA for interleukin (IL) 2 and IL-12p40 and a shift towards mucosal immunoglobulin (Ig) G production are consistent findings, whilst variable responses are seen in tumour necrosis factor-alpha (TNF-alpha), IL-1, IL-4, IL-6, and interferon-gamma (IFN-gamma). Increased mucosal permeability and deranged intestinal motility are common sequelae. Despite obvious similarities with Crohn's disease and ulcerative colitis in humans, important differences exist. Of these, the diffuse superficial nature but with no Th1 or Th2 bias, and the prevalence of proximal small intestinal disease are notable. Potential hypotheses for these disparities include specific differences in the types or locations of agonistic gut flora, diffuse abnormalities in microbial-host interactions, a greater importance of diet, or anatomical or cellular differences in mucosal immune responses. Although specific pathogens and genetic susceptibilities may be involved, quantitative or qualitative changes in the normal flora or abnormal responses to a normal flora are more likely to be involved in the immunopathogenesis. Dietary influences include a large source of antigen, promotion of abnormal microbial growth through Maillard compounds within canned diets, and specific macro- and micronutrient deficiencies. Although dependent on a histopathological diagnosis, limitations of biopsies procured endoscopically, lack of histopathological standardisation and difficulty distinguishing inflammation from neoplasia remain significant problems. Clinician-pathologist dialogue, immunohistochemistry, cytokine profiling and lymphocyte clonality assessment

  4. Emerging treatments in the management of psoriasis: biological targeting with ustekinumab

    Directory of Open Access Journals (Sweden)

    Marina Papoutsaki

    2009-05-01

    Full Text Available Marina Papoutsaki, Antonio Costanzo, Sergio ChimentiDepartment of Dermatology, University of Rome, “Tor vergata”, Rome, ItalyAbstract: Psoriasis is a chronic, genetically determined, immune-mediated, inflammatory skin disease affecting approximately 2% to 3% of Caucasian population. Given the well-established role of the immuno-mediated inflammation in the pathogenesis of psoriasis, in the past few years several key steps in the pathogenesis of this disease have been elucidated and the increased knowledge led to the development of specific drugs, commonly defined as “biologics” targeting one or more of these steps. At present an anti-CD11a antibody (efalizumab, an anti-LFA3/CD2 receptor (alefacept and 3 antitumor necrosis factor alpha agents (adalimumab, etanercept, infliximab are now commercially available for the treatment of both psoriasis and psoriatic arthritis. Recent studies have demonstrated that interleukins (IL 12 and 23 play an important role in the pathophysiology of psoriasis. In fact members of the IL-12 family of cytokines have the potential to act as the next major cytokine(s in pathogenesis and the treatment of psoriasis. Ustekinumab (CNTO 1275, Centocor Inc, Malvern, PA, USA is a human monoclonal antibody that binds to the shared p40 protein subunit of human interleukins 12 and 23 with high affinity and specificity, thereby preventing interaction with their surface IL-12Rβ1 receptor. Different clinical studies have been conducted to date. In particular a phase II study and two phase III studies, PHOENIX 1 together with PHOENIX 2, show very encouraging results. This review reports on the latest progress made in the clinical use of biologic drugs for psoriasis focusing on the new human IL-12/23 monoclonal antibody, ustekinumab, for psoriasis.Keywords: psoriasis, ustekinumab, interleukin-12/23 monoclonal antibody

  5. Raman spectroscopy and x-ray diffraction of sp3CaCO3 at lower mantle pressures

    Energy Technology Data Exchange (ETDEWEB)

    Lobanov, Sergey S.; Dong, Xiao; Martirosyan, Naira S.; Samtsevich, Artem I.; Stevanovic, Vladan; Gavryushkin, Pavel N.; Litasov, Konstantin D.; Greenberg, Eran; Prakapenka, Vitali B.; Oganov, Artem R.; Goncharov, Alexander F.

    2017-09-01

    The exceptional ability of carbon to form sp 2 and sp 3 bonding states leads to a great structural and chemical diversity of carbon-bearing phases at nonambient conditions. Here we use laser-heated diamond-anvil cells combined with synchrotron x-ray diffraction, Raman spectroscopy, and first-principles calculations to explore phase transitions in CaC O 3 at P > 40 GPa . We find that postaragonite CaC O 3 transforms to the previously predicted P 2 1 / c CaC O 3 with sp 3 -hybridized carbon at 105 GPa ( ~ 30 GPa higher than the theoretically predicted crossover pressure). The lowest-enthalpy transition path to P2 1 / c CaC O 3 includes reoccurring sp 2 and sp 3 CaC O 3 intermediate phases and transition states, as revealed by our variable-cell nudged-elastic-band simulation. Raman spectra of P 2 1 / c CaC O 3 show an intense band at 1025 c m -1 , which we assign to the symmetric C-O stretching vibration based on empirical and first-principles calculations. This Raman band has a frequency that is ~ 20 % low-ymmetric C-O stretching in sp 2 CaC O 3 due to the C-O bond length increase across the sp 2 ~ sp 3 transition and can be used as a fingerprint of tetrahedrally coordinated carbon in other carbonates.

  6. Part II: Biomechanical assessment for a footprint-restoring transosseous-equivalent rotator cuff repair technique compared with a double-row repair technique.

    Science.gov (United States)

    Park, Maxwell C; Tibone, James E; ElAttrache, Neal S; Ahmad, Christopher S; Jun, Bong-Jae; Lee, Thay Q

    2007-01-01

    We hypothesized that a transosseous-equivalent repair would demonstrate improved tensile strength and gap formation between the tendon and tuberosity when compared with a double-row technique. In 6 fresh-frozen human shoulders, a transosseous-equivalent rotator cuff repair was performed: a suture limb from each of two medial anchors was bridged over the tendon and fixed laterally with an interference screw. In 6 contralateral matched-pair specimens, a double-row repair was performed. For all repairs, a materials testing machine was used to load each repair cyclically from 10 N to 180 N for 30 cycles; each repair underwent tensile testing to measure failure loads at a deformation rate of 1 mm/sec. Gap formation between the tendon edge and insertion was measured with a video digitizing system. The mean ultimate load to failure was significantly greater for the transosseous-equivalent technique (443.0 +/- 87.8 N) compared with the double-row technique (299.2 +/- 52.5 N) (P = .043). Gap formation during cyclic loading was not significantly different between the transosseous-equivalent and double-row techniques, with mean values of 3.74 +/- 1.51 mm and 3.79 +/- 0.68 mm, respectively (P = .95). Stiffness for all cycles was not statistically different between the two constructs (P > .40). The transosseous-equivalent rotator cuff repair technique improves ultimate failure loads when compared with a double-row technique. Gap formation is similar for both techniques. A transosseous-equivalent repair helps restore footprint dimensions and provides a stronger repair than the double-row technique, which may help optimize healing biology.

  7. Purification and characterization of a polyisoprenyl phosphate phosphatase from pig brain. Possible dual specificity.

    Science.gov (United States)

    Frank, D W; Waechter, C J

    1998-05-08

    Microsomal fractions from pig and calf brain catalyze the enzymatic dephosphorylation of endogenous and exogenous dolichyl monophosphate (Dol-P) (Sumbilla, C. A., and Waechter, C. J. (1985) Methods Enzymol. 111, 471-482). The Dol-P phosphatase (EC 3.1.3.51) has been solubilized by extracting pig brain microsomes with the nonionic detergent Nonidet P-40 and purified approximately 1,107-fold by a combination of anion exchange chromatography, polyethylene glycol fractionation, dye-ligand chromatography, and wheat germ agglutinin affinity chromatography. Treatment of the enzyme with neuraminidase prevented binding to wheat germ agglutinin-Sepharose, indicating the presence of one or more N-acetylneuraminyl residues per molecule of enzyme. When the highly purified polyisoprenyl phosphate phosphatase was analyzed by SDS-polyacrylamide gel electrophoresis, a major 33-kDa polypeptide was observed. Enzymatic dephosphorylation of Dol-P by the purified phosphatase was 1) optimal at pH 7; 2) potently inhibited by F-, orthovanadate, and Zn2+ > Co2+ > Mn2+ but unaffected by Mg2+; 3) exhibited an approximate Km for C95-Dol-P of 45 microM; and 4) was sensitive to N-ethylmaleimide, phenylglyoxal, and diethylpyrocarbonate. The pig brain phosphatase did not dephosphorylate glucose 6-phosphate, mannose 6-phosphate, 5'-AMP, or p-nitrophenylphosphate, but it dephosphorylated dioleoyl-phosphatidic acid at initial rates similar to those determined for Dol-P. Based on the virtually identical sensitivity of Dol-P and phosphatidic acid dephosphorylation by the highly purified enzyme to N-ethylmaleimide, F-, phenylglyoxal, and diethylpyrocarbonate, both substrates appear to be hydrolyzed by a single enzyme with an apparent dual specificity. This is the first report of the purification of a neutral Dol-P phosphatase from mammalian tissues. Although the enzyme is Mg2+-independent and capable of dephosphorylating Dol-P and PA, several enzymological properties distinguish this lipid

  8. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Pelch, Katherine E.; Tokar, Erik J. [National Toxicology Program Laboratory, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Merrick, B. Alex [Molecular Toxicology and Informatics Group, Biomolecular Screening Branch, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Morrisville, NC 27560 (United States); Waalkes, Michael P., E-mail: waalkes@niehs.nih.gov [National Toxicology Program Laboratory, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States)

    2015-08-01

    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  9. Th17 plasticity and transition toward a pathogenic cytokine signature are regulated by cyclosporine after allogeneic SCT.

    Science.gov (United States)

    Gartlan, Kate H; Varelias, Antiopi; Koyama, Motoko; Robb, Renee J; Markey, Kate A; Chang, Karshing; Wilkinson, Andrew N; Smith, David; Ullah, Md Ashik; Kuns, Rachel D; Raffelt, Neil C; Olver, Stuart D; Lineburg, Katie E; Teal, Bianca E; Cheong, Melody; Teng, Michele W L; Smyth, Mark J; Tey, Siok-Keen; MacDonald, Kelli P A; Hill, Geoffrey R

    2017-02-14

    T-helper 17 (Th17) cells have been widely implicated as drivers of autoimmune disease. In particular, Th17 cytokine plasticity and acquisition of an interleukin-17A + (IL-17A + )interferon γ(IFNγ) + cytokine profile is associated with increased pathogenic capacity. Donor Th17 polarization is known to exacerbate graft-versus-host disease (GVHD) after allogeneic stem cell transplantation (allo-SCT); however, donor Th17 cytokine coexpression and plasticity have not been fully characterized. Using IL-17 "fate-mapping" mice, we identified IL-6-dependent Th17 cells early after allo-SCT, characterized by elevated expression of proinflammatory cytokines, IL-17A, IL-22, granulocyte-macrophage colony-stimulating factor, and tumor necrosis factor. This population did not maintain lineage fidelity, with a marked loss of IL-17A and IL-22 expression late posttransplant. Th17 cells were further segregated based on IFNγ coexpression, and IL-17A + IFNγ + Th17 displayed an enhanced proinflammatory phenotype. Th17 cytokine plasticity and IFNγ production were critically dependent upon donor-derived IL-12p40, and cyclosporine (CsA) treatment regulated this differentiation pathway. This observation was highly concordant with clinical samples from allo-SCT recipients receiving CsA-based immune suppression where although the IFNγ-negative-Th17 subset predominated, IFNγ + -Th17 cells were also present. In sum, Th17 polarization and ensuing differentiation are mediated by sequential inflammatory signals, which are modulated by immunosuppressive therapy, leading to distinct phenotypes within this lineage.

  10. Patterns of immune development in urban preschoolers with recurrent wheeze and/or atopy.

    Science.gov (United States)

    Gern, James E; Calatroni, Agustin; Jaffee, Katy F; Lynn, Henry; Dresen, Amy; Cruikshank, William W; Lederman, Howard M; Sampson, Hugh A; Shreffler, Wayne; Bacharier, Leonard B; Gergen, Peter J; Gold, Diane R; Kattan, Meyer; O'Connor, George T; Sandel, Megan T; Wood, Robert A; Bloomberg, Gordon R

    2017-09-01

    Disadvantaged urban children have high rates of allergic diseases and wheezing, which are diseases associated with type 2-biased immunity. We sought to determine whether environmental exposures in early life influence cytokine responses that affect the development of recurrent wheezing illnesses and allergic sensitization. A birth cohort of 560 urban families was recruited from neighborhoods with high rates of poverty, and 467 (83%) children were followed until 3 years of age. Cytokine responses were measured in blood cell samples obtained at birth (cord blood) and ages 1 and 3 years. Cytokine responses were examined in relation to personal characteristics and environmental exposures to allergens and endotoxin and to the development of allergic sensitization and recurrent wheeze assessed at age 3 years. Cytokine responses generally increased with age, but responses at birth were poorly predictive for those at ages 1 and 3 years. Exposure to certain allergens (cockroach, mouse, dust mite) was significantly associated with enhanced cytokine responses at age 3 years, including IFN-α and IL-10 responses to certain stimulants and responses to phytohemagglutinin. Regarding the clinical outcomes, reduced LPS-induced IL-10 responses at birth were associated with recurrent wheeze. In contrast, reduced respiratory syncytial virus-induced IL-8 responses and increased 5'-cytosine-phosphate-guanine-3' (CpG)-induced IL-12p40 and allergen-induced IL-4 responses were associated with atopy. These findings suggest that diverse biologic exposures, including allergens and endotoxin, in urban homes stimulate the development of cytokine responses in early life, and that cytokine responses to specific microbial and viral stimuli are associated with the development of allergic sensitization and recurrent wheeze. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. All rights reserved.

  11. Enhanced Removal of a Human Norovirus Surrogate from Fresh Vegetables and Fruits by a Combination of Surfactants and Sanitizers▿

    Science.gov (United States)

    Predmore, Ashley; Li, Jianrong

    2011-01-01

    Fruits and vegetables are major vehicles for transmission of food-borne enteric viruses since they are easily contaminated at pre- and postharvest stages and they undergo little or no processing. However, commonly used sanitizers are relatively ineffective for removing human norovirus surrogates from fresh produce. In this study, we systematically evaluated the effectiveness of surfactants on removal of a human norovirus surrogate, murine norovirus 1 (MNV-1), from fresh produce. We showed that a panel of surfactants, including sodium dodecyl sulfate (SDS), Nonidet P-40 (NP-40), Triton X-100, and polysorbates, significantly enhanced the removal of viruses from fresh fruits and vegetables. While tap water alone and chlorine solution (200 ppm) gave only <1.2-log reductions in virus titer in all fresh produce, a solution containing 50 ppm of surfactant was able to achieve a 3-log reduction in virus titer in strawberries and an approximately 2-log reduction in virus titer in lettuce, cabbage, and raspberries. Moreover, a reduction of approximately 3 logs was observed in all the tested fresh produce after sanitization with a solution containing a combination of 50 ppm of each surfactant and 200 ppm of chlorine. Taken together, our results demonstrate that the combination of a surfactant with a commonly used sanitizer enhanced the efficiency in removing viruses from fresh produce by approximately 100 times. Since SDS is an FDA-approved food additive and polysorbates are recognized by the FDA as GRAS (generally recognized as safe) products, implementation of this novel sanitization strategy would be a feasible approach for efficient reduction of the virus load in fresh produce. PMID:21622782

  12. Socio-economic status and feeding habits of students in lower secondary schools in Bytom

    Directory of Open Access Journals (Sweden)

    Agata Wypych-Ślusarska

    2013-12-01

    Full Text Available Introduction: Eating habits are formed in childhood and adolescence.. Economic issues including social and demographic factors influence the choice and quality of products consumed. Aim: The aim of the study is to determine the impact of socio-economic status (SES on eating habits of students in lower secondary schools. Material and methods: At the turn of 2011 and 2012, an epidemiological cross-sectional study on 1,099 students in lower secondary schools from Bytom was conducted. The questionnaire was based on the form used in Health Behaviour in School – aged Children study (HBSC. The socio-economic status of students was determined according to the Family Affluence Scale (FAS and the mother’s level of education. The statistical analysis was conducted using Statistica 10.0 software. The significance level was set at p40.05. Results: 1,099 students in lower secondary school took part in the study (55.6% females and 44.4% males. 59% of students skip vegetables in their daily diet, (58.5% fruits and (49.4%. milk but 59.7% have breakfast every day. Nevertheless the high percentage of children eating sweets every day or several times a day (37.2% is worrying. Those children whose mothers declared secondary education and high level of FAS have proper eating habits. Children eating sweets at least once a day come mostly from families with low level of FAS. Conclusions: Bad eating habits are mostly among children whose mothers are of primary or vocational education and a low level of FAS.

  13. GENETIC VARIABILITY OF THREE POPULATIONS OF FLYING FISH, Hirundichthy oxycephalus FROM MAKASSAR STRAIT

    Directory of Open Access Journals (Sweden)

    Andi Parenrengi

    2016-03-01

    Full Text Available Flying fish, Hirundichthy oxycephalus is one of economically important marine species to Indonesia, particularly in Makassar Strait and Flores Sea. However, there is a limited published data on genetic variation in molecular marker level of this species. Random Amplified Polymorphic DNA (RAPD was employed in this study to determine the genetic variability of three populations of flying fish collected from Takalar, Pare-Pare, and Majene in Makassar Strait. Genomic DNA was isolated from preserved muscle tissue using phenol-chloroform technique. Two selected arbitrary primers (CA-01 and P-40 were performed to generate RAPD finger printing of flying fish populations. The two primers generated a total of 81 fragments (loci and 50 polymorphic fragments with size ranging from 125 to 1,250 bp. There were no significant differences in number of fragment and number of polymorphic fragment among populations. The high polymorphism (63.5±7.4% was obtained from Takalar population followed by Pare-Pare (58.3±19.6% and Majene population (57.7±0.8%. Similarity index of individuals was 0.60±0.17 for Takalar, 0.63±0.17 for Majene and 0.75±0.21 for Pare-Pare population. Seven fragments were identified as species-specific markers of H. oxycephalus. The UPGMA cluster analysis showed that the Takalar population was genetically closer to Pare-Pare population (D= 0.0812 than to Majene population (D= 0.1873.

  14. Bilateral hearing loss is associated with decreased nonverbal intelligence in US children aged 6 to 16 years.

    Science.gov (United States)

    Emmett, Susan D; Francis, Howard W

    2014-09-01

    To evaluate the association between hearing loss and nonverbal intelligence in US children. The Third National Health and Nutrition Examination Survey (NHANES III) is a cross-sectional survey (1988-1994) that used complex multistage sampling design to produce nationally representative demographic and examination data. A total of 4,823 children ages 6 to 16 years completed audiometric evaluation and cognitive testing during NHANES III. Hearing loss was defined as low-frequency pure-tone average (PTA) >25 dB (0.5, 1, 2 kHz) or high-frequency PTA >25 dB (3, 4, 6, 8 kHz) and was designated as unilateral or bilateral. Nonverbal intelligence was measured using the Wechsler Intelligence Scale for Children-Revised block design subtest. Low nonverbal intelligence was defined as a standardized score intelligence scores differed between children with normal hearing (9.59) and children with bilateral (6.87; P = .02) but not unilateral (9.12; P = .42) hearing loss. Non-Hispanic black race/ethnicity and family income intelligence, respectively (odds ratio [OR]: 3.92; P intelligence compared to normal hearing children (OR: 5.77; P = .02). Unilateral hearing loss was not associated with higher odds of low nonverbal intelligence (OR: 0.73; P = .40). Bilateral but not unilateral hearing loss is associated with decreased nonverbal intelligence in US children. Longitudinal studies are urgently needed to better understand these associations and their potential impact on future opportunities. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.

  15. Macrophage Migration Inhibitory Factor Contributes to Host Defense against Acute Trypanosoma cruzi Infection

    Science.gov (United States)

    Reyes, José L.; Terrazas, Luis I.; Espinoza, Bertha; Cruz-Robles, David; Soto, Virgilia; Rivera-Montoya, Irma; Gómez-García, Lorena; Snider, Heidi; Satoskar, Abhay R.; Rodríguez-Sosa, Miriam

    2006-01-01

    Macrophage migration inhibitory factor (MIF) is a proinflammatory cytokine that is involved in the host defense against several pathogens. Here we used MIF−/− mice to determine the role of endogenous MIF in the regulation of the host immune response against Trypanosoma cruzi infection. MIF−/− mice displayed high levels of blood and tissue parasitemia, developed severe heart and skeletal muscle immunopathology, and succumbed to T. cruzi infection faster than MIF+/+ mice. The enhanced susceptibility of MIF−/− mice to T. cruzi was associated with reduced levels of proinflammatory cytokines, such as tumor necrosis factor alpha, interleukin-12 (IL-12), IL-18, gamma interferon (IFN-γ), and IL-1β, in their sera and reduced production of IL-12, IFN-γ, and IL-4 by spleen cells during the early phase of infection. At all time points, antigen-stimulated splenocytes from MIF+/+ and MIF−/− mice produced comparable levels of IL-10. MIF−/− mice also produced significantly less Th1-associated antigen-specific immunoglobulin G2a (IgG2a) throughout the infection, but both groups produced comparable levels of Th2-associated IgG1. Lastly, inflamed hearts from T. cruzi-infected MIF−/− mice expressed increased transcripts for IFN-γ, but fewer for IL-12 p35, IL-12 p40, IL-23, and inducible nitric oxide synthase, compared to MIF+/+ mice. Taken together, our findings show that MIF plays a role in controlling acute T. cruzi infection. PMID:16714544

  16. Effects of abutment diameter, luting agent type, and re-cementation on the retention of implant-supported CAD/CAM metal copings over short abutments

    Science.gov (United States)

    Safari, Sina; Amini, Parviz; Yaghmaei, Kaveh

    2018-01-01

    PURPOSE The aim of this study was to evaluate the effects of abutment diameter, cement type, and re-cementation on the retention of implant-supported CAD/CAM metal copings over short abutments. MATERIALS AND METHODS Sixty abutments with two different diameters, the height of which was reduced to 3 mm, were vertically mounted in acrylic resin blocks with matching implant analogues. The specimens were divided into 2 diameter groups: 4.5 mm and 5.5 mm (n=30). For each abutment a CAD/CAM metal coping was manufactured, with an occlusal loop. Each group was sub-divided into 3 sub-groups (n=10). In each subgroup, a different cement type was used: resin-modified glass-ionomer, resin cement and zinc-oxide-eugenol. After incubation and thermocycling, the removal force was measured using a universal testing machine at a cross-head speed of 0.5 mm/min. In zinc-oxide-eugenol group, after removal of the coping, the cement remnants were completely cleaned and the copings were re-cemented with resin cement and re-tested. Two-way ANOVA, post hoc Tukey tests, and paired t-test were used to analyze data (α=.05). RESULTS The highest pulling force was registered in the resin cement group (414.8 N), followed by the re-cementation group (380.5 N). Increasing the diameter improved the retention significantly (P=.006). The difference in retention between the cemented and recemented copings was not statistically significant (P=.40). CONCLUSION Resin cement provided retention almost twice as strong as that of the RMGI. Increasing the abutment diameter improved retention significantly. Re-cementation with resin cement did not exhibit any difference from the initial cementation with resin cement. PMID:29503708

  17. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    International Nuclear Information System (INIS)

    Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex; Waalkes, Michael P.

    2015-01-01

    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  18. Association of physical activity with metabolic syndrome in a predominantly rural Nigerian population.

    Science.gov (United States)

    Oguoma, Victor M; Nwose, Ezekiel U; Skinner, Timothy C; Richards, Ross S; Digban, Kester A; Onyia, Innocent C

    2016-01-01

    Physical activity is an essential determinant of health. However, there is dearth of evidence regarding prevalence of physical activity in developing countries, especially its association with metabolic syndrome risk factors. This study assessed the association of physical activity with metabolic syndrome in a Nigerian population. A cross-sectional study was carried out on apparently healthy persons who are ≥ 18 years old. The World Health Organisation (WHO) Global Physical Activity Questionnaire (GPAQ) was used to collect five domains of physical activity. Participants were classified as physically active or inactive based on meeting the cut-off value of 600 MET-min/week. Metabolic syndrome was diagnosed using the Joint Scientific Statement on Harmonizing the Metabolic Syndrome criteria. Overall prevalence of physically active individuals was 50.1% (CI: 45.6-54.7%). Physical inactivity is significantly more in females (p40 years old (pmetabolic syndrome appeared more likely to be physically active (OR=1.48, CI: 0.71-3.09); physical inactivity showed to exist more among participants who were living in urban area (OR=6.61, CI: 3.40-12.85, pmetabolic syndrome risk factors. The high prevalence of physical inactivity in this study population is a clear indication that concerted efforts to improve physical activity may be required. However, it seems that metabolic syndrome is not improved by being physically active. This suggests that interventions directed at physical activity alone may not produce optimal efficacy in this study population. Copyright © 2015 Diabetes India. Published by Elsevier Ltd. All rights reserved.

  19. Xylitol, an anticaries agent, exhibits potent inhibition of inflammatory responses in human THP-1-derived macrophages infected with Porphyromonas gingivalis.

    Science.gov (United States)

    Park, Eunjoo; Na, Hee Sam; Kim, Sheon Min; Wallet, Shannon; Cha, Seunghee; Chung, Jin

    2014-06-01

    Xylitol is a well-known anticaries agent and has been used for the prevention and treatment of dental caries. In this study, the anti-inflammatory effects of xylitol are evaluated for possible use in the prevention and treatment of periodontal infections. Cytokine expression was stimulated in THP-1 (human monocyte cell line)-derived macrophages by live Porphyromonas gingivalis, and enzyme-linked immunosorbent assay and a commercial multiplex assay kit were used to determine the effects of xylitol on live P. gingivalis-induced production of cytokine. The effects of xylitol on phagocytosis and the production of nitric oxide were determined using phagocytosis assay, viable cell count, and Griess reagent. The effects of xylitol on P. gingivalis adhesion were determined by immunostaining, and costimulatory molecule expression was examined by flow cytometry. Live P. gingivalis infection increased the production of representative proinflammatory cytokines, such as tumor necrosis factor-α and interleukin (IL)-1β, in a multiplicity of infection- and time-dependent manner. Live P. gingivalis also enhanced the release of cytokines and chemokines, such as IL-12 p40, eotaxin, interferon γ-induced protein 10, monocyte chemotactic protein-1, and macrophage inflammatory protein-1. The pretreatment of xylitol significantly inhibited the P. gingivalis-induced cytokines production and nitric oxide production. In addition, xylitol inhibited the attachment of live P. gingivalis on THP-1-derived macrophages. Furthermore, xylitol exerted antiphagocytic activity against both Escherichia coli and P. gingivalis. These findings suggest that xylitol acts as an anti-inflammatory agent in THP-1-derived macrophages infected with live P. gingivalis, which supports its use in periodontitis.

  20. Balance Regularity Among Former High School Football Players With or Without a History of Concussion.

    Science.gov (United States)

    Schmidt, Julianne D; Terry, Douglas P; Ko, Jihyun; Newell, Karl M; Miller, L Stephen

    2018-02-01

      Subclinical postural-control changes may persist beyond the point when athletes are considered clinically recovered postconcussion.   To compare postural-control performance between former high school football players with or without a history of concussion using linear and nonlinear metrics.   Case-control study.   Clinical research laboratory.   A total of 11 former high school football players (age range, 45-60 years) with 2 or more concussions and 11 age- and height-matched former high school football players without a history of concussion. No participant had college or professional football experience.   Participants completed the Sensory Organization Test. We compared postural control (linear: equilibrium scores; nonlinear: sample and multiscale entropy) between groups using a 2 × 3 analysis of variance across conditions 4 to 6 (4: eyes open, sway-referenced platform; 5: eyes closed, sway-referenced platform; 6: eyes open, sway-referenced surround and platform).   We observed a group-by-condition interaction effect for medial-lateral sample entropy ( F 2,40 = 3.26, P = .049, η p 2 = 0.140). Participants with a history of concussion presented with more regular medial-lateral sample entropy values (0.90 ± 0.41) for condition 5 than participants without a history of concussion (1.30 ± 0.35; mean difference = -0.40; 95% confidence interval [CI] = -0.74, -0.06; t 20 = -2.48, P = .02), but conditions 4 (mean difference = -0.11; 95% CI: -0.37, 0.15; t 20 = -0.86, P = .40) and 6 (mean difference = -0.25; 95% CI: -0.55, 0.06; t 20 = -1.66, P = .11) did not differ between groups.   Postconcussion deficits, detected using nonlinear metrics, may persist long after injury resolution. Subclinical concussion deficits may persist for years beyond clinical concussion recovery.

  1. Effects of fluoxetine on fine motor performance in dysthymia: an 8-week, nonrandomized, open-label study.

    Science.gov (United States)

    Schrijvers, Didier; Maas, Yvonne J; Sabbe, Bernard G C

    2009-01-01

    Present findings on psychomotor retardation in dysthymia are inconsistent and changes in psychomotor performance during antidepressant treatment have not been investigated in this population to date. The present study aims to explore the psychomotor effects of an 8-week regimen of fluoxetine in dysthymic patients. Dysthymic patients (both inpatients and outpatients of the Psychiatric Hospital Sint-Norbertus, Duffel, Belgium), presenting over a period of 2 years, meeting the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision criteria for dysthymia, and having Hamilton Depression Rating Scale scores of > or = 12 were enrolled. During 8 weeks of treatment with fluoxetine 20 mg/d, depression severity and graphic motor activity were assessed 4 times by recording the time (a reaction time [RT] and a movement time [MT]) participants needed to copy single lines and simple and complex figures. The patients' outcomes were compared with those of untreated, healthy controls, matched for sex and comparable age and education. The assessors were masked to treatment and group. Eighteen dysthymic patients (mean age, 40 years; male/female ratio, 4/14; mean weight, 70 kg; all white) were treated; 18 healthy controls (mean age, 40 years; male/female ratio, 4/14; mean weight, 72 kg; all white) were used as comparison. The overall patient group experienced significant psychomotor changes only in association with the complex figure-copying task (RT: F = 5.67, P 40% decrease in severity scores), significant improvements were observed only for the RT of the line- (F = 4.75, P dysthymia.

  2. CB1 cannabinoid receptor expression in the striatum: Association with corticostriatal circuits and developmental regulation

    Directory of Open Access Journals (Sweden)

    Vincent eVan Waes

    2012-03-01

    Full Text Available Corticostriatal circuits mediate various aspects of goal-directed behavior and are critically important for basal ganglia-related disorders. Activity in these circuits is regulated by the endocannabinoid system via stimulation of CB1 cannabinoid receptors. CB1 receptors are highly expressed in projection neurons and select interneurons of the striatum, but expression levels vary considerably between different striatal regions (functional domains. We investigated CB1 receptor expression within specific corticostriatal circuits by mapping CB1 mRNA levels in striatal sectors defined by their cortical inputs in rats. We also assessed changes in CB1 expression in the striatum during development. Our results show that CB1 expression is highest in juveniles (P25 and then progressively decreases towards adolescent (P40 and adult (P70 levels. At every age, CB1 receptors are predominantly expressed in sensorimotor striatal sectors, with considerably lower expression in associative and limbic sectors. Moreover, for most corticostriatal circuits there is an inverse relationship between cortical and striatal expression levels. Thus, striatal sectors with high CB1 expression (sensorimotor sectors tend to receive inputs from cortical areas with low expression, while striatal sectors with low expression (associative/limbic sectors receive inputs from cortical regions with higher expression (medial prefrontal cortex. In so far as CB1 mRNA levels reflect receptor function, our findings suggest differential CB1 signaling between different developmental stages and between sensorimotor and associative/limbic circuits. The regional distribution of CB1 receptor expression in the striatum further suggests that, in sensorimotor sectors, CB1 receptors mostly regulate GABA inputs from local axon collaterals of projection neurons, whereas in associative/limbic sectors, CB1 regulation of GABA inputs from interneurons and glutamate inputs may be more important.

  3. Increased corticosterone in peripubertal rats leads to long-lasting alterations in social exploration and aggression

    Directory of Open Access Journals (Sweden)

    Vandana eVeenit

    2013-04-01

    Full Text Available Stress during childhood and adolescence enhances the risk of psychopathology later in life. We have previously shown that subjecting male rats to stress during the peripubertal period induces long-lasting effects on emotion and social behaviors. As corticosterone is increased by stress and known to exert important programming effects, we reasoned that increasing corticosterone might mimic the effects of peripubertal stress. To this end, we injected corticosterone (5 mg/kg on 7 scattered days during the peripuberty period (P28-P30, P34, P36, P40 and P42, following the same experimental schedule as for stress administration in our peripubertal paradigm. We measured play behavior in the homecage and, at adulthood, the corticosterone response to novelty and behavioral responses in tests for anxiety- and depression-like behaviors, aggression and social exploration. As compared to vehicle, corticosterone-treated animals exhibit more aggressive play behavior during adolescence, increased aggressive behavior in a resident-intruder test while reduced juvenile exploration and corticosterone reactivity at adulthood. Whereas the corticosterone treatment mimicked alterations induced by the peripuberty stress protocol in the social domain, it did not reproduce previously observed effects of peripuberty stress on increasing anxiety-like and depression-like behaviors, respectively evaluated in the elevated plus maze and the forced swim tests. Our findings indicate that increasing corticosterone levels during peripuberty might be instrumental to program alterations in the social domain observed following stress, whereas other factors might need to be recruited for the programming of long-term changes in emotionality. Our study opens the possibility that individual differences on the degree of glucocorticoid activation during peripuberty might be central to defining differences in vulnerability to develop psychopathological disorders coursing with alterations in

  4. Loss of Endogenous Interleukin-12 Activates Survival Signals in Ultraviolet-Exposed Mouse Skin and Skin Tumors

    Directory of Open Access Journals (Sweden)

    Syed M. Meeran

    2009-09-01

    Full Text Available Interleukin-12 (IL-12-deficiency promotes photocarcinogenesis in mice; however, the molecular mechanisms underlying this effect have not been fully elucidated. Here, we report that long-term exposure to ultraviolet (UV radiation resulted in enhancement of the levels of cell survival kinases, such as phosphatidylinositol 3-kinase (PI3K, Akt (Ser473, p-ERK1/2, and p-p38 in the skin of IL-12p40 knockout (IL-12 KO mice compared with the skin of wild-type mice. UV-induced activation of nuclear factor-κB (NF-κB/p65 in the skin of IL-12 KO mice was also more prominent. The levels of NF-κB-targeted proteins, such as proliferating cell nuclear antigen (PCNA, cyclooxygenase-2, cyclin D1, and inducible nitric oxide synthase, were higher in the UV-exposed skin of IL-12 KO mice than the UV-exposed skin of wild types. In short-term UV irradiation experiments, subcutaneous treatment of IL-12 KO mice with recombinant IL-12 (rIL-12 or topical treatment with oridonin, an inhibitor of NF-κB, resulted in the inhibition of UV-induced increases in the levels of PCNA, cyclin D1, and NF-κB compared with non-rIL-12- or non-oridonin-treated IL-12 KO mice. UV-induced skin tumors of IL-12 KO mice had higher levels of PI3K, p-Akt (Ser473, p-ERK1/2, p-p38, NF-κB, and PCNA and fewer apoptotic cells than skin tumors of wild types. Together, these data suggest that the loss of endogenous IL-12 activates survival signals in UV-exposed skin and that may lead to the enhanced photocarcinogenesis in mice.

  5. Tracheal tube airleak in clinical practice and impact on tidal volume measurement in ventilated neonates.

    Science.gov (United States)

    Mahmoud, Ramadan A; Proquitté, Hans; Fawzy, Naglaa; Bührer, Christoph; Schmalisch, Gerd

    2011-03-01

    To determine the prevalence, size, and factors affecting tracheal tube (TT) leak in clinical practice and their influence on the displayed tidal volume (Vt) in ventilated newborn infants using uncuffed TTs. Monitoring of Vt is important for implementation of lung-protective ventilation strategies but becomes meaningless in the presence of large TT airleaks. Retrospective clinical study. Neonatal intensive care unit. Patient records of 163 neonates ventilated with Babylog 8000 for ≥ 5 hrs with a median (range) gestation age of 31.1 wks (23.3-41.9 wks) and a median birth weight of 1470 g (410-4475 g) were evaluated. : Ventilatory settings, TT leak, and Vt were recorded every 3 hrs. The lowest, median, and highest TT leaks were noted on the day the first TT leak (>5%) occurred, the day on which TT leak peaked, and the day of extubation. A TT leak of >5% was seen in 122 (75%) infants. Neonates with TT leak, compared with those without TT leak, had a longer duration of mechanical ventilation (p 40% commonly seen on the third day of mechanical ventilation. Regression analysis showed that a TT leak of 40% indicated that the displayed Vt was underestimated by 1.2 mL/kg (about 24% of target Vt). TT leak is highly variable, and TT leak of >40% with clinically relevant Vt errors occurred in nearly half of all ventilated neonates. Preterm infants of low birth weight and with small-diameter TTs ventilated for a long period were at greater risk of TT leak.

  6. Hemocyanins Stimulate Innate Immunity by Inducing Different Temporal Patterns of Proinflammatory Cytokine Expression in Macrophages.

    Science.gov (United States)

    Zhong, Ta-Ying; Arancibia, Sergio; Born, Raimundo; Tampe, Ricardo; Villar, Javiera; Del Campo, Miguel; Manubens, Augusto; Becker, María Inés

    2016-06-01

    Hemocyanins induce a potent Th1-dominant immune response with beneficial clinical outcomes when used as a carrier/adjuvant in vaccines and nonspecific immunostimulant in cancer. However, the mechanisms by which hemocyanins trigger innate immune responses, leading to beneficial adaptive immune responses, are unknown. This response is triggered by a proinflammatory signal from various components, of which macrophages are an essential part. To understand how these proteins influence macrophage response, we investigated the effects of mollusks hemocyanins with varying structural and immunological properties, including hemocyanins from Concholepas concholepas, Fissurella latimarginata, and Megathura crenulata (keyhole limpet hemocyanin), on cultures of peritoneal macrophages. Hemocyanins were phagocytosed and slowly processed. Analysis of this process showed differential gene expression along with protein levels of proinflammatory markers, including IL-1β, IL-6, IL-12p40, and TNF-α. An extended expression analysis of 84 cytokines during a 24-h period showed a robust proinflammatory response for F. latimarginata hemocyanin in comparison with keyhole limpet hemocyanin and C. concholepas hemocyanin, which was characterized by an increase in the transcript levels of M1 cytokines involved in leukocyte recruitment. These cytokine genes included chemokines (Cxcl1, Cxcl3, Cxcl5, Ccl2, and Ccl3), ILs (Il1b and Ifng), growth factors (Csf2 and Csf3), and TNF family members (Cd40lg). The protein levels of certain cytokines were increased. However, every hemocyanin maintains downregulated key M2 cytokine genes, including Il4 and Il5 Collectively, our data demonstrate that hemocyanins are able to trigger the release of proinflammatory factors with different patterns of cytokine expression, suggesting differential signaling pathways and transcriptional network mechanisms that lead to the activation of M1-polarized macrophages. Copyright © 2016 by The American Association of

  7. Immunological profile of silent brain infarction and lacunar stroke.

    Directory of Open Access Journals (Sweden)

    Paola Sarchielli

    Full Text Available Neuroinflammation is believed to be involved in the pathophysiological mechanisms of silent brain infarcts (SBI. However, the immunological profile of SBI has been scarcely investigated. In the context of a national research project named SILENCE, aimed at investigating clinical, biochemical and pathogenic features of SBI, we have measured the plasma profile of some inflammatory-related molecules in SBI patients (n = 21, patients with recent lacunar infarcts (LI, n = 28 and healthy controls (n = 31, consecutively enrolled in four Italian centres. A panel of chemokines (MIG, CTACK, IL16, SDF1a, MCP1, growth factors (SCF, SCGFb, HGF, IL3, immunoglobulin-type adhesion molecules (ICAM1, VCAM1, proinflammatory cytokines (IL18, INFa2, MIF, IL12p40, cell surface receptors on T-cells (IL2Ra, and inductors of apoptosis (TRAIL was assessed in plasma samples by Luminex xMAP™ technology. Immunological parameters were compared using non-parametric statistics and performance to distinguish SBI and LI was evaluated by receiver operating characteristic (ROC analysis. Plasma levels of ICAM1 were significantly higher in both SBI and LI patients as compared to controls (SBI≥LI>Ctrl. A different trend was observed for IL16 (SBICtrl, SCF (LICtrl and SCGFb (SBI>LICtrl and IL18 when compared to LI patients (Ctrl≤SBI>LI. All the other immunological markers did not significantly differ among groups. According to ROC analysis, the best predictor for SBI condition was the chemokine MIG (AUC = 0.84, sensitivity 86%, specificity 77%, while SCF had the best performance in distinguishing LI patients (AUC = 0.84, sensitivity 86%, specificity 68%. These results confirm the involvement of inflammatory processes in cerebrovascular disorders, particularly in SBI, a very common age-related condition. The differences in plasma profile of inflammatory molecules may underlie different pathological mechanisms in SBI and LI patients.

  8. Ruxolitinib vs best available therapy for ET intolerant or resistant to hydroxycarbamide.

    Science.gov (United States)

    Harrison, Claire N; Mead, Adam J; Panchal, Anesh; Fox, Sonia; Yap, Christina; Gbandi, Emmanouela; Houlton, Aimee; Alimam, Samah; Ewing, Joanne; Wood, Marion; Chen, Frederick; Coppell, Jason; Panoskaltsis, Nicki; Knapper, Steven; Ali, Sahra; Hamblin, Angela; Scherber, Robyn; Dueck, Amylou C; Cross, Nicholas C P; Mesa, Ruben; McMullin, Mary Frances

    2017-10-26

    Treatments for high-risk essential thrombocythemia (ET) address thrombocytosis, disease-related symptoms, as well as risks of thrombosis, hemorrhage, transformation to myelofibrosis, and leukemia. Patients resistant/intolerant to hydroxycarbamide (HC) have a poor outlook. MAJIC (ISRCTN61925716) is a randomized phase 2 trial of ruxolitinib (JAK1/2 inhibitor) vs best available therapy (BAT) in ET and polycythemia vera patients resistant or intolerant to HC. Here, findings of MAJIC-ET are reported, where the modified intention-to-treat population included 58 and 52 patients randomized to receive ruxolitinib or BAT, respectively. There was no evidence of improvement in complete response within 1 year reported in 27 (46.6%) patients treated with ruxolitinib vs 23 (44.2%) with BAT ( P = .40). At 2 years, rates of thrombosis, hemorrhage, and transformation were not significantly different; however, some disease-related symptoms improved in patients receiving ruxolitinib relative to BAT. Molecular responses were uncommon; there were 2 complete molecular responses (CMR) and 1 partial molecular response in CALR- positive ruxolitinib-treated patients. Transformation to myelofibrosis occurred in 1 CMR patient, presumably because of the emergence of a different clone, raising questions about the relevance of CMR in ET patients. Grade 3 and 4 anemia occurred in 19% and 0% of ruxolitinib vs 0% (both grades) in the BAT arm, and grade 3 and 4 thrombocytopenia in 5.2% and 1.7% of ruxolitinib vs 0% (both grades) of BAT-treated patients. Rates of discontinuation or treatment switching did not differ between the 2 trial arms. The MAJIC-ET trial suggests that ruxolitinib is not superior to current second-line treatments for ET. This trial was registered at www.isrctn.com as #ISRCTN61925716. © 2017 by The American Society of Hematology.

  9. Radiation dosimetry predicts IQ after conformal radiation therapy in pediatric patients with localized ependymoma

    International Nuclear Information System (INIS)

    Merchant, Thomas E.; Kiehna, Erin N.; Li Chenghong; Xiong Xiaoping; Mulhern, Raymond K.

    2005-01-01

    Purpose: To assess the effects of radiation dose-volume distribution on the trajectory of IQ development after conformal radiation therapy (CRT) in pediatric patients with ependymoma. Methods and Materials: The study included 88 patients (median age, 2.8 years ± 4.5 years) with localized ependymoma who received CRT (54-59.4 Gy) that used a 1-cm margin on the postoperative tumor bed. Patients were evaluated with tests that included IQ measures at baseline (before CRT) and at 6, 12, 24, 36, 48, and 60 months. Differential dose-volume histograms (DVH) were derived for total-brain, supratentorial-brain, and right and left temporal-lobe volumes. The data were partitioned into three dose intervals and integrated to create variables that represent the fractional volume that received dose over the specified intervals (e.g., V 0-20Gy , V 20-40Gy , V 40-65Gy ) and modeled with clinical variables to develop a regression equation to estimate IQ after CRT. Results: A total of 327 IQ tests were performed in 66 patients with infratentorial tumors and 20 with supratentorial tumors. The median follow-up was 29.4 months. For all patients, IQ was best estimated by age (years) at CRT; percent volume of the supratentorial brain that received doses between 0 and 20 Gy, 20 and 40 Gy, and 40 and 65 Gy; and time (months) after CRT. Age contributed significantly to the intercept (p > 0.0001), and the dose-volume coefficients were statistically significant (V 0-20Gy , p = 0.01; V 20-40Gy , p 40-65Gy , p = 0.04). A similar model was developed exclusively for patients with infratentorial tumors but not supratentorial tumors. Conclusion: Radiation dosimetry can be used to predict IQ after CRT in patients with localized ependymoma. The specificity of models may be enhanced by grouping according to tumor location

  10. Trends in a changing vascular practice environment for members of the Society for Vascular Surgery

    Science.gov (United States)

    Matthews, Mika A. B.; Satiani, Bhagwan; Lohr, Joann M.

    2013-01-01

    Objective To survey the Society for Vascular Surgery (SVS) membership with regard to practice trends related to work effort, employment status, practice ownership, endovascular cases, and anticipated changes in practice in the near future. Methods A survey questionnaire was developed to gather information about member demographics and practice, hours worked, full-time (FT) or part-time status, employment status, practice ownership, competition for referrals, proportion of endovascular vs open procedures, and anticipated changes in practice in the next 3 years. We used SurveyMonkey and distributed the survey to all active vascular surgeon (VS) members of the SVS. Results The response rate was 207 of 2230 (10.7%). Two thirds were in private practice, and 21% were in solo practice. Twenty-four percent were employed by hospitals/health systems. Those VS under the age of 50 years were more likely to exclusively practice vascular surgery compared with VS over the age of 50 years (P = .0003). Sixty-eight of the physicians (32.7%) were between 50 and 59 years old, 186 (90.3%) were men, 192 (92.8%) worked FT (>36 hours of patient care per week), and almost two thirds worked >60 hours per week. Those in physician-owned practices worked >40 hours of patient care per week more often than did FT employed VS (P = .012). Younger VS (age 50% of their workload being endovascular compared with older VS (age ≥50 years; P 40 hours of patient care per week than are FT employed VS. Longitudinal surveys of SVS members are imperative to help tailor educational, training, and practice management offerings, guide governmental activities, advocate for issues important to members, improve branding initiatives, and sponsor workforce analyses. PMID:23254185

  11. Novel immunomodulatory effects of adiponectin on dendritic cell functions.

    Science.gov (United States)

    Tsang, Julia Yuen Shan; Li, Daxu; Ho, Derek; Peng, Jiao; Xu, Aimin; Lamb, Jonathan; Chen, Yan; Tam, Paul Kwong Hang

    2011-05-01

    Adiponectin (ADN) is an adipocytokine with anti-inflammatory properties. Although it has been reported that ADN can inhibit the immunostimulatory function of monocytes and macrophages, little is known of its effect on dendritic cells (DC). Recent data suggest that ADN can regulate immune responses. DCs are uniquely specialised antigen presenting cells that play a central role in the initiation of immunity and tolerance. In this study, we have investigated the immuno- modulatory effects of ADN on DC functions. We found that ADN has only moderate effect on the differentiation of murine bone marrow (BM) derived DCs but altered the phenotype of DCs. The expression of major histocompatibilty complex class II (MHCII), CD80 and CD86 on ADN conditioned DCs (ADN-DCs) was lower than that on untreated cells. The production of IL-12p40 was also suppressed in ADN-DCs. Interestingly, ADN treated DCs showed an increase in the expression of the inhibitory molecule, programmed death-1 ligand (PDL-1) compared to untreated cells. In vitro co-culture of ADN-DCs with allogeneic T cells led to a decrease in T cell proliferation and reduction of IL-2 production. Concomitant with that, a higher percentage of CD4(+)CD25(+)Foxp3(+) regulatory T cells (Tregs) was detected in co-cultures of T cells and ADN-DCs. Blocking PD-1/PDL-1 pathway could partially restore T cell function. These findings suggest that the immunomodulatory effect of ADN on immune responses could be at least partially be mediated by its ability to alter DC function. The PD-1/PDL-1 pathway and the enhancement of Treg expansion are implicated in the immunomodulatory mechanisms. Copyright © 2010 Elsevier B.V. All rights reserved.

  12. Studies of the spin-isospin response of the nuclear continuum using intermediate energy hadrons. Final technical report, May 20, 1987--April 30, 1994

    International Nuclear Information System (INIS)

    1995-01-01

    For the most part the work supported by this grant has involved study of the spin, isospin, and multipole content of the continuum of nuclei. Most of the work has used polarized (p,p') or (d,d') reactions, measuring spin observables to infer properties of the target nuclei. In addition some work has been done using the (p,nx) reaction to study the Δ excitation region of the continuum. Publications resulting from this work have included seventeen refereed articles and letters, seventeen abstracts and conference talks, three of which were invited. Experiments included: 12 C(p,p), E=318 MeV; 48 Ca(p,p), E=318 MeV; 40 Ca(p,p), E=800 MeV; 208 Pb(p,p), E=200 MeV; H, 12 C(n,p); 40 Ca(p,p), E=580 MeV; 208 Pb(p,p), E=200 MeV; 12 C(d,d), E d =400 MeV; 40 Ca(p,p), E=500 MeV; 12 C(p,p), E=800 MeV; 40 Ca(d,d), E d =400 MeV; 40 Ca(p,p), E p =318 MeV; 208 Pb(p,p), E p =200 MeV; 12 C(d,d), E d =400 MeV; 2 H, 12 C(p,nπ), E p =800 MeV; 12 C(d,d), E d =600 MeV

  13. Structural abnormalities and altered regional brain activity in multiple sclerosis with simple spinal cord involvement.

    Science.gov (United States)

    Yin, Ping; Liu, Yi; Xiong, Hua; Han, Yongliang; Sah, Shambhu Kumar; Zeng, Chun; Wang, Jingjie; Li, Yongmei

    2018-02-01

    To assess the changes of the structural and functional abnormalities in multiple sclerosis with simple spinal cord involvement (MS-SSCI) by using resting-state functional MRI (RS-fMRI), voxel based morphology (VBM) and diffusion tensor tractography. The amplitude of low-frequency fluctuation (ALFF) of 22 patients with MS-SSCI and 22 healthy controls (HCs) matched for age, gender and education were compared by using RS-fMRI. We also compared the volume, fractional anisotropy (FA) and apparent diffusion coefficient of the brain regions in baseline brain activity by using VBM and diffusion tensor imaging. The relationships between the expanded disability states scale (EDSS) scores, changed parameters of structure and function were further explored. (1) Compared with HCs, the ALFF of the bilateral hippocampus and right middle temporal gyrus in MS-SSCI decreased significantly. However, patients exhibited increased ALFF in the left middle frontal gyrus, left posterior cingulate gyrus and right middle occipital gyrus ( two-sample t-test, after AlphaSim correction, p 40). The volume of right middle frontal gyrus reduced significantly (p right hippocampus, the FA of left hippocampus and right middle temporal gyrus were significantly different. (2) A significant correlation between EDSS scores and ALFF was noted only in the left posterior cingulate gyrus. Our results detected structural and functional abnormalities in MS-SSCI and functional parameters were associated with clinical abnormalities. Multimodal imaging plays an important role in detecting structural and functional abnormalities in MS-SSCI. Advances in knowledge: This is the first time to apply RS-fMRI, VBM and diffusion tensor tractography to study the structural and functional abnormalities in MS-SSCI, and to explore its correlation with EDSS score.

  14. Mnn10 Maintains Pathogenicity in Candida albicans by Extending α-1,6-Mannose Backbone to Evade Host Dectin-1 Mediated Antifungal Immunity.

    Directory of Open Access Journals (Sweden)

    Shi Qun Zhang

    2016-05-01

    Full Text Available The cell wall is a dynamic structure that is important for the pathogenicity of Candida albicans. Mannan, which is located in the outermost layer of the cell wall, has been shown to contribute to the pathogenesis of C. albicans, however, the molecular mechanism by which this occurs remains unclear. Here we identified a novel α-1,6-mannosyltransferase encoded by MNN10 in C. albicans. We found that Mnn10 is required for cell wall α-1,6-mannose backbone biosynthesis and polysaccharides organization. Deletion of MNN10 resulted in significant attenuation of the pathogenesis of C. albicans in a murine systemic candidiasis model. Inhibition of α-1,6-mannose backbone extension did not, however, impact the invasive ability of C. albicans in vitro. Notably, mnn10 mutant restored the invasive capacity in athymic nude mice, which further supports the notion of an enhanced host antifungal defense related to this backbone change. Mnn10 mutant induced enhanced Th1 and Th17 cell mediated antifungal immunity, and resulted in enhanced recruitment of neutrophils and monocytes for pathogen clearance in vivo. We also demonstrated that MNN10 could unmask the surface β-(1,3-glucan, a crucial pathogen-associated molecular pattern (PAMP of C. albicans recognized by host Dectin-1. Our results demonstrate that mnn10 mutant could stimulate an enhanced Dectin-1 dependent immune response of macrophages in vitro, including the activation of nuclear factor-κB, mitogen-activated protein kinase pathways, and secretion of specific cytokines such as TNF-α, IL-6, IL-1β and IL-12p40. In summary, our study indicated that α-1,6-mannose backbone is critical for the pathogenesis of C. albicans via shielding β-glucan from recognition by host Dectin-1 mediated immune recognition. Moreover, our work suggests that inhibition of α-1,6-mannose extension by Mnn10 may represent a novel modality to reduce the pathogenicity of C. albicans.

  15. Generation of a convalescent model of virulent Francisella tularensis infection for assessment of host requirements for survival of tularemia.

    Directory of Open Access Journals (Sweden)

    Deborah D Crane

    Full Text Available Francisella tularensis is a facultative intracellular bacterium and the causative agent of tularemia. Development of novel vaccines and therapeutics for tularemia has been hampered by the lack of understanding of which immune components are required to survive infection. Defining these requirements for protection against virulent F. tularensis, such as strain SchuS4, has been difficult since experimentally infected animals typically die within 5 days after exposure to as few as 10 bacteria. Such a short mean time to death typically precludes development, and therefore assessment, of immune responses directed against virulent F. tularensis. To enable identification of the components of the immune system that are required for survival of virulent F. tularensis, we developed a convalescent model of tularemia in C57Bl/6 mice using low dose antibiotic therapy in which the host immune response is ultimately responsible for clearance of the bacterium. Using this model we demonstrate αβTCR(+ cells, γδTCR(+ cells, and B cells are necessary to survive primary SchuS4 infection. Analysis of mice deficient in specific soluble mediators shows that IL-12p40 and IL-12p35 are essential for survival of SchuS4 infection. We also show that IFN-γ is required for survival of SchuS4 infection since mice lacking IFN-γR succumb to disease during the course of antibiotic therapy. Finally, we found that both CD4(+ and CD8(+ cells are the primary producers of IFN-γand that γδTCR(+ cells and NK cells make a minimal contribution toward production of this cytokine throughout infection. Together these data provide a novel model that identifies key cells and cytokines required for survival or exacerbation of infection with virulent F. tularensis and provides evidence that this model will be a useful tool for better understanding the dynamics of tularemia infection.

  16. Suppression of dendritic cells' maturation and functions by daidzein, a phytoestrogen

    International Nuclear Information System (INIS)

    Yum, Min Kyu; Jung, Mi Young; Cho, Daeho; Kim, Tae Sung

    2011-01-01

    Isoflavones are ubiquitous compounds in foods and in the environment in general. Daidzein and genistein, the best known of isoflavones, are structurally similar to 17β-estradiol and known to exert estrogenic effects. They also evidence a broad variety of biological properties, including antioxidant, anti-carcinogenic, anti-atherogenic and anti-osteoporotic activities. Previously, daidzein was reported to increase the phagocytic activity of peritoneal macrophages and splenocyte proliferation, and to inhibit nitric oxide (NO) production in macrophages. However, its potential impacts on immune response in dendritic cells (DCs), antigen-presenting cells that link innate and adaptive immunity, have yet to be clearly elucidated. In this study, we evaluated the effects of isoflavones on the maturation and activation of DCs. Isoflavones (formononetin, daidzein, equol, biochanin A, genistein) were found to differentially affect the expression of CD86, a costimulatory molecule, on lipopolysaccharide (LPS)-stimulated DCs. In particular, daidzein significantly and dose-dependently inhibited the expression levels of maturation-associated cell surface markers including CD40, costimulatory molecules (CD80, CD86), and major histocompatibility complex class II (I-A b ) molecule on LPS-stimulated DCs. Daidzein also suppressed pro-inflammatory cytokine production such as IL-12p40, IL-6 and TNF-α, whereas it didn't affect IL-10 and IL-1β expression. Furthermore, daidzein enhanced endocytosis and inhibited the allo-stimulatory ability of LPS-stimulated DCs on T cells, indicating that daidzein treatment can inhibit the functional maturation of DCs. These results demonstrate that daidzein may exhibit immunosuppressive activity by inhibiting the maturation and activation of DCs. -- Highlights: ► Daidzein inhibited expression of maturation-associated cell surface markers in DCs. ► Daidzein suppressed expression of pro-inflammatory cytokines in LPS-stimulated DCs. ► Daidzein

  17. Liposomal bupivacaine as a single-injection peripheral nerve block: a dose-response study.

    Science.gov (United States)

    Ilfeld, Brian M; Malhotra, Nisha; Furnish, Timothy J; Donohue, Michael C; Madison, Sarah J

    2013-11-01

    Currently available local anesthetics approved for single-injection peripheral nerve blocks have a maximum duration of fashion. The end points included the maximum voluntary isometric contraction (MVIC) of the quadriceps femoris muscle and tolerance to cutaneous electrical current in the femoral nerve distribution. Measurements were performed from baseline until quadriceps MVIC returned to 80% of baseline bilaterally. There were statistically significant dose responses in MVIC (0.09%/mg, SE = 0.03, 95% confidence interval [CI], 0.04-0.14, P = 0.002) and tolerance to cutaneous current (-0.03 mA/mg, SE = 0.01, 95% CI, -0.04 to -0.02, P 40 mg, tolerance to cutaneous current did not return to within 20% above baseline until after 24 hours in 100% of subjects (95% CI, 56%-100%). MVIC did not consistently return to within 20% of baseline until after 24 hours in 90% of subjects (95% CI, 54%-100%). Motor block duration was not correlated with bupivacaine dose (0.06 hour/mg, SE = 0.14, 95% CI, -0.27 to 0.39, P = 0.707). The results of this investigation suggest that deposition of a liposomal bupivacaine formulation adjacent to the femoral nerve results in a partial sensory and motor block of >24 hours for the highest doses examined. However, the high variability of block magnitude among subjects and inverse relationship of dose and response magnitude attests to the need for a phase 3 study with a far larger sample size, and that these results should be viewed as suggestive, requiring confirmation in a future trial.

  18. Patterns of remission, continuation and incidence of broadly defined eating disorders during early pregnancy in the Norwegian Mother and Child Cohort Study (MoBa).

    Science.gov (United States)

    Bulik, Cynthia M; Von Holle, Ann; Hamer, Robert; Knoph Berg, Cecilie; Torgersen, Leila; Magnus, Per; Stoltenberg, Camilla; Siega-Riz, Anna Maria; Sullivan, Patrick; Reichborn-Kjennerud, Ted

    2007-08-01

    We explored the course of broadly defined eating disorders during pregnancy in the Norwegian Mother and Child Cohort Study (MoBa) at the Norwegian Institute of Public Health. A total of 41,157 pregnant women, enrolled at approximately 18 weeks' gestation, had valid data from the Norwegian Medical Birth Registry. We collected questionnaire-based diagnostic information on broadly defined anorexia nervosa (AN), and bulimia nervosa (BN), and eating disorders not otherwise specified (EDNOS). EDNOS subtypes included binge eating disorder (BED) and recurrent self-induced purging in the absence of binge eating (EDNOS-P). We explored rates of remission, continuation and incidence of BN, BED and EDNOS-P during pregnancy. Prepregnancy prevalence estimates were 0.1% for AN, 0.7% for BN, 3.5% for BED and 0.1% for EDNOS-P. During early pregnancy, estimates were 0.2% (BN), 4.8% (BED) and 0.1% (EDNOS-P). Proportions of individuals remitting during pregnancy were 78% (EDNOS-P), 40% (BN purging), 39% (BED), 34% (BN any type) and 29% (BN non-purging type). Additional individuals with BN achieved partial remission. Incident BN and EDNOS-P during pregnancy were rare. For BED, the incidence rate was 1.1 per 1000 person-weeks, equating to 711 new cases of BED during pregnancy. Incident BED was associated with indices of lower socio-economic status. Pregnancy appears to be a catalyst for remission of some eating disorders but also a vulnerability window for the new onset of broadly defined BED, especially in economically disadvantaged individuals. Vigilance by health-care professionals for continuation and emergence of eating disorders in pregnancy is warranted.

  19. Mechanisms underlying the anti-inflammatory effects of Clinacanthus nutans Lindau extracts: inhibition of cytokine production and Toll-like receptor-4 activation

    Directory of Open Access Journals (Sweden)

    Chun Wai eMai

    2016-02-01

    Full Text Available Clinacanthus nutans has had a long history of use in folk medicine in Malaysia and Southeast Asia; mostly in the relief of inflammatory conditions. In this study, we investigated the effects of different extracts of C. nutans upon lipopolysaccharide (LPS induced inflammation in order to identify its mechanism of action. Extracts of leaves and stem bark of C. nutans were prepared using polar and non-polar solvents to produce four extracts, namely polar leaf extract (LP, non-polar leaf extract (LN, polar stem extract (SP and non-polar stem extracts (SN. The extracts were standardized by determining its total phenolic and total flavonoid contents. Its anti-inflammatory effects were assessed on LPS induced nitrite release in RAW264.7 macrophages and Toll-like receptor (TLR-4 activation in TLR-4 transfected human embryonic kidney cells (HEK-BlueTM-hTLR4 cells. The levels of inflammatory cytokines (TNF-α, IFN-γ, IL-1β, IL-6, IL-12p40 and IL-17 in treated RAW264.7 macrophages were quantified to verify its anti-inflammatory effects. Western blotting was used to investigate the effect of the most potent extract (LP on TLR-4 related inflammatory proteins (p65, p38, ERK, JNK, IRF3 in RAW264.7 macrophages. All four extracts produced a significant, concentration-dependent reduction in LPS-stimulated nitric oxide, LPS-induced TLR-4 activation in HEK-BlueTM-hTLR4 cells and LPS-stimulated cytokines production in RAW264.7 macrophages. The most potent extract, LP, also inhibited all LPS-induced TLR-4 inflammatory proteins. These results provide a basis for understanding the mechanisms underlying the previously demonstrated anti-inflammatory activity of C. nutans extracts.

  20. Polymorphisms in genes TLR1, 2 and 4 are associated with differential cytokine and chemokine serum production in patients with leprosy

    Directory of Open Access Journals (Sweden)

    Nadja de Lima Santana

    Full Text Available BACKGROUND Leprosy or hansen’s disease is a spectral disease whose clinical forms mostly depends on host’s immune and genetic factors. Different Toll-like receptors (TLR variants have been described associated with leprosy, but with some lack of replication across different populations. OBJECTIVES To evaluate the role of polymorphisms in genes TLR1, TLR2 and TLR4 and susceptibility to leprosy in a genetic case control study; to verify the association between genotypes of these markers and the immunological profile in the serum of patients with leprosy. METHODS Pre-designed TaqMan® assays were used to genotype markers at TLR1 (rs4833095, rs5743551, TLR2 (rs7656411, rs3804099 and TLR4 (rs1927914, rs1927911. A panel of cytokines and chemokines was accessed by enzime-linked immunosorbent assay (ELISA test in the serum of a subgroup of patients with and without leprosy reactions. FINDINGS Our results show an association between the T allele of rs3804099 at the TLR2 gene and increased risk for leprosy per se [Odds ratio (OR = 1.296, p = 0,022]. In addition, evaluating the association between different genotypes of the TLR1, 2 and 4 markers and cytokine/chemokine serological levels, IL-17 appears as an immunological marker regulated by the polymorphism of the three TLR genes evaluated, whereas different TLR1 genotypes were associated with differential production of IL-12p40 and MCP-1(CCL2. Furthermore, other relevant serum markers such as CXCL-10 and IL-6 seemed to be regulated by TLR2 variants and IL-1β was related to TLR4 genotypes. MAIN CONCLUSIONS All together our data points that the tested TLR markers may have a regulatory role in the immunity against Mycobacterium leprae, by driving the host’s production of key cytokines and chemokines involved in the pathogenesis of this disease.

  1. Effects of the Advanced Innovative Internet-Based Communication Education Program on Promoting Communication Between Nurses and Patients With Dementia.

    Science.gov (United States)

    Chao, Hui-Chen; Kaas, Merrie; Su, Ying-Hwa; Lin, Mei-Feng; Huang, Mei-Chih; Wang, Jing-Jy

    2016-06-01

    Effective communication between nurses and patients with dementia promotes the quality of patient care by improving the identification of patient needs and by reducing the miscommunication-related frustration of patients and nurses. This study evaluates the effects of an advanced innovative Internet-based communication education (AIICE) program on nurses' communication knowledge, attitudes, frequency of assessing patient communication capacity, and communication performance in the context of care for patients with dementia. In addition, this study attempts to evaluate the indirect effects of this program on outcomes for patients with dementia, including memory and behavior-related problems and depressive symptoms. A quasi-experimental research design with a one-group repeated measure was conducted. Convenience sampling was used to recruit nurses from long-term care facilities in southern Taiwan. Data were analyzed using general estimating equations to compare changes over time across three points: baseline, fourth-week posttest, and 16th-week posttest. One hundred five nurses completed the AIICE program and the posttest surveys. The findings indicate that nurses' communication knowledge, frequency in assessing patients' communication capacity, and communication performance had improved significantly over the baseline by either the 4th- or 16th-week posttest (p < .01). However, communication attitude showed no significant improvement in the posttest survey (p = .40). Furthermore, the findings indicate that the memory and behavior-related problems and the depressive symptoms of patients had decreased significantly by the 16th-week posttest (p = .05). This study showed that the AIICE program improves nurses' communication knowledge, frequency to assess patients' communication capacity, and communication performance and alleviates the memory and behavior-related problems and depressive symptoms of patients. The continuous communication training of nurses using the

  2. The Attenuated Brucella abortus Strain 19 Invades, Persists in, and Activates Human Dendritic Cells, and Induces the Secretion of IL-12p70 but Not IL-23.

    Directory of Open Access Journals (Sweden)

    Mario Weinhold

    Full Text Available Bacterial vectors have been proposed as novel vaccine strategies to induce strong cellular immunity. Attenuated strains of Brucella abortus comprise promising vector candidates since they have the potential to induce strong CD4(+ and CD8(+ T-cell mediated immune responses in the absence of excessive inflammation as observed with other Gram-negative bacteria. However, some Brucella strains interfere with the maturation of dendritic cells (DCs, which is essential for antigen-specific T-cell priming. In the present study, we investigated the interaction of human monocyte-derived DCs with the smooth attenuated B. abortus strain (S 19, which has previously been employed successfully to vaccinate cattle.We first looked into the potential of S19 to hamper the cytokine-induced maturation of DCs; however, infected cells expressed CD25, CD40, CD80, and CD86 to a comparable extent as uninfected, cytokine-matured DCs. Furthermore, S19 activated DCs in the absence of exogeneous stimuli, enhanced the expression of HLA-ABC and HLA-DR, and was able to persist intracellularly without causing cytotoxicity. Thus, DCs provide a cellular niche for persisting brucellae in vivo as a permanent source of antigen. S19-infected DCs produced IL-12/23p40, IL-12p70, and IL-10, but not IL-23. While heat-killed bacteria also activated DCs, soluble mediators were not involved in S19-induced activation of human DCs. HEK 293 transfectants revealed cellular activation by S19 primarily through engagement of Toll-like receptor (TLR2.Thus, as an immunological prerequisite for vaccine efficacy, B. abortus S19 potently infects and potently activates (most likely via TLR2 human DCs to produce Th1-promoting cytokines.

  3. Ebulliometric determination and prediction of (vapor + liquid) equilibria for binary and ternary mixtures containing alcohols (C{sub 1}-C{sub 4}) and dimethyl carbonate

    Energy Technology Data Exchange (ETDEWEB)

    Matsuda, Hiroyuki, E-mail: matsuda@chem.cst.nihon-u.ac.jp [Department of Materials and Applied Chemistry, Nihon University, 1-8 Kanda Surugadai, Chiyoda-ku, Tokyo 101-8308 (Japan); Fukano, Makoto; Kikkawa, Shinichiro [Department of Materials and Applied Chemistry, Nihon University, 1-8 Kanda Surugadai, Chiyoda-ku, Tokyo 101-8308 (Japan); Constantinescu, Dana [Carl von Ossietzky Universitaet Oldenburg, Technische Chemie, D-26111 Oldenburg (Germany); Kurihara, Kiyofumi; Tochigi, Katsumi; Ochi, Kenji [Department of Materials and Applied Chemistry, Nihon University, 1-8 Kanda Surugadai, Chiyoda-ku, Tokyo 101-8308 (Japan); Gmehling, Juergen [Carl von Ossietzky Universitaet Oldenburg, Technische Chemie, D-26111 Oldenburg (Germany)

    2012-01-15

    Highlights: > The VLE behavior of systems containing dimethyl carbonate (DMC) was investigated. > VLE data for ternary and binary mixtures containing alcohol and DMC were measured. > Several activity coefficient models were used for data reduction or prediction. > Valley line, i.e., distillation boundary, was observed for the ternary mixture. > Residue curves were calculated to investigate composition profile for distillation. - Abstract: (Vapor + liquid) equilibrium (VLE) data for a ternary mixture, namely {l_brace}methanol + propan-1-ol + dimethyl carbonate (DMC){r_brace}, and four binary mixtures, namely an {l_brace}alcohol (C{sub 3} or C{sub 4}) + DMC{r_brace}, containing the binary constituent mixtures of the ternary mixture, were measured at p = (40.00 to 93.32) kPa using a modified Swietoslawski-type ebulliometer. The experimental data for the binary systems were correlated using the Wilson model. The Wilson model was also applied to the ternary system to predict the VLE behavior using parameters from the binary mixtures. The modified UNIFAC (Dortmund) model was also tested for the predictions of the VLE behavior of the binary and ternary mixtures. In addition, the experimental VLE data for the ternary and constituent binary mixtures were correlated using the extended Redlich-Kister (ERK) model, which can completely represent the azeotropic points. For the ternary system, a comparison of the experimental and the predicted or correlated boiling points obtained using the Wilson and ERK models showed that the ERK model is more accurate. The valley line, i.e., the curve which divides the patterns of vapor-liquid tie lines, was found in the (methanol + propan-1-ol + DMC) system. This valley line could be represented by the ERK model. Finally, the composition profile for simple distillation of this ternary mixture was obtained by analysis of the residue curves from the estimated Wilson parameters of the constituent binary mixtures.

  4. IRF4 Deficiency Abrogates Lupus Nephritis Despite Enhancing Systemic Cytokine Production

    Science.gov (United States)

    Lech, Maciej; Weidenbusch, Marc; Kulkarni, Onkar P.; Ryu, Mi; Darisipudi, Murthy Narayana; Susanti, Heni Eka; Mittruecker, Hans-Willi; Mak, Tak W.

    2011-01-01

    The IFN-regulatory factors IRF1, IRF3, IRF5, and IRF7 modulate processes involved in the pathogenesis of systemic lupus and lupus nephritis, but the contribution of IRF4, which has multiple roles in innate and adaptive immunity, is unknown. To determine a putative pathogenic role of IRF4 in lupus, we crossed Irf4-deficient mice with autoimmune C57BL/6-(Fas)lpr mice. IRF4 deficiency associated with increased activation of antigen-presenting cells in C57BL/6-(Fas)lpr mice, resulting in a massive increase in plasma levels of TNF and IL-12p40, suggesting that IRF4 suppresses cytokine release in these mice. Nevertheless, IRF4 deficiency completely protected these mice from glomerulonephritis and lung disease. The mice were hypogammaglobulinemic and lacked antinuclear and anti-dsDNA autoantibodies, revealing the requirement of IRF4 for the maturation of plasma cells. As a consequence, Irf4-deficient C57BL/6-(Fas)lpr mice neither developed immune complex disease nor glomerular activation of complement. In addition, lack of IRF4 impaired the maturation of Th17 effector T cells and reduced plasma levels of IL-17 and IL-21, which are cytokines known to contribute to autoimmune tissue injury. In summary, IRF4 deficiency enhances systemic inflammation and the activation of antigen-presenting cells but also prevents the maturation of plasma cells and effector T cells. Because these adaptive immune effectors are essential for the evolution of lupus nephritis, we conclude that IRF4 promotes the development of lupus nephritis despite suppressing antigen-presenting cells. PMID:21742731

  5. Pattern of expression of immune-relevant genes in the gonad of a teleost, the gilthead seabream (Sparus aurata L.).

    Science.gov (United States)

    Chaves-Pozo, E; Liarte, S; Fernández-Alacid, L; Abellán, E; Meseguer, J; Mulero, V; García-Ayala, A

    2008-05-01

    Immune responses in the testis are regulated in a way that provides protection for the developing male germ cells, while permitting qualitatively normal inflammatory responses and protection against infection. In addition, germ cells are potent targets for the growth factors and cytokines which regulate the reproductive process. Our study analyzes for the first time the pattern of expression of several immune-relevant genes in the gonad of a seasonal breeding teleost fish. The immune molecules analyzed include (i) inflammatory molecules, such as interleukin-1b (il1b), il6, tumor necrosis factor-a (tnfa), cyclooxygenase-2 (cox2) and the NADPH oxidase subunit p40(phox) (ncf4 gene); (ii) the anti-inflammatory cytokine transforming growth factor-b1 (tgfb1) and its type 2 receptor tgfbr2; (iii) innate immune receptors, including toll-like receptor 9 (tlr9), tlr5, tlr22 and macrophage-colony stimulating factor receptor (mcsfr); (iv) lymphocyte receptors, such as the beta subunit of T-cell receptor (Tcrb) and the heavy chain of immunoglobulin M (ighm); (v) the anti-bacterial molecules lysozyme (lyz), hepcidin (hamp) and complement component 3 (c3); (vi) the anti-viral molecule myxovirus (influenza) resistance protein (mx); and (vii) molecules related to leukocyte infiltration, including the CC chemokine ccl4, the CXC chemokine il8 and the leukocyte adhesion molecule E-selectin (Sele). Notably, all of them show a pattern of expression that depends on the reproductive stage of the first two reproductive cycles when the fish develop and function as males. Furthermore, we demonstrate that some of these immune-relevant molecules, such as Il1b and Mcsfr, are produced by germ cells (Il1b) and ovarian and testicular somatic cells (Mcsfr). These data suggest that, as occurs in mammals, there is a critical balance between immune molecules and that these may play an essential role in the orchestration of gametogenesis and the maintenance of gonad tissue homeostasis in fish.

  6. Neural-specific deletion of Htra2 causes cerebellar neurodegeneration and defective processing of mitochondrial OPA1.

    Directory of Open Access Journals (Sweden)

    Victoria L Patterson

    Full Text Available HTRA2, a serine protease in the intermembrane space, has important functions in mitochondrial stress signaling while its abnormal activity may contribute to the development of Parkinson's disease. Mice with a missense or null mutation of Htra2 fail to thrive, suffer striatal neuronal loss, and a parkinsonian phenotype that leads to death at 30-40 days of age. While informative, these mouse models cannot separate neural contributions from systemic effects due to the complex phenotypes of HTRA2 deficiency. Hence, we developed mice carrying a Htra2-floxed allele to query the consequences of tissue-specific HTRA2 deficiency. We found that mice with neural-specific deletion of Htra2 exhibited atrophy of the thymus and spleen, cessation to gain weight past postnatal (P day 18, neurological symptoms including ataxia and complete penetrance of premature death by P40. Histologically, increased apoptosis was detected in the cerebellum, and to a lesser degree in the striatum and the entorhinal cortex, from P25. Even earlier at P20, mitochondria in the cerebella already exhibited abnormal morphology, including swelling, vesiculation, and fragmentation of the cristae. Furthermore, the onset of these structural anomalies was accompanied by defective processing of OPA1, a key molecule for mitochondrial fusion and cristae remodeling, leading to depletion of the L-isoform. Together, these findings suggest that HTRA2 is essential for maintenance of the mitochondrial integrity in neurons. Without functional HTRA2, a lifespan as short as 40 days accumulates a large quantity of dysfunctional mitochondria that contributes to the demise of mutant mice.

  7. Characterization of neuronal cell death in the spiral ganglia of a mouse model of endolymphatic hydrops.

    Science.gov (United States)

    Semaan, Maroun T; Zheng, Qing Y; Han, Fengchan; Zheng, Yuxi; Yu, Heping; Heaphy, John C; Megerian, Cliff A

    2013-04-01

    Spiral ganglion neurons (SGN) in the Phex male mouse, a murine model of postnatal endolymphatic hydrops (ELH) undergo progressive deterioration reminiscent of human and other animal models of ELH with features suggesting apoptosis as an important mechanism. Histologic analysis of the mutant's cochlea demonstrates ELH by postnatal Day (P) 21 and SGN loss by P90. The SGN loss seems to occur in a consistent topographic pattern beginning at the cochlear apex. SGN were counted at P60, P90, and P120. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative PCR, and immunohistochemical analyses of activated caspase-3, caspase-8, and caspase-9 were performed on cochlear sections obtained from mutants and controls. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay (TUNEL) was carried out on 2 mutants and 2 controls. Corrected SGN counts in control mice were greater in the apical turn of the cochleae at P90 and P120, respectively (p < 0.01). Increased expression of activated caspase-3, caspase-8, and caspase-9 was seen in the mutant. At later time points, activated caspase expression gradually declined in the apical turns and increased in basal turns of the cochlea. Quantitative and semiquantitative PCR analysis confirmed increased expression of caspase-3, caspase-8, and caspase-9 at P21 and P40. TUNEL staining demonstrated apoptosis at P90 in the apical and basal turns of the mutant cochleae. SGN degeneration in the Phex /Y mouse seems to mimic patterns observed in other animals with ELH. Apoptosis plays an important role in the degeneration of the SGN in the Phex male mouse.

  8. Tumor necrosis factor alpha blockade exacerbates murine psoriasis-like disease by enhancing Th17 function and decreasing expansion of Treg cells.

    Science.gov (United States)

    Ma, Hak-Ling; Napierata, Lee; Stedman, Nancy; Benoit, Stephen; Collins, Mary; Nickerson-Nutter, Cheryl; Young, Deborah A

    2010-02-01

    Patients with psoriasis and psoriatic arthritis respond well to tumor necrosis factor alpha (TNFalpha) blockers in general; however, there is now mounting evidence that a small cohort of patients with rheumatoid arthritis who receive TNFalpha blockers develop psoriasis. This study was undertaken to explore the mechanisms underlying TNFalpha blockade-induced exacerbation of skin inflammation in murine psoriasis-like skin disease. Skin inflammation was induced in BALB/c scid/scid mice after they received CD4+CD45RB(high)CD25- (naive CD4) T cells from donor mice. These mice were treated with either anti-interleukin-12 (anti-IL-12)/23p40 antibody or murine TNFRII-Fc fusion protein and were examined for signs of disease, including histologic features, various cytokine levels in the serum, and cytokine or FoxP3 transcripts in the affected skin and draining lymph node (LN) cells. In a separate study, naive CD4+ T cells were differentiated into Th1 or Th17 lineages with anti-CD3/28 magnetic beads and appropriate cytokines in the presence or absence of TNFalpha. Cytokine gene expression from these differentiated cells was also determined. Neutralization of TNFalpha exacerbated skin inflammation and markedly enhanced the expression of the proinflammatory cytokines IL-1beta, IL-6, IL-17, IL-21, and IL-22 but suppressed FoxP3 expression in the skin and reduced the number of FoxP3-positive Treg cells in the draining LNs. TNFalpha also demonstrated a divergent role during priming and reactivation of naive T cells. These results reveal a novel immunoregulatory role of TNFalpha on Th17 and Treg cells in some individuals, which may account for the exacerbation of skin inflammation in some patients who receive anti-TNF treatments.

  9. The Tobacco Smoke Component, Acrolein, Suppresses Innate Macrophage Responses by Direct Alkylation of c-Jun N-Terminal Kinase

    Science.gov (United States)

    Hristova, Milena; Spiess, Page C.; Kasahara, David I.; Randall, Matthew J.; Deng, Bin

    2012-01-01

    The respiratory innate immune system is often compromised by tobacco smoke exposure, and previous studies have indicated that acrolein, a reactive electrophile in tobacco smoke, may contribute to the immunosuppressive effects of smoking. Exposure of mice to acrolein at concentrations similar to those in cigarette smoke (5 ppm, 4 h) significantly suppressed alveolar macrophage responses to bacterial LPS, indicated by reduced induction of nitric oxide synthase 2, TNF-α, and IL-12p40. Mechanistic studies with bone marrow–derived macrophages or MH-S macrophages demonstrated that acrolein (1–30 μM) attenuated these LPS-mediated innate responses in association with depletion of cellular glutathione, although glutathione depletion itself was not fully responsible for these immunosuppressive effects. Inhibitory actions of acrolein were most prominent after acute exposure (acrolein with critical signaling pathways. Among the key signaling pathways involved in innate macrophage responses, acrolein marginally affected LPS-mediated activation of nuclear factor (NF)-κB, and significantly suppressed phosphorylation of c-Jun N-terminal kinase (JNK) and activation of c-Jun. Using biotin hydrazide labeling, NF-κB RelA and p50, as well as JNK2, a critical mediator of innate macrophage responses, were revealed as direct targets for alkylation by acrolein. Mass spectrometry analysis of acrolein-modified recombinant JNK2 indicated adduction to Cys41 and Cys177, putative important sites involved in mitogen-activated protein kinase (MAPK) kinase (MEK) binding and JNK2 phosphorylation. Our findings indicate that direct alkylation of JNK2 by electrophiles, such as acrolein, may be a prominent and hitherto unrecognized mechanism in their immunosuppressive effects, and may be a major factor in smoking-induced effects on the immune system. PMID:21778411

  10. C-terminal region of DNA ligase IV drives XRCC4/DNA ligase IV complex to chromatin

    International Nuclear Information System (INIS)

    Liu, Sicheng; Liu, Xunyue; Kamdar, Radhika Pankaj; Wanotayan, Rujira; Sharma, Mukesh Kumar; Adachi, Noritaka; Matsumoto, Yoshihisa

    2013-01-01

    Highlights: •Chromatin binding of XRCC4 is dependent on the presence of DNA ligase IV. •C-terminal region of DNA ligase IV alone can recruit itself and XRCC4 to chromatin. •Two BRCT domains of DNA ligase IV are essential for the chromatin binding of XRCC4. -- Abstract: DNA ligase IV (LIG4) and XRCC4 form a complex to ligate two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). It is not fully understood how these proteins are recruited to DSBs. We recently demonstrated radiation-induced chromatin binding of XRCC4 by biochemical fractionation using detergent Nonidet P-40. In the present study, we examined the role of LIG4 in the recruitment of XRCC4/LIG4 complex to chromatin. The chromatin binding of XRCC4 was dependent on the presence of LIG4. The mutations in two BRCT domains (W725R and W893R, respectively) of LIG4 reduced the chromatin binding of LIG4 and XRCC4. The C-terminal fragment of LIG4 (LIG4-CT) without N-terminal catalytic domains could bind to chromatin with XRCC4. LIG4-CT with W725R or W893R mutation could bind to chromatin but could not support the chromatin binding of XRCC4. The ability of C-terminal region of LIG4 to interact with chromatin might provide us with an insight into the mechanisms of DSB repair through NHEJ

  11. Testosterone improves erectile function through inhibition of reactive oxygen species generation in castrated rats

    Directory of Open Access Journals (Sweden)

    Rui Li

    2016-05-01

    Full Text Available Testosterone is overwhelmingly important in regulating erectile physiology. However, the associated molecular mechanisms are poorly understood. The purpose of this study was to explore the effects and mechanisms of testosterone in erectile dysfunction (ED in castrated rats. Forty male Sprague-Dawley rats were randomized to four groups (control, sham-operated, castration and castration-with-testosterone-replacement. Reactive oxygen species (ROS production was measured by dihydroethidium (DHE staining. Erectile function was assessed by the recording of intracavernous pressure (ICP and mean arterial blood pressure (MAP. Protein expression levels were examined by western blotting. We found that castration reduced erectile function and that testosterone restored it. Nitric oxide synthase (NOS activity was decrease in the castrated rats, and testosterone administration attenuated this decrease (each p < 0.05. The testosterone, dihydrotestosterone, cyclic guanosine monophosphate (cGMP and cyclic adenosine monophosphate (cAMP concentrations were lower in the castrated rats, and testosterone restored these levels (each p < 0.05. Furthermore, the cyclooxygenase-2 (COX-2 and prostacyclin synthase (PTGIS expression levels and phospho-endothelial nitric oxide synthase (p-eNOS, Ser1177/endothelial nitric oxide synthase (eNOS ratio were reduced in the castrated rats compared with the controls (each p < 0.05. In addition, the p40phox and p67phox expression levels were increased in the castrated rats, and testosterone reversed these changes (each p < 0.05. Overall, our results demonstrate that testosterone ameliorates ED after castration by reducing ROS production and increasing the activity of the eNOS/cGMP and COX-2/PTGIS/cAMP signaling pathways.

  12. Combination of endolysins and high pressure to inactivate Listeria monocytogenes.

    Science.gov (United States)

    van Nassau, Tomas J; Lenz, Christian A; Scherzinger, Anna S; Vogel, Rudi F

    2017-12-01

    Outbreaks of listeriosis are often related to the consumption of low-processed ready-to-eat food products (e.g. soft cheeses or smoked fish) contaminated with Listeria monocytogenes. Traditional preservation techniques, such as heat treatment, cannot eliminate Listeria from these products without strongly affecting the quality of the foods. We therefore investigated the use of endolysin (PlyP40, Ply511, or PlyP825) in combination with high hydrostatic pressure processing to kill L. monocytogenes in buffer. The results demonstrated a more than additive effect when both treatments were combined. For example, whereas 0.16 μg/mL PlyP825 or 300 MPa (1 min, 30 °C) applied individually reduced the cell count by 0.2 and 0.3 log cfu, respectively, a combined treatment resulted in a reduction of 5.5 log cfu. Similar results were obtained for the other endolysins combined with high pressure processing. We also showed that the synergistic inactivation of cells by endolysin and HHP is possible at a pressure level of only 200 MPa (2 min, 30 °C). Thus, the application of endolysins did not only substantially increase the bactericidal effect of high pressure, but it also enabled the inactivation of bacterial cells at much lower pressure levels. This shows the potential of using such combined processes for the inactivation of L. monocytogenes and food preservation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Rehabilitation using high-intensity physical training and long-term return-to-work in cancer survivors.

    Science.gov (United States)

    Thijs, Karin M; de Boer, Angela G E M; Vreugdenhil, Gerard; van de Wouw, Agnès J; Houterman, Saskia; Schep, Goof

    2012-06-01

    Due to large and increasing numbers of cancer survivors, long-term cancer-related health issues have become a major focus of attention. This study examined the relation between a high-intensity physical rehabilitation program and return-to-work in cancer survivors who had received chemotherapy. The intervention group, consisting of 72 cancer survivors from one hospital (8 men and 64 women, mean age 49 years), followed an 18-weeks rehabilitation program including strength and interval training, and home-based activities. An age-matched control group, consisting of 38 cancer survivors (9 men and 29 women), was recruited from two other hospitals. They received only standard medical care. All subjects were evaluated during a telephone interview on employment issues, conducted at ±3 years after diagnosis. The main outcomes were change in working hours per week and time until return-to-work. Patients in the intervention group showed significant less reduction in working hours per week [-5.0 h/week vs. -10.8 h/week (P = .03)]. Multivariate analyses showed that the training intervention, the age of patients, and the number of working hours pre-diagnosis could explain the improvement in long-term participation at work. Time until (partial) return-to-work was 11.5 weeks for the intervention group versus 13.2 weeks for the control group (P = .40). On long-term follow-up, 78% of the participants from the intervention group versus 66% from the control group had returned to work on the pre-diagnosis level of working hours (P = .18). Rehabilitation using high-intensity physical training is useful for working patients to minimize the decreased ability to work resulting from cancer and its treatment.

  14. Acute injury in the peripheral nervous system triggers an alternative macrophage response

    Directory of Open Access Journals (Sweden)

    Ydens Elke

    2012-07-01

    Full Text Available Abstract Background The activation of the immune system in neurodegeneration has detrimental as well as beneficial effects. Which aspects of this immune response aggravate the neurodegenerative breakdown and which stimulate regeneration remains an open question. To unravel the neuroprotective aspects of the immune system we focused on a model of acute peripheral nerve injury, in which the immune system was shown to be protective. Methods To determine the type of immune response triggered after axotomy of the sciatic nerve, a model for Wallerian degeneration in the peripheral nervous system, we evaluated markers representing the two extremes of a type I and type II immune response (classical vs. alternative using real-time quantitative polymerase chain reaction (RT-qPCR, western blot, and immunohistochemistry. Results Our results showed that acute peripheral nerve injury triggers an anti-inflammatory and immunosuppressive response, rather than a pro-inflammatory response. This was reflected by the complete absence of classical macrophage markers (iNOS, IFNγ, and IL12p40, and the strong up-regulation of tissue repair markers (arginase-1, Ym1, and Trem2. The signal favoring the alternative macrophage environment was induced immediately after nerve damage and appeared to be established within the nerve, well before the infiltration of macrophages. In addition, negative regulators of the innate immune response, as well as the anti-inflammatory cytokine IL-10 were induced. The strict regulation of the immune system dampens the potential tissue damaging effects of an over-activated response. Conclusions We here demonstrate that acute peripheral nerve injury triggers an inherent protective environment by inducing the M2 phenotype of macrophages and the expression of arginase-1. We believe that the M2 phenotype, associated with a sterile inflammatory response and tissue repair, might explain their neuroprotective capacity. As such, shifting the

  15. Phosphatidylinositol 3,5-Bisphosphate-Rich Membrane Domains in Endosomes and Lysosomes.

    Science.gov (United States)

    Takatori, Sho; Tatematsu, Tsuyako; Cheng, Jinglei; Matsumoto, Jun; Akano, Takuya; Fujimoto, Toyoshi

    2016-02-01

    Phosphatidylinositol 3,5-bisphosphate (PtdIns(3,5)P2 ) has critical functions in endosomes and lysosomes. We developed a method to define nanoscale distribution of PtdIns(3,5)P2 using freeze-fracture electron microscopy. GST-ATG18-4×FLAG was used to label PtdIns(3,5)P2 and its binding to phosphatidylinositol 3-phosphate (PtdIns(3)P) was blocked by an excess of the p40(phox) PX domain. In yeast exposed to hyperosmotic stress, PtdIns(3,5)P2 was concentrated in intramembrane particle (IMP)-deficient domains in the vacuolar membrane, which made close contact with adjacent membranes. The IMP-deficient domain was also enriched with PtdIns(3)P, but was deficient in Vph1p, a liquid-disordered domain marker. In yeast lacking either PtdIns(3,5)P2 or its effector, Atg18p, the IMP-deficient, PtdIns(3)P-rich membranes were folded tightly to make abnormal tubular structures, thus showing where the vacuolar fragmentation process is arrested when PtdIns(3,5)P2 metabolism is defective. In HeLa cells, PtdIns(3,5)P2 was significantly enriched in the vesicular domain of RAB5- and RAB7-positive endosome/lysosomes of the tubulo-vesicular morphology. This biased distribution of PtdIns(3,5)P2 was also observed using fluorescence microscopy, which further showed enrichment of a retromer component, VPS35, in the tubular domain. This is the first report to show segregation of PtdIns(3,5)P2 -rich and -deficient domains in endosome/lysosomes, which should be important for endosome/lysosome functionality. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Elevated cytokine responses to Vibrio harveyi infection in the Japanese pufferfish (Takifugu rubripes) treated with Lactobacillus paracasei spp. paracasei (06TCa22) isolated from the Mongolian dairy product.

    Science.gov (United States)

    Biswas, G; Korenaga, H; Nagamine, R; Kawahara, S; Takeda, S; Kikuchi, Y; Dashnyam, B; Yoshida, T; Kono, T; Sakai, M

    2013-09-01

    With the aim of evaluating the effect of a Mongolian dairy product derived Lactobacillus paracasei spp. paracasei (strain 06TCa22) (Lpp) on the cytokine-mediated immune responses to Vibrio harveyi infection, we examined 16 cytokine expressions in the Japanese pufferfish, Takifugu rubripes. Fish were orally treated with the heat-killed Lpp at 1 mg g(-1) body weight d(-1) for 3 days. At 24 h posttreatment, fish were infected by an intramuscular injection of 0.1 mL V. harveyi bacterial suspension (10(8) cfu mL(-1)). Additionally, superoxide anion production (SAP) and phagocytic activity (PA) of head kidney cells were assessed during 120 h postinfection period. Significant up-regulation of pro-inflammatory (IL-1β, IL-6, IL-17A/F-3, TNF-α and TNF-N), cell-mediated immune inducing (IL-12p35, IL-12p40 and IL-18), antiviral/intra-cellular pathogen killing (I-IFN-1 and IFN-γ), anti-inflammatory (IL-10) and lymphocyte agonistic (IL-2, IL-7, IL-15, IL-21 and TGF-β1) cytokines was observed in the treated fish compared to control ones during the pathogen infection. Furthermore, significantly increased SAP and PA (P < 0.01; 0.05) were recorded in the treated fish compared to untreated fish. These results suggest the beneficial role of Lpp in enhancement of cytokine-mediated immunity in the Japanese pufferfish against V. harveyi infection and application of this product as a potential fish immunostimulant. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Vitamin D enhances IL-1β secretion and restricts growth of Mycobacterium tuberculosis in macrophages from TB patients.

    Science.gov (United States)

    Eklund, Daniel; Persson, Hans Lennart; Larsson, Marie; Welin, Amanda; Idh, Jonna; Paues, Jakob; Fransson, Sven-Göran; Stendahl, Olle; Schön, Thomas; Lerm, Maria

    2013-03-01

    The emergence of multidrug-resistant strains of Mycobacterium tuberculosis (MTB), the bacterium responsible for tuberculosis (TB), has rekindled the interest in the role of nutritional supplementation of micronutrients, such as vitamin D, as adjuvant treatment. Here, the growth of virulent MTB in macrophages obtained from the peripheral blood of patients with and without TB was studied. The H37Rv strain genetically modified to express Vibrio harveyi luciferase was used to determine the growth of MTB by luminometry in the human monocyte-derived macrophages (hMDMs) from study subjects. Determination of cytokine levels in culture supernatants was performed using a flow cytometry-based bead array technique. No differences in intracellular growth of MTB were observed between the different study groups. However, stimulation with 100nM 1,25-dihydroxyvitamin D significantly enhanced the capacity of hMDMs isolated from TB patients to control the infection. This effect was not observed in hMDMs from the other groups. The interleukin (IL)-1β and IL-10 release by hMDMs was clearly increased upon stimulation with 1,25-dihydroxyvitamin D. Furthermore, the 1,25-dihydroxyvitamin D stimulation also led to elevated levels of TNF-α (tumor necrosis factor-alpha) and IL-12p40. It was concluded that vitamin D triggers an inflammatory response in human macrophages with enhanced secretion of cytokines, as well as enhancing the capacity of hMDMs from patients with active TB to restrict mycobacterial growth. Copyright © 2013 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  18. Surfactant secretion is stimulated by decreased alveolar CO2

    International Nuclear Information System (INIS)

    Chander, A.; Dodia, C.R.; Gullo, J.; Fisher, A.B.

    1986-01-01

    The authors investigated the hypothesis that altered intracellular pH may modulate lung surfactant secretion. They have used isolated perfused lung preparation to investigate release of [ 3 H]choline labeled phosphatidylcholine (PC) in the alveolar space of rat lungs ventilated with 5%, 2.5%, or 0% CO 2 in air. Adult rats were injected i.p. 40uCi of [ 3 H-methyl] choline and lungs removed after 45 min. Lungs were perfused for 15 or 60 min. with KRB plus 25 mM HEPES. At the end of perfusion lungs were lavaged five times with 7 ml of ice cold saline. Lavage fluid, was centrifuged, lyophilized, and both lung and lavage fluid extracted for lipids. Lipid choline label in lavage fluid, expressed as percent of that in lung lipids, from control lungs (5% CO 2 ) showed 0.6 +/- 0.1 % at 15 min and 1.1 +/- 0.3% (mean +/- SE, n=6) label at 60 min. When perfused with 50 μM 1-isoproterenol, the label after 60 min perfusion increased to 2.76 +/- 0.33 (n=3). Ventilation with air containing 2.5% CO 2 and 0% CO 2 showed 6.1 +/- 2.1 % (n=4) and 6.4 +/- 1.8% (n=4) label in lavage fluid. Addition of 25mM sodium acetate in the perfusion medium and ventilation with 0% CO 2 in air lowered release of label to 4.2 +/- 1.4% (n=4). These results show that low pCO 2 increases surfactant PC secretion in lung and suggest that intracellular alkalosis triggers surfactant release

  19. CCR5 controls immune and metabolic functions during Toxoplasma gondii infection.

    Directory of Open Access Journals (Sweden)

    Giuliano Bonfá

    Full Text Available CCR5, an important receptor related to cell recruitment and inflammation, is expressed during experimental Toxoplasma gondii infection. However, its role in the immunopathology of toxoplasmosis is not clearly defined yet. Thus, we inoculated WT and CCR5(-/- mice with a sub lethal dose of the parasite by oral route. CCR5(-/- mice were extremely susceptible to infection, presenting higher parasite load and lower tissue expression of IL-12p40, IFN-γ, TNF, IL-6, iNOS, Foxp3, T-bet, GATA-3 and PPARα. Although both groups presented inflammation in the liver with prominent neutrophil infiltration, CCR5(-/- mice had extensive tissue damage with hepatocyte vacuolization, steatosis, elevated serum triglycerides and transaminases. PPARα agonist Gemfibrozil improved the vacuolization but did not rescue CCR5(-/- infected mice from high serum triglycerides levels and enhanced mortality. We also found intense inflammation in the ileum of CCR5(-/- infected mice, with epithelial ulceration, augmented CD4 and decreased frequency of NK cells in the gut lamina propria. Most interestingly, these findings were accompanied by an outstanding accumulation of neutrophils in the ileum, which seemed to be involved in the gut immunopathology, once the depletion of these cells was accompanied by reduced local damage. Altogether, these data demonstrated that CCR5 is essential to the control of T. gondii infection and to maintain the metabolic, hepatic and intestinal integrity. These findings add novel information on the disease pathogenesis and may be relevant for directing future approaches to the treatment of multi-deregulated diseases.

  20. Curcumin improves regulatory T cells in gut-associated lymphoid tissue of colitis mice.

    Science.gov (United States)

    Zhao, Hai-Mei; Xu, Rong; Huang, Xiao-Ying; Cheng, Shao-Min; Huang, Min-Fang; Yue, Hai-Yang; Wang, Xin; Zou, Yong; Lu, Ai-Ping; Liu, Duan-Yong

    2016-06-21

    To explore the probable pathway by which curcumin (Cur) regulates the function of Treg cells by observing the expression of costimulatory molecules of dendritic cells (DCs). Experimental colitis was induced by administering 2, 4, 6-trinitrobenzene sulfonic acid (TNBS)/ethanol solution. Forty male C57BL/6 mice were randomly divided into four groups: normal, TNBS + Cur, TNBS + mesalazine (Mes) and TNBS groups. The mice in the TNBS + Cur and TNBS +Mes groups were treated with Cur and Mes, respectively, while those in the TNBS group were treated with physiological saline for 7 d. After treatment, the curative effect of Cur was evaluated by colonic weight, colonic length, weight index of the colon, and histological observation and score. The levels of CD4(+)CD25+Foxp3(+) T cells (Treg cells) and costimulatory molecules of DCs were measured by flow cytometry. Also, related cytokines were analyzed by enzyme-linked immunosorbent assay. Cur alleviated inflammatory injury of the colonic mucosa, decreased colonic weigh and histological score, and restored colonic length. The number of Treg cells was increased, while the secretion of TNF-α, IL-2, IL-6, IL-12 p40, IL-17 and IL-21 and the expression of costimulatory molecules (CD205, CD54 [ICAM-1], TLR4, CD252[OX40 L], CD256 [RANK] and CD254 [RANK L]) of DCs were notably inhibited in colitis mice treated with Cur. Cur potentially modulates activation of DCs to enhance the suppressive functions of Treg cells and promote the recovery of damaged colonic mucosa in inflammatory bowel disease.

  1. Effect of endodontic cement on bone mineral density using serial dual-energy x-ray absorptiometry.

    Science.gov (United States)

    Saghiri, Mohammad Ali; Orangi, Jafar; Tanideh, Nader; Janghorban, Kamal; Sheibani, Nader

    2014-05-01

    Materials with new compositions were tested in order to develop dental materials with better properties. Calcium silicate-based cements, including white mineral trioxide aggregate (WMTA), may improve osteopromotion because of their composition. Nano-modified cements may help researchers produce ideal root-end filling materials. Serial dual-energy x-ray absorptiometry measurement was used to evaluate the effects of particle size and the addition of tricalcium aluminate (C3A) to a type of mineral trioxide aggregate-based cement on bone mineral density and the surrounding tissues in the mandible of rabbits. Forty mature male rabbits (N = 40) were anesthetized, and a bone defect measuring 7 × 1 × 1 mm was created on the semimandible. The rabbits were divided into 2 groups, which were subdivided into 5 subgroups with 4 animals each based on the defect filled by the following: Nano-WMTA (patent application #13/211.880), WMTA (as standard), WMTA without C3A, Nano-WMTA + 2% Nano-C3A (Fujindonjnan Industrial Co, Ltd, Fujindonjnan Xiamen, China), and a control group. Twenty and forty days postoperatively, the animals were sacrificed, and the semimandibles were removed for DXA measurement. The Kruskal-Wallis test followed by the Mann-Whitney U test showed significant differences between the groups at a significance level of P density at both intervals and P20 day = .004 and P40 day = .005 for bone mineral content. This study showed that bone regeneration was enhanced by reducing the particle size (nano-modified) and C3A mixture. This may relate to the existence of an external supply of minerals and a larger surface area of nano-modified material, which may lead to faster release rate of Ca(2+), inducing bone formation. Adding Nano-C3A to Nano-WMTA may improve bone regeneration properties. Copyright © 2014 American Association of Endodontists. All rights reserved.

  2. Corticosteroids for bacterial keratitis: the Steroids for Corneal Ulcers Trial (SCUT).

    Science.gov (United States)

    Srinivasan, Muthiah; Mascarenhas, Jeena; Rajaraman, Revathi; Ravindran, Meenakshi; Lalitha, Prajna; Glidden, David V; Ray, Kathryn J; Hong, Kevin C; Oldenburg, Catherine E; Lee, Salena M; Zegans, Michael E; McLeod, Stephen D; Lietman, Thomas M; Acharya, Nisha R

    2012-02-01

    To determine whether there is a benefit in clinical outcomes with the use of topical corticosteroids as adjunctive therapy in the treatment of bacterial corneal ulcers. Randomized, placebo-controlled, double-masked, multicenter clinical trial comparing prednisolone sodium phosphate, 1.0%, to placebo as adjunctive therapy for the treatment of bacterial corneal ulcers. Eligible patients had a culture-positive bacterial corneal ulcer and received topical moxifloxacin for at least 48 hours before randomization. The primary outcome was best spectacle-corrected visual acuity (BSCVA) at 3 months from enrollment. Secondary outcomes included infiltrate/scar size, reepithelialization, and corneal perforation. Between September 1, 2006, and February 22, 2010, 1769 patients were screened for the trial and 500 patients were enrolled. No significant difference was observed in the 3-month BSCVA (-0.009 logarithm of the minimum angle of resolution [logMAR]; 95% CI, -0.085 to 0.068; P = .82), infiltrate/scar size (P = .40), time to reepithelialization (P = .44), or corneal perforation (P > .99). A significant effect of corticosteroids was observed in subgroups of baseline BSCVA (P = .03) and ulcer location (P = .04). At 3 months, patients with vision of counting fingers or worse at baseline had 0.17 logMAR better visual acuity with corticosteroids (95% CI, -0.31 to -0.02; P = .03) compared with placebo, and patients with ulcers that were completely central at baseline had 0.20 logMAR better visual acuity with corticosteroids (-0.37 to -0.04; P = .02). We found no overall difference in 3-month BSCVA and no safety concerns with adjunctive corticosteroid therapy for bacterial corneal ulcers. Adjunctive topical corticosteroid use does not improve 3-month vision in patients with bacterial corneal ulcers. clinicaltrials.gov Identifier: NCT00324168.

  3. Corticosteroids for Bacterial Keratitis

    Science.gov (United States)

    Srinivasan, Muthiah; Mascarenhas, Jeena; Rajaraman, Revathi; Ravindran, Meenakshi; Lalitha, Prajna; Glidden, David V.; Ray, Kathryn J.; Hong, Kevin C.; Oldenburg, Catherine E.; Lee, Salena M.; Zegans, Michael E.; McLeod, Stephen D.; Lietman, Thomas M.; Acharya, Nisha R.

    2013-01-01

    Objective To determine whether there is a benefit in clinical outcomes with the use of topical corticosteroids as adjunctive therapy in the treatment of bacterial corneal ulcers. Methods Randomized, placebo-controlled, double-masked, multicenter clinical trial comparing prednisolone sodium phosphate, 1.0%, to placebo as adjunctive therapy for the treatment of bacterial corneal ulcers. Eligible patients had a culture-positive bacterial corneal ulcer and received topical moxifloxacin for at least 48 hours before randomization. Main Outcome Measures The primary outcome was best spectacle-corrected visual acuity (BSCVA) at 3 months from enrollment. Secondary outcomes included infiltrate/scar size, reepithelialization, and corneal perforation. Results Between September 1, 2006, and February 22, 2010, 1769 patients were screened for the trial and 500 patients were enrolled. No significant difference was observed in the 3-month BSCVA (−0.009 logarithm of the minimum angle of resolution [logMAR]; 95% CI, −0.085 to 0.068; P = .82), infiltrate/scar size (P = .40), time to reepithelialization (P = .44), or corneal perforation (P > .99). A significant effect of corticosteroids was observed in subgroups of baseline BSCVA (P = .03) and ulcer location (P = .04). At 3 months, patients with vision of counting fingers or worse at baseline had 0.17 logMAR better visual acuity with corticosteroids (95% CI, −0.31 to −0.02; P = .03) compared with placebo, and patients with ulcers that were completely central at baseline had 0.20 logMAR better visual acuity with corticosteroids (−0.37 to −0.04; P = .02). Conclusions We found no overall difference in 3-month BSCVA and no safety concerns with adjunctive corticosteroid therapy for bacterial corneal ulcers. Application to Clinical Practice Adjunctive topical corticosteroid use does not improve 3-month vision in patients with bacterial corneal ulcers. PMID:21987582

  4. Biotin deficiency enhances the inflammatory response of human dendritic cells.

    Science.gov (United States)

    Agrawal, Sudhanshu; Agrawal, Anshu; Said, Hamid M

    2016-09-01

    The water-soluble biotin (vitamin B7) is indispensable for normal human health. The vitamin acts as a cofactor for five carboxylases that are critical for fatty acid, glucose, and amino acid metabolism. Biotin deficiency is associated with various diseases, and mice deficient in this vitamin display enhanced inflammation. Previous studies have shown that biotin affects the functions of adaptive immune T and NK cells, but its effect(s) on innate immune cells is not known. Because of that and because vitamins such as vitamins A and D have a profound effect on dendritic cell (DC) function, we investigated the effect of biotin levels on the functions of human monocyte-derived DCs. Culture of DCs in a biotin-deficient medium (BDM) and subsequent activation with LPS resulted in enhanced secretion of the proinflammatory cytokines TNF-α, IL-12p40, IL-23, and IL-1β compared with LPS-activated DCs cultured in biotin-sufficient (control) and biotin-oversupplemented media. Furthermore, LPS-activated DCs cultured in BDM displayed a significantly higher induction of IFN-γ and IL-17 indicating Th1/Th17 bias in T cells compared with cells maintained in biotin control or biotin-oversupplemented media. Investigations into the mechanisms suggested that impaired activation of AMP kinase in DCs cultured in BDM may be responsible for the observed increase in inflammatory responses. In summary, these results demonstrate for the first time that biotin deficiency enhances the inflammatory responses of DCs. This may therefore be one of the mechanism(s) that mediates the observed inflammation that occurs in biotin deficiency.

  5. A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

    Directory of Open Access Journals (Sweden)

    Luiz Tadeu M Figueiredo

    1997-05-01

    Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

  6. The changes in renal function after a single dose of intravenous furosemide in patients with compensated liver cirrhosis

    Directory of Open Access Journals (Sweden)

    Mejirisky Yoram

    2006-11-01

    Full Text Available Abstract Background Patients with compensated Child-A cirrhosis have sub clinical hypovolemia and diuretic treatment could result in renal impairment. Aim To evaluate the changes in renal functional mass as reflected by DMSA uptake after single injection of intravenous furosemide in patients with compensated liver cirrhosis. Methods Eighteen cirrhotic patients were divided in two groups; eight patients (group 1, age 56 ± 9.6 yrs, Gender 5M/3F, 3 alcoholic and 5 non alcoholic were given low intravenous 40 mg furosemide and ten other patients (group 2, age 54 ± 9.9, Gender 6M/4F, 4 alcoholic and 6 non alcoholic were given high 120 mg furosemide respectively. Renoscintigraphy with 100MBq Of Tc 99 DMSA was given intravenously before and 90 minutes after furosemide administration and SPECT imaging was determined 3 hours later. All patients were kept under low sodium diet (80mEq/d and all diuretics were withdrawn for 3 days. 8-hours UNa exertion, Calculated and measured Creatinine clearance (CCT were performed for all patients. Results Intravenous furosemide increased the mean renal DMSA uptake in 55% of patients with compensated cirrhosis and these changes persist up to three hours after injection. This increase was at the same extent in either low or high doses of furosemide. (From 12.8% ± 3.8 to 15.2% ± 2.2, p 40%, as compared to normal calculated creatinine clearance (CCT 101 ± 26, and measured CCT of 87 ± 30 cc/min (P Conclusion A single furosemide injection increases renal functional mass as reflected by DMSA in 55% of patients with compensated cirrhosis and identify 45% of patients with reduced uptake and who could develop renal impairment under diuretics. Whether or not albumin infusion exerts beneficial effect in those patients with reduced DMSA uptake remains to be determined.

  7. Increased Age, but Not Parity Predisposes to Higher Bacteriuria Burdens Due to Streptococcus Urinary Tract Infection and Influences Bladder Cytokine Responses, Which Develop Independent of Tissue Bacterial Loads.

    Science.gov (United States)

    Sullivan, Matthew J; Carey, Alison J; Leclercq, Sophie Y; Tan, Chee K; Ulett, Glen C

    2016-01-01

    Streptococcus agalactiae causes urinary tract infection (UTI) in pregnant adults, non-pregnant adults, immune-compromised individuals and the elderly. The pathogenesis of S. agalactiae UTI in distinct patient populations is poorly understood. In this study, we used murine models of UTI incorporating young mice, aged and dam mice to show that uropathogenic S. agalactiae causes bacteriuria at significantly higher levels in aged mice compared to young mice and this occurs coincident with equivalent levels of bladder tissue colonisation at 24 h post-infection (p.i.). In addition, aged mice exhibited significantly higher bacteriuria burdens at 48 h compared to young mice, confirming a divergent pattern of bacterial colonization in the urinary tract of aged and young mice. Multiparous mice, in contrast, exhibited significantly lower urinary titres of S. agalactiae compared to age-matched nulliparous mice suggesting that parity enhances the ability of the host to control S. agalactiae bacteriuria. Additionally, we show that both age and parity alter the expression levels of several key regulatory and pro-inflammatory cytokines, which are known to be important the immune response to UTI, including Interleukin (IL)-1β, IL-12(p40), and Monocyte Chemoattractant Protein-1 (MCP-1). Finally, we demonstrate that other cytokines, including IL-17 are induced significantly in the S. agalactiae-infected bladder regardless of age and parity status. Collectively, these findings show that the host environment plays an important role in influencing the severity of S. agalactiae UTI; infection dynamics, particularly in the context of bacteriuria, depend on age and parity, which also affect the nature of innate immune responses to infection.

  8. Who presents past the gestational age limit for first trimester abortion in the public sector in Mexico City?

    Science.gov (United States)

    Saavedra-Avendano, Biani; Schiavon, Raffaela; Sanhueza, Patricio; Rios-Polanco, Ranulfo; Garcia-Martinez, Laura; Darney, Blair G.

    2018-01-01

    Objective To identify socio-demographic factors associated with presenting for abortion services past the gestational age (GA) limit (12 weeks), and thus not receiving services, in Mexico City’s public sector first trimester abortion program. Methods We used clinical data from four high volume sites in the Interrupción Legal de Embarazo (ILE) program, 2007–2015. We used descriptive statistics to quantify the proportion of women who did not receive an abortion due to presenting past the gestational age limit. We used multivariable logistic regression to identify associations between women’s characteristics and presenting past the GA limit and calculated predicted probabilities of late presentation for key characteristics. Results Our sample included 52,391 women, 8.10% (n = 4,246) of whom did not receive abortion services due to presenting past the GA limit. Adolescents (12–17) made up 8.69% of the total sample and 13.40% of those presenting past the GA limit (p = 40 years’ old respectively). Women living in Mexico City and with higher levels of education had lower odds of presenting past the GA limit, and there was an educational gradient across all age groups. In the multivariable predicted probability models, adolescents at every level of education have significantly higher probabilities of not receiving an abortion due to presenting past the gestational age limit compared with adults (among women with a primary education: 11.75% adolescents vs. 9.02–4.26% across adult age groups). Conclusions Our results suggest that continued efforts are needed to educate women, especially younger and less educated women, about early pregnancy recognition. In addition, all women need information about the availability of first trimester legal abortion to ensure timely access to abortion services. PMID:29414987

  9. Prior Virus Exposure Alters the Long-Term Landscape of Viral Replication during Feline Lentiviral Infection

    Directory of Open Access Journals (Sweden)

    Sue VandeWoude

    2011-10-01

    Full Text Available We developed a feline model of lentiviral cross-species transmission using a puma lentivirus (PLV or FIVPco which infects domestic cats but does not cause disease. Infection with PLV protects cats from CD4+ T-cell decline caused by subsequent infection with virulent feline immunodeficiency virus (FIV. Previous studies implicate innate immune and/or cellular restriction mechanisms for FIV disease attenuation in PLV-infected cats. In this study, we evaluated viral infection and cytokine mRNA tran