WorldWideScience

Sample records for p2y2 nucleotide receptors

  1. The roles of P2Y2 purinergic receptors in osteoblasts and mechanotransduction.

    Directory of Open Access Journals (Sweden)

    Yanghui Xing

    Full Text Available We previously demonstrated, using osteoblastic MC3T3-E1 cells, that P2Y2 purinergic receptors are involved in osteoblast mechanotransduction. In this study, our objective was to further investigate, using a knockout mouse model, the roles of P2Y2 receptors in bone mechanobiology. We first examined bone structure with micro-CT and measured bone mechanical properties with three point bending experiments in both wild type mice and P2Y2 knockout mice. We found that bones from P2Y2 knockout mice have significantly decreased bone volume, bone thickness, bone stiffness and bone ultimate breaking force at 17 week old age. In order to elucidate the mechanisms by which P2Y2 receptors contribute to bone biology, we examined differentiation and mineralization of bone marrow cells from wild type and P2Y2 knockout mice. We found that P2Y2 receptor deficiency reduces the differentiation and mineralization of bone marrow cells. Next, we compared the response of primary osteoblasts, from both wild type and P2Y2 knockout mice, to ATP and mechanical stimulation (oscillatory fluid flow, and found that osteoblasts from wild type mice have a stronger response, in terms of ERK1/2 phosphorylation, to both ATP and fluid flow, relative to P2Y2 knockout mice. However, we did not detect any difference in ATP release in response to fluid flow between wild type and P2Y2 knock out osteoblasts. Our findings suggest that P2Y2 receptors play important roles in bone marrow cell differentiation and mineralization as well as in bone cell mechanotransduction, leading to an osteopenic phenotype in P2Y2 knockout mice.

  2. UTP reduces infarct size and improves mice heart function after myocardial infarct via P2Y2 receptor

    DEFF Research Database (Denmark)

    Cohen, A; Shainberg, Asher; Hochhauser, E

    2011-01-01

    Pyrimidine nucleotides are signaling molecules, which activate G protein-coupled membrane receptors of the P2Y family. P2Y(2) and P2Y(4) receptors are part of the P2Y family, which is composed of 8 subtypes that have been cloned and functionally defined. We have previously found that uridine-5......'-triphosphate (UTP) reduces infarct size and improves cardiac function following myocardial infarct (MI). The aim of the present study was to determine the role of P2Y(2) receptor in cardiac protection following MI using knockout (KO) mice, in vivo and wild type (WT) for controls. In both experimental groups...... used (WT and P2Y(2)(-/-) receptor KO mice) there were 3 subgroups: sham, MI, and MI+UTP. 24h post MI we performed echocardiography and measured infarct size using triphenyl tetrazolium chloride (TTC) staining on all mice. Fractional shortening (FS) was higher in WT UTP-treated mice than the MI group...

  3. Association of P2Y(2) receptor SNPs with bone mineral density and osteoporosis risk in a cohort of Dutch fracture patients

    DEFF Research Database (Denmark)

    Wesselius, Anke; Bours, Martijn J L; Henriksen, Zanne

    2013-01-01

    The P2Y(2) receptor is a G-protein-coupled receptor with adenosine 5'-triphosphate (and UTP) as natural ligands. It is thought to be involved in bone physiology in an anti-osteogenic manner. As several non-synonymous single nucleotide polymorphisms (SNPs) have been identified within the P2Y(2) re...

  4. P2Y2 receptor knock-out mice display normal NaCl absorption in medullary thick ascending limb

    Directory of Open Access Journals (Sweden)

    Rita Delgado Marques

    2013-10-01

    Full Text Available Local purinergic signals modulate renal tubular transport. Acute activation of renal epithelial P2 receptors causes inhibition of epithelial transport and thus, should favor increased water and salt excretion by the kidney. So far only a few studies have addressed the effects of extracellular nucleotides on ion transport in the thick ascending limb. In the medullary thick ascending limb (mTAL, basolateral P2X receptors markedly (~25% inhibit NaCl absorption. Although this segment does express both apical and basolateral P2Y2 receptors, acute activation of the basolateral P2Y2 receptors had no apparent effect on transepithelial ion transport. Here we studied, if the absence of the P2Y2 receptor causes chronic alterations in mTAL NaCl absorption by comparing basal and AVP-stimulated transepithelial transport rates. We used perfused mouse mTALs to electrically measure NaCl absorption in juvenile (35 days male mice. Using microelectrodes, we determined the transepithelial voltage (Vte and the transepithelial resistance (Rte and thus, transepithelial NaCl absorption (equivalent short circuit current, I’sc.We find that mTALs from adult wild type (WT mice have significantly lower NaCl absorption rates when compared to mTALs from juvenile WT mice. This could be attributed to significantly higher Rte values in mTALs from adult WT mice. This pattern was not observed in mTALs from P2Y2 receptor knockout (KO mice. In addition, adult P2Y2 receptor KO mTALs have significantly lower Vte values compared to the juvenile. No difference in absolute I´sc was observed when comparing mTALs from WT and KO mice. AVP stimulated the mTALs to similar increases of NaCl absorption irrespective of the absence of the P2Y2 receptor. No difference was observed in the medullary expression level of NKCC2 in between the genotypes.These data indicate that the lack of P2Y2 receptors does not cause substantial differences in resting and AVP-stimulated NaCl absorption in

  5. P2Y2 Receptor and EGFR Cooperate to Promote Prostate Cancer Cell Invasion via ERK1/2 Pathway.

    Science.gov (United States)

    Li, Wei-Hua; Qiu, Ying; Zhang, Hong-Quan; Tian, Xin-Xia; Fang, Wei-Gang

    2015-01-01

    As one member of G protein-coupled P2Y receptors, P2Y2 receptor can be equally activated by extracellular ATP and UTP. Our previous studies have proved that activation of P2Y2 receptor by extracellular ATP could promote prostate cancer cell invasion and metastasis in vitro and in vivo via regulating the expressions of some epithelial-mesenchymal transition/invasion-related genes (including IL-8, E-cadherin, Snail and Claudin-1), and the most significant change in expression of IL-8 was observed after P2Y2 receptor activation. However, the signaling pathway downstream of P2Y2 receptor and the role of IL-8 in P2Y2-mediated prostate cancer cell invasion remain unclear. Here, we found that extracellular ATP/UTP induced activation of EGFR and ERK1/2. After knockdown of P2Y2 receptor, the ATP -stimulated phosphorylation of EGFR and ERK1/2 was significantly suppressed. Further experiments showed that inactivation of EGFR and ERK1/2 attenuated ATP-induced invasion and migration, and suppressed ATP-mediated IL-8 production. In addition, knockdown of IL-8 inhibited ATP-mediated invasion and migration of prostate cancer cells. These findings suggest that P2Y2 receptor and EGFR cooperate to upregulate IL-8 production via ERK1/2 pathway, thereby promoting prostate cancer cell invasion and migration. Thus blocking of the P2Y2-EGFR-ERK1/2 pathway may provide effective therapeutic interventions for prostate cancer.

  6. Bone turnover is altered in transgenic rats overexpressing the P2Y2 purinergic receptor

    DEFF Research Database (Denmark)

    Ellegaard, Maria; Agca, Cansu; Petersen, Solveig

    2017-01-01

    overexpression on bone status and bone cell function using a transgenic rat. Three-month-old female transgenic Sprague Dawley rats overexpressing P2Y2R (P2Y2R-Tg) showed higher bone strength of the femoral neck. Histomorphometry showed increase in resorptive surfaces and reduction in mineralizing surfaces. Both...

  7. ATP and UTP responses of cultured rat aortic smooth muscle cells revisited: dominance of P2Y2 receptors

    Science.gov (United States)

    Kumari, Rajendra; Goh, Gareth; Ng, Leong L; Boarder, Michael R

    2003-01-01

    It has previously been shown that ATP and UTP stimulate P2Y receptors in vascular smooth muscle cells (VSMCs), but the nature of these receptors, in particular the contribution of P2Y2 and P2Y4 subtypes, has not been firmly established. Here we undertake a further pharmacological analysis of [3H]inositol polyphosphate responses to nucleotides in cultured rat VSMCs. ATP generated a response that was partial compared to UTP, as reported earlier. In the presence of a creatine phosphokinase (CPK) system for regenerating nucleoside triphosphates, the response to ATP was increased, the response to UTP was unchanged, and the difference between UTP and ATP concentration–response curves disappeared. Chromatographic analysis showed that ATP was degraded slightly faster than UTP. The response to UDP was always smaller than that to UTP, but with a shallow slope and a high potency component. In the presence of hexokinase (which prevents the accumulation of ATP/UTP from ADP/UDP), the maximum response to UDP was reduced and the high-potency component of the curve was retained. By contrast, the response to ADP was weaker throughout in the presence of hexokinase. ATPγS was an effective agonist with a similar EC50 to UTP, but with a lower maximum. ITP was a weak agonist compared with UTP. Suramin was an effective antagonist of the response to UTP (pA2=4.48), but not when ATP was the agonist. However, suramin was an effective antagonist (pA2=4.45) when stimulation with ATP was in the presence of the CPK regenerating system. Taken together with the results of others, these findings indicate that the response of cultured rat VSMCs to UTP and to ATP is predominantly at the P2Y2 receptor, and that there is also a response to UDP at the P2Y6 receptor. PMID:14597595

  8. P2Y2 and P2Y4 receptors regulate pancreatic Ca²+-activated K+ channels differently

    DEFF Research Database (Denmark)

    Klærke, Susanne Edeling Hede; Amstrup, Jan; Klærke, Dan Arne

    2005-01-01

    Extracellular ATP is an important regulator of transepithelial transport in a number of tissues. In pancreatic ducts, we have shown that ATP modulates epithelial K+ channels via purinergic receptors, most likely the P2Y2 and P2Y4 receptors, but the identity of the involved K+ channels was not cle...

  9. Genetic deletion of the P2Y2 receptor offers significant resistance to development of lithium-induced polyuria accompanied by alterations in PGE2 signaling.

    Science.gov (United States)

    Zhang, Yue; Pop, Ioana L; Carlson, Noel G; Kishore, Bellamkonda K

    2012-01-01

    Lithium (Li)-induced polyuria is due to resistance of the medullary collecting duct (mCD) to the action of arginine vasopressin (AVP), apparently mediated by increased production of PGE(2). We previously reported that the P2Y(2) receptor (P2Y(2)-R) antagonizes the action of AVP on the mCD and may play a role in Li-induced polyuria by enhancing the production of PGE(2) in mCD. Hence, we hypothesized that genetic deletion of P2Y(2)-R should ameliorate Li-induced polyuria. Wild-type (WT) or P2Y(2)-R knockout (KO) mice were fed normal or Li-added diets for 14 days and euthanized. Li-induced polyuria, and decreases in urine osmolality and AQP2 protein abundance in the renal medulla, were significantly less compared with WT mice despite the lack of differences in Li intake or terminal serum or inner medullary tissue Li levels. Li-induced increased urinary excretion of PGE(2) was not affected in KO mice. However, prostanoid EP(3) receptor (EP3-R) protein abundance in the renal medulla of KO mice was markedly lower vs. WT mice, irrespective of the dietary regimen. The protein abundances of other EP-Rs were not altered across the groups irrespective of the dietary regimen. Ex vivo stimulation of mCD with PGE(2) generated significantly more cAMP in Li-fed KO mice (130%) vs. Li-fed WT mice (100%). Taken together, these data suggest 1) genetic deletion of P2Y(2)-R offers significant resistance to the development of Li-induced polyuria; and 2) this resistance is apparently due to altered PGE(2) signaling mediated by a marked decrease in EP3-R protein abundance in the medulla, thus attenuating the EP3-mediated decrease in cAMP levels in mCD.

  10. Functional and molecular evidence for heteromeric association of P2Y1 receptor with P2Y2 and P2Y4 receptors in mouse granulocytes.

    Science.gov (United States)

    Ribeiro-Filho, Antonio Carlos; Buri, Marcus Vinicius; Barros, Carlos Castilho; Dreyfuss, Juliana Luporini; Nader, Helena Bonciani; Justo, Giselle Zenker; Craveiro, Rogério Bastos; Pesquero, João Bosco; Miranda, Antonio; Ferreira, Alice Teixeira; Paredes-Gamero, Edgar Julian

    2016-07-07

    All hematopoietic cells express P2 receptors, however pharmacological characteristics such as expression and affinity in granulocytes are unknown. Pharmacological characteristics of P2 receptors were evaluated by Ca(2+) measurements using Fura-2 fluorophore. P2 receptors expression were analyzed by flow cytometry and RT-PCR. P2 interaction were shown by coimmunoprecipitation, western blotting and FRET. Granulocytes were responsive to P2Y agonists, whereas P2X agonists were ineffective. Ca(2+) increase, elicited by ADP and UTP was dependent on intracellular stocks and sensitive to G-coupled receptor inhibition. Moreover, MRS2179, a specific antagonist of the P2Y1 receptor, abolished ADP response. Interestingly, ADP and UTP exhibited full heterologous desensitization, suggesting that these agonists interact with the same receptor. The heteromeric association between P2Y1 receptor and the P2Y2 and P2Y4 receptors was shown by immunoprecipitation and FRET analysis. Clear evidence of heteromeric association of P2Y receptors was found during the evaluation of P2 receptors present in mice granulocytes, which could impact in the classical pharmacology of P2Y receptors in granulocytes.

  11. P2Y2 receptor knock-out mice display normal NaCl absorption in medullary thick ascending limb

    DEFF Research Database (Denmark)

    Marques, Rita D; Praetorius, Helle A; Leipziger, Jens

    2013-01-01

    Local purinergic signals modulate renal tubular transport. Acute activation of renal epithelial P2 receptors causes inhibition of epithelial transport and thus, should favor increased water and salt excretion by the kidney. So far only a few studies have addressed the effects of extracellular nuc...

  12. Uridine adenosine tetraphosphate (Up4A) is a strong inductor of smooth muscle cell migration via activation of the P2Y2 receptor and cross-communication to the PDGF receptor

    International Nuclear Information System (INIS)

    Wiedon, Annette; Tölle, Markus; Bastine, Joschika; Schuchardt, Mirjam; Huang, Tao; Jankowski, Vera; Jankowski, Joachim; Zidek, Walter; Giet, Markus van der

    2012-01-01

    Highlights: ► Up 4 A induces VSMC migration. ► VSMC migration towards Up 4 A involves P2Y 2 activation. ► Up 4 A-induced VSMC migration is OPN-dependent. ► Activation of ERK1/2 pathway is necessary for VSMC migration towards Up 4 A. ► Up 4 A-directed VSMC migration cross-communicates with the PDGFR. -- Abstract: The recently discovered dinucleotide uridine adenosine tetraphosphate (Up 4 A) was found in human plasma and characterized as endothelium-derived vasoconstrictive factor (EDCF). A further study revealed a positive correlation between Up 4 A and vascular smooth muscle cell (VSMC) proliferation. Due to the dominant role of migration in the formation of atherosclerotic lesions our aim was to investigate the migration stimulating potential of Up 4 A. Indeed, we found a strong chemoattractant effect of Up 4 A on VSMC by using a modified Boyden chamber. This migration dramatically depends on osteopontin secretion (OPN) revealed by the reduction of the migration signal down to 23% during simultaneous incubation with an OPN-blocking antibody. Due to inhibitory patterns using specific and unspecific purinoreceptor inhibitors, Up 4 A mediates it’s migratory signal mainly via the P2Y 2 . The signaling behind the receptor was investigated with luminex technique and revealed an activation of the extracellular signal-regulated kinases 1 and 2 (ERK1/2) pathway. By use of the specific PDGF receptor (PDGFR) inhibitor AG1296 and siRNA technique against PDGFR-β we found a strongly reduced migration signal after Up 4 A stimulation in the PDGFR-β knockdown cells compared to control cells. In this study, we present substantiate data that Up 4 A exhibits migration stimulating potential probably involving the signaling cascade of MEK1 and ERK1/2 as well as the matrix protein OPN. We further suggest that the initiation of the migration process occurs predominant through direct activation of the P2Y 2 by Up 4 A and via transactivation of the PDGFR.

  13. Protein kinase C-mediated ATP stimulation of Na(+)-ATPase activity in LLC-PK1 cells involves a P2Y2 and/or P2Y4 receptor.

    Science.gov (United States)

    Wengert, M; Ribeiro, M C; Abreu, T P; Coutinho-Silva, R; Leão-Ferreira, L R; Pinheiro, A A S; Caruso-Neves, C

    2013-07-15

    ATP-activated P2Y receptors play an important role in renal sodium excretion. The aim of this study was to evaluate the modulation of ATPase-driven sodium reabsorption in the proximal tubule by ATP or adenosine (Ado). LLC-PK1 cells, a model of porcine proximal tubule cells, were used. ATP (10(-6)M) or Ado (10(-6)M) specifically stimulated Na(+)-ATPase activity without any changes in (Na(+)+K(+))-ATPase activity. Our results show that the Ado effect is mediated by its conversion to ATP. Furthermore, it was observed that the effect of ATP was mimicked by UTP, ATPγS and 2-thio-UTP, an agonist of P2Y2 and P2Y4 receptors. In addition, ATP-stimulated Na(+)-ATPase activity involves protein kinase C (PKC). Our results indicate that ATP-induced stimulation of proximal tubule Na(+)-ATPase activity is mediated by a PKC-dependent P2Y2 and/or P2Y4 pathway. These findings provide new perspectives on the role of the effect of P2Y-mediated extracellular ATP on renal sodium handling. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Excessive Extracellular ATP Desensitizes P2Y2 and P2X4 ATP Receptors Provoking Surfactant Impairment Ending in Ventilation-Induced Lung Injury

    Directory of Open Access Journals (Sweden)

    Djo Hasan

    2018-04-01

    Full Text Available Stretching the alveolar epithelial type I (AT I cells controls the intercellular signaling for the exocytosis of surfactant by the AT II cells through the extracellular release of adenosine triphosphate (ATP (purinergic signaling. Extracellular ATP is cleared by extracellular ATPases, maintaining its homeostasis and enabling the lung to adapt the exocytosis of surfactant to the demand. Vigorous deformation of the AT I cells by high mechanical power ventilation causes a massive release of extracellular ATP beyond the clearance capacity of the extracellular ATPases. When extracellular ATP reaches levels >100 μM, the ATP receptors of the AT II cells become desensitized and surfactant impairment is initiated. The resulting alteration in viscoelastic properties and in alveolar opening and collapse time-constants leads to alveolar collapse and the redistribution of inspired air from the alveoli to the alveolar ducts, which become pathologically dilated. The collapsed alveoli connected to these dilated alveolar ducts are subject to a massive strain, exacerbating the ATP release. After reaching concentrations >300 μM extracellular ATP acts as a danger-associated molecular pattern, causing capillary leakage, alveolar space edema, and further deactivation of surfactant by serum proteins. Decreasing the tidal volume to 6 mL/kg or less at this stage cannot prevent further lung injury.

  15. Tools and drugs for uracil nucleotide-activated P2Y receptors.

    Science.gov (United States)

    Rafehi, Muhammad; Müller, Christa E

    2018-04-13

    P2Y receptors (P2YRs) are a family of G protein-coupled receptors activated by extracellular nucleotides. Physiological P2YR agonists include purine and pyrimidine nucleoside di- and triphosphates, such as ATP, ADP, UTP, UDP, nucleotide sugars, and dinucleotides. Eight subtypes exist, P2Y 1 , P2Y 2 , P2Y 4 , P2Y 6 , P2Y 11 , P2Y 12 , P2Y 13 , and P2Y 14 , which represent current or potential future drug targets. Here we provide a comprehensive overview of ligands for the subgroup of the P2YR family that is activated by uracil nucleotides: P2Y 2 (UTP, also ATP and dinucleotides), P2Y 4 (UTP), P2Y 6 (UDP), and P2Y 14 (UDP, UDP-glucose, UDP-galactose). The physiological agonists are metabolically unstable due to their fast hydrolysis by ectonucleotidases. A number of agonists with increased potency, subtype-selectivity and/or enzymatic stability have been developed in recent years. Useful P2Y 2 R agonists include MRS2698 (6-01, highly selective) and PSB-1114 (6-05, increased metabolic stability). A potent and selective P2Y 2 R antagonist is AR-C118925 (10-01). For studies of the P2Y 4 R, MRS4062 (3-15) may be used as a selective agonist, while PSB-16133 (10-06) represents a selective antagonist. Several potent P2Y 6 R agonists have been developed including 5-methoxyuridine 5'-O-((R p )α-boranodiphosphate) (6-12), PSB-0474 (3-11), and MRS2693 (3-26). The isocyanate MRS2578 (10-08) is used as a selective P2Y 6 R antagonist, although its reactivity and low water-solubility are limiting. With MRS2905 (6-08), a potent and metabolically stable P2Y 14 R agonist is available, while PPTN (10-14) represents a potent and selective P2Y 14 R antagonist. The radioligand [ 3 H]UDP can be used to label P2Y 14 Rs. In addition, several fluorescent probes have been developed. Uracil nucleotide-activated P2YRs show great potential as drug targets, especially in inflammation, cancer, cardiovascular and neurodegenerative diseases. Copyright © 2018. Published by Elsevier Inc.

  16. Adenine Nucleotide Analogues Locked in a Northern Methanocarba Conformation: Enhanced Stability and Potency as P2Y1 Receptor Agonists

    Science.gov (United States)

    Ravi, R. Gnana; Kim, Hak Sung; Servos, Jörg; Zimmermann, Herbert; Lee, Kyeong; Maddileti, Savitri; Boyer, José L.; Harden, T. Kendall; Jacobson, Kenneth A.

    2016-01-01

    Preference for the Northern (N) ring conformation of the ribose moiety of nucleotide 5′-triphosphate agonists at P2Y1, P2Y2, P2Y4, and P2Y11 receptors, but not P2Y6 receptors, was established using a ring-constrained methanocarba (a 3.1.0-bicyclohexane) ring as a ribose substitute (Kim et al. J. Med. Chem. 2002, 45, 208–218.). We have now combined the ring-constrained (N)-methanocarba modification of adenine nucleotides with other functionalities known to enhance potency at P2 receptors. The potency of the newly synthesized analogues was determined in the stimulation of phospholipase C through activation of turkey erythrocyte P2Y1 or human P2Y1 and P2Y2 receptors stably expressed in astrocytoma cells. An (N)-methanocarba-2-methylthio-ADP analogue displayed an EC50 at the hP2Y1 receptor of 0.40 nM and was 55-fold more potent than the corresponding triphosphate and 16-fold more potent than the riboside 5′-diphosphate. 2-Cl–(N)-methanocarba-ATP and its N6-Me analogue were also highly selective, full agonists at P2Y1 receptors. The (N)-methanocarba-2-methylthio and 2-chloromonophosphate analogues were full agonists exhibiting micromolar potency at P2Y1 receptors, while the corresponding ribosides were inactive. Although β,γ-methylene-ATP was inactive at P2Y receptors, β,γ-methylene-(N)-methanocarba-ATP was a potent hP2Y1 receptor agonist with an EC50 of 160 nM and was selective versus hP2Y2 and hP2Y4 receptors. The rates of hydrolysis of Northern (N) and Southern (S) methanocarba analogues of AMP by rat 5′-ectonucleotidase were negligible. The rates of hydrolysis of the corresponding triphosphates by recombinant rat NTPDase1 and 2 were studied. Both isomers were hydrolyzed by NTPDase 1 at about half the rate of ATP hydrolysis. The (N) isomer was hardly hydrolyzed by NTPDase 2, while the (S) isomer was hydrolyzed at one-third of the rate of ATP hydrolysis. This suggests that new, more stable and selective nucleotide agonists may be designed on the basis of

  17. UTP reduces infarct size and improves mice heart function after myocardial infarct via P2Y2 receptor

    DEFF Research Database (Denmark)

    Cohen, A; Shainberg, Asher; Hochhauser, E

    2011-01-01

    (44.7±4.08% vs. 33.5±2.7% respectively, ptreatment (34.7±5.3% vs. 35.9±2.9%). Similar results were obtained with TTC and hematoxylin and eosin stainings. Moreover, troponin T measurements demonstrated reduced myocardial...

  18. ADP stimulation of inositol phosphates in hepatocytes: role of conversion to ATP and stimulation of P2Y2 receptors.

    Science.gov (United States)

    Dixon, C Jane; Hall, John F; Boarder, Michael R

    2003-01-01

    1 Accumulation of inositol (poly)phosphates (InsP(x)) has been studied in rat hepatocytes labelled with [(3)H]inositol. Stimulation with ADP resulted in a significant increase in total [(3)H]InsP(x), whereas 2-MeSADP had only a small effect and ADPbetaS was ineffective. UTP and ITP also stimulated substantial increases in [(3)H]InsP(x). 2 The dose-response curve to ADP was largely unaltered by the presence of the P2Y(1) antagonist, adenosine-3'-phosphate-5'-phosphate (A3P5P). Similarly, inclusion of MRS 2179, a more selective P2Y(1) antagonist, had no effect on the dose-response curve to ADP. 3 The inclusion of hexokinase in the assay reduced, but did not abolish, the response to ADP. 4 HPLC analysis revealed that ADP in the medium was rapidly converted to AMP and ATP. The inclusion of hexokinase removed ATP, but exacerbated the decline in ADP concentration, leading to increased levels of AMP. 2-MeSADP was stable in the medium and ATP was largely unaffected. 5 The addition of the adenylate kinase inhibitor, diadenosine pentaphosphate (Ap(5)A) significantly reduced the ADP response. HPLC analysis conducted in parallel demonstrated that this treatment inhibited conversion of ADP to ATP and AMP. 6 Inclusion of the P1 antagonist CGS 15943 had no effect on the dose-response curve to ADP. 7 These observations indicate that hepatocytes respond to ADP with an increase in inositol (poly)phosphates following conversion to ATP. P2Y(1) activation in hepatocytes does not appear to be coupled to inositol 1,4,5-trisphosphate (Ins(1,4,5)P(3)) production.

  19. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  20. Excessive extracellular ATP desensitizes P2Y2 and P2X4 ATP receptors provoking surfactant impairment ending in ventilation-induced lung injury

    NARCIS (Netherlands)

    D. Hasan (Djo); Satalin, J. (Joshua); van der Zee, P. (Philip); Kollisch-Singule, M. (Michaela); P. Blankman (Paul); Shono, A. (Atsuko); P. Somhorst (Peter); C.A. den Uil (Corstiaan); H.J. Meeder (Han); Kotani, T. (Toru); G.F. Nieman (Gary F.)

    2018-01-01

    textabstractStretching the alveolar epithelial type I (AT I) cells controls the intercellular signaling for the exocytosis of surfactant by the AT II cells through the extracellular release of adenosine triphosphate (ATP) (purinergic signaling). Extracellular ATP is cleared by extracellular ATPases,

  1. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  2. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  3. Bone phenotypes of P2 receptor knockout mice

    DEFF Research Database (Denmark)

    Orriss, Isabel; Syberg, Susanne; Wang, Ning

    2011-01-01

    The action of extracellular nucleotides is mediated by ionotropic P2X receptors and G-protein coupled P2Y receptors. The human genome contains 7 P2X and 8 P2Y receptor genes. Knockout mice strains are available for most of them. As their phenotypic analysis is progressing, bone abnormalities have...... been observed in an impressive number of these mice: distinct abnormalities in P2X7-/- mice, depending on the gene targeting construct and the genetic background, decreased bone mass in P2Y1-/- mice, increased bone mass in P2Y2-/- mice, decreased bone resorption in P2Y6-/- mice, decreased bone...... formation and bone resorption in P2Y13-/- mice. These findings demonstrate the unexpected importance of extracellular nucleotide signalling in the regulation of bone metabolism via multiple P2 receptors and distinct mechanisms involving both osteoblasts and osteoclasts....

  4. Attenuated purinergic receptor function in patients with type 2 diabetes

    DEFF Research Database (Denmark)

    Thaning, Pia; Bune, Laurids T.; Hellsten, Ylva

    2010-01-01

    Objective: Extra cellular nucleotides and nucleosides are involved in regulation of skeletal muscle blood flow. Diabetes induces cardiovascular dysregulation but the extent to which the vasodilatatory capacity of nucleotides and nucleosides are affected in type 2 diabetes is unknown. The present...... study investigated: 1) the vasodilatatory effect of ATP, UTP, and adenosine (ADO) and 2) the expression and distribution of P2Y(2) and P2X(1) receptors in skeletal muscles of diabetic subjects. Research Design and Methods: In 10 diabetic patients and 10 age-matched controls, leg blood flow (LBF......-DM (1.5). The distribution and mRNA-expression of receptors were similar in the two groups. Conclusions: The vasodilatatory effect of the purinergic system is severely reduced in type 2 diabetic patients. The potency of nucleotides varies with the following rank order: UTP>ATP>>>ADO. This is not due...

  5. Guanine nucleotide regulatory protein co-purifies with the D2-dopamine receptor

    International Nuclear Information System (INIS)

    Senogles, S.E.; Caron, M.G.

    1986-01-01

    The D 2 -dopamine receptor from bovine anterior pituitary was purified ∼1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with 3 H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D 2 receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 μM NPA. 35 S-GTPγS binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D 2 -dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D 2 -dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes

  6. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  7. Ric-8A, a Gα protein guanine nucleotide exchange factor potentiates taste receptor signaling

    Directory of Open Access Journals (Sweden)

    Claire J Fenech

    2009-10-01

    Full Text Available Taste receptors for sweet, bitter and umami tastants are G-protein coupled receptors (GPCRs. While much effort has been devoted to understanding G-protein-receptor interactions and identifying the components of the signalling cascade downstream of these receptors, at the level of the G-protein the modulation of receptor signal transduction remains relatively unexplored. In this regard a taste-specific regulator of G-protein signaling (RGS, RGS21, has recently been identified. To study whether guanine nucleotide exchange factors (GEFs are involved in the transduction of the signal downstream of the taste GPCRs we investigated the expression of Ric-8A and Ric-8B in mouse taste cells and their interaction with G-protein subunits found in taste buds. Mammalian Ric-8 proteins were initially identified as potent GEFs for a range of Gα subunits and Ric-8B has recently been shown to amplify olfactory signal transduction. We find that both Ric-8A and Ric-8B are expressed in a large portion of taste bud cells and that most of these cells contain IP3R-3 a marker for sweet, umami and bitter taste receptor cells. Ric-8A interacts with Gα-gustducin and Gαi2 through which it amplifies the signal transduction of hTas2R16, a receptor for bitter compounds. Overall, these findings are consistent with a role for Ric-8 in mammalian taste signal transduction.

  8. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  9. Apical membrane P2Y4 purinergic receptor controls K+ secretion by strial marginal cell epithelium

    Directory of Open Access Journals (Sweden)

    Scofield Margaret A

    2005-11-01

    Full Text Available Abstract Background It was previously shown that K+ secretion by strial marginal cell epithelium is under the control of G-protein coupled receptors of the P2Y family in the apical membrane. Receptor activation by uracil nucleotides (P2Y2, P2Y4 or P2Y6 leads to a decrease in the electrogenic K+ secretion. The present study was conducted to determine the subtype of the functional purinergic receptor in gerbil stria vascularis, to test if receptor activation leads to elevation of intracellular [Ca2+] and to test if the response to these receptors undergoes desensitization. Results The transepithelial short circuit current (Isc represents electrogenic K+ secretion and was found to be decreased by uridine 5'-triphosphate (UTP, adenosine 5'-triphosphate (ATP and diadenosine tetraphosphate (Ap4A but not uridine 5'-diphosphate (UDP at the apical membrane of marginal cells of the gerbil stria vascularis. The potencies of these agonists were consistent with rodent P2Y4 and P2Y2 but not P2Y6 receptors. Activation caused a biphasic increase in intracellular [Ca2+] that could be partially blocked by 2-aminoethoxy-diphenyl borate (2-APB, an inhibitor of the IP3 receptor and store-operated channels. Suramin (100 μM did not inhibit the effect of UTP (1 μM. The ineffectiveness of suramin at the concentration used was consistent with P2Y4 but not P2Y2. Transcripts for both P2Y2 and P2Y4 were found in the stria vascularis. Sustained exposure to ATP or UTP for 15 min caused a depression of Isc that appeared to have two components but with apparently no chronic desensitization. Conclusion The results support the conclusion that regulation of K+ secretion across strial marginal cell epithelium occurs by P2Y4 receptors at the apical membrane. The apparent lack of desensitization of the response is consistent with two processes: a rapid-onset phosphorylation of KCNE1 channel subunit and a slower-onset of regulation by depletion of plasma membrane PIP2.

  10. Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

    International Nuclear Information System (INIS)

    Rivkees, S.A.; Carlson, L.L.; Reppert, S.M.

    1989-01-01

    Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using 125 I-labeled melatonin ( 125 I-Mel), a potent melatonin agonist. 125 I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K d of 2.3 ± 1.0 x 10 -11 M and 2.06 ± 0.43 x 10 -10 M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5'-[γ-thio]triphosphate (GTP[γS]), significantly reduced the number of high-affinity receptors and increased the dissociation rate of 125 I-Mel from its receptor. Furthermore, GTP[γS] treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of 125 I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M r > 400,000 and M r ca. 110,000. This elution profile was markedly altered by pretreatment with GTP[γS] before solubilization; only the M r 110,000 peak was present in GTP[γS]-pretreated membranes. The results strongly suggest that 125 I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000

  11. Purinergic receptors in the endocrine and exocrine pancreas.

    Science.gov (United States)

    Novak, I

    2008-09-01

    The pancreas is a complex gland performing both endocrine and exocrine functions. In recent years there has been increasing evidence that both endocrine and exocrine cells possess purinergic receptors, which influence processes such as insulin secretion and epithelial ion transport. Most commonly, these processes have been viewed separately. In beta cells, stimulation of P2Y(1) receptors amplifies secretion of insulin in the presence of glucose. Nucleotides released from secretory granules could also contribute to autocrine/paracrine regulation in pancreatic islets. In addition to P2Y(1) receptors, there is also evidence for other P2 and adenosine receptors in beta cells (P2Y(2), P2Y(4), P2Y(6), P2X subtypes and A(1) receptors) and in glucagon-secreting alpha cells (P2X(7), A(2) receptors). In the exocrine pancreas, acini release ATP and ATP-hydrolysing and ATP-generating enzymes. P2 receptors are prominent in pancreatic ducts, and several studies indicate that P2Y(2), P2Y(4), P2Y(11), P2X(4) and P2X(7) receptors could regulate secretion, primarily by affecting Cl(-) and K(+) channels and intracellular Ca(2+) signalling. In order to understand the physiology of the whole organ, it is necessary to consider the full complement of purinergic receptors on different cells as well as the structural and functional relation between various cells within the whole organ. In addition to the possible physiological function of purinergic receptors, this review analyses whether the receptors could be potential therapeutic targets for drug design aimed at treatment of pancreatic diseases.

  12. Purinergic receptors and calcium signalling in human pancreatic duct cell lines

    DEFF Research Database (Denmark)

    Hansen, Mette R; Krabbe, Simon; Novak, Ivana

    2008-01-01

    pancreatic duct cell lines PANC-1 and CFPAC-1. Expression of P2 receptors was examined using RT-PCR and immunocytochemistry. Both cell lines, and also Capan-1 cells, express RNA transcripts for the following receptors: P2Y1, P2Y2, P2Y4, P2Y6, P2Y11-14 and P2X1, P2X2, P2X4, P2X5, P2X6 and P2X7. Using Fura-2...... and single-cell imaging we tested effects of various nucleotide analogues on intracellular Ca(2+) signals in PANC-1 and CFPAC-1 cells. The cell lines responded to all nucleotides with the following efficiency: UTP >or= ATP = ATPgammaS > BzATP. ATP, UTP and ATPgammaS elicited oscillatory responses. Bz...

  13. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    International Nuclear Information System (INIS)

    Feltner, D.E.; Marasco, W.A.

    1989-01-01

    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of [3H]FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM [3H]FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. [3H]FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of [3H]FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM [3H]FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state

  14. Risk of estrogen receptor-positive and -negative breast cancer and single-nucleotide polymorphism 2q35-rs13387042

    DEFF Research Database (Denmark)

    Milne, Roger L; Benítez, Javier; Nevanlinna, Heli

    2009-01-01

    BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...

  15. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  16. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. DMPD: Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health and disease. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available and nucleotide oligomerisation domain inthe regulation of health and disease. Pu...bmedID 17535871 Title Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health...17535871 Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of heal...th and disease. Mitchell JA, Paul-Clark MJ, Clarke GW, McMaster SK, Cartwright N. J

  18. Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

    Science.gov (United States)

    Dass, J Febin Prabhu; Sudandiradoss, C

    2012-07-15

    5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    International Nuclear Information System (INIS)

    Agui, T.; Matsumoto, K.

    1990-01-01

    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with [ 125 I]VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit [ 125 I]VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. [ 125 I]VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland

  20. Association of Nucleotide-binding Oligomerization Domain Receptors with Peptic Ulcer and Gastric Cancer.

    Science.gov (United States)

    Mohammadian Amiri, Rajeeh; Tehrani, Mohsen; Taghizadeh, Shirin; Shokri-Shirvani, Javad; Fakheri, Hafez; Ajami, Abolghasem

    2016-10-01

    Host innate immunity can affect the clinical outcomes of Helicobacter pylori infection, including gastritis, gastric ulcer, gastric adenocarcinoma, and MALT lymphoma. Nucleotide binding oligomerization domain (NOD)-1 and -2 are two molecules of innate immunity which are involved in the host defense against H. pylori. This study aimed to evaluate the effect of the expression level of NOD1 and NOD2 on the susceptibility to gastric cancer as well as peptic ulcer in individuals with H. pylori infection. The gene expression levels of these molecules were compared in three groups of non-ulcer dyspepsia (NUD) as a control group (n=52); peptic ulcer disease (PUD), (n=53); and gastric cancer (GC), (n=39). Relative expression levels of NOD1 in patients with GC were higher than those of NUD and PUD (p<0.001 and P<0.001, respectively). Similarly in case of NOD1, PUD group showed higher level of expression than NUD group (p<0.01). However, there was no significant difference between H. pylori -positive and -negative patients in NUD, PUD, or GC groups. Moreover, the expression levels of NOD2 showed no significant difference among NUD, PUD, or GC groups, while among H. pylori-positive patients, it was higher in GC group than NUD  and PUD groups (p<0.05 and p<0.01, respectively). In addition, positive correlation coefficients were attained between NOD1 and NOD2 expressions in patients with NUD (R2 Linear=0.349, p<0.001), PUD (R2 Linear=0.695, p<0.001), and GC (R2 Linear=0.385, p<0.001). Collectively, the results suggest that the chronic activation of NOD1 and NOD2 receptors might play a role in the development of gastric cancer.

  1. Transduction proteins of olfactory receptor cells: identification of guanine nucleotide binding proteins and protein kinase C

    International Nuclear Information System (INIS)

    Anholt, R.R.H.; Mumby, S.M.; Stoffers, D.A.; Girard, P.R.; Kuo, J.F.; Snyder, S.H.

    1987-01-01

    The authors have analyzed guanine nucleotide binding proteins (G-proteins) in the olfactory epithelium of Rana catesbeiana using subunit-specific antisera. The olfactory epithelium contained the α subunits of three G-proteins, migrating on polyacrylamide gels in SDS with apparent molecular weights of 45,000, 42,000, and 40,000, corresponding to G/sub s/, G/sub i/, and G/sub o/, respectively. A single β subunit with an apparent molecular weight of 36,000 was detected. An antiserum against the α subunit of retinal transducin failed to detect immunoreactive proteins in olfactory cilia detached from the epithelium. The olfactory cilia appeared to be enriched in immunoreactive G/sub sα/ relative to G/sub ichemical bond/ and G/sub ochemical bond/ when compared to membranes prepared from the olfactory epithelium after detachment of the cilia. Bound antibody was detected by autoradiography after incubation with [ 125 I]protein. Immunohistochemical studies using an antiserum against the β subunit of G-proteins revealed intense staining of the ciliary surface of the olfactory epithelium and of the axon bundles in the lamina propria. In contrast, an antiserum against a common sequence of the α subunits preferentially stained the cell membranes of the olfactory receptor cells and the acinar cells of Bowman's glands and the deep submucosal glands. In addition to G-proteins, they have identified protein kinase C in olfactory cilia via a protein kinase C specific antiserum and via phorbol ester binding. However, in contrast to the G-proteins, protein kinase C occurred also in cilia isolated from respiratory epithelium

  2. The effects of irradiation on the cytosol glucocorticoid receptor and concentrations of corticosterone and cyclic nucleotides in the rat liver

    International Nuclear Information System (INIS)

    Teshima, Teruki; Mori, Masaki; Honke, Yoshifumi

    1983-01-01

    The effects of irradiation on both the cytosol glucocorticoid receptor and concentrations of corticosterone and cyclic nucleotides in the rat liver were investigated. The liver concentrations of corticosterone and cyclic nucleotides were measured by radioimmunoassay before and after the irradiation of 1,000 rad/l fraction. The glucocorticoid receptor in the liver cytosol was determined by the measurement of the cytosol binding to 3 H-dexamethasone. The cytosol and nuclear corticosterone levels reached a peak 1 day after the irradiation of the rat liver and declined to the control levels after 2 days. The increase in corticosterone levels may be due to the direct stimulation of the right adrenal gland and/ or the stress induced by the irradiation. The binding capacity of the glucocorticoid receptor in rat liver cytosol decreased to the minimum 1 day after the irradiation, and the recovery occurred at 4 days. The Kd value of the glucocorticoid receptor remained unchanged from 1 hour until 4 days but was high at 4 and 7 days. The distinctly increased levels of cyclic GMP in the rat liver were found from 1 hour through 7 days after the irradiation, while cyclic AMP did not change. The inversed relationship between the cytosol glucocorticoid receptor and corticosterone levels in cytosol and the nuclei indicates that the receptor-bound corticosterone in cytosol can be transferred to a nucleus and remain there in the presence of appropriate amounts of corticosterone in cytosol, after which the receptor is released from the nucleus into cytosol. The high Kd values observed 4 -- 7 days after the irradiation may be either due to the direct effect of irradiation or to the replenishment of the receptor with a low affinity. (author)

  3. Effects of luminal flow and nucleotides on [Ca(2+)](i) in rabbit cortical collecting duct.

    Science.gov (United States)

    Woda, Craig B; Leite, Maurilo; Rohatgi, Rajeev; Satlin, Lisa M

    2002-09-01

    Nucleotide binding to purinergic P2 receptors contributes to the regulation of a variety of physiological functions in renal epithelial cells. Whereas P2 receptors have been functionally identified at the basolateral membrane of the cortical collecting duct (CCD), a final regulatory site of urinary Na(+), K(+), and acid-base excretion, controversy exists as to whether apical purinoceptors exist in this segment. Nor has the distribution of receptor subtypes present on the unique cell populations that constitute Ca(2+) the CCD been established. To examine this, we measured nucleotide-induced changes in intracellular Ca(2+) concentration ([Ca(2+)](i)) in fura 2-loaded rabbit CCDs microperfused in vitro. Resting [Ca(2+)](i) did not differ between principal and intercalated cells, averaging approximately 120 nM. An acute increase in tubular fluid flow rate, associated with a 20% increase in tubular diameter, led to increases in [Ca(2+)](i) in both cell types. Luminal perfusion of 100 microM UTP or ATP-gamma-S, in the absence of change in flow rate, caused a rapid and transient approximately fourfold increase in [Ca(2+)](i) in both cell types (P < 0.05). Luminal suramin, a nonspecific P2 receptor antagonist, blocked the nucleotide- but not flow-induced [Ca(2+)](i) transients. Luminal perfusion with a P2X (alpha,beta-methylene-ATP), P2X(7) (benzoyl-benzoyl-ATP), P2Y(1) (2-methylthio-ATP), or P2Y(4)/P2Y(6) (UDP) receptor agonist had no effect on [Ca(2+)](i). The nucleotide-induced [Ca(2+)](i) transients were inhibited by the inositol-1,4,5-triphosphate receptor blocker 2-aminoethoxydiphenyl borate, thapsigargin, which depletes internal Ca(2+) stores, luminal perfusion with a Ca(2+)-free perfusate, or the L-type Ca(2+) channel blocker nifedipine. These results suggest that luminal nucleotides activate apical P2Y(2) receptors in the CCD via pathways that require both internal Ca(2+) mobilization and extracellular Ca(2+) entry. The flow-induced rise in [Ca(2+)](i) is

  4. Receptor binding of somatostatin-14 and somatostatin-28 in rat brain: differential modulation by nucleotides and ions.

    Science.gov (United States)

    Srikant, C B; Dahan, A; Craig, C

    1990-02-04

    The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2

  5. Implementation of anion-receptor macrocycles in supramolecular tandem assays for enzymes involving nucleotides as substrates, products, and cofactors.

    Science.gov (United States)

    Florea, Mara; Nau, Werner M

    2010-03-07

    A supramolecular tandem assay for direct continuous monitoring of nucleotide triphosphate-dependent enzymes such as potato apyrase is described. The underlying principle of the assay relies on the use of anion-receptor macrocycles in combination with fluorescent dyes as reporter pairs. A combinatorial approach was used to identify two complementary reporter pairs, i.e. an amino-gamma-cyclodextrin with 2-anilinonaphtalene-6-sulfonate (ANS) as dye (fluorescence enhancement factor of 17 upon complexation) and a polycationic cyclophane with 8-hydroxy-1,3,6-pyrene trisulfonate (HPTS) as dye (fluorescence decrease by a factor of more than 2000), which allow the kinetic monitoring of potato apyrase activity at different ATP concentration ranges (microM and mM) with different types of photophysical responses (switch-ON and switch-OFF). Competitive fluorescence titrations revealed a differential binding of ATP (strongest competitor) versus ADP and AMP, which constitutes the prerequisite for monitoring enzymatic conversions (dephosphorylation or phosphorylation) involving nucleotides. The assay was tested for different enzyme and substrate concentrations and exploited for the screening of activating additives, namely divalent transition metal ions (Ni(2+), Mg(2+), Mn(2+), and Ca(2+)). The transferability of the assay could be demonstrated by monitoring the dephosphorylation of other nucleotide triphosphates (GTP, TTP, and CTP).

  6. Nucleotide transmitters ATP and ADP mediate intercellular calcium wave communication via P2Y12/13 receptors among BV-2 microglia.

    Directory of Open Access Journals (Sweden)

    Pengchong Jiang

    Full Text Available Nerve injury is accompanied by a liberation of diverse nucleotides, some of which act as 'find/eat-me' signals in mediating neuron-glial interplay. Intercellular Ca2+ wave (ICW communication is the main approach by which glial cells interact and coordinate with each other to execute immune defense. However, the detailed mechanisms on how these nucleotides participate in ICW communication remain largely unclear. In the present work, we employed a mechanical stimulus to an individual BV-2 microglia to simulate localized injury. Remarkable ICW propagation was observed no matter whether calcium was in the environment or not. Apyrase (ATP/ADP-hydrolyzing enzyme, suramin (broad-spectrum P2 receptor antagonist, 2-APB (IP3 receptor blocker and thapsigargin (endoplasmic reticulum calcium pump inhibitor potently inhibited these ICWs, respectively, indicating the dependence of nucleotide signals and P2Y receptors. Then, we detected the involvement of five naturally occurring nucleotides (ATP, ADP, UTP, UDP and UDP-glucose by desensitizing receptors. Results showed that desensitization with ATP and ADP could block ICW propagation in a dose-dependent manner, whereas other nucleotides had little effect. Meanwhile, the expression of P2Y receptors in BV-2 microglia was identified and their contributions were analyzed, from which we suggested P2Y12/13 receptors activation mostly contributed to ICWs. Besides, we estimated that extracellular ATP and ADP concentration sensed by BV-2 microglia was about 0.3 μM during ICWs by analyzing calcium dynamic characteristics. Taken together, these results demonstrated that the nucleotides ATP and ADP were predominant signal transmitters in mechanical stimulation-induced ICW communication through acting on P2Y12/13 receptors in BV-2 microglia.

  7. ATP induced vasodilatation and purinergic receptors in the human leg: roles of nitric oxide, prostaglandins and adenosine

    DEFF Research Database (Denmark)

    Mortensen, Stefan P; Gonzalez-Alonso, Jose; Bune, Laurids

    2009-01-01

    .05) and was associated with a parallel lowering in leg vascular conductance and cardiac output and a compensatory increase in leg O2 extraction. Infusion of theophylline did not alter the ATP induced leg hyperemia or systemic variables. Real time PCR analysis of the mRNA content from the vastus lateralus muscle of 8...... subjects showed the highest expression of P2Y2 receptors of the 10 investigated P2 receptor subtypes. Immunohistochemistry showed that P2Y2 receptors were located in the endothelium of microvessels and smooth muscle cells, whereas P2X1 receptors were located in the endothelium and the sacrolemma....... Collectively, these results indicate that NO and prostaglandins, but not adenosine, play a role in ATP induced vasodilation in human skeletal muscle. The localization of the P2Y2 and P2X1 receptors suggest that these receptors may mediate ATP induced vasodilation in skeletal muscle. Key words: Skeletal Muscle...

  8. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    Energy Technology Data Exchange (ETDEWEB)

    Di Paolo, T.; Falardeau, P.

    1987-08-31

    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p < 0.001). Competition for (/sup 3/H)-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-(..beta..-..gamma..-imino)triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables.

  9. Guanine nucleotide regulation of dopamine receptor agonist affinity states in rat estradiol-induced pituitary tumors

    International Nuclear Information System (INIS)

    Di Paolo, T.; Falardeau, P.

    1987-01-01

    The authors have investigated dopamine (DA) receptor agonist high- and low-affinity states in female rate estradiol-induced prolactin (PRL)-secreting pituitary tumors and intact pituitary tissue. Estradiol treatment increased the anterior pituitary weight 9-fold and plasma prolactin levels 74-fold and these measures are correlated (R = 0.745, n = 73, p 3 H]-spiperone binding to the DA receptor by apomorphine was compared in normal and adenomatous pituitary tissue. The inhibition constants (Ki) and the proportions of the two apomorphine sites are unchanged in tumors compared to intact pituitary tissue. Guanosine 5'-[β-γ-imino]triphosphate (Gpp(NH)p) causes complete conversion of the high into low affinity dopaminergic agonist site in normal pituitary and in tumors. These results suggest that rats with primary estradiol-induced pituitary tumors have normal and functional DA receptors. 9 references, 2 tables

  10. Functional reconstitution of prostaglandin E receptor from bovine adrenal medulla with guanine nucleotide binding proteins

    International Nuclear Information System (INIS)

    Negishi, M.; Ito, S.; Yokohama, H.; Hayashi, H.; Katada, T.; Ui, M.; Hayaishi, O.

    1988-01-01

    Prostaglandin E 2 (PEG 2 ) was found to bind specifically to a 100,000 x g pellet prepared from bovine adrenal medulla. The PGE receptor was associated with a GTP-binding protein (G-protein) and could be covalently cross-linked with this G-protein by dithiobis(succinimidyl propionate) in the 100,000 x g pellet. In order to characterize the G-protein associated with the PGE receptor and reconstitute these proteins in phospholipid vesicles, the authors purified the G-protein to apparent homogeneity from the 100,000 x g pellet. The G-protein served as a substrate of pertussis toxin but differed in its α subunit from two known pertussis toxin substrate G-proteins (G/sub i/ and G 0 ) purified from bovine brain. The molecular weight of the α subunit was 40,000, which is between those of G/sub i/ and G 0 . The purified protein was also distinguished immunologically from G/sub i/ and G 0 and was referred to as G/sub am/. Reconstitution of the PGE receptor with pure C/sub am/, G/sub i/, or G 0 in phospholipid vesicles resulted in a remarkable restoration of [ 3 H]PGE 2 binding activity in a GTP-dependent manner. The efficiency of these three G-proteins in this capacity was roughly equal. When pertussis toxin- or N-ethylmaleimide-treated G-proteins, instead of the native ones, were reconstituted into vesicles, the restoration of binding activity was no longer observed. These results indicate that the PGE receptor can couple functionally with G/sub am/, G/sub i/, or G 0 in phospholipid vesicles and suggest that G/sub am/ may be involved in signal transduction of the PGE receptor in bovine adrenal medulla

  11. Critical role of nucleotide-binding oligomerization domain-like receptor 3 in vascular repair

    Energy Technology Data Exchange (ETDEWEB)

    Schlaweck, Sebastian; Zimmer, Sebastian; Struck, Rafael [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Bartok, Eva [Institute for Clinical Chemistry and Clinical Pharmacology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Werner, Nikos [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Bauernfeind, Franz [Institute for Clinical Chemistry and Clinical Pharmacology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Latz, Eicke [Institute of Innate Immunity, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Nickenig, Georg [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Hornung, Veit [Institute for Clinical Chemistry and Clinical Pharmacology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany); Ghanem, Alexander, E-mail: ghanem@uni-bonn.de [Department of Medicine/Cardiology, University of Bonn, Sigmund-Freud-Str. 25, 53105 Bonn (Germany)

    2011-08-05

    Highlights: {yields} NLRP3 is not required for systemic cardiovascular function in healthy mice. {yields} NLRP3 deficiency itself does not affect the functional cardiovascular phenotype and that it does not alter peripheral differential blood counts. {yields} NLRP3 is critical in neointima formation following vascular injury. -- Abstract: Vascular remodeling characterized by hyperproliferative neointima formation is an unfavorable repair process that is triggered by vascular damage. This process is characterized by an increased local inflammatory and proliferative response that critically involves the pro-inflammatory cytokine interleukin-1{beta} (IL-1{beta}). IL-1{beta} is expressed and cytosolically retained as a procytokine that requires additional processing prior to exerting its pro-inflammatory function. Maturation and release of pro IL-1{beta} is governed by a cytosolic protein scaffold that is known as the inflammasome. Here we show that NLRP3 (NOD-like receptor family, pryin domain containing 3), an important activating component of the inflammasome, is involved in neointima formation after vascular injury. NLRP3 deficiency itself does not affect the functional cardiovascular phenotype and does not alter peripheral differential blood counts. However, neointima development following wire injury of the carotid artery was significantly decreased in NLRP3-deficient mice as compared to wild-type controls. In all, NLRP3 plays a non-redundant role in vascular damage mediated neointima formation. Our data establish NLRP3 as a key player in the response to vascular damage, which could open new avenues to therapeutic intervention.

  12. Critical role of nucleotide-binding oligomerization domain-like receptor 3 in vascular repair

    International Nuclear Information System (INIS)

    Schlaweck, Sebastian; Zimmer, Sebastian; Struck, Rafael; Bartok, Eva; Werner, Nikos; Bauernfeind, Franz; Latz, Eicke; Nickenig, Georg; Hornung, Veit; Ghanem, Alexander

    2011-01-01

    Highlights: → NLRP3 is not required for systemic cardiovascular function in healthy mice. → NLRP3 deficiency itself does not affect the functional cardiovascular phenotype and that it does not alter peripheral differential blood counts. → NLRP3 is critical in neointima formation following vascular injury. -- Abstract: Vascular remodeling characterized by hyperproliferative neointima formation is an unfavorable repair process that is triggered by vascular damage. This process is characterized by an increased local inflammatory and proliferative response that critically involves the pro-inflammatory cytokine interleukin-1β (IL-1β). IL-1β is expressed and cytosolically retained as a procytokine that requires additional processing prior to exerting its pro-inflammatory function. Maturation and release of pro IL-1β is governed by a cytosolic protein scaffold that is known as the inflammasome. Here we show that NLRP3 (NOD-like receptor family, pryin domain containing 3), an important activating component of the inflammasome, is involved in neointima formation after vascular injury. NLRP3 deficiency itself does not affect the functional cardiovascular phenotype and does not alter peripheral differential blood counts. However, neointima development following wire injury of the carotid artery was significantly decreased in NLRP3-deficient mice as compared to wild-type controls. In all, NLRP3 plays a non-redundant role in vascular damage mediated neointima formation. Our data establish NLRP3 as a key player in the response to vascular damage, which could open new avenues to therapeutic intervention.

  13. A study of possible associations between single nucleotide polymorphisms in the estrogen receptor 2 gene and female sexual desire.

    Science.gov (United States)

    Gunst, Annika; Jern, Patrick; Westberg, Lars; Johansson, Ada; Salo, Benny; Burri, Andrea; Spector, Tim; Eriksson, Elias; Sandnabba, N Kenneth; Santtila, Pekka

    2015-03-01

    Female sexual desire and arousal problems have been shown to have a heritable component of moderate size. Previous molecular genetic studies on sexual desire have mainly focused on genes associated with neurotransmitters such as dopamine and serotonin. Nevertheless, there is reason to believe that hormones with more specific functions concerning sexuality could have an impact on sexual desire and arousal. The aim of the present study was to investigate the possible effects of 17 single nucleotide polymorphisms (SNPs) located in estrogen receptor genes on female sexual desire and subjective and genital arousal (lubrication). Based on previous research, we hypothesized that ESR1 and ESR2 are relevant genes that contribute to female sexual desire and arousal. The desire, arousal, and lubrication subdomains of the Female Sexual Function Index self-report questionnaire were used. The present study involved 2,448 female twins and their sisters aged 18-49 who had submitted saliva samples for genotyping. The participants were a subset from a large-scale, population-based sample. We found nominally significant main effects on sexual desire for three ESR2 -linked SNPs when controlled for anxiety, suggesting that individuals homozygous for the G allele of the rs1271572 SNP, and the A allele of the rs4986938 and rs928554 SNPs had lower levels of sexual desire. The rs4986938 SNP also had a nominally significant effect on lubrication. No effects for any of the SNPs on subjective arousal could be detected. The number of nominally significant results for SNPs in the ESR2 gene before correcting for multiple testing suggests that further studies on the possible influence of this gene on interindividual variation in female sexual functioning are warranted. In contrast, no support for an involvement of ESR1 was obtained. Our results should be interpreted with caution until replicated in independent, large samples. © 2014 International Society for Sexual Medicine.

  14. Impacts of Nonsynonymous Single Nucleotide Polymorphisms of Adiponectin Receptor 1 Gene on Corresponding Protein Stability: A Computational Approach

    Directory of Open Access Journals (Sweden)

    Md. Abu Saleh

    2016-01-01

    Full Text Available Despite the reported association of adiponectin receptor 1 (ADIPOR1 gene mutations with vulnerability to several human metabolic diseases, there is lack of computational analysis on the functional and structural impacts of single nucleotide polymorphisms (SNPs of the human ADIPOR1 at protein level. Therefore, sequence- and structure-based computational tools were employed in this study to functionally and structurally characterize the coding nsSNPs of ADIPOR1 gene listed in the dbSNP database. Our in silico analysis by SIFT, nsSNPAnalyzer, PolyPhen-2, Fathmm, I-Mutant 2.0, SNPs&GO, PhD-SNP, PANTHER, and SNPeffect tools identified the nsSNPs with distorting functional impacts, namely, rs765425383 (A348G, rs752071352 (H341Y, rs759555652 (R324L, rs200326086 (L224F, and rs766267373 (L143P from 74 nsSNPs of ADIPOR1 gene. Finally the aforementioned five deleterious nsSNPs were introduced using Swiss-PDB Viewer package within the X-ray crystal structure of ADIPOR1 protein, and changes in free energy for these mutations were computed. Although increased free energy was observed for all the mutants, the nsSNP H341Y caused the highest energy increase amongst all. RMSD and TM scores predicted that mutants were structurally similar to wild type protein. Our analyses suggested that the aforementioned variants especially H341Y could directly or indirectly destabilize the amino acid interactions and hydrogen bonding networks of ADIPOR1.

  15. Nucleotide-oligomerizing domain-1 (NOD1) receptor activation induces pro-inflammatory responses and autophagy in human alveolar macrophages.

    Science.gov (United States)

    Juárez, Esmeralda; Carranza, Claudia; Hernández-Sánchez, Fernando; Loyola, Elva; Escobedo, Dante; León-Contreras, Juan Carlos; Hernández-Pando, Rogelio; Torres, Martha; Sada, Eduardo

    2014-09-25

    Nucleotide-binding oligomerizing domain-1 (NOD1) is a cytoplasmic receptor involved in recognizing bacterial peptidoglycan fragments that localize to the cytosol. NOD1 activation triggers inflammation, antimicrobial mechanisms and autophagy in both epithelial cells and murine macrophages. NOD1 mediates intracellular pathogen clearance in the lungs of mice; however, little is known about NOD1's role in human alveolar macrophages (AMs) or its involvement in Mycobacterium tuberculosis (Mtb) infection. AMs, monocytes (MNs), and monocyte-derived macrophages (MDMs) from healthy subjects were assayed for NOD1 expression. Cells were stimulated with the NOD1 ligand Tri-DAP and cytokine production and autophagy were assessed. Cells were infected with Mtb and treated with Tri-DAP post-infection. CFUs counting determined growth control, and autophagy protein recruitment to pathogen localization sites was analyzed by immunoelectron microscopy. NOD1 was expressed in AMs, MDMs and to a lesser extent MNs. Tri-DAP stimulation induced NOD1 up-regulation and a significant production of IL1β, IL6, IL8, and TNFα in AMs and MDMs; however, the level of NOD1-dependent response in MNs was limited. Autophagy activity determined by expression of proteins Atg9, LC3, IRGM and p62 degradation was induced in a NOD1-dependent manner in AMs and MDMs but not in MNs. Infected AMs could be activated by stimulation with Tri-DAP to control the intracellular growth of Mtb. In addition, recruitment of NOD1 and the autophagy proteins IRGM and LC3 to the Mtb localization site was observed in infected AMs after treatment with Tri-DAP. NOD1 is involved in AM and MDM innate responses, which include proinflammatory cytokines and autophagy, with potential implications in the killing of Mtb in humans.

  16. Association of single nucleotide polymorphisms in pro-inflammatory cytokine and toll-like receptor genes with pediatric hematogenous osteomyelitis.

    Science.gov (United States)

    Osman, A E; Mubasher, M; ElSheikh, N E; AlHarthi, H; AlZahrani, M S; Ahmed, N; ElGhazali, G; Bradley, B A; Fadil, A-S A

    2016-05-23

    Hematogenous osteomyelitis (HO) is a bone infection wherein bacteria penetrate to the bone through the blood stream. Several single nucleotide polymorphisms (SNPs) have been associated with susceptibility to infectious diseases. In this study, we investigated the contribution of SNPs in interleukin (IL)-1B1 (rs16944), IL1A (rs1800587), IL1B (rs1143634), toll-like receptor (TLR)-2 (rs3804099), TLR4 (rs4986790), TLR4 (rs4986791), IL1R (rs2234650), tumor necrosis factor (TNF)-α (rs1800629), TNF (rs361525), and IL1RN (rs315952) towards the development of HO in Saudi patients and compared to healthy controls. Fifty-two patients diagnosed with HO and 103 healthy individuals were genotyped. The frequencies of genotypes GG (rs16944) and AA (rs16944) were lower and higher in patients [odds ratio (OR) = 0.34, Pc = 0.05] and controls (OR = 1.33, Pc = 0.05), respectively, suggesting that SNPs at this locus could alter HO susceptibility. In addition, the patients and controls exhibited lower and higher frequencies of the alleles G (rs16944) (OR = 0.43, Pc = 0.007) and A (rs16944) (OR = 2.32, Pc = 0.007), respectively. The expression of alleles C (rs3804099) and T (rs3804099) were higher in patients (OR = 2.05, Pc = 0.04) and controls (OR = 0.49, Pc = 0.04), respectively. In conclusion, SNPs at rs16944 and rs3804099 were found to be associated with HO in the Saudi population.

  17. Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools

    Directory of Open Access Journals (Sweden)

    Lefranc Marie-Paule

    2008-10-01

    Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By

  18. Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools.

    Science.gov (United States)

    Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard

    2008-10-02

    Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we

  19. Role of a guanine nucleotide-binding protein in α1-adrenergic receptor-mediated Ca2+ mobilization in DDT1 MF-2 cells

    International Nuclear Information System (INIS)

    Cornett, L.E.; Norris, J.S.

    1987-01-01

    In this study the mechanisms involved in α 1 -adrenergic receptor-mediated Ca 2+ mobilization at the level of the plasma membrane were investigated. Stimulation of 45 Ca 2+ efflux from saponin-permeabilized DDT 1 MF-2 cells was observed with the addition of either the α 1 -adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of [ 32 P] NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT 1 , MF-2 cells, possibly the α-subunit of N/sub i/. However, stimulation of unidirectional 45 Ca 2+ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the α 1 -adrenergic receptor to Ca 2+ mobilization in DDT 1 MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family

  20. Single nucleotide polymorphisms and genotypes of transient receptor potential ion channel and acetylcholine receptor genes from isolated B lymphocytes in myalgic encephalomyelitis/chronic fatigue syndrome patients.

    Science.gov (United States)

    Marshall-Gradisnik, Sonya; Johnston, Samantha; Chacko, Anu; Nguyen, Thao; Smith, Peter; Staines, Donald

    2016-12-01

    Objective The pathomechanism of chronic fatigue syndrome/myalgic encephalomyelitis (CFS/ME) is unknown; however, a small subgroup of patients has shown muscarinic antibody positivity and reduced symptom presentation following anti-CD20 intervention. Given the important roles of calcium (Ca 2+ ) and acetylcholine (ACh) signalling in B cell activation and potential antibody development, we aimed to identify relevant single nucleotide polymorphisms (SNPs) and genotypes in isolated B cells from CFS/ME patients. Methods A total of 11 CFS/ME patients (aged 31.82 ± 5.50 years) and 11 non-fatigued controls (aged 33.91 ± 5.06 years) were included. Flow cytometric protocols were used to determine B cell purity, followed by SNP and genotype analysis for 21 mammalian TRP ion channel genes and nine mammalian ACh receptor genes. SNP association and genotyping analysis were performed using ANOVA and PLINK analysis software. Results Seventy-eight SNPs were identified in nicotinic and muscarinic acetylcholine receptor genes in the CFS/ME group, of which 35 were in mAChM3. The remaining SNPs were identified in nAChR delta (n = 12), nAChR alpha 9 (n = 5), TRPV2 (n = 7), TRPM3 (n = 4), TRPM4 (n = 1) mAChRM3 2 (n = 2), and mAChRM5 (n = 3) genes. Nine genotypes were identified from SNPs in TRPM3 (n = 1), TRPC6 (n = 1), mAChRM3 (n = 2), nAChR alpha 4 (n = 1), and nAChR beta 1 (n = 4) genes, and were located in introns and 3' untranslated regions. Odds ratios for these specific genotypes ranged between 7.11 and 26.67 for CFS/ME compared with the non-fatigued control group. Conclusion This preliminary investigation identified a number of SNPs and genotypes in genes encoding TRP ion channels and AChRs from B cells in patients with CFS/ME. These may be involved in B cell functional changes, and suggest a role for Ca 2+ dysregulation in AChR and TRP ion channel signalling in the pathomechanism of CFS/ME.

  1. Effects of airway surface liquid height on the kinetics of extracellular nucleotides in airway epithelia.

    Science.gov (United States)

    Amarante, Tauanne D; da Silva, Jafferson K L; Garcia, Guilherme J M

    2014-12-21

    Experimental techniques aimed at measuring the concentration of signaling molecules in the airway surface liquid (ASL) often require an unrealistically large ASL volume to facilitate sampling. This experimental limitation, prompted by the difficulty of pipetting liquid from a very shallow layer (~15 μm), leads to dilution and the under-prediction of physiologic concentrations of signaling molecules that are vital to the regulation of mucociliary clearance. Here, we use a computational model to describe the effect of liquid height on the kinetics of extracellular nucleotides in the airway surface liquid coating respiratory epithelia. The model consists of a reaction-diffusion equation with boundary conditions that represent the enzymatic reactions occurring on the epithelial surface. The simulations reproduce successfully the kinetics of extracellular ATP following hypotonic challenge for ASL volumes ranging from 25 μl to 500 μl in a 12-mm diameter cell culture. The model reveals that [ATP] and [ADO] reach 1200 nM and 2200 nM at the epithelial surface, respectively, while their volumetric averages remain less than 200 nM at all times in experiments with a large ASL volume (500 μl). These findings imply that activation of P2Y2 and A2B receptors is robust after hypotonic challenge, in contrast to what could be concluded based on experimental measurements of volumetric concentrations in large ASL volumes. Finally, given the central role that ATP and ADO play in regulating mucociliary clearance, we investigated which enzymes, when inhibited, provide the greatest increase in ATP and ADO concentrations. Our findings suggest that inhibition of NTPDase1/highTNAP would cause the greatest increase in [ATP] after hypotonic challenge, while inhibition of the transporter CNT3 would provide the greatest increase in [ADO]. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Extracellular ATP elevates cytoplasmatic free Ca2+ in HeLa cells by the interaction with a 5'-nucleotide receptor

    NARCIS (Netherlands)

    Smit, M J; Leurs, R; Bloemers, S M; Tertoolen, L G; Bast, A; De Laat, S W; Timmerman, H

    1993-01-01

    In the present study we have characterized the effects of ATP and several other nucleotides on the intracellular Ca2+ levels of HeLa cells. Using fura-2 microscopy fluorescence measurements, the ATP-mediated increase in intracellular Ca2+ was shown to consist of a rapid rise which decreased after a

  3. Insulin: its binding to specific receptors and its stimulation of DNA synthesis and 2',3'-cyclic nucleotide phosphohydrolase in embryonic mouse brain cell cultures

    International Nuclear Information System (INIS)

    Shanker, G.; Pieringer, R.A.

    1986-01-01

    Previously, the authors demonstrated that ornithine decarboxylase was stimulated by insulin in cultures of embryonic mouse brain cells. In the present work, they have investigated the presence and specificity of insulin receptors in these cultures. A time study showed that maximum binding of 125 [I] labelled insulin was around 75 min. Other studies measured the influence of concentration and age on insulin binding. A displacement study using increasing concentrations of cold insulin, glucagon or growth hormone demonstrated that the specificity of the receptors for insulin was rather high. It was also found that insulin displayed a clear dose-dependent stimulation of thymidine incorporation into the brain cells. Insulin also stimulated the glial enzyme 2':3'-cyclic nucleotide phosphohydrolase (CNP-ase). The results suggest a dual role for insulin; it regulates both cell proliferation as well as differentiation

  4. [3H]WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    International Nuclear Information System (INIS)

    Norman, A.B.; Battaglia, G.; Creese, I.

    1985-01-01

    In the presence of a 30 nM prazosin mask, [ 3 H]-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ([ 3 H]WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for [ 3 H] WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at [ 3 H]WB4101-binding sites in the presence of 30 nM prazosin and [ 3 H] lysergic acid diethylamide ([ 3 H]LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5 mM MgSO4, the Bmax of [ 3 H]WB4101 is significantly lower than the Bmax of [ 3 H]LSD in various brain regions. WB4101 competition for [ 3 H] LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of [ 3 H]WB4101 binding derived from saturation experiments. This suggests that [ 3 H]WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by [ 3 H]LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for [ 3 H]WB4101 but compete for multiple [ 3 H]LSD 5-HT1 binding sites. These data indicate that [ 3 H]WB4101 selectively labels the 5-HT1A serotonin receptor, whereas [ 3 H] LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of [ 3 H]WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of [ 3 H]WB4101 binding

  5. Differential regulation of inositol 1,4,5-trisphosphate by co-existing P2Y-purinoceptors and nucleotide receptors on bovine aortic endothelial cells.

    Science.gov (United States)

    Purkiss, J R; Wilkinson, G F; Boarder, M R

    1994-03-01

    1. We have examined the inositol 1,4,5-trisphosphate (Ins(1,4,5)P3) responses in bovine aortic endothelial (BAE) cells to purines (ATP, ADP and analogues) and the pyrimidine, uridine triphosphate (UTP). 2. Exchange of medium on BAE cells in the absence of agonist was found to be a stimulus for Ins(1,4,5)P3 generation. BAE cells stimulated with 100 microM ATP, 30 microM 2MeSATP (an agonist at P2Y-purinoceptors but not nucleotide receptors) or 100 microM UTP (an agonist at nucleotide receptors but not P2Y-purinoceptors) gave Ins(1,4,5)P3 responses above that caused by exchange of medium. The time course was rapid, with peak response within the first 5 s and levels returning close to basal after 30 s of stimulation. 3. Significant differences in Ins(1,4,5)P3 responses to 100 microM UTP and 30 microM 2MeSATP stimulation were observed. The response to UTP was reproducibly more sustained than that to 2MeSATP. 4. Stimulation of BAE cells with 100 microM UTP plus 30 microM 2MeSATP produced a response statistically indistinguishable from that predicted by addition of the responses to the two agonists in isolation. 5. The Ins(1,4,5)P3 response to UTP was attenuated to 25% of control by pretreatment of BAE cells with pertussis toxin. Responses to 2MeSATP and ADP were essentially unaffected. ATP stimulation was reduced to 65% of control. 6. Activation of protein kinase C with tetradecanoyl phorbol acetate (TPA) profoundly inhibited Ins(1,4,5)P3 responses to 2MeSATP and ADP but had no effect on UTP stimulation. The protein kinase C inhibitor, Ro 31-8220, enhanced responses to 2MeSATP, ADP and ATP but no effect was observed on UTP stimulation. 7. These observations show that nucleotide and P2Y-receptors mobilise the second messenger Ins(1,4,5)P3 by separate routes resulting in different patterns of generation and suggest that while ATP activates both receptors, ADP principally influences these cells by interacting with the P2Y-purinoceptors.

  6. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  7. Activation of nucleotide-binding domain-like receptor containing protein 3 inflammasome in dendritic cells and macrophages by Streptococcus sanguinis.

    Science.gov (United States)

    Saeki, Ayumi; Suzuki, Toshihiko; Hasebe, Akira; Kamezaki, Ryousuke; Fujita, Mari; Nakazawa, Futoshi; Shibata, Ken-Ichiro

    2017-03-01

    Streptococcus sanguinis is frequently isolated from the blood of patients with infective endocarditis and contributes to the pathology of this disease through induction of interleukin (IL)-1β responsible for the development of the disease. However, the mechanism of IL-1β induction remains unknown. In this study, S. sanguinis activated a murine dendritic cell (DC) to induce IL-1β and this activity was attenuated by silencing the mRNAs of nucleotide-binding domain-like receptor containing protein 3 (NLRP3) and caspase-1. S. sanguinis induced IL-1β production in murine bone marrow-derived macrophage, but this activity was significantly reduced in bone marrow-derived macrophages from NLRP3-, apoptosis-associated speck-like protein containing a caspase-recruitment domain-, and caspase-1-deficient mice. DC phagocytosed S. sanguinis cells, followed by the release of adenosine triphosphate (ATP). The ATP-degradating enzyme attenuated the release of ATP and IL-1β. The inhibitors for ATP receptor reduced IL-1β release in DC. These results strongly suggest that S. sanguinis has the activity to induce IL-1β through the NLRP3 inflammasome in macrophage and DC and interaction of purinergic receptors with ATP released is involved in expression of the activity. © 2016 John Wiley & Sons Ltd.

  8. Polycystic ovary syndrome: association of a C/T single nucleotide polymorphism at tyrosine kinase domain of insulin receptor gene with pathogenesis among lean Japanese women.

    Science.gov (United States)

    Kashima, Katsunori; Yahata, Tetsuro; Fujita, Kazuyuki; Tanaka, Kenichi

    2013-01-01

    To assess whether the insulin receptor (INSR) gene contributes to genetic susceptibility to polycystic ovary syndrome (PCOS) in a Japanese population. We ex-amined the frequency of the His 1058 C/T single nucleotide polymorphism (SNP) found in exon 17 of the INSR gene in 61 Japanese PCOS patients and 99 Japanese healthy controls. In addition, we analyzed the association between the genotype of this SNP and the clinical phenotypes. The frequency of the C/C genotype was not significantly different between all PCOS patients (47.5%) and controls (35.4%). However, among the lean cases (body mass index PCOS patients (65.0%) as compared with controls (36.6%). We concluded that the His 1058 C/T polymorphism at the tyrosine kinase domain of the INSR gene had a relationship to the pathogenesis of lean PCOS patients in a Japanese population.

  9. The Gly16 allele of the G16R single nucleotide polymorphism in the β2-adrenergic receptor gene augments the glycemic response to adrenaline in humans

    DEFF Research Database (Denmark)

    Rokamp, Kim Z.; Staalsø, Jonatan M.; Zaar, Morten

    2017-01-01

    Cerebral non-oxidative carbohydrate consumption may be driven by a ß2-adrenergic mechanism. This study tested whether the 46G > A (G16R) single nucleotide polymorphism of the ß2-adrenergic receptor gene (ADRB2) influences the metabolic and cerebrovascular responses to administration of adrenaline....... Forty healthy Caucasian men were included from a group of genotyped individuals. Cardio- and cerebrovascular variables at baseline and during a 60-min adrenaline infusion (0.06 μg kg-1 min-1) were measured by Model flow, near-infrared spectroscopy and transcranial Doppler sonography. Blood samples were...... obtained from an artery and a retrograde catheter in the right internal jugular vein. The ADRB2 G16R variation had no effect on baseline arterial glucose, but during adrenaline infusion plasma glucose was up to 1.2 mM (CI95: 0.36-2.1, P

  10. Single Nucleotide Polymorphisms in Taste Receptor Genes Are Associated with Snacking Patterns of Preschool-Aged Children in the Guelph Family Health Study: A Pilot Study

    Directory of Open Access Journals (Sweden)

    Elie Chamoun

    2018-01-01

    Full Text Available Snacking is an integral component of eating habits in young children that is often overlooked in nutrition research. While snacking is a substantial source of calories in preschoolers’ diets, there is limited knowledge about the factors that drive snacking patterns. The genetics of taste may help to better understand the snacking patterns of children. The rs1761667 single nucleotide polymorphism (SNP in the CD36 gene has been linked to fat taste sensitivity, the rs35874116 SNP in the TAS1R2 gene has been related to sweet taste preference, and the rs713598 SNP in the TAS2R38 gene has been associated with aversion to bitter, green leafy vegetables. This study seeks to determine the cross-sectional associations between three taste receptor SNPs and snacking patterns among preschoolers in the Guelph Family Health Study. Preschoolers’ snack quality, quantity, and frequency were assessed using three-day food records and saliva was collected for SNP genotyping (n = 47. Children with the TT genotype in TAS1R2 consumed snacks with significantly more calories from sugar, and these snacks were consumed mostly in the evening. Total energy density of snacks was highest in the CC and CG genotypes compared to the GG genotype in TAS2R38, and also greater in the AA genotype in CD36 compared to G allele carriers, however this difference was not individually attributable to energy from fat, carbohydrates, sugar, or protein. Genetic variation in taste receptors may influence snacking patterns of preschoolers.

  11. P2Y purinoceptor and nucleotide receptor-induced relaxation of precontracted bovine aortic collateral artery rings: differential sensitivity to suramin and indomethacin.

    Science.gov (United States)

    Wilkinson, G F; McKechnie, K; Dainty, I A; Boarder, M R

    1994-02-01

    We have examined a series of adenine nucleotides and UTP for their ability to cause relaxation of precontracted bovine aortic collateral artery rings. The overall rank order of agonist potency for relaxation was 2-methylthioadenosine 5'-triphosphate (2MeSATP) > adenosine 5'-O-(3-thiotriphosphate) (ATP gamma S) > UTP > ADP > ATP. These responses were endothelium-dependent. Interaction studies showed that responses to the selective P2Y purinoceptor agonist 2MeSATP, and to ADP, were mediated by different receptors from those mediating responses to UTP. Suramin, a P2 purinoceptor antagonist that binds to diverse sites for ATP, produced a concentration-dependent shift in the agonist concentration-effect curve to 2MeSATP, with a pKB of 5.45 +/- 0.15 and a slope of 0.94 +/- 0.09. Suramin produced a small, nonsignificant shift in the UTP response curve and had little effect on responses to ATP. Indomethacin (2.8 x 10(-6) M) had no effect on concentration-effect curves to UTP but almost abolished the relaxations produced by 2MeSATP and ADP. The concentration-effect curves to ATP and ATP gamma S showed a significant (P effects of indomethacin show that these receptors differentially modulate the release of cyclooxygenase-derived mediators of relaxation.

  12. Purinergic receptors in the endocrine and exocrine pancreas

    DEFF Research Database (Denmark)

    Novak, I

    2008-01-01

    The pancreas is a complex gland performing both endocrine and exocrine functions. In recent years there has been increasing evidence that both endocrine and exocrine cells possess purinergic receptors, which influence processes such as insulin secretion and epithelial ion transport. Most commonly......, there is also evidence for other P2 and adenosine receptors in beta cells (P2Y(2), P2Y(4), P2Y(6), P2X subtypes and A(1) receptors) and in glucagon-secreting alpha cells (P2X(7), A(2) receptors). In the exocrine pancreas, acini release ATP and ATP-hydrolysing and ATP-generating enzymes. P2 receptors...

  13. Guanine nucleotide regulation of muscarinic receptor-mediated inositol phosphate formation in permeabilized 1321N1 cells

    International Nuclear Information System (INIS)

    Orellana, S.A.; Trilivas, I.; Brown, J.H.

    1986-01-01

    Carbachol and guanine nucleotides stimulate formation of the ( 3 H)inositol phosphates IP, IP2, and IP3 in saponin-permeabilized monolayers labelled with ( 3 H) inositol. Carbachol alone has little effect on formation of the ( 3 H) inositol phosphates (IPs), but GTPγS causes synergistic accumulation of ( 3 H)IPs to levels similar to those seen in intact cells. GTP, GppNHp, and GTPγS all support formation of the ( 3 H)IPs, with or without hormone, but GTPγS is the most effective. In the presence of GTPγS, the effect of carbachol is dose-dependent. Half-maximal and maximal accumulation of the ( 3 H)IPs occur at ∼ 5 μM and ∼ 100 μM carbachol, respectively; values close to those seen in intact cells. GTPγS alone stimulates formation of the ( 3 H)IPs after a brief lag time. The combination of GTPγS and carbachol both increases the rate of, and decreases the lag in, formation of the ( 3 H)IPs. LiCl increases ( 3 H)IP and IP2, but not IP3, accumulation; while 2,3-diphosphoglycerate substantially increases that of ( 3 H)IP3. GTPγS and carbachol cause formation of ( 3 H)IPs in the absence of Ca ++ , but formation induced by GTPγS with or without carbachol is Ca ++ -sensitive over a range of physiological concentrations. Although carbachol, Ca ++ , and GTPγS all have effects on formation of ( 3 H)IPs, GTPγS appears to be a primary and obligatory regulator of phosphoinositide hydrolysis in the permeabilized 1321N1 astrocytoma cell

  14. Invasive Streptococcus mutans induces inflammatory cytokine production in human aortic endothelial cells via regulation of intracellular toll-like receptor 2 and nucleotide-binding oligomerization domain 2.

    Science.gov (United States)

    Nagata, E; Oho, T

    2017-04-01

    Streptococcus mutans, the primary etiologic agent of dental caries, can gain access to the bloodstream and has been associated with cardiovascular disease. However, the roles of S. mutans in inflammation in cardiovascular disease remain unclear. The aim of this study was to examine cytokine production induced by S. mutans in human aortic endothelial cells (HAECs) and to evaluate the participation of toll-like receptors (TLRs) and cytoplasmic nucleotide-binding oligomerization domain (NOD) -like receptors in HAECs. Cytokine production by HAECs was determined using enzyme-linked immunosorbent assays, and the expression of TLRs and NOD-like receptors was evaluated by real-time polymerase chain reaction, flow cytometry and immunocytochemistry. The involvement of TLR2 and NOD2 in cytokine production by invaded HAECs was examined using RNA interference. The invasion efficiencies of S. mutans strains were evaluated by means of antibiotic protection assays. Five of six strains of S. mutans of various serotypes induced interleukin-6, interleukin-8 and monocyte chemoattractant protein-1 production by HAECs. All S. mutans strains upregulated TLR2 and NOD2 mRNA levels in HAECs. Streptococcus mutans Xc upregulated the intracellular TLR2 and NOD2 protein levels in HAECs. Silencing of the TLR2 and NOD2 genes in HAECs invaded by S. mutans Xc led to a reduction in interleukin-6, interleukin-8 and monocyte chemoattractant protein-1 production. Cytokine production induced by invasive S. mutans via intracellular TLR2 and NOD2 in HAECs may be associated with inflammation in cardiovascular disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. The regulation of aortic endothelial cells by purines and pyrimidines involves co-existing P2y-purinoceptors and nucleotide receptors linked to phospholipase C.

    Science.gov (United States)

    Wilkinson, G F; Purkiss, J R; Boarder, M R

    1993-03-01

    1. We have examined the phospholipase C responses in bovine aortic endothelial cells to purines (ATP, ADP and analogues) and the pyrimidine, uridine triphosphate (UTP). 2. The cells responded to purines in a manner consistent with the presence of P2y purinoceptors; both 2-methylthioadenosine 5'-triphosphate (2MeSATP) and adenosine 5'-0-(2-thiodiphosphate) (ADP beta S) were potent agonists (EC50 0.41 microM and 0.85 microM respectively) while beta, gamma-methylene ATP at 300 microM was not. 3. The cells also responded to UTP. The maximal response to UTP was less than that for either 2MeSATP and ADP beta S while adenosine 5'-0-(3-thiotriphosphate) (ATP gamma S) gave the largest maximal response. 4. The concentration-effect curve to UTP was additive in the presence of either 2MeSATP or ADP beta S. However, the concentration-effect curves to ATP gamma S reached the same maximum in the presence or absence of UTP. 5. Suramin, at concentrations between 10 microM and 100 microM was a competitive antagonist for the response to ADP beta S and 2MeSATP but not the response to UTP. 6. The results show that there are two separate, co-existing, receptor populations: P2y-purinoceptors (responding to purines) and nucleotide receptors (responding to both purines and pyrimidines). We conclude that purines such as ATP/ADP may regulate aortic endothelial cells by interacting with two phospholipase C-linked receptors.

  16. Polyamidoamine (PAMAM) Dendrimer Conjugates of Clickable Agonists of the A3 Adenosine Receptor and Coactivation of the P2Y14 Receptor by a Tethered Nucleotide

    Energy Technology Data Exchange (ETDEWEB)

    Tosh, Dilip, K. [National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health; Yoo, Lena S. [National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health; Chinn, Moshe [National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health; Hong, Kunlun [ORNL; Kilbey, II, S Michael [ORNL; Barrett, Matthew O. [University of North Carolina School of Medicine; Fricks, Ingrid P. [University of North Carolina School of Medicine; Harden, T. Kendall [University of North Carolina School of Medicine; Jacobson, Kenneth A. [National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health

    2010-01-01

    We previously synthesized a series of potent and selective A{sub 3} adenosine receptor (AR) agonists (North-methanocarba nucleoside 5{prime}-uronamides) containing dialkyne groups on extended adenine C2 substituents. We coupled the distal alkyne of a 2-octadiynyl nucleoside by Cu(I)-catalyzed 'click' chemistry to azide-derivatized G4 (fourth-generation) PAMAM dendrimers to form triazoles. A{sub 3}AR activation was preserved in these multivalent conjugates, which bound with apparent Ki of 0.1-0.3 nM. They were substituted with nucleoside moieties, solely or in combination with water-solubilizing carboxylic acid groups derived from hexynoic acid. A comparison with various amide-linked dendrimers showed that triazole-linked conjugates displayed selectivity and enhanced A{sub 3}AR affinity. We prepared a PAMAM dendrimer containing equiproportioned peripheral azido and amino groups for conjugation of multiple ligands. A bifunctional conjugate activated both A{sub 3} and P2Y{sub 14} receptors (via amide-linked uridine-5{prime}-diphosphoglucuronic acid), with selectivity in comparison to other ARs and P2Y receptors. This is the first example of targeting two different GPCRs with the same dendrimer conjugate, which is intended for activation of heteromeric GPCR aggregates. Synergistic effects of activating multiple GPCRs with a single dendrimer conjugate might be useful in disease treatment.

  17. Role of P2 Receptors as Modulators of Rat Eosinophil Recruitment in Allergic Inflammation.

    Directory of Open Access Journals (Sweden)

    Anael Viana Pinto Alberto

    Full Text Available ATP and other nucleotides are released from cells through regulated pathways or following the loss of plasma membrane integrity. Once outside the cell, these compounds can activate P2 receptors: P2X ionotropic receptors and G protein-coupled P2Y receptors. Eosinophils represent major effector cells in the allergic inflammatory response and they are, in fact, associated with several physiological and pathological processes. Here we investigate the expression of P2 receptors and roles of those receptors in murine eosinophils. In this context, our first step was to investigate the expression and functionality of the P2X receptors by patch clamping, our results showed a potency ranking order of ATP>ATPγS> 2meSATP> ADP> αβmeATP> βγmeATP>BzATP> UTP> UDP>cAMP. This data suggest the presence of P2X1, P2X2 and P2X7. Next we evaluate by microfluorimetry the expression of P2Y receptors, our results based in the ranking order of potency (UTP>ATPγS> ATP > UDP> ADP >2meSATP > αβmeATP suggests the presence of P2Y2, P2Y4, P2Y6 and P2Y11. Moreover, we confirmed our findings by immunofluorescence assays. We also did chemotaxis assays to verify whether nucleotides could induce migration. After 1 or 2 hours of incubation, ATP increased migration of eosinophils, as well as ATPγS, a less hydrolysable analogue of ATP, while suramin a P2 blocker abolished migration. In keeping with this idea, we tested whether these receptors are implicated in the migration of eosinophils to an inflammation site in vivo, using a model of rat allergic pleurisy. In fact, migration of eosinophils has increased when ATP or ATPγS were applied in the pleural cavity, and once more suramin blocked this effect. We have demonstrated that rat eosinophils express P2X and P2Y receptors. In addition, the activation of P2 receptors can increase migration of eosinophils in vitro and in vivo, an effect blocked by suramin.

  18. Association Between the Estrogen Receptor Beta (ESR2) Rs1256120 Single Nucleotide Polymorphism and Adolescent Idiopathic Scoliosis: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Zhao, Linlu; Roffey, Darren M; Chen, Suzan

    2017-06-01

    A systematic review and meta-analysis. The aim of this study was to assess and synthesize the current evidence on the association between the rs1256120 single nucleotide polymorphism (SNP) of the estrogen receptor beta gene (ESR2) and adolescent idiopathic scoliosis (AIS). Hormonal disturbance has been postulated as a potential etiological factor in the development of AIS. As estrogen receptors are important mediators of estrogen response, mutations in these genes, including rs1256120 of ESR2, have been chosen as susceptibility candidates for AIS predisposition. The association of rs1256120 with AIS has been investigated in several recent studies, but showed conflicting evidence. We conducted a systematic review to evaluate the strength of this body of evidence and quantitative synthesis to examine sources of heterogeneity. This study conformed to PRISMA guidelines. Using a sensitive search strategy, PubMed (MEDLINE), EMBASE, and HuGE Literature Finder databases were searched to identify relevant studies for inclusion in the systematic review and meta-analysis. Risk of bias was assessed using a modified Newcastle-Ottawa Scale. The inverse variance model was used to calculate summary odds ratios (ORs) and corresponding 95% confidence intervals (CIs) for the allelic (C vs. T) and genotypic comparisons. Planned subgroup and sensitivity analyses were performed. Three studies were included for systematic review and meta-analysis (n = 1264 AIS cases and n=1020 controls). A null relationship was found between rs1256120 and AIS (allelic OR = 1.20, 95% CI: 0.81-1.78, P = 0.36, I = 84.9%), with the first reported association likely to be false-positive and contributing substantially to heterogeneity. Findings from the systematic review and meta-analysis suggest that rs1256120 of ESR2 is unlikely to be a predisposing or disease-modifying genetic risk factor for AIS. 2.

  19. G16R single nucleotide polymorphism but not haplotypes of the ß2-adrenergic receptor gene alters cardiac output in humans

    DEFF Research Database (Denmark)

    Rokamp, Kim Z; Staalsø, Jonatan M; Gartmann, Martin

    2013-01-01

    Variation in genes encoding the ß2-adrenergic receptor (ADRB2) and angiotensin-converting enzyme (ACE) may influence Q¿ (cardiac output). The 46G>A (G16R) SNP (single nucleotide polymorphism) has been associated with ß2-mediated vasodilation, but the effect of ADRB2 haplotypes on Q¿ has not been...... studied. Five SNPs within ADRB2 (46G>A, 79C>G, 491C>T, 523C>A and 1053G>C by a pairwise tagging principle) and the I/D (insertion/deletion) polymorphism in ACE were genotyped in 143 subjects. Cardiovascular variables were evaluated by the Model flow method at rest and during incremental cycling exercise...... V¿O2 (oxygen uptake) in G16G subjects, but the increase was 0.5 (0.0-0.9) l/min lower in Arg16 carriers (P=0.035). A similar effect size was observed for the Arg16 haplotypes ACCCG and ACCCC. No interaction was found between ADRB2 and ACE polymorphisms. During exercise, the increase in Q¿ was 0...

  20. Homozygosity of single nucleotide polymorphisms in the 3' region of the canine estrogen receptor 1 gene is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas.

    Science.gov (United States)

    Pathirana, Indunil N; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2011-06-01

    Differences in the distribution of single nucleotide polymorphisms (SNPs) and haplotypes in the estrogen receptor α gene (ESR1) were examined in Miniature Dachshunds (n = 48), Chihuahuas (n = 20) and Toy Poodles (n = 18). Five DNA fragments located in the 40-kb region at the 3' end of ESR1 were amplified by polymerase chain reaction and were directly sequenced. We compared allele, genotype and estimated haplotype frequencies at each SNP in the 3' end of ESR1 for these three breeds of small dog. The frequency of the major allele and the genotype frequency of the major allele homozygotes, were significantly higher in Toy Poodles for five SNPs (SNP #5, #14-17) than in Miniature Dachshunds, and significantly higher in Toy Poodles than Chihuahuas for three SNPs (SNP #15-17). A common haplotype block was identified in an approximately 20-kb region encompassing four SNPs (SNPs # 14-17). The frequencies of the most abundant estimated haplotype (GTTG) and GTTG homozygotes were significantly higher in Toy Poodles than in the other two breeds. These results imply that homozygosity for the allele, genotype and haplotype distribution within the block at the 3' end of ESR1 is greater in Toy Poodles than in Miniature Dachshunds and Chihuahuas. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

  1. Single-nucleotide polymorphisms in Toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus.

    Science.gov (United States)

    Janardhanan, Jeshina; Joseph Martin, Sherry; Astrup, Elisabeth; Veeramanikandan, R; Aukrust, Pål; Abraham, Ooriapadickal C; Varghese, George M

    2013-11-01

    Scrub typhus is a highly prevalent bacterial infection in India and South Asia that is caused by Orientia tsutsugamushi. The innate immune response to infections is modulated by Toll-like receptors (TLRs) and heat shock proteins (HSPs). This study was done to assess the prevalence and possible association of TLR and HSP polymorphisms in scrub typhus. TLR4 Asp299Gly, TLR4 Thr399Ile, TLR2 Arg753Gln and HSP70-2 A1267G are single-nucleotide polymorphisms (SNPs) that may modulate their activities, and these SNPs were assessed in 137 scrub typhus patients and 134 controls by PCR restriction fragment length polymorphism. We found that the two TLR4 mutations, TLR4 D299G and TLR4T399I, were present in 19.5% and 22% of the study population, respectively, and was in significant linkage disequilibrium with a D' of 0.8. The TLR2 mutation was found to be rare, whereas the HSP A>G mutation was very common (77.5%). Compared with the controls, the prevalence of heterozygous genotype of the TLR4D299G SNP, but not any of the other SNPs, was significantly higher among scrub typhus patients. Further studies using a larger sample size and more candidate genes may better enable in determining the role of these associations in susceptibility and severity of scrub typhus.

  2. Single nucleotide polymorphism in toll-like receptor 6 is associated with a decreased risk for ureaplasma respiratory tract colonization and bronchopulmonary dysplasia in preterm infants.

    Science.gov (United States)

    Winters, Alexandra H; Levan, Tricia D; Vogel, Stefanie N; Chesko, Kirsty L; Pollin, Toni I; Viscardi, Rose M

    2013-08-01

    Ureaplasma spp. respiratory tract colonization is a risk factor for bronchopulmonary dysplasia (BPD) in preterm infants, but differences in host susceptibility have not been elucidated. We hypothesized that variants in genes regulating the innate immune response are associated with altered risk for Ureaplasma spp. respiratory colonization and BPD in preterm infants. Twenty-four tag single nucleotide polymorphisms (SNPs) from Toll-like receptor (TLR)1, TLR2, TLR4 and TLR6 were assayed in 298 infants Ureaplasma spp. and were evaluated for BPD. The majority of subjects (N = 205 [70%]) were African-American. One hundred ten (37%) were Ureaplasma positive. Four SNPs in TLR2 and TLR6 were significantly associated with Ureaplasma respiratory tract colonization. Single SNPs in TLR2, TLR4 and TLR6 were associated with BPD. TLR6 SNP rs5743827 was associated with both a decreased risk for Ureaplasma respiratory tract colonization and decreased risk for BPD (odds ratio: 0.54 [0.34-0.86] and odds ratio: 0.54 [0.31-0.95], respectively). There was a significant additive interaction between Ureaplasma colonization and genotype at TLR6 SNP rs5743827 (Padditive = 0.023), with an attributable proportion due to interaction of 0.542. Polymorphisms in host defense genes may alter susceptibility to Ureaplasma infection and severity of the inflammatory response contributing to BPD. These observations implicate host genetic susceptibility as a major factor in BPD pathogenesis in Ureaplasma-infected preterms.

  3. ARF6 Activated by the LHCG Receptor through the Cytohesin Family of Guanine Nucleotide Exchange Factors Mediates the Receptor Internalization and Signaling*

    Science.gov (United States)

    Kanamarlapudi, Venkateswarlu; Thompson, Aiysha; Kelly, Eamonn; López Bernal, Andrés

    2012-01-01

    The luteinizing hormone chorionic gonadotropin receptor (LHCGR) is a Gs-coupled GPCR that is essential for the maturation and function of the ovary and testis. LHCGR is internalized following its activation, which regulates the biological responsiveness of the receptor. Previous studies indicated that ADP-ribosylation factor (ARF)6 and its GTP-exchange factor (GEF) cytohesin 2 regulate LHCGR internalization in follicular membranes. However, the mechanisms by which ARF6 and cytohesin 2 regulate LHCGR internalization remain incompletely understood. Here we investigated the role of the ARF6 signaling pathway in the internalization of heterologously expressed human LHCGR (HLHCGR) in intact cells using a combination of pharmacological inhibitors, siRNA and the expression of mutant proteins. We found that human CG (HCG)-induced HLHCGR internalization, cAMP accumulation and ARF6 activation were inhibited by Gallein (βγ inhibitor), Wortmannin (PI 3-kinase inhibitor), SecinH3 (cytohesin ARF GEF inhibitor), QS11 (an ARF GAP inhibitor), an ARF6 inhibitory peptide and ARF6 siRNA. However, Dynasore (dynamin inhibitor), the dominant negative mutants of NM23-H1 (dynamin activator) and clathrin, and PBP10 (PtdIns 4,5-P2-binding peptide) inhibited agonist-induced HLHCGR and cAMP accumulation but not ARF6 activation. These results indicate that heterotrimeric G-protein, phosphatidylinositol (PI) 3-kinase (PI3K), cytohesin ARF GEF and ARF GAP function upstream of ARF6 whereas dynamin and clathrin act downstream of ARF6 in the regulation of HCG-induced HLHCGR internalization and signaling. In conclusion, we have identified the components and molecular details of the ARF6 signaling pathway required for agonist-induced HLHCGR internalization. PMID:22523074

  4. Analysis of single nucleotide polymorphisms in the 3' region of the estrogen receptor 1 gene in normal and cryptorchid Miniature Dachshunds and Chihuahuas.

    Science.gov (United States)

    Pathirana, Indunil Nishantha; Tanaka, Kakeru; Kawate, Noritoshi; Tsuji, Makoto; Kida, Kayoko; Hatoya, Shingo; Inaba, Toshio; Tamada, Hiromichi

    2010-08-01

    This study was performed to examine the distribution of single nucleotide polymorphisms (SNPs) and estimated haplotypes in the canine estrogen receptor (ER) alpha gene (ESR1) and the association of them with different phenotypes of cryptorchidism (CO) in Miniature Dachshunds and Chihuahuas. Forty CO and 68 normal dogs were used, and CO was classified into unilateral (UCO; n=33) and bilateral CO (BCO; n=5) or into abdominal (ACO; n=16) and inguinal CO (ICO; n=22). Thirteen DNA fragments located in the 70-kb region at the 3' end of ESR1 were amplified by PCR and sequenced to examine 13 SNPs (#1-#13) reported in a canine SNP database. Ten SNPs (#1-#4, #7, #8, #10-#13) were not polymorphic, and 5 new SNPs (#14-#18) were discovered. A common haplotype block in normal, CO and CO phenotypes was identified for an approximately 20-kb region encompassing 4 SNPs (#14-#17). Allele, genotype and haplotype frequencies in CO without classification by phenotype and also in UCO, ACO and ICO phenotypes were not statistically different from the normal group. Significant differences in genotype frequencies and homozygosity for the estimated GTTG haplotype within the block were observed in BCO compared with the normal group, although the number of BCO animals was small. Our results demonstrate that the examined SNPs and haplotypes in the 3' end of canine ESR1 are not associated with unilateral, abdominal and inguinal CO phenotypes and CO per se in Miniature Dachshunds and Chihuahuas. Further studies are necessary to suggest a clear association between the ESR1 SNPs and bilateral CO in dogs.

  5. Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent

    Directory of Open Access Journals (Sweden)

    Miao Yu

    2017-01-01

    Full Text Available Purpose. Dental caries is a multifactorial infectious disease. In this study, we investigated whether single nucleotide polymorphisms (SNPs in vitamin D receptor (VDR gene were associated with susceptibility to permanent tooth caries in Chinese adolescents. Method. A total of 200 dental caries patients and 200 healthy controls aged 12 years were genotyped for VDR gene polymorphisms using the PCR-restriction fragment length polymorphism (PCR-RFLP assay. All of them were examined for their oral and dental status with the WHO criteria, and clinical information such as the Decayed Missing Filled Teeth Index (DMFT was evaluated. Genomic DNA was extracted from the buccal epithelial cells. The four polymorphic SNPs (Bsm I, Taq I, Apa I, and Fok I in VDR were assessed for both genotypic and phenotypic susceptibilities. Results. Among the four examined VDR gene polymorphisms, the increased frequency of the CT and CC genotype of the Fok I VDR gene polymorphism was associated with dental caries in 12-year-old adolescent, compared with the controls (X2 = 17.813, p≤0.001. Moreover, Fok I polymorphic allele C frequency was significantly increased in the dental caries cases, compared to the controls (X2 = 14.144, p≤0.001, OR = 1.730, 95% CI = 1.299–2.303. However, the other three VDR gene polymorphisms (Bsm I, Taq I, and Apa I showed no statistically significant differences in the caries groups compared with the controls. Conclusion. VDR-Fok I gene polymorphisms may be associated with susceptibility to permanent tooth caries in Chinese adolescent.

  6. Association of single nucleotide polymorphisms in a glutamate receptor gene (GRM8) with theta power of event-related oscillations and alcohol dependence.

    Science.gov (United States)

    Chen, Andrew C H; Tang, Yongqiang; Rangaswamy, Madhavi; Wang, Jen C; Almasy, Laura; Foroud, Tatiana; Edenberg, Howard J; Hesselbrock, Victor; Nurnberger, John; Kuperman, Samuel; O'Connor, Sean J; Schuckit, Marc A; Bauer, Lance O; Tischfield, Jay; Rice, John P; Bierut, Laura; Goate, Alison; Porjesz, Bernice

    2009-04-05

    Evidence suggests the P3 amplitude of the event-related potential and its underlying superimposed event-related oscillations (EROs), primarily in the theta (4-5 Hz) and delta (1-3 Hz) frequencies, as endophenotypes for the risk of alcoholism and other disinhibitory disorders. Major neurochemical substrates contributing to theta and delta rhythms and P3 involve strong GABAergic, cholinergic and glutamatergic system interactions. The aim of this study was to test the potential associations between single nucleotide polymorphisms (SNPs) in glutamate receptor genes and ERO quantitative traits. GRM8 was selected because it maps at chromosome 7q31.3-q32.1 under the peak region where we previously identified significant linkage (peak LOD = 3.5) using a genome-wide linkage scan of the same phenotype (event-related theta band for the target visual stimuli). Neural activities recorded from scalp electrodes during a visual oddball task in which rare target elicited P3s were analyzed in a subset of the Collaborative Study on the Genetics of Alcoholism (COGA) sample comprising 1,049 Caucasian subjects from 209 families (with 472 DSM-IV alcohol dependent individuals). The family-based association test (FBAT) detected significant association (P power to target visual stimuli, and also with alcohol dependence, even after correction for multiple comparisons by false discovery rate (FDR). Our results suggest that variation in GRM8 may be involved in modulating event-related theta oscillations during information processing and also in vulnerability to alcoholism. These findings underscore the utility of electrophysiology and the endophenotype approach in the genetic study of psychiatric disorders. (c) 2008 Wiley-Liss, Inc.

  7. Single nucleotide polymorphisms at interleukin (IL-1β + 3954 and vitamin D receptor (VDR TaqI in chronic periodontitis patients: A pilot study in North Indian population

    Directory of Open Access Journals (Sweden)

    Anika Daing

    2015-01-01

    Full Text Available Background: Increasing evidences support the role of genetic factors in susceptibility to chronic periodontitis. The aim of the present pilot study was to explore the association of two potential single nucleotide polymorphisms (SNPs: Interleukin (IL-1β + 3954 (rs1143634, C > T and vitamin D receptor (VDR TaqI (rs731236, T > C with chronic periodontitis in a North Indian population. Materials and Methods: Twenty-eight chronic periodontitis subjects and 47 periodontally healthy controls were recruited. Individual samples of venous blood were obtained from each subject. Genotyping was done by polymerase chain reaction, followed by restriction fragment length polymorphism (PCR-RFLP. Logistic regression and chi square test were used for genetic association analysis and a P value less than 0.05 taken as statistical significance. Statistical Analysis Used: Chi square test and odds ratio (OR was used. Results: Genotypes and alleles of SNP IL-1β + 3954 did not show a significant association (P > 0.05 with chronic periodontitis. Genotype CC and allele C of VDR TaqI were significantly associated with a higher risk for chronic periodontitis as compared to subjects with TT genotype (CC/TT OR = 4.615; 95% confidence interval [CI]: 1.17 to 18.078 P = 0.028 and allele T (C/T OR = 2.423; 95% CI: 1.179 to 4.980. Conclusion: In North Indian population, genotype CC and allele C of VDR TaqI were associated with risk of chronic periodontitis. No significant correlation was found for IL-1β + 3954 polymorphism and chronic periodontitis.

  8. Identification of single nucleotide polymorphisms in the bovine Toll-like receptor 1 gene and association with health traits in cattle

    Directory of Open Access Journals (Sweden)

    Russell Christopher D

    2012-03-01

    Full Text Available Abstract Bovine mastitis remains the most common and costly disease of dairy cattle worldwide. A complementary control measure to herd hygiene and vaccine development would be to selectively breed cattle with greater resistance to mammary infection. Toll-like receptor 1 (TLR1 has an integral role for the initiation and regulation of the immune response to microbial pathogens, and has been linked to numerous inflammatory diseases. The objective of this study was to investigate whether single nucleotide polymorphisms (SNPs within the bovine TLR1 gene (boTLR1 are associated with clinical mastitis (CM. Selected boTLR1 SNPs were analysed within a Holstein Friesian herd. Significant associations were found for the tagging SNP -79 T > G and the 3'UTR SNP +2463 C > T. We observed favourable linkage of reduced CM with increased milk fat and protein, indicating selection for these markers would not be detrimental to milk quality. Furthermore, we present evidence that some of these boTLR1 SNPs underpin functional variation in bovine TLR1. Animals with the GG genotype (from the tag SNP -79 T > G had significantly lower boTLR1 expression in milk somatic cells when compared with TT or TG animals. In addition, stimulation of leucocytes from GG animals with the TLR1-ligand Pam3csk4 resulted in significantly lower levels of CXCL8 mRNA and protein. SNPs in boTLR1 were significantly associated with CM. In addition we have identified a bovine population with impaired boTLR1 expression and function. This may have additional implications for animal health and warrants further investigation to determine the suitability of identified SNPs as markers for disease susceptibility.

  9. A Molecular Case-Control Study on the Association of Melatonin Hormone and rs#10830963 Single Nucleotide Polymorphism in its Receptor MTNR1B Gene with Breast Cancer

    Directory of Open Access Journals (Sweden)

    Nadia A Abd El Moneim

    2015-01-01

    Full Text Available Background: The main function of the pineal hormone melatonin which is mediated via its two receptors, MTNR1A and MTNR1B, is to mediate dark signals in addition to anti-oxidation, immune system enhancement, protection from radiation, and anti-cancer functions. A common single nucleotide polymorphism in the MTNR1B gene is rs#10830963, which is well known as a risk factor for type 2 diabetes mellitus. This study intends to figure out the role of melatonin and its receptor MTNR1B gene rs#10830963 polymorphism in breast cancer incidence, diagnosis and prognosis. Methods: This study included 43 females with breast cancer and 45 apparently normal healthy females. Restriction fragment length polymorphism-PCR was used for amplification and genotyping of the MTNR1B gene rs#10830963 polymorphism in whole blood. Serum melatonin levels were measured using a ready-for-use radioimmunoassay kit. Results: For the MTNR1B gene rs#10830963 polymorphism, we observed a significantly higher GG genotype frequency among cases (72.1% than controls (13.3%, with a diagnostic sensitivity of 83.78% and specificity of 76.47%. The cases had a frequency of 11.6% for the CC genotype and 16.3% for the CG genotype which was significantly lower compared to controls that had a 44.4% frequency of the CC genotype and 42.2% frequency of the CG genotype. The GG genotype had a significant association with larger tumor volume (P=0.048. Serum melatonin levels were significantly lower among breast cancer patients than controls. Using the ROC curve analysis, serum melatonin showed a significant AUC (72.6%, P39.5 pg/ml. Conclusion: The risk for breast cancer incidence increased as the serum levels of melatonin decreased and in females homozygous for the G allele (GG genotype of the MTNR1B gene rs#10830963 polymorphism. The GG genotype was found to be associated with increased breast tumor volume as a marker of a poor prognosis breast cancer.

  10. A preliminary study on the association of single nucleotide polymorphisms of interleukin 4 (IL4, IL13, IL4 receptor alpha (IL4Rα & Toll-like receptor 4 (TLR4 genes with asthma in Indian adults

    Directory of Open Access Journals (Sweden)

    Parisa Davoodi

    2015-01-01

    Full Text Available Background & objectives: Interleukin 4 (IL4 and IL13 genes are believed to be responsible for inflammation of the airways in asthmatics. These share a common receptor component called IL4Rα which is another potentially important candidate gene linked to asthma phenotypes. Another gene Toll-like receptor 4 (TLR4 might affect the incidence or progression of asthma through the expression of proinflammatory genes. Several single nucleotide polymorphisms (SNPs in IL4, IL13, IL4Rα and TLR4 have been reported to be linked to asthma or related phenotypes in several ethnic populations using linkage studies and association studies. However, the results have not been consistent. We investigated five SNPs (C-589T and C-33T of IL4, G+2044A of IL13, A+1902G of IL4Rα, and A+896G of TLR4 in patients with adult onset asthma to evaluate their role in manifestation and severity of asthma. Methods: Adult (>18 yr of age patients with asthma (n=100 and healthy controls (n=50 were included in the study. Genotyping was performed using sequenom MassARRAY technology. Results: The mutant alleles of the C-589T and C-33T SNPs in the promoter region of IL4 were present in 4 per cent patients with asthma but absent from the control group suggesting that the variations in IL4 may contribute to asthma occurrence. The SNPs of other genes were seen in both controls and patients. Interpretation & conclusions: The results suggest the possible association between the genetic distribution of C-589T and C-33T SNPs of IL4 with asthma in Indian adults.

  11. Association between Single Nucleotide Polymorphisms in Gamma-Aminobutyric Acid B Receptor, Insulin Receptor Substrate-1, and Hypocretin Neuropeptide Precursor Genes and Susceptibility to Obstructive Sleep Apnea Hypopnea Syndrome in a Chinese Han Population.

    Science.gov (United States)

    Li, Zhijun; Tang, Tingyu; Du, Jianzong; Wu, Wenjuan; Zhou, Xiaoxi; Qin, Guangyue

    2016-01-01

    To investigate genotype-phenotype changes between rs29230 in γ-aminobutyric acid B receptor (GABBR1), rs1801278 in insulin receptor substrate-1 (IRS-1), and rs9902709 in hypocretin neuropeptide precursor (HCRT) and obstructive sleep apnea hypopnea syndrome (OSAHS) in Chinese Han individuals. A total of 130 patients with OSAHS and 136 age- and gender-matched healthy controls were enrolled in this study. A brief description of DNA extraction and genotyping is given. Multivariate unconditional logistic regression analysis adjusted for gender and age was used to estimate the associations of single nucleotide polymorphisms (SNPs) rs29230 (GABBR1), rs1801278 (IRS-1), and rs9902709 (HCRT) with OSAHS risk. Subgroup analysis was performed to evaluate differences in these SNPs among subgroups according to gender, body mass index (BMI), and severity of disease. Genotype and allele frequencies of rs29230 were significantly different between cases and controls (p = 0.0205 and p = 0.0191, respectively; odds ratio = 0.493, 95% confidence interval = 0.271-0.896), especially for male patients (p = 0.0259 and p = 0.0202, respectively). Subgroup analysis according to BMI also revealed a significant allele difference for rs29230 between cases and controls in the overweight subgroup (p = 0.0333). Furthermore, allele and genotype frequencies of rs1801278 showed significant differences between cases and controls (p = 0.0488 and p = 0.0471, respectively). However, no association was observed between rs9902709 and OSAHS risk (p = 0.2762), and no differences were identified in other subgroups. In this study, there was an association between variants of rs29230 and rs1801278 and OSAHS risk in the Chinese Han population but not for rs9902709. © 2016 S. Karger AG, Basel.

  12. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  13. Regulation of brain capillary endothelial cells by P2Y receptors coupled to Ca2+, phospholipase C and mitogen-activated protein kinase.

    Science.gov (United States)

    Albert, J L; Boyle, J P; Roberts, J A; Challiss, R A; Gubby, S E; Boarder, M R

    1997-11-01

    activation at P2Y2 receptors. 2MeSATP gave a much smaller response with a lower potency than UTP. 7. These results are consistent with brain endothelial regulation by P2Y2 receptors coupled to phospholipase C, Ca2+ and MAPK; and by P2Y1-like (2MeSATP-sensitive) receptors which are linked to Ca2+ mobilization by a mechanism apparently independent of agonist stimulated Ins(1,4,5)P3 levels. A further response to ATP, acting at an undefined receptor, caused an increase in cyclic AMP levels in the presence of forskolin. The differential MAPK coupling of these receptors suggests that they exert fundamentally distinct influences over brain endothelial function.

  14. Characterization of a Ca2+ response to both UTP and ATP at human P2Y11 receptors: evidence for agonist-specific signaling.

    Science.gov (United States)

    White, Pamela J; Webb, Tania E; Boarder, Michael R

    2003-06-01

    Previous reports on heterologously-expressed human P2Y11 receptors have indicated that ATP, but not UTP, is an agonist stimulating both phosphoinositidase C and adenylyl cyclase. Consistent with these findings, we report that in 1321N1 cells expressing human P2Y11 receptors, UTP stimulation did not lead to accumulation of inositol(poly)phosphates under conditions in which ATP gave a robust, concentration-dependent effect. Unexpectedly, however, both UTP and ATP stimulated increases in cytosolic Ca2+ concentration ([Ca2+]c), with both nucleotides achieving similar EC50 and maximal responses. The responses to maximally effective concentrations of ATP and UTP were not additive. The [Ca2+]c increase in response to UTP was less dependent on extracellular Ca2+ than was the response to ATP. AR-C67085 (2-propylthio-beta,gamma-difluoromethylene-d-ATP, a P2Y11-selective agonist), adenosine 5'-O-(3-thiotriphosphate), and benzoyl ATP were all full agonists with potencies similar to those of ATP and UTP. In desensitization experiments, exposure to ATP resulted in loss of the UTP response; this response was more sensitive to desensitization than that of ATP. Pertussis toxin pretreatment attenuated the response to UTP but left the ATP response unaffected. The presence of 2-aminoethyl diphenylborate differentially affected the responses of ATP and UTP. No mRNA transcripts for P2Y2 or P2Y4 were detectable in the P2Y11-expressing cells. We conclude that UTP is a Ca2+-mobilizing agonist at P2Y11 receptors and that ATP and UTP acting at the same receptor recruit distinct signaling pathways. This example of agonist-specific signaling is discussed in terms of agonist trafficking and differential signal strength.

  15. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  16. The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein.

    Science.gov (United States)

    Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2015-10-09

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein*

    Science.gov (United States)

    Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2015-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038

  18. Functional genomics analysis of big data identifies novel peroxisome proliferator–activated receptor gamma target single nucleotide polymorphisms showing association with cardiometabolic outcomes

    Science.gov (United States)

    Background Cardiovascular disease and type 2 diabetes mellitus represent overlapping diseases where a large portion of the variation attributable to genetics remains unexplained. An important player in their pathogenesis is peroxisome proliferator–activated receptor gamma (PPARgamma) that is involve...

  19. Discovery of Nanomolar Desmuramylpeptide Agonists of the Innate Immune Receptor Nucleotide-Binding Oligomerization Domain-Containing Protein 2 (NOD2) Possessing Immunostimulatory Properties.

    Science.gov (United States)

    Gobec, Martina; Tomašič, Tihomir; Štimac, Adela; Frkanec, Ruža; Trontelj, Jurij; Anderluh, Marko; Mlinarič-Raščan, Irena; Jakopin, Žiga

    2018-04-12

    Muramyl dipeptide (MDP), a fragment of bacterial peptidoglycan, has long been known as the smallest fragment possessing adjuvant activity, on the basis of its agonistic action on the nucleotide-binding oligomerization domain-containing protein 2 (NOD2). There is a pressing need for novel adjuvants, and NOD2 agonists provide an untapped source of potential candidates. Here, we report the design, synthesis, and characterization of a series of novel acyl tripeptides. A pivotal structural element for molecular recognition by NOD2 has been identified, culminating in the discovery of compound 9, the most potent desmuramylpeptide NOD2 agonist to date. Compound 9 augmented pro-inflammatory cytokine release from human peripheral blood mononuclear cells in synergy with lipopolysaccharide. Furthermore, it was able to induce ovalbumin-specific IgG titers in a mouse model of adjuvancy. These findings provide deeper insights into the structural requirements of desmuramylpeptides for NOD2-activation and highlight the potential use of NOD2 agonists as adjuvants for vaccines.

  20. The Q705K and F359L Single-Nucleotide Polymorphisms of NOD-Like Receptor Signaling Pathway: Association with Chronic Pancreatitis, Pancreatic Cancer, and Periodontitis.

    Science.gov (United States)

    Miskiewicz, Andrzej; Szparecki, Grzegorz; Durlik, Marek; Rydzewska, Grażyna; Ziobrowski, Ireneusz; Górska, Renata

    2015-12-01

    The aim of this study was to establish the correlation between the occurrence of Q705K and F359L polymorphisms in patients diagnosed with pancreatic diseases and periodontal conditions of various degrees of severity. The above-mentioned genetic markers were assessed in patients with pancreatic cancer (n = 18) and chronic pancreatitis (n = 39) as well as in a healthy control group (n = 115). The established inclusion criteria were the following: Caucasian descent, non-smoking, and age range 20-80, with different levels of periodontitis activity according to S. Offenbacher's scale. The genotyping reactions were performed by means of an RT-PCR with the use of TaqMan(®) genotyping assay. Results of the study revealed that the state of periodontium was significantly worse in patients with chronic pancreatitis. The Q705K and F359L polymorphisms were associated with more advanced cases of periodontitis measured by clinical attachment level, whereas the Q705K was associated with intensified bleeding index. Furthermore, the F359L single-nucleotide polymorphism was significantly higher in the group with chronic pancreatitis (p periodontitis, pancreatic cancer, and chronic pancreatitis. These findings might constitute the basis for a new diagnostic and therapeutic approach.

  1. Association of peroxisome proliferator-activated receptor single-nucleotide polymorphisms and gene-gene interactions with the lipoprotein(a)

    Institute of Scientific and Technical Information of China (English)

    解惠坚

    2014-01-01

    Objective To examine the associations of 10 singlenucleotide polymorphisms(SNPs)in peroxisome proliferator-activated receptor(PPARs)gene with lipoprotein(a)level,and to investigate if there is gene-gene interaction among the SNPs on lipoprotein(a)level.Methods Totally 644 subjects(234 men and 410 women)were enrolled from Prevention of Multiple Metabolic Disorders and Metabolic Syndrome Study Cohort,which was an urban community survey study conducted in Jiangsu province.Ten SNPs in PPARα(rs135539,rs4253778,

  2. Single-nucleotide polymorphisms in the P2X7 receptor gene are associated with post-menopausal bone loss and vertebral fractures

    DEFF Research Database (Denmark)

    Rye Jørgensen, Niklas; Husted, Lise Bjerre; Skarratt, Kristen K

    2012-01-01

    to bone mass and fracture incidence in post-menopausal women. A total of 1694 women (aged 45-58) participating in the Danish Osteoporosis Prevention Study were genotyped for 12 functional P2X7 receptor variants. Bone mineral density was determined at baseline and after 10 years. In addition, vertebral...... had increased bone loss. In contrast, the Gln460Arg polymorphism was associated with protection against bone loss. The Ala348Thr polymorphism was associated with a lower vertebral fracture incidence 10 years after menopause. Finally, we developed a risk model, which integrated P2RX7 genotypes. Using...

  3. Circadian ATP Release in Organotypic Cultures of the Rat Suprachiasmatic Nucleus Is Dependent on P2X7 and P2Y Receptors

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Irena; Bhattacharya, Anirban; Ivetic, Milorad; Bendová, Z.; Zemková, Hana

    2018-01-01

    Roč. 9, Mar 6 (2018), č. článku 192. ISSN 1663-9812 R&D Projects: GA ČR(CZ) GA16-12695S; GA ČR(CZ) GBP304/12/G069; GA MŠk(CZ) LQ1604; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : suprachiasmatic nucleus * organotypic cultures * astrocytes * P2X7 receptor * P2Y1 receptor * P2Y2 receptor * pannexin-1 hemichannel * ATP release Subject RIV: FH - Neurology OBOR OECD: Neurosciences (including psychophysiology Impact factor: 4.400, year: 2016

  4. Impact of vascular endothelial growth factor (VEGF and vascular endothelial growth factor receptor (VEGFR single nucleotide polymorphisms on outcome in gastroenteropancreatic neuroendocrine neoplasms.

    Directory of Open Access Journals (Sweden)

    Rossana Berardi

    Full Text Available Angiogenesis represents a key event in cancer development, leading to local invasion e metastatization, and might be considered a basic feature in gastroenteropancreatic neuroendocrine neoplasms (GEP-NENs with a high expression of angiogenic molecules. We aimed to analyze the prognostic and predictive role of angiogenic factors in GEP-NENs through the analysis of single nucleotide polymorphisms (SNPs of VEGF-A, VEGFR2 and VEGFR3. The genomic DNA of 58 consecutive patients with GEP-NENs treated at our Institution was extracted from peripheral blood. Two SNPs were identified respectively in VEGF-A (rs2010963G>C, rs699947A>C, VEGFR-2 (rs2305948C>T, rs1870377T>A, and VEGFR-3 (rs307821T>C, rs307826C>A gene. Gene polymorphisms were determined by Real-Time PCR using TaqMan assays. Median age was 57 years (range 24-79 years; 32 patients were male and 77.5% of NENs were localized in the pancreas. The allele frequency of VEGFR-2 rs2305948T and of VEGF-A rs2010963C showed a trend of higher frequency than in general population (12.1% vs. 8.0% and 34.5% vs. 31.2%, respectively. Three out SNPs (VEGF-A rs699947C, VEGF-A rs2010963GC and VEGFR-3 rs307821C showed a correlation with an increased risk of disease relapse. Moreover median PFS changes according to the presence of 0-1 SNPs (20.7% of cases; 61.9 months, 2 SNPs (25.9%; 49.2 months and 3 SNPs (53.4%; 27.8 months (p = 0.034. Results suggest, for the first time, that specific SNPs in VEGF-A and VEGFR-3 correlate with poor prognosis in GEP-NENs. The identification of this new prognostic factor might be helpful in order to optimize the management of these heterogeneous neoplasms.

  5. Evaluation of human epidermal growth factor receptor 2 (HER2) single nucleotide polymorphisms (SNPs) in normal and breast tumor tissues and their link with breast cancer prognostic factors.

    Science.gov (United States)

    Furrer, Daniela; Lemieux, Julie; Côté, Marc-André; Provencher, Louise; Laflamme, Christian; Barabé, Frédéric; Jacob, Simon; Michaud, Annick; Diorio, Caroline

    2016-12-01

    Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with worse prognosis and decreased overall survival in breast cancer patients. The HER2 gene contains several polymorphisms; two of the best-characterized HER2 polymorphisms are Ile655Val and Ala1170Pro. The aim of this study was to evaluate the association between these two HER2 polymorphisms in normal breast and breast cancer tissues and known breast cancer prognostic factors in a retrospective cohort study of 73 women with non-metastatic HER2-positive breast cancer. HER2 polymorphisms were assessed in breast cancer tissue and normal breast tissue using TaqMan assay. Ala1170Pro polymorphism in normal breast tissue was associated with age at diagnosis (p = 0.007), tumor size (p = 0.004) and lymphovascular invasion (p = 0.06). Similar significant associations in cancer tissues were observed. No association between the Ile655Val polymorphism and prognostic factors were observed. However, we found significant differences in the distribution of Ile655Val (p = 0.03) and Ala1170Pro (p = 0.01) genotypes between normal breast and breast tumor tissues. This study demonstrates that only the Ala1170Pro polymorphism is associated with prognostic factors in HER2-positive breast cancer patients. Moreover, our results suggest that both HER2 polymorphisms could play a significant role in carcinogenesis in non-metastatic HER2-positive breast cancer women. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  7. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  8. Genotype-Phenotype Associations of the CD-Associated Single Nucleotide Polymorphism within the Gene Locus Encoding Protein Tyrosine Phosphatase Non-Receptor Type 22 in Patients of the Swiss IBD Cohort.

    Directory of Open Access Journals (Sweden)

    Marianne R Spalinger

    Full Text Available Protein tyrosine phosphatase non-receptor type 22 (PTPN22 plays an important role in immune cell function and intestinal homeostasis. The single nucleotide polymorphism (SNP rs2476601 within the PTPN22 gene locus results in aberrant function of PTPN22 protein and protects from Crohn's disease (CD. Here, we investigated associations of PTPN22 SNP rs2476601 in inflammatory bowel disease (IBD patients in the Swiss IBD Cohort Study (SIBDCS.2'028 SIBDCS patients (1173 CD and 855 ulcerative colitis (UC patients were included. The clinical characteristics were analysed for an association with the presence of the PTPN22 SNP rs2476601 genotypes 'homozygous variant' (AA, 'heterozygous' (GA and 'homozygous wild-type' (GG.13 patients (0.6% were homozygous variant (AA for the PTPN22 polymorphism, 269 (13.3% heterozygous variant (GA and 1'746 (86.1% homozygous wild-type (GG. In CD, AA and GA genotypes were associated with less use of steroids and antibiotics, and reduced prevalence of vitamin D and calcium deficiency. In UC the AA and GA genotype was associated with increased use of azathioprine and anti-TNF antibodies, but significantly less patients with the PTPN22 variant featured malabsorption syndrome (p = 0.026.Our study for the first time addressed how presence of SNP rs2476601 within the PTPN22 gene affects clinical characteristics in IBD-patients. Several factors that correlate with more severe disease were found to be less common in CD patients carrying the A-allele, pointing towards a protective role for this variant in affected CD patients. In UC patients however, we found the opposite trend, suggesting a disease-promoting effect of the A-allele.

  9. Follicle-stimulating hormone receptor-mediated uptake of 45Ca2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    International Nuclear Information System (INIS)

    Grasso, P.; Reichert, L.E. Jr.

    1990-01-01

    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel

  10. Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by cultured rat Sertoli cells does not require activation of cholera toxin- or pertussis toxin-sensitive guanine nucleotide binding proteins or adenylate cyclase

    Energy Technology Data Exchange (ETDEWEB)

    Grasso, P.; Reichert, L.E. Jr. (Albany Medical College, NY (USA))

    1990-08-01

    We have previously reported that FSH stimulates flux of 45Ca2+ into cultured Sertoli cells from immature rats via voltage-sensitive and voltage-independent calcium channels. In the present study, we show that this effect of FSH does not require cholera toxin (CT)- or pertussis toxin (PT)-sensitive guanine nucleotide binding (G) protein or activation of adenylate cyclase (AC). Significant stimulation of 45Ca2+ influx was observed within 1 min, and maximal response (3.2-fold over basal levels) was achieved within 2 min after exposure to FSH. FSH-stimulated elevations in cellular cAMP paralleled increases in 45Ca2+ uptake, suggesting a possible coupling of AC activation to 45Ca2+ influx. (Bu)2cAMP, however, was not able to enhance 45Ca2+ uptake over basal levels at a final concentration of 1000 microM, although a concentration-related increase in androstenedione conversion to estradiol was evident. Exposure of Sertoli cells to CT (10 ng/ml) consistently stimulated basal levels of androstenedione conversion to estradiol but had no effect on basal levels of 45Ca2+ uptake. Similarly, CT had no effect on FSH-induced 45Ca2+ uptake, but potentiated FSH-stimulated estradiol synthesis. PT (10 ng/ml) augmented basal and FSH-stimulated estradiol secretion without affecting 45Ca2+ influx. The adenosine analog N6-phenylisopropyladenosine, which binds to Gi-coupled adenosine receptors on Sertoli cells, inhibited FSH-stimulated androgen conversion to estradiol in a dose-related (1-1000 nM) manner, but FSH-stimulated 45Ca2+ influx remained unchanged. Our results show that in contrast to FSH-stimulated estradiol synthesis, the flux of 45Ca2+ into Sertoli cells in response to FSH is not mediated either directly or indirectly by CT- or PT-sensitive G protein, nor does it require activation of AC. Our data further suggest that the FSH receptor itself may function as a calcium channel.

  11. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  12. Bay11-7082 attenuates neuropathic pain via inhibition of nuclear factor-kappa B and nucleotide-binding domain-like receptor protein 3 inflammasome activation in dorsal root ganglions in a rat model of lumbar disc herniation

    Directory of Open Access Journals (Sweden)

    Zhang AL

    2017-02-01

    Full Text Available Ailiang Zhang, Kun Wang, Lianghua Ding, Xinnan Bao, Xuan Wang, Xubin Qiu, Jinbo Liu Spine Surgery, Third Affiliated Hospital of Soochow University, Changzhou, People’s Republic of China Abstract: Lumbar disc herniation (LDH is an important cause of radiculopathy, but the underlying mechanisms are incompletely understood. Many studies suggested that local inflammation, rather than mechanical compression, results in radiculopathy induced by LDH. On the molecular and cellular level, nuclear factor-kappa B (NF-κB and nucleotide-binding domain-like receptor protein 3 (NLRP3 inflammasome have been implicated in the regulation of neuroinflammation formation and progression. In this study, the autologous nucleus pulposus (NP was implanted in the left L5 dorsal root ganglion (DRG to mimic LDH in rats. We investigated the expression of NF-κB and the components of NLRP3 inflammasome in the DRG neurons in rats. Western blotting and immunofluorescence for the related molecules, including NLRP3, apoptosis-associated speck-like protein containing caspase-1 activator domain (ASC, caspase-1, interleukin (IL-1β, IL-18, IκBα, p-IκBα, p65, p-p65, and calcitonin gene-related peptide (CGRP were examined. In the NP-treated group, the activations of NLRP3, ASC, caspase-1, IL-1β, IL-18, p-IκBα, and p-p65 in DRG neurons in rats were elevated at 1 day after surgery, and the peak occurred at 7 days. Treatment with Bay11-7082, an inhibitor of the actions of IKK-β, was able to inhibit expression and activation of the molecules (NLRP3, ASC, caspase-1, IL-1β, IL-18, p-IκBα, and p-p65 and relieve the pain in rats. Our study shows that NF-κB and NLRP3 inflammasome are involved in the maintenance of NP-induced pain, and that Bay11-7082 could alleviate mechanical allodynia and thermal hyperalgesia by inhibiting NF-κB and NLRP3 inflammasome activation. Keywords: pain, NLRP3, NF-κB, dorsal root ganglion, nucleus pulposus

  13. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  14. Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine Toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Muneta, Y.; Minagawa, Y.; Kusumoto, M.; Shinkai, H.; Uenishi, H.; Šplíchal, Igor

    2012-01-01

    Roč. 56, č. 6 (2012), s. 385-391 ISSN 0385-5600 R&D Projects: GA ČR GA524/09/0365 Institutional support: RVO:61388971 Keywords : allele-specific PCR * Salmonella enterica serovar Choleraesuis * single nucleotide polymorphism Subject RIV: EC - Immunology Impact factor: 1.545, year: 2012

  15. receptores

    Directory of Open Access Journals (Sweden)

    Salete Regina Daronco Benetti

    2006-01-01

    Full Text Available Se trata de un estudio etnográfico, que tuvo lo objetivo de interpretar el sistema de conocimiento y del significado atribuidos a la sangre referente a la transfusión sanguínea por los donadores y receptores de un banco de sangre. Para la colecta de las informaciones se observaron los participantes y la entrevista etnográfica se realizó el análisis de dominio, taxonómicos y temáticos. Los dominios culturales fueron: la sangre es vida: fuente de vida y alimento valioso; creencias religiosas: fuentes simbólicas de apoyos; donación sanguínea: un gesto colaborador que exige cuidarse, gratifica y trae felicidad; donación sanguínea: fuente simbólica de inseguridad; estar enfermo es una condición para realizar transfusión sanguínea; transfusión sanguínea: esperanza de vida; Creencias populares: transfusión sanguínea como riesgo para la salud; donadores de sangre: personas benditas; donar y recibir sangre: como significado de felicidad. Temática: “líquido precioso que origina, sostiene, modifica la vida, provoca miedo e inseguridad”.

  16. Pilocarpine-Induced Status Epilepticus Increases the Sensitivity of P2X7 and P2Y1 Receptors to Nucleotides at Neural Progenitor Cells of the Juvenile Rodent Hippocampus.

    Science.gov (United States)

    Rozmer, Katalin; Gao, Po; Araújo, Michelle G L; Khan, Muhammad Tahir; Liu, Juan; Rong, Weifang; Tang, Yong; Franke, Heike; Krügel, Ute; Fernandes, Maria José S; Illes, Peter

    2017-07-01

    Patch-clamp recordings indicated the presence of P2X7 receptors at neural progenitor cells (NPCs) in the subgranular zone of the dentate gyrus in hippocampal brain slices prepared from transgenic nestin reporter mice. The activation of these receptors caused inward current near the resting membrane potential of the NPCs, while P2Y1 receptor activation initiated outward current near the reversal potential of the P2X7 receptor current. Both receptors were identified by biophysical/pharmacological methods. When the brain slices were prepared from mice which underwent a pilocarpine-induced status epilepticus or when brain slices were incubated in pilocarpine-containing external medium, the sensitivity of P2X7 and P2Y1 receptors was invariably increased. Confocal microscopy confirmed the localization of P2X7 and P2Y1 receptor-immunopositivity at nestin-positive NPCs. A one-time status epilepticus in rats caused after a latency of about 5 days recurrent epileptic fits. The blockade of central P2X7 receptors increased the number of seizures and their severity. It is hypothesized that P2Y1 receptors after a status epilepticus may increase the ATP-induced proliferation/ectopic migration of NPCs; the P2X7 receptor-mediated necrosis/apoptosis might counteract these effects, which would otherwise lead to a chronic manifestation of recurrent epileptic fits. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  18. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  19. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  20. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  1. A non-synonymous single-nucleotide polymorphism in the gene encoding Toll-like Receptor 3 (TLR3) is associated with sero-negative Rheumatoid Arthritis (RA) in a Danish population

    DEFF Research Database (Denmark)

    Laska, Magdalena Janina; Hansen, Bettina; Troldborg, Anne

    2014-01-01

    BACKGROUND: It has been suggested that polymorphisms in Toll-like Receptors (TLRs) are associated with Rheumatoid Arthritis (RA), but the implicated alleles have differed between studies. The aim of this investigation was to explore whether polymorphisms of TLR genes are associated with RA...... according to IgM rheumatoid factor (RF) and anti-cyclic citrinullated peptide (CCP) status suggested a significant association of sero-negative RA with the rs3775291 A allele and disease activity in this subset. CONCLUSION: These observations on a RA population of Danish ancestry suggest that variations...... in the TLR3 locus may be implicated in the pathogenesis of sero-negative RA. Since this TLR3 SNP has previously been associated with systemic lupus erythematous (SLE), the present findings support the notion that TLR3 genetic variants may represent a common risk factor in different chronic inflammatory...

  2. Characterization of P2Y receptors mediating ATP induced relaxation in guinea pig airway smooth muscle: involvement of prostaglandins and K+ channels.

    Science.gov (United States)

    Montaño, Luis M; Cruz-Valderrama, José E; Figueroa, Alejandra; Flores-Soto, Edgar; García-Hernández, Luz M; Carbajal, Verónica; Segura, Patricia; Méndez, Carmen; Díaz, Verónica; Barajas-López, Carlos

    2011-10-01

    In airway smooth muscle (ASM), adenosine 5'-triphosphate (ATP) induces a relaxation associated with prostaglandin production. We explored the role of K(+) currents (I (K)) in this relaxation. ATP relaxed the ASM, and this effect was abolished by indomethacin. Removal of airway epithelium slightly diminished the ATP-induced relaxation at lower concentration without modifying the responses to ATP at higher concentrations. ATPγS and UTP induced a concentration-dependent relaxation similar to ATP; α,β-methylene-ATP was inactive from 1 to 100 μM. Suramin or reactive blue 2 (RB2), P2Y receptor antagonists, did not modify the relaxation, but their combination significantly reduced this effect of ATP. The relaxation was also inhibited by N-ethylmaleimide (NEM; which uncouples G proteins). In myocytes, the ATP-induced I (K) increment was not modified by suramin or RB2 but the combination of both drugs abolished it. This increment in the I (K) was also completely nullified by NEM and SQ 22,536. 4-Amynopyridine or iberiotoxin diminished the ATP-induced I (K) increment, and the combination of both substances diminished ATP-induced relaxation. The presence of P2Y(2) and P2Y(4) receptors in smooth muscle was corroborated by Western blot and confocal images. In conclusion, ATP: (1) produces relaxation by inducing the production of bronchodilator prostaglandins in airway smooth muscle, most likely by acting on P2Y(4) and P2Y(2) receptors; (2) induces I (K) increment through activation of the delayed rectifier K(+) channels and the high-conductance Ca(2+)-dependent K(+) channels, therefore both channels are implicated in the ATP-induced relaxation; and (3) this I (K) increment is mediated by prostaglandin production which in turns increase cAMP signaling pathway.

  3. Extracellular nucleotide signaling in plants

    Energy Technology Data Exchange (ETDEWEB)

    Stacey, Gary [Univ. of Missouri, Columbia, MO (United States)

    2016-09-08

    Over the life of this funded project, our research group identified and characterized two key receptor proteins in plants; one mediating the innate immunity response to chitin and the other elucidating the key receptor for extracellular ATP. In the case of chitin recognition, we recently described the quaternary structure of this receptor, shedding light on how the receptor functions. Perhaps more importantly, we demonstrated that all plants have the ability to recognize both chitin oligomers and lipochitooligosacchardes, fundamentally changing how the community views the evolution of these systems and strategies that might be used, for example, to extend symbiotic nitrogen fixation to non-legumes. Our discovery of DORN1 opens a new chapter in plant physiology documenting conclusively that eATP is an important extracellular signal in plants, as it is in animals. At this point, we cannot predict just how far reaching this discovery may prove to be but we are convinced that eATP signaling is fundamental to plant growth and development and, hence, we believe that the future will be very exciting for the study of DORN1 and its overall function in plants.

  4. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  5. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  6. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  7. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  8. Quantitative properties and receptor reserve of the IP(3) and calcium branch of G(q)-coupled receptor signaling.

    Science.gov (United States)

    Dickson, Eamonn J; Falkenburger, Björn H; Hille, Bertil

    2013-05-01

    Gq-coupled plasma membrane receptors activate phospholipase C (PLC), which hydrolyzes membrane phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG). This leads to calcium release, protein kinase C (PKC) activation, and sometimes PIP2 depletion. To understand mechanisms governing these diverging signals and to determine which of these signals is responsible for the inhibition of KCNQ2/3 (KV7.2/7.3) potassium channels, we monitored levels of PIP2, IP3, and calcium in single living cells. DAG and PKC are monitored in our companion paper (Falkenburger et al. 2013. J. Gen. Physiol. http://dx.doi.org/10.1085/jgp.201210887). The results extend our previous kinetic model of Gq-coupled receptor signaling to IP3 and calcium. We find that activation of low-abundance endogenous P2Y2 receptors by a saturating concentration of uridine 5'-triphosphate (UTP; 100 µM) leads to calcium release but not to PIP2 depletion. Activation of overexpressed M1 muscarinic receptors by 10 µM Oxo-M leads to a similar calcium release but also depletes PIP2. KCNQ2/3 channels are inhibited by Oxo-M (by 85%), but not by UTP (calcium responses can be elicited even after PIP2 was partially depleted by overexpressed inducible phosphatidylinositol 5-phosphatases, suggesting that very low amounts of IP3 suffice to elicit a full calcium release. Hence, weak PLC activation can elicit robust calcium signals without net PIP2 depletion or KCNQ2/3 channel inhibition.

  9. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  10. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  11. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  12. The effect of nucleotides and adenosine on stimulus-evoked glutamate release from rat brain cortical slices

    OpenAIRE

    Bennett, Gillian C; Boarder, Michael R

    2000-01-01

    Evidence has previously been presented that P1 receptors for adenosine, and P2 receptors for nucleotides such as ATP, regulate stimulus-evoked release of biogenic amines from nerve terminals in the brain. Here we investigated whether adenosine and nucleotides exert presynaptic control over depolarisation-elicited glutamate release.Slices of rat brain cortex were perfused and stimulated with pulses of 46 mM K+ in the presence of the glutamate uptake inhibitor L-trans-pyrrolidine-2,4-dicarboxyl...

  13. Basolateral P2X receptors mediate inhibition of NaCl transport in mouse medullary thick ascending limb (mTAL)

    DEFF Research Database (Denmark)

    Marques, Rita D; de Bruijn, Pauline I.A.; Sørensen, Mads Vaarby

    2012-01-01

    Extracellular nucleotides regulate epithelial transport via luminal and basolateral P2 receptors. Renal epithelia express multiple P2 receptors, which mediate significant inhibition of solute absorption. Recently, we identified several P2 receptors in the medullary thick ascending limb (m...

  14. A pepducin derived from the third intracellular loop of FPR2 is a partial agonist for direct activation of this receptor in neutrophils but a full agonist for cross-talk triggered reactivation of FPR2.

    Directory of Open Access Journals (Sweden)

    Michael Gabl

    Full Text Available We recently described a novel receptor cross-talk mechanism in neutrophils, unique in that the signals generated by the PAF receptor (PAFR and the ATP receptor (P2Y2R transfer formyl peptide receptor 1 (FPR1 from a desensitized (non-signaling state back to an actively signaling state (Forsman H et al., PLoS One, 8:e60169, 2013; Önnheim K, et al., Exp Cell Res, 323∶209, 2014. In addition to the G-protein coupled FPR1, neutrophils also express the closely related receptor FPR2. In this study we used an FPR2 specific pepducin, proposed to work as an allosteric modulator at the cytosolic signaling interface, to determine whether the cross-talk pathway is utilized also by FPR2. The pepducin used contains a fatty acid linked to a peptide sequence derived from the third intracellular loop of FPR2, and it activates as well as desensensitizes this receptor. We now show that neutrophils desensitized with the FPR2-specific pepducin display increased cellular responses to stimulation with PAF or ATP. The secondary PAF/ATP induced response was sensitive to FPR2-specific inhibitors, disclosing a receptor cross-talk mechanism underlying FPR2 reactivation. The pepducin induced an activity in naïve cells similar to that of a conventional FPR2 agonist, but with lower potency (partial efficacy, meaning that the pepducin is a partial agonist. The PAF- or ATP-induced reactivation was, however, much more pronounced when neutrophils had been desensitized to the pepducin as compared to cells desensitized to conventional agonists. The pepducin should thus in this respect be classified as a full agonist. In summary, we demonstrate that desensitized FPR2 can be transferred back to an actively signaling state by receptor cross-talk signals generated through PAFR and P2Y2R, and the difference in agonist potency with respect to pepducin-induced direct receptor activation and cross-talk reactivation of FPR2 puts the concept of functional selectivity in focus.

  15. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  16. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  17. Pattern recognition receptors and the inflammasome in kidney disease

    NARCIS (Netherlands)

    Leemans, Jaklien C.; Kors, Lotte; Anders, Hans-Joachim; Florquin, Sandrine

    2014-01-01

    Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain receptors (NLRs) are families of pattern recognition receptors that, together with inflammasomes, sense and respond to highly conserved pathogen motifs and endogenous molecules released upon cell damage or stress. Evidence

  18. A Pepducin Derived from the Third Intracellular Loop of FPR2 Is a Partial Agonist for Direct Activation of This Receptor in Neutrophils But a Full Agonist for Cross-Talk Triggered Reactivation of FPR2

    DEFF Research Database (Denmark)

    Gabl, Michael; Winther, Malene; Skovbakke, Sarah Line

    2014-01-01

    We recently described a novel receptor cross-talk mechanism in neutrophils, unique in that the signals generated by the PAF receptor (PAFR) and the ATP receptor (P2Y2R) transfer formyl peptide receptor 1 (FPR1) from a desensitized (non-signaling) state back to an actively signaling state (Forsman H...... et al., PLoS One, 8:e60169, 2013; Önnheim K, et al., Exp Cell Res, 323:209, 2014). In addition to the G-protein coupled FPR1, neutrophils also express the closely related receptor FPR2. In this study we used an FPR2 specific pepducin, proposed to work as an allosteric modulator at the cytosolic...... signaling interface, to determine whether the cross-talk pathway is utilized also by FPR2. The pepducin used contains a fatty acid linked to a peptide sequence derived from the third intracellular loop of FPR2, and it activates as well as desensensitizes this receptor. We now show that neutrophils...

  19. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  20. Short-range intercellular calcium signaling in bone

    DEFF Research Database (Denmark)

    Jørgensen, Niklas Rye

    2005-01-01

    different mechanisms for this propagation. One mechanism involves the secretion of a nucleotide, possibly ATP, acting in an autocrine action to purinergic P2Y2 receptors on the neighboring cells, leading to intracellular IP3 generation and subsequent release of calcium from intracellular stores. The other...... to osteoclasts as well. We demonstrated that paracrine action of ATP was responsible for the wave propagation, but now the purinergic P2X7 receptor was involved. Thus, the studies demonstrate that calcium signals can be propagated not only among osteoblasts, but also between osteoblasts and osteoclasts...

  1. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  2. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  3. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  4. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  5. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  6. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  7. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  8. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  9. Insulin receptors

    International Nuclear Information System (INIS)

    Kahn, C.R.; Harrison, L.C.

    1988-01-01

    This book contains the proceedings on insulin receptors. Part A: Methods for the study of structure and function. Topics covered include: Method for purification and labeling of insulin receptors, the insulin receptor kinase, and insulin receptors on special tissues

  10. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  11. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  12. Human dopamine receptor and its uses

    Energy Technology Data Exchange (ETDEWEB)

    Civelli, Olivier (Portland, OR); Van Tol, Hubert Henri-Marie (Toronto, CA)

    1999-01-01

    The present invention is directed toward the isolation, characterization and pharmacological use of the human D4 dopamine receptor. The nucleotide sequence of the gene corresponding to this receptor and alleleic variant thereof are provided by the invention. The invention also includes recombinant eukaryotic expression constructs capable of expressing the human D4 dopamine receptor in cultures of transformed eukaryotic cells. The invention provides cultures of transformed eukaryotic cells which synthesize the human D4 dopamine receptor, and methods for characterizing novel psychotropic compounds using such cultures.

  13. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  14. P2Y6 Receptor Activation Promotes Inflammation and Tissue Remodeling in Pulmonary Fibrosis

    Science.gov (United States)

    Müller, Tobias; Fay, Susanne; Vieira, Rodolfo Paula; Karmouty-Quintana, Harry; Cicko, Sanja; Ayata, Cemil Korcan; Zissel, Gernot; Goldmann, Torsten; Lungarella, Giuseppe; Ferrari, Davide; Di Virgilio, Francesco; Robaye, Bernard; Boeynaems, Jean-Marie; Lazarowski, Eduardo R.; Blackburn, Michael R.; Idzko, Marco

    2017-01-01

    Idiopathic pulmonary fibrosis (IPF) is a disease with a poor prognosis and very few available treatment options. The involvement of the purinergic receptor subtypes P2Y2 and P2X7 in fibrotic lung disease has been demonstrated recently. In this study, we investigated the role of P2Y6 receptors in the pathogenesis of IPF in humans and in the animal model of bleomycin-induced lung injury. P2Y6R expression was upregulated in lung structural cells but not in bronchoalveolar lavage (BAL) cells derived from IPF patients as well as in animals following bleomycin administration. Furthermore, BAL fluid levels of the P2Y6R agonist uridine-5′-diphosphate were elevated in animals with bleomycin-induced pulmonary fibrosis. Inflammation and fibrosis following bleomycin administration were reduced in P2Y6R-deficient compared to wild-type animals confirming the pathophysiological relevance of P2Y6R subtypes for fibrotic lung diseases. Experiments with bone marrow chimeras revealed the importance of P2Y6R expression on lung structural cells for pulmonary inflammation and fibrosis. Similar effects were obtained when animals were treated with the P2Y6R antagonist MRS2578. In vitro studies demonstrated that proliferation and secretion of the pro-inflammatory/pro-fibrotic cytokine IL-6 by lung fibroblasts are P2Y6R-mediated processes. In summary, our results clearly demonstrate the involvement of P2Y6R subtypes in the pathogenesis of pulmonary fibrosis. Thus, blocking pulmonary P2Y6 receptors might be a new target for the treatment of IPF. PMID:28878780

  15. P2Y6 Receptor Activation Promotes Inflammation and Tissue Remodeling in Pulmonary Fibrosis

    Directory of Open Access Journals (Sweden)

    Tobias Müller

    2017-08-01

    Full Text Available Idiopathic pulmonary fibrosis (IPF is a disease with a poor prognosis and very few available treatment options. The involvement of the purinergic receptor subtypes P2Y2 and P2X7 in fibrotic lung disease has been demonstrated recently. In this study, we investigated the role of P2Y6 receptors in the pathogenesis of IPF in humans and in the animal model of bleomycin-induced lung injury. P2Y6R expression was upregulated in lung structural cells but not in bronchoalveolar lavage (BAL cells derived from IPF patients as well as in animals following bleomycin administration. Furthermore, BAL fluid levels of the P2Y6R agonist uridine-5′-diphosphate were elevated in animals with bleomycin-induced pulmonary fibrosis. Inflammation and fibrosis following bleomycin administration were reduced in P2Y6R-deficient compared to wild-type animals confirming the pathophysiological relevance of P2Y6R subtypes for fibrotic lung diseases. Experiments with bone marrow chimeras revealed the importance of P2Y6R expression on lung structural cells for pulmonary inflammation and fibrosis. Similar effects were obtained when animals were treated with the P2Y6R antagonist MRS2578. In vitro studies demonstrated that proliferation and secretion of the pro-inflammatory/pro-fibrotic cytokine IL-6 by lung fibroblasts are P2Y6R-mediated processes. In summary, our results clearly demonstrate the involvement of P2Y6R subtypes in the pathogenesis of pulmonary fibrosis. Thus, blocking pulmonary P2Y6 receptors might be a new target for the treatment of IPF.

  16. Functional expression of ionotropic purinergic receptors on mouse taste bud cells.

    Science.gov (United States)

    Hayato, Ryotaro; Ohtubo, Yoshitaka; Yoshii, Kiyonori

    2007-10-15

    Neurotransmitter receptors on taste bud cells (TBCs) and taste nerve fibres are likely to contribute to taste transduction by mediating the interaction among TBCs and that between TBCs and taste nerve fibres. We investigated the functional expression of P2 receptor subtypes on TBCs of mouse fungiform papillae. Electrophysiological studies showed that 100 microm ATP applied to their basolateral membranes either depolarized or hyperpolarized a few cells per taste bud. Ca(2+) imaging showed that similarly applied 1 mum ATP, 30 microm BzATP (a P2X(7) agonist), or 1 microm 2MeSATP (a P2Y(1) and P2Y(11) agonist) increased intracellular Ca(2+) concentration, but 100 microm UTP (a P2Y(2) and P2Y(4) agonist) and alpha,beta-meATP (a P2X agonist except for P2X(2), P2X(4) and P2X(7)) did not. RT-PCR suggested the expression of P2X(2), P2X(4), P2X(7), P2Y(1), P2Y(13) and P2Y(14) among the seven P2X subtypes and seven P2Y subtypes examined. Immunohistostaining confirmed the expression of P2X(2). The exposure of the basolateral membranes to 3 mm ATP for 30 min caused the uptake of Lucifer Yellow CH in a few TBCs per taste bud. This was antagonized by 100 microm PPADS (a non-selective P2 blocker) and 1 microm KN-62 (a P2X(7) blocker). These results showed for the first time the functional expression of P2X(2) and P2X(7) on TBCs. The roles of P2 receptor subtypes in the taste transduction, and the renewal of TBCs, are discussed.

  17. Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

    Science.gov (United States)

    Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

    2016-09-01

    Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

  18. Purinergic Receptors in Ocular Inflammation

    Directory of Open Access Journals (Sweden)

    Ana Guzman-Aranguez

    2014-01-01

    Full Text Available Inflammation is a complex process that implies the interaction between cells and molecular mediators, which, when not properly “tuned,” can lead to disease. When inflammation affects the eye, it can produce severe disorders affecting the superficial and internal parts of the visual organ. The nucleoside adenosine and nucleotides including adenine mononucleotides like ADP and ATP and dinucleotides such as P1,P4-diadenosine tetraphosphate (Ap4A, and P1,P5-diadenosine pentaphosphate (Ap5A are present in different ocular locations and therefore they may contribute/modulate inflammatory processes. Adenosine receptors, in particular A2A adenosine receptors, present anti-inflammatory action in acute and chronic retinal inflammation. Regarding the A3 receptor, selective agonists like N6-(3-iodobenzyl-5′-N-methylcarboxamidoadenosine (CF101 have been used for the treatment of inflammatory ophthalmic diseases such as dry eye and uveoretinitis. Sideways, diverse stimuli (sensory stimulation, large intraocular pressure increases can produce a release of ATP from ocular sensory innervation or after injury to ocular tissues. Then, ATP will activate purinergic P2 receptors present in sensory nerve endings, the iris, the ciliary body, or other tissues surrounding the anterior chamber of the eye to produce uveitis/endophthalmitis. In summary, adenosine and nucleotides can activate receptors in ocular structures susceptible to suffer from inflammatory processes. This involvement suggests the possible use of purinergic agonists and antagonists as therapeutic targets for ocular inflammation.

  19. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  20. M3 muscarinic receptor interaction with phospholipase C beta3 determines its signaling efficiency

    NARCIS (Netherlands)

    Kan, W.; Adjobo-Hermans, M.J.; Burroughs, M.; Faibis, G.; Malik, S.; Tall, G.G.; Smrcka, A.V.

    2014-01-01

    Phospholipase Cbeta (PLCbeta) enzymes are activated by G protein-coupled receptors through receptor-catalyzed guanine nucleotide exchange on Galphabetagamma heterotrimers containing Gq family G proteins. Here we report evidence for a direct interaction between M3 muscarinic receptor (M3R) and

  1. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  2. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  3. Somatostatin receptors

    DEFF Research Database (Denmark)

    Møller, Lars Neisig; Stidsen, Carsten Enggaard; Hartmann, Bolette

    2003-01-01

    functional units, receptors co-operate. The total receptor apparatus of individual cell types is composed of different-ligand receptors (e.g. SRIF and non-SRIF receptors) and co-expressed receptor subtypes (e.g. sst(2) and sst(5) receptors) in characteristic proportions. In other words, levels of individual......-peptides, receptor agonists and antagonists. Relatively long half lives, as compared to those of the endogenous ligands, have been paramount from the outset. Motivated by theoretical puzzles or the shortcomings of present-day diagnostics and therapy, investigators have also aimed to produce subtype...

  4. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

    Science.gov (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

    2004-12-15

    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  5. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  6. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  7. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  8. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  9. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  10. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  11. Changing the insulin receptor to possess insulin-like growth factor I ligand specificity

    International Nuclear Information System (INIS)

    Andersen, A.S.; Kjeldsen, T.; Wiberg, F.C.; Christensen, P.M.; Rasmussen, J.S.; Norris, K.; Moeller, K.B.; Moeller, N.P.H.

    1990-01-01

    To examine the role of the N-terminal part of the insulin-like growth factor I (IGF-I) receptor and insulin receptor in determining ligand specificity, the authors prepared an expression vector encoding a hybrid receptor where exon 1 (encoding the signal peptide and seven amino acids of the α-subunit), exon 2, and exon 3 of the insulin receptor were replaced with the corresponding IGF-I receptor cDNA (938 nucleotides). To allow direct quantitative comparison of the binding capabilities of this hybrid receptor with those of the human IGF-I receptor and the insulin receptor, all three receptors were expressed in baby hamster kidney (BHK) cells as soluble molecules and partially purified before characterization. The hybrid IGF-I/insulin receptor bound IGF-I with an affinity comparable to that of the wild-type IGF-I receptor. In contrast, the hybrid receptor no longer displayed high-affinity binding of insulin. These results directly demonstrate that it is possible to change the specificity of the insulin receptor to that of the IGF-I receptor and, furthermore, that the binding specificity for IGF-I is encoded within the nucleotide sequence from 135 to 938 of the IGF-I receptor cDNA. Since the hybrid receptor only bound insulin with low affinity, the insulin binding region is likely to be located within exons 2 and 3 of the insulin receptor

  12. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  13. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  15. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  16. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    Science.gov (United States)

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

    2009-03-01

    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  17. Single nucleotide polymorphisms as susceptibility, prognostic, and therapeutic markers of nonsmall cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zienolddiny S

    2011-12-01

    Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most

  18. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  19. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  20. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  1. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  2. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  4. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  5. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  7. Genetic polymorphisms of tumour necrosis factor receptor superfamily 1b and fas ligand are associated with clinical efficacy and/or acute severe infusion reactions to infliximab in Crohn's disease

    DEFF Research Database (Denmark)

    Steenholdt, C; Enevold, C; Ainsworth, M A

    2012-01-01

    Single nucleotide polymorphisms (SNPs) in TNF receptor superfamily (TNFRSF) 1A and 1B, and Fas ligand (FASLG) genes, have been associated with responsiveness to infliximab (IFX) in Crohn's disease.......Single nucleotide polymorphisms (SNPs) in TNF receptor superfamily (TNFRSF) 1A and 1B, and Fas ligand (FASLG) genes, have been associated with responsiveness to infliximab (IFX) in Crohn's disease....

  8. Structural basis for solute transport, nucleotide regulation, and immunological recognition of Neisseria meningitidis PorB

    Energy Technology Data Exchange (ETDEWEB)

    Tanabe, Mikio; Nimigean, Crina M.; Iverson, T.M. (Weill-Med); (Vanderbilt)

    2010-06-25

    PorB is the second most prevalent outer membrane protein in Neisseria meningitidis. PorB is required for neisserial pathogenesis and can elicit a Toll-like receptor mediated host immune response. Here, the x-ray crystal structure of PorB has been determined to 2.3 {angstrom} resolution. Structural analysis and cocrystallization studies identify three putative solute translocation pathways through the channel pore: One pathway transports anions nonselectively, one transports cations nonselectively, and one facilitates the specific uptake of sugars. During infection, PorB likely binds host mitochondrial ATP, and cocrystallization with the ATP analog AMP-PNP suggests that binding of nucleotides regulates these translocation pathways both by partial occlusion of the pore and by restricting the motion of a putative voltage gating loop. PorB is located on the surface of N. meningitidis and can be recognized by receptors of the host innate immune system. Features of PorB suggest that Toll-like receptor mediated recognition outer membrane proteins may be initiated with a nonspecific electrostatic attraction.

  9. Receptor assay

    Energy Technology Data Exchange (ETDEWEB)

    Kato, K; Ibayashi, H [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine

    1975-05-01

    This paper summarized present status and problems of analysis of hormone receptor and a few considerations on clinical significance of receptor abnormalities. It was pointed that in future clinical field quantitative and qualitative analysis of receptor did not remain only in the etiological discussion, but that it was an epoch-making field of investigation which contained the possiblity of artificial change of sensitivity of living body on drugs and the development connected directly with treatment of various diseases.

  10. Function of the Nucleotide Exchange Activity of Vav1 in T cell Development and Activation*

    Science.gov (United States)

    Saveliev, Alexander; Vanes, Lesley; Ksionda, Olga; Rapley, Jonathan; Smerdon, Stephen J.; Rittinger, Katrin; Tybulewicz, Victor L. J.

    2012-01-01

    The guanine nucleotide exchange factor (GEF) Vav1 is essential for transducing T cell antigen receptor (TCR) signals and therefore plays a critical role in the development and activation of T cells. It has been presumed that the GEF activity of Vav1 is important for its function; however, there has been no direct demonstration of this. Here, we generated mice expressing enzymatically inactive, but normally folded, Vav1 protein. Analysis of these mice showed that the GEF activity of Vav1 was necessary for the selection of thymocytes and for the optimal activation of T cells, including signal transduction to Rac1, Akt, and integrins. In contrast, the GEF activity of Vav1 was not required for TCR-induced calcium flux, activation of extracellular signal–regulated kinase (ERK) and protein kinase D1 (PKD1), and cell polarization. Thus, in T cells, the GEF activity of Vav1 is essential for some, but not all, of its functions. PMID:20009105

  11. Function of the nucleotide exchange activity of vav1 in T cell development and activation.

    Science.gov (United States)

    Saveliev, Alexander; Vanes, Lesley; Ksionda, Olga; Rapley, Jonathan; Smerdon, Stephen J; Rittinger, Katrin; Tybulewicz, Victor L J

    2009-12-15

    The guanine nucleotide exchange factor (GEF) Vav1 is essential for transducing T cell antigen receptor (TCR) signals and therefore plays a critical role in the development and activation of T cells. It has been presumed that the GEF activity of Vav1 is important for its function; however, there has been no direct demonstration of this. Here, we generated mice expressing enzymatically inactive, but normally folded, Vav1 protein. Analysis of these mice showed that the GEF activity of Vav1 was necessary for the selection of thymocytes and for the optimal activation of T cells, including signal transduction to Rac1, Akt, and integrins. In contrast, the GEF activity of Vav1 was not required for TCR-induced calcium flux, activation of extracellular signal-regulated kinase and protein kinase D1, and cell polarization. Thus, in T cells, the GEF activity of Vav1 is essential for some, but not all, of its functions.

  12. Crystal structure of the β2 adrenergic receptor-Gs protein complex

    DEFF Research Database (Denmark)

    Rasmussen, Søren Gøgsig Faarup; DeVree, Brian T; Zou, Yaozhong

    2011-01-01

    -occupied receptor. The β(2) adrenergic receptor (β(2)AR) activation of Gs, the stimulatory G protein for adenylyl cyclase, has long been a model system for GPCR signalling. Here we present the crystal structure of the active state ternary complex composed of agonist-occupied monomeric β(2)AR and nucleotide-free Gs...

  13. GPCR engineering yields high-resolution structural insights into beta2-adrenergic receptor function

    DEFF Research Database (Denmark)

    Rosenbaum, Daniel M; Cherezov, Vadim; Hanson, Michael A

    2007-01-01

    The beta2-adrenergic receptor (beta2AR) is a well-studied prototype for heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptors (GPCRs) that respond to diffusible hormones and neurotransmitters. To overcome the structural flexibility of the beta2AR and to facilitate its cr...

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  15. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  16. AMP is an adenosine A1 receptor agonist.

    Science.gov (United States)

    Rittiner, Joseph E; Korboukh, Ilia; Hull-Ryde, Emily A; Jin, Jian; Janzen, William P; Frye, Stephen V; Zylka, Mark J

    2012-02-17

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5'-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5'-monophosphonate, ACP) directly activated the adenosine A(1) receptor (A(1)R). In contrast, AMP only activated the adenosine A(2B) receptor (A(2B)R) after hydrolysis to adenosine by ecto-5'-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A(1)R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A(1)R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2',4'-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A(1)R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A(1)R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine.

  17. Role of purinergic receptor polymorphisms in human bone

    DEFF Research Database (Denmark)

    Wesselius, Anke; Bours, Martijn J L; Agrawal, Ankita

    2011-01-01

    Osteoporosis is a multifactorial disease with a strong genetic component. Variations in a number of genes have been shown to associate with bone turnover and risk of osteoporosis. P2 purinergic receptors are proteins that have ATP or other nucleotides as their natural ligands. Various P2Y and P2X...

  18. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  19. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  20. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  1. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  2. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  3. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  4. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  5. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  6. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  7. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  8. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  9. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  10. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  11. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  12. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  13. Guanine nucleotide binding proteins in zucchini seedlings: Characterization and interactions with the NPA receptor

    International Nuclear Information System (INIS)

    Lindeberg, M.; Jacobs, M.

    1989-01-01

    A microsomal membrane preparation from hypocotyls of dark-grown Cucurbita pepo L. seedlings contains specific high-affinity binding sites for the non-hydrolyzable GTP analog guanosine 5'-[γ-thio] triphosphate (GTP-γ-S). Both the binding affinity and the pattern of binding specificity for GTP and GTP analogs are similar to animal G-proteins, and two zucchini membrane proteins are recognized in western blots by antiserum specific for the σ subunit of platelet G s protein. GTP-γ-S can increase specific naphthylphthalamic acid (NPA) binding in zucchini microsomal membrane preparations, with its stimulation increasing with large tissue age. Al +3 and F - agents known to activate G-proteins - decreased NPA specific binding by ca. 15%. In tests of in vitro auxin transport employing zucchini plasma membrane vesicles, AlF - 4 strongly inhibited 3 H-indoleacetic acid nor accumulation; GTP-γ-S effects on this system will be discussed

  14. Striatal dopamine release and genetic variation of the serotonin 2C receptor in humans

    OpenAIRE

    Mickey, Brian J; Sanford, Benjamin J; Love, Tiffany M; Shen, Pei-Hong; Hodgkinson, Colin; Stohler, Christian S; Goldman, David; Zubieta, Jon-Kar

    2012-01-01

    Mesoaccumbal and nigrostriatal projections are sensitive to stress, and heightened stress sensitivity is thought to confer risk for neuropsychiatric disorders. Serotonin 2C (5-HT2C) receptors mediate the inhibitory effects of serotonin on dopaminergic circuitry in experimental animals, and preclinical findings have implicated 5-HT2C receptors in motivated behaviors and psychotropic drug mechanisms. In humans, a common missense single-nucleotide change (rs6318, Cys23Ser) in the 5-HT2C receptor...

  15. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  16. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  17. A single-nucleotide polymorphism of human neuropeptide s gene originated from Europe shows decreased bioactivity.

    Directory of Open Access Journals (Sweden)

    Cheng Deng

    Full Text Available Using accumulating SNP (Single-Nucleotide Polymorphism data, we performed a genome-wide search for polypeptide hormone ligands showing changes in the mature regions to elucidate genotype/phenotype diversity among various human populations. Neuropeptide S (NPS, a brain peptide hormone highly conserved in vertebrates, has diverse physiological effects on anxiety, fear, hyperactivity, food intake, and sleeping time through its cognate receptor-NPSR. Here, we report a SNP rs4751440 (L(6-NPS causing non-synonymous substitution on the 6(th position (V to L of the NPS mature peptide region. L(6-NPS has a higher allele frequency in Europeans than other populations and probably originated from European ancestors ~25,000 yrs ago based on haplotype analysis and Approximate Bayesian Computation. Functional analyses indicate that L(6-NPS exhibits a significant lower bioactivity than the wild type NPS, with ~20-fold higher EC50 values in the stimulation of NPSR. Additional evolutionary and mutagenesis studies further demonstrate the importance of the valine residue in the 6(th position for NPS functions. Given the known physiological roles of NPS receptor in inflammatory bowel diseases, asthma pathogenesis, macrophage immune responses, and brain functions, our study provides the basis to elucidate NPS evolution and signaling diversity among human populations.

  18. Molecular cloning and functional characterization of duck nucleotide-binding oligomerization domain 1 (NOD1).

    Science.gov (United States)

    Li, Huilin; Jin, Hui; Li, Yaqian; Liu, Dejian; Foda, Mohamed Frahat; Jiang, Yunbo; Luo, Rui

    2017-09-01

    Nucleotide-binding oligomerization domain 1 (NOD1) is an imperative cytoplasmic pattern recognition receptor (PRR) and considered as a key member of the NOD-like receptor (NLR) family which plays a critical role in innate immunity through sensing microbial components derived from bacterial peptidoglycan. In the current study, the full-length of duck NOD1 (duNOD1) cDNA from duck embryo fibroblasts (DEFs) was cloned. Multiple sequence alignment and phylogenetic analysis demonstrated that duNOD1 exhibited a strong evolutionary relationship with chicken and rock pigeon NOD1. Tissue-specific expression analysis showed that duNOD1 was widely distributed in various organs, with the highest expression observed in the liver. Furthermore, duNOD1 overexpression induced NF-κB activation in DEFs and the CARD domain is crucial for duNOD1-mediated NF-κB activation. In addition, silencing the duNOD1 decreased the activity of NF-κB in DEFs stimulated by iE-DAP. Overexpression of duNOD1 significantly increased the expression of TNF-α, IL-6, and RANTES in DEFs. These findings highlight the crucial role of duNOD1 as an intracellular sensor in duck innate immune system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. The selective phosphorylation of a guanine nucleotide-binding regulatory protein

    International Nuclear Information System (INIS)

    Carlson, K.E.

    1989-01-01

    Receptor-activated signal transduction pathways regulate the responsiveness of cells to external stimuli. These transduction pathways themselves are subject to regulation, most commonly by phosphorylation. Guanine nucleotide-binding regulatory proteins (G Proteins), as requisite signal transducing elements for many plasma membrane receptors, are considered likely targets for regulation by phosphorylation. Protein kinase C (PKC) has been shown to phosphorylate the α subunit of G i and other G proteins in solution. However, the occurrence of the phosphorylation of G 1 within intact cells in response to activation of PKC has not been rigorously demonstrated. In this thesis, the extent to which the α subunits of G i undergo phosphorylation within human platelets in response to activation of PKC was examined by means of radiolabeling and immunoprecipitation. Incubation of platelets with phorbol-12-myristate-13-acetate (PMA), a potent activator of PKC, promoted the phosphorylation of several proteins within saponin-permeabilized and intact platelets incubated with [γ 32 P]ATP and [ 32 P]H 3 PO 4 , respectively. None of the phosphoproteins, however, were precipitated by either of two antisera containing antibodies differing in specificities for epitopes within G iα -despite precipitation of a substantial fraction of the subunit itself. In contrast, other antisera, containing antibodies specific for the recently describe G zα , or antibodies for both G zα and G iα , precipitated a 40-kDa phosphoprotein

  20. Mathematical model reveals role of nucleotide signaling in airway surface liquid homeostasis and its dysregulation in cystic fibrosis.

    Science.gov (United States)

    Sandefur, Conner I; Boucher, Richard C; Elston, Timothy C

    2017-08-29

    Mucociliary clearance is composed of three components (i.e., mucin secretion, airway surface hydration, and ciliary-activity) which function coordinately to clear inhaled microbes and other foreign particles from airway surfaces. Airway surface hydration is maintained by water fluxes driven predominantly by active chloride and sodium ion transport. The ion channels that mediate electrogenic ion transport are regulated by extracellular purinergic signals that signal through G protein-coupled receptors. These purinoreceptors and the signaling pathways they activate have been identified as possible therapeutic targets for treating lung disease. A systems-level description of airway surface liquid (ASL) homeostasis could accelerate development of such therapies. Accordingly, we developed a mathematical model to describe the dynamic coupling of ion and water transport to extracellular purinergic signaling. We trained our model from steady-state and time-dependent experimental measurements made using normal and cystic fibrosis (CF) cultured human airway epithelium. To reproduce CF conditions, reduced chloride secretion, increased potassium secretion, and increased sodium absorption were required. The model accurately predicted ASL height under basal normal and CF conditions and the collapse of surface hydration due to the accelerated nucleotide metabolism associated with CF exacerbations. Finally, the model predicted a therapeutic strategy to deliver nucleotide receptor agonists to effectively rehydrate the ASL of CF airways.

  1. The effect of nucleotides and adenosine on stimulus-evoked glutamate release from rat brain cortical slices.

    Science.gov (United States)

    Bennett, G C; Boarder, M R

    2000-10-01

    Evidence has previously been presented that P1 receptors for adenosine, and P2 receptors for nucleotides such as ATP, regulate stimulus-evoked release of biogenic amines from nerve terminals in the brain. Here we investigated whether adenosine and nucleotides exert presynaptic control over depolarisation-elicited glutamate release. Slices of rat brain cortex were perfused and stimulated with pulses of 46 mM K(+) in the presence of the glutamate uptake inhibitor L-trans-pyrrolidine-2,4-dicarboxylic acid (0.2 mM). High K(+) substantially increased efflux of glutamate from the slices. Basal glutamate release was unchanged by the presence of nucleotides or adenosine at concentrations of 300 microM. Adenosine, ATP, ADP and adenosine 5'-O-(3-thiotriphoshate) at 300 microM attenuated depolarisation-evoked release of glutamate. However UTP, 2-methylthio ATP, 2-methylthio ADP, and alpha,beta-methylene ATP at 300 microM had no effect on stimulated glutamate efflux. Adenosine deaminase blocked the effect of adenosine, but left the response to ATP unchanged. The A(1) antagonist 8-cyclopentyl-1, 3-dipropylxanthine antagonised the inhibitory effect of both adenosine and ATP. Cibacron blue 3GA inhibited stimulus-evoked glutamate release when applied alone. When cibacron blue 3GA was present with ATP, stimulus-evoked glutamate release was almost eliminated. However, this P2 antagonist had no effect on the inhibition by adenosine. These results show that the release of glutamate from depolarised nerve terminals of the rat cerebral cortex is inhibited by adenosine and ATP. ATP appears to act directly and not through conversion to adenosine.

  2. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  3. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  4. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  5. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  6. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  7. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  8. Single nucleotide polymorphisms (SNPs in coding regions of canine dopamine- and serotonin-related genes

    Directory of Open Access Journals (Sweden)

    Lingaas Frode

    2008-01-01

    Full Text Available Abstract Background Polymorphism in genes of regulating enzymes, transporters and receptors of the neurotransmitters of the central nervous system have been associated with altered behaviour, and single nucleotide polymorphisms (SNPs represent the most frequent type of genetic variation. The serotonin and dopamine signalling systems have a central influence on different behavioural phenotypes, both of invertebrates and vertebrates, and this study was undertaken in order to explore genetic variation that may be associated with variation in behaviour. Results Single nucleotide polymorphisms in canine genes related to behaviour were identified by individually sequencing eight dogs (Canis familiaris of different breeds. Eighteen genes from the dopamine and the serotonin systems were screened, revealing 34 SNPs distributed in 14 of the 18 selected genes. A total of 24,895 bp coding sequence was sequenced yielding an average frequency of one SNP per 732 bp (1/732. A total of 11 non-synonymous SNPs (nsSNPs, which may be involved in alteration of protein function, were detected. Of these 11 nsSNPs, six resulted in a substitution of amino acid residue with concomitant change in structural parameters. Conclusion We have identified a number of coding SNPs in behaviour-related genes, several of which change the amino acids of the proteins. Some of the canine SNPs exist in codons that are evolutionary conserved between five compared species, and predictions indicate that they may have a functional effect on the protein. The reported coding SNP frequency of the studied genes falls within the range of SNP frequencies reported earlier in the dog and other mammalian species. Novel SNPs are presented and the results show a significant genetic variation in expressed sequences in this group of genes. The results can contribute to an improved understanding of the genetics of behaviour.

  9. Design and synthesis of labeled analogs of PhTX-56, a potent and selective AMPA receptor antagonist

    DEFF Research Database (Denmark)

    Andersen, Trine F; Vogensen, Stine B; Jensen, Lars S

    2005-01-01

    Polyamines and polyamine toxins are biologically important molecules, having modulatory effects on nucleotides and proteins. The wasp toxin, philanthotoxin-433 (PhTX-433), is a non-selective and uncompetitive antagonist of ionotropic receptors, such as ionotropic glutamate receptors and nicotinic...

  10. High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor

    DEFF Research Database (Denmark)

    Cherezov, Vadim; Rosenbaum, Daniel M; Hanson, Michael A

    2007-01-01

    Heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptors constitute the largest family of eukaryotic signal transduction proteins that communicate across the membrane. We report the crystal structure of a human beta2-adrenergic receptor-T4 lysozyme fusion protein bound to t...

  11. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  13. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  14. Medicinal chemistry of adenosine, P2Y and P2X receptors.

    Science.gov (United States)

    Jacobson, Kenneth A; Müller, Christa E

    2016-05-01

    Pharmacological tool compounds are now available to define action at the adenosine (ARs), P2Y and P2X receptors. We present a selection of the most commonly used agents to study purines in the nervous system. Some of these compounds, including A1 and A3 AR agonists, P2Y1R and P2Y12R antagonists, and P2X3, P2X4 and P2X7 antagonists, are potentially of clinical use in treatment of disorders of the nervous system, such as chronic pain, neurodegeneration and brain injury. Agonists of the A2AAR and P2Y2R are already used clinically, P2Y12R antagonists are widely used antithrombotics and an antagonist of the A2AAR is approved in Japan for treating Parkinson's disease. The selectivity defined for some of the previously introduced compounds has been revised with updated pharmacological characterization, for example, various AR agonists and antagonists were deemed A1AR or A3AR selective based on human data, but species differences indicated a reduction in selectivity ratios in other species. Also, many of the P2R ligands still lack bioavailability due to charged groups or hydrolytic (either enzymatic or chemical) instability. X-ray crystallographic structures of AR and P2YRs have shifted the mode of ligand discovery to structure-based approaches rather than previous empirical approaches. The X-ray structures can be utilized either for in silico screening of chemically diverse libraries for the discovery of novel ligands or for enhancement of the properties of known ligands by chemical modification. Although X-ray structures of the zebrafish P2X4R have been reported, there is scant structural information about ligand recognition in these trimeric ion channels. In summary, there are definitive, selective agonists and antagonists for all of the ARs and some of the P2YRs; while the pharmacochemistry of P2XRs is still in nascent stages. The therapeutic potential of selectively modulating these receptors is continuing to gain interest in such fields as cancer, inflammation, pain

  15. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  16. Pathophysiological consequences of receptor mistraffic: Tales from the platelet P2Y12 receptor.

    Science.gov (United States)

    Cunningham, Margaret R; Aungraheeta, Riyaad; Mundell, Stuart J

    2017-07-05

    Genetic variations in G protein-coupled receptor (GPCR) genes can disrupt receptor function in a wide variety of human genetic diseases, including platelet bleeding disorders. Platelets are critical for haemostasis with inappropriate platelet activation leading to the development of arterial thrombosis, which can result in heart attack and stroke whilst decreased platelet activity is associated with an increased risk of bleeding. GPCRs expressed on the surface of platelets play key roles in regulating platelet activity and therefore function. Receptors include purinergic receptors (P2Y 1 and P2Y 12 ), proteinase-activated receptor (PAR1 and PAR4) and thromboxane receptors (TPα), among others. Pharmacological blockade of these receptors forms a powerful therapeutic tool in the treatment and prevention of arterial thrombosis. With the advance of genomic technologies, there has been a substantial increase in the identification of naturally occurring rare and common GPCR variants. These variants include single-nucleotide polymorphisms (SNPs) and insertion or deletions that have the potential to alter GPCR expression or function. A number of defects in platelet GPCRs that disrupt receptor function have now been characterized in patients with mild bleeding disorders. This review will focus on rare, function-disrupting variants of platelet GPCRs with particular emphasis upon mutations in the P2Y 12 receptor gene that affect receptor traffic to modulate platelet function. Further this review will outline how the identification and characterization of function-disrupting GPCR mutations provides an essential link in translating our detailed understanding of receptor traffic and function in cell line studies into relevant human biological systems. Copyright © 2017. Published by Elsevier B.V.

  17. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  18. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  19. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  20. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  1. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  2. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  3. Nucleotide Excision Repair and Vitamin D--Relevance for Skin Cancer Therapy.

    Science.gov (United States)

    Pawlowska, Elzbieta; Wysokinski, Daniel; Blasiak, Janusz

    2016-04-06

    Ultraviolet (UV) radiation is involved in almost all skin cancer cases, but on the other hand, it stimulates the production of pre-vitamin D3, whose active metabolite, 1,25-dihydroxyvitamin D3 (1,25VD3), plays important physiological functions on binding with its receptor (vitamin D receptor, VDR). UV-induced DNA damages in the form of cyclobutane pyrimidine dimers or (6-4)-pyrimidine-pyrimidone photoproducts are frequently found in skin cancer and its precursors. Therefore, removing these lesions is essential for the prevention of skin cancer. As UV-induced DNA damages are repaired by nucleotide excision repair (NER), the interaction of 1,25VD3 with NER components can be important for skin cancer transformation. Several studies show that 1,25VD3 protects DNA against damage induced by UV, but the exact mechanism of this protection is not completely clear. 1,25VD3 was also shown to affect cell cycle regulation and apoptosis in several signaling pathways, so it can be considered as a potential modulator of the cellular DNA damage response, which is crucial for mutagenesis and cancer transformation. 1,25VD3 was shown to affect DNA repair and potentially NER through decreasing nitrosylation of DNA repair enzymes by NO overproduction by UV, but other mechanisms of the interaction between 1,25VD3 and NER machinery also are suggested. Therefore, the array of NER gene functioning could be analyzed and an appropriate amount of 1.25VD3 could be recommended to decrease UV-induced DNA damage important for skin cancer transformation.

  4. Previously Unidentified Single Nucleotide Polymorphisms in HIV/AIDS Cases Associate with Clinical Parameters and Disease Progression

    Directory of Open Access Journals (Sweden)

    Vladimir V. Anokhin

    2016-01-01

    Full Text Available The genetic background of an individual plays an important role in the progression of HIV infection to AIDS. Identifying previously unknown or uncharacterized single nucleotide polymorphisms (SNPs that associate with disease progression may reveal important therapeutic targets and provide a greater understanding of disease pathogenesis. In the present study, we employed ultra-high multiplex PCR on an Ion Torrent next-generation sequencing platform to sequence 23 innate immune genes from 94 individuals with HIV/AIDS. This data was used to identify potential associations of SNPs with clinical parameters and disease progression. SNPs that associated with an increased viral load were identified in the genes for the interleukin 15 receptor (IL15RA, toll-like receptor 7 (TLR7, tripartite motif-containing protein 5 (TRIM5, and two killer-cell immunoglobulin-like receptors (KIR2DL1 and KIR2DL3. Additionally, SNPs that associated with progression from HIV infection to AIDS were identified in two 2′-5′-oligoadenylate synthetase genes (OAS2 and OAS3. In contrast, other SNPs identified in OAS2 and OAS3 genes, as well as in the TRIM5 and KIR2DS4 genes, were associated with a slower progression of disease. Taken together, our data demonstrates the utility of ultra-high multiplex PCR in identifying polymorphisms of potential clinical significance and further,identifies SNPs that may play a role in HIV pathogenesis.

  5. Approach for targeting Ras with small molecules that activate SOS-mediated nucleotide exchange.

    Science.gov (United States)

    Burns, Michael C; Sun, Qi; Daniels, R Nathan; Camper, DeMarco; Kennedy, J Phillip; Phan, Jason; Olejniczak, Edward T; Lee, Taekyu; Waterson, Alex G; Rossanese, Olivia W; Fesik, Stephen W

    2014-03-04

    Aberrant activation of the small GTPase Ras by oncogenic mutation or constitutively active upstream receptor tyrosine kinases results in the deregulation of cellular signals governing growth and survival in ∼30% of all human cancers. However, the discovery of potent inhibitors of Ras has been difficult to achieve. Here, we report the identification of small molecules that bind to a unique pocket on the Ras:Son of Sevenless (SOS):Ras complex, increase the rate of SOS-catalyzed nucleotide exchange in vitro, and modulate Ras signaling pathways in cells. X-ray crystallography of Ras:SOS:Ras in complex with these molecules reveals that the compounds bind in a hydrophobic pocket in the CDC25 domain of SOS adjacent to the Switch II region of Ras. The structure-activity relationships exhibited by these compounds can be rationalized on the basis of multiple X-ray cocrystal structures. Mutational analyses confirmed the functional relevance of this binding site and showed it to be essential for compound activity. These molecules increase Ras-GTP levels and disrupt MAPK and PI3K signaling in cells at low micromolar concentrations. These small molecules represent tools to study the acute activation of Ras and highlight a pocket on SOS that may be exploited to modulate Ras signaling.

  6. Single-nucleotide polymorphisms of TNFA and IL1 in allergic rhinitis.

    Science.gov (United States)

    Nasiri, R; Amirzargar, A Akbar; Movahedi, M; Hirbod-Mobarakeh, A; Farhadi, E; Behniafard, N; Tavakkol, M; Ansaripour, B; Moradi, B; Zare, A; Rezaei, N

    2013-01-01

    Allergic rhinitis is a complex polygenic disorder of the upper respiratory tract. Given that proinflammatory cytokines such as tumor necrosis factor (TNF) and interleukin (IL) 1 seem to play a role in the development of allergic rhinitis, we evaluated the associations between various single-nucleotide polymorphisms (SNPs) of the TNF and IL1 genes in a case-control study. The study population comprised 98 patients with allergic rhinitis. Genotyping was performed using polymerase chain reaction with sequence-specific primers for 2 TNFA promoter variants (rs1800629 and rs361525), 1 variant in the promoter region of IL1A (rs1800587), 2 SNPs in the IL1B gene (rs16944 and rs1 143634), 1 variant in the IL1 receptor (rs2234650), and 1 in IL1RA (rs315952). Patients who were homozygous for the T allele of rs16944 in IL1B had an 8.1-fold greater risk of allergic rhinitis than those with the C allele. In TNFA, a significant relationship was also detected between rs1800629 and rs361525 and allergic rhinitis. Except for rs1800587 in IL1A and rs315952 in IL1RA, significant differences were found between the patient and control groups for all other SNPs. We found that allelic variants in the TNFA and IL1 genes were not only associated with the risk of developing allergic rhinitis, but also affected disease course and severity.

  7. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  8. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  9. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  10. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  11. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  12. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  13. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  14. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  15. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  16. Biochemical and immunological studies of the Muscarinic acetylcholine receptor

    International Nuclear Information System (INIS)

    Gainer, M.W.

    1985-01-01

    Muscarinic acetylcholine receptors were solubilized from bovine brain membranes with 3[3-cholamidopropyl)dimethylammonio]propanesulfonate (CHAPS). A combination of 10 mM CHAPS and 1 M NaCl solubilized 15-40% of the specific receptor binding sites from these membranes. The solubilized receptors displayed high affinity binding of the muscarinic antagonist, [ 3 H]quinuclidinyl benzilate with a K/sub D/ = 300 pM. In addition, the solubilized and retained guanyl nucleotide regulation of agonist binding characteristic of membrane bound receptors. Gel filtration experiments showed that solubilized receptors from cortex and cerebellum had different elution profiles. Analysis by sucrose density gradient centrifugation showed that receptors in the lower molecular weight peak sedimented with a coefficient of 5S. Receptors in the larger molecular weight peak sedimented to the bottom of the gradient. Attempts to purify receptors by chromatography on propylbenzilycholine Sepharose were unsuccessful. The technique used to attach the ligand to the solid support, however, was used to synthesize a PrBCM-BSA conjugate and the conjugate used as an antigen in the production of anti-ligand antibodies. Two anti-PrBCM monoclonal antibodies were isolated that recognize muscarinic but not nicotinic cholinergic ligands. The abilities of the antibodies to recognize other muscarinic ligands indicated the antibodies recognized a portion of PrBCM involved in binding to the receptor. Construction of an antibody affinity resin resulted in the purification of this fragment a minimum of 170 fold

  17. AMP Is an Adenosine A1 Receptor Agonist*

    Science.gov (United States)

    Rittiner, Joseph E.; Korboukh, Ilia; Hull-Ryde, Emily A.; Jin, Jian; Janzen, William P.; Frye, Stephen V.; Zylka, Mark J.

    2012-01-01

    Numerous receptors for ATP, ADP, and adenosine exist; however, it is currently unknown whether a receptor for the related nucleotide adenosine 5′-monophosphate (AMP) exists. Using a novel cell-based assay to visualize adenosine receptor activation in real time, we found that AMP and a non-hydrolyzable AMP analog (deoxyadenosine 5′-monophosphonate, ACP) directly activated the adenosine A1 receptor (A1R). In contrast, AMP only activated the adenosine A2B receptor (A2BR) after hydrolysis to adenosine by ecto-5′-nucleotidase (NT5E, CD73) or prostatic acid phosphatase (PAP, ACPP). Adenosine and AMP were equipotent human A1R agonists in our real-time assay and in a cAMP accumulation assay. ACP also depressed cAMP levels in mouse cortical neurons through activation of endogenous A1R. Non-selective purinergic receptor antagonists (pyridoxalphosphate-6-azophenyl-2′,4′-disulfonic acid and suramin) did not block adenosine- or AMP-evoked activation. Moreover, mutation of His-251 in the human A1R ligand binding pocket reduced AMP potency without affecting adenosine potency. In contrast, mutation of a different binding pocket residue (His-278) eliminated responses to AMP and to adenosine. Taken together, our study indicates that the physiologically relevant nucleotide AMP is a full agonist of A1R. In addition, our study suggests that some of the physiological effects of AMP may be direct, and not indirect through ectonucleotidases that hydrolyze this nucleotide to adenosine. PMID:22215671

  18. Structural determination of functional units of the nucleotide binding domain (NBD94 of the reticulocyte binding protein Py235 of Plasmodium yoelii.

    Directory of Open Access Journals (Sweden)

    Ardina Grüber

    2010-02-01

    Full Text Available Invasion of the red blood cells (RBC by the merozoite of malaria parasites involves a large number of receptor ligand interactions. The reticulocyte binding protein homologue family (RH plays an important role in erythrocyte recognition as well as virulence. Recently, it has been shown that members of RH in addition to receptor binding may also have a role as ATP/ADP sensor. A 94 kDa region named Nucleotide-Binding Domain 94 (NBD94 of Plasmodium yoelii YM, representative of the putative nucleotide binding region of RH, has been demonstrated to bind ATP and ADP selectively. Binding of ATP or ADP induced nucleotide-dependent structural changes in the C-terminal hinge-region of NBD94, and directly impacted on the RBC binding ability of RH.In order to find the smallest structural unit, able to bind nucleotides, and its coupling module, the hinge region, three truncated domains of NBD94 have been generated, termed NBD94(444-547, NBD94(566-663 and NBD94(674-793, respectively. Using fluorescence correlation spectroscopy NBD94(444-547 has been identified to form the smallest nucleotide binding segment, sensitive for ATP and ADP, which became inhibited by 4-Chloro-7-nitrobenzofurazan. The shape of NBD94(444-547 in solution was calculated from small-angle X-ray scattering data, revealing an elongated molecule, comprised of two globular domains, connected by a spiral segment of about 73.1 A in length. The high quality of the constructs, forming the hinge-region, NBD94(566-663 and NBD94(674-793 enabled to determine the first crystallographic and solution structure, respectively. The crystal structure of NBD94(566-663 consists of two helices with 97.8 A and 48.6 A in length, linked by a loop. By comparison, the low resolution structure of NBD94(674-793 in solution represents a chair-like shape with three architectural segments.These structures give the first insight into how nucleotide binding impacts on the overall structure of RH and demonstrates the

  19. Changes in calmodulin concentration and cyclic 3',5'-nucleotide phosphodiesterase activity in skeletal muscle of hyper- and hypothyroid rats.

    Science.gov (United States)

    Mano, T; Iwase, K; Yoshimochi, I; Sawai, Y; Oda, N; Nishida, Y; Mokuno, T; Kotake, M; Nakai, A; Hayakawa, N

    1995-08-01

    Hyper- and hypothyroid states occasionally induce skeletal muscle dysfunction i.e. periodic paralysis and thyroid myopathy. The etiology of these diseases remains unclear, but several findings suggest that the catecholamine-beta-receptor-cAMP system or other messenger systems are disturbed in these diseases. In this context, we evaluated changes in the cyclic 3',5'-nucleotide metabolic enzyme, cyclic 3',5'-nucleotide phosphodiesterase (PDE) and calmodulin concentrations in skeletal muscles of hyper- and hypothyroid rats. Activities of cyclic AMP-PDE were low in skeletal muscle both from hyper- and hypothyroid rats, and calmodulin concentration was high in hyperthyroid and low in hypothyroid rats, as compared with normal rats. DE-52 column chromatographic analysis showed that the cGMP hydrolytic activity in peak I and the cAMP hydrolytic activity in peak II were decreased in hypothyroid rats, whereas cAMP hydrolytic activity in peak III was unchanged. The cAMP hydrolytic activity in peak III was decreased in hyperthyroid rats, but the activities in peaks I and II were unchanged. These findings indicate that cAMP and calmodulin may have some role in skeletal muscle function in the hyperthyroid state, and that cAMP and calmodulin-dependent metabolism may be suppressed in the hypothyroid state.

  20. Optimization of cAMP fluorescence dataset from ACTOne cannabinoid receptor 1 cell line

    Directory of Open Access Journals (Sweden)

    Chaela S. Presley

    2016-06-01

    Full Text Available The ACTOne cannabinoid receptor 1 functional system is comprised of transfected HEK cells with the parental cyclic nucleotide gated channel (CNG co-transfected with cannabinoid receptor 1 (CB1. The ACTOne CB1 cell line was evaluated for cAMP driven fluorescence by optimizing experimental conditions for sensitivity to forskolin and CP 55,940, reading time point, reliability of cell passage number, and pertussis inactivation of Gi/o.

  1. Characteristics of the mouse genomic histamine H1 receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, Isao; Taniuchi, Ichiro; Kitamura, Daisuke [Kyushu Univ., Fukuoka (Japan)] [and others

    1996-08-15

    We report here the molecular cloning of a mouse histamine H1 receptor gene. The protein deduced from the nucleotide sequence is composed of 488 amino acid residues with characteristic properties of GTP binding protein-coupled receptors. Our results suggest that the mouse histamine H1 receptor gene is a single locus, and no related sequences were detected. Interspecific backcross analysis indicated that the mouse histamine H1 receptor gene (Hrh1) is located in the central region of mouse Chromosome 6 linked to microphthalmia (Mitfmi), ras-related fibrosarcoma oncogene 1 (Raf1), and ret proto-oncogene (Ret) in a region of homology with human chromosome 3p. 12 refs., 3 figs.

  2. Association of single nucleotide polymorphisms in genes coding ...

    African Journals Online (AJOL)

    The insulin-like growth factor 1 system plays a central role in the growth and development of the mammary gland. Insulin-like growth factor 1 (IGF1) and insulin-like growth factor 1 receptor (IGF1R) have been proposed as candidate genes for milk production traits. This study involved a population of 163 Montbeliarde cows.

  3. Brain purine metabolism and xanthine dehydrogenase/oxidase conversion in hyperammonemia are under control of NMDA receptors and nitric oxide.

    Science.gov (United States)

    Kaminsky, Yury; Kosenko, Elena

    2009-10-19

    In hyperammonemia, a decrease in brain ATP can be a result of adenine nucleotide catabolism. Xanthine dehydrogenase (XD) and xanthine oxidase (XO) are the end steps in the purine catabolic pathway and directly involved in depletion of the adenylate pool in the cell. Besides, XD can easily be converted to XO to produce reactive oxygen species in the cell. In this study, the effects of acute ammonia intoxication in vivo on brain adenine nucleotide pool and xanthine and hypoxanthine, the end degradation products of adenine nucleotides, during the conversion of XD to XO were studied. Injection of rats with ammonium acetate was shown to lead to the dramatic decrease in the ATP level, adenine nucleotide pool size and adenylate energy charge and to the great increase in hypoxanthine and xanthine 11 min after the lethal dose indicating rapid degradation of adenylates. Conversion of XD to XO in hyperammonemic rat brain was evidenced by elevated XO/XD activity ratio. Injection of MK-801, a NMDA receptor blocker, prevented ammonia-induced catabolism of adenine nucleotides and conversion of XD to XO suggesting that in vivo these processes are mediated by activation of NMDA receptors. The in vitro dose-dependent effects of sodium nitroprusside, a NO donor, on XD and XO activities are indicative of the direct modification of the enzymes by nitric oxide. This is the first report evidencing the increase in brain xanthine and hypoxanthine levels and adenine nucleotide breakdown in acute ammonia intoxication and NMDA receptor-mediated prevention of these alterations.

  4. Regulation of cyclic AMP by extracellular ATP in cultured brain capillary endothelial cells

    Science.gov (United States)

    Anwar, Zubeya; Albert, Jennifer L; Gubby, Sharon E; Boyle, John P; Roberts, Jonathon A; Webb, Tania E; Boarder, Michael R

    1999-01-01

    In primary unpassaged rat brain capillary endothelial cell cultures (RBECs), using reverse-transcriptase PCR with primers specific for P2Y receptor subtypes, we detected mRNA for P2Y2, P2Y4 and P2Y6, but not P2Y1 receptors.None of the various nucleotides tested reduced forskolin elevated cyclic AMP levels in RBECs. ATP and ATPγS, as well as adenosine, enhanced cyclic AMP accumulation in the presence of forskolin.Comparison of the concentration response curves to ATPγS with those for ATP and adenosine, at different incubation times, indicated that the response to purine nucleotides was not wholly dependent on conversion to adenosine. Adenosine deaminase abolished the response to adenosine but only reduced the response to ATP by about 50%. These results suggest the participation of a receptor responsive to nucleotides.Isobutylmethylxanthine and 8-sulphophenyltheophylline prevented the cyclic AMP response, while neither 8-cyclopentyl-1,3-dipropylxanthine nor SCH58261 were effective antagonists. 2-chloradenosine gave a robust response, but neither 2-chloro-N6-cyclopentyladenosine nor CGS 21680 were agonists.These results show that adenosine and ATP can elevate the cyclic AMP levels of brain endothelial cells by acting on receptors which have a pharmacology apparently distinct from known P2Y and adenosine receptors. PMID:10510459

  5. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  6. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  7. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  8. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  9. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  10. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  11. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  12. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  13. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  14. Purification of the active C5a receptor from human polymorphonuclear leukocytes as a receptor - G sub i complex

    Energy Technology Data Exchange (ETDEWEB)

    Rollins, T.E.; Siciliano, S.; Kobayashi, S.; Cianciarulo, D.N.; Bonilla-Argudo, V.; Collier, K.; Springer, M.S. (Merck Sharp and Dohme Research Lab., Rahway, NJ (United States))

    1991-02-01

    The authors have isolated, in an active state, the C5a receptor from human polymorphonuclear leukocytes. The purification was achieved in a single step using a C5a affinity column in which the C5a molecule was coupled to the resin through its N terminus. The purified receptor, like the crude solubilized molecule, exhibited a single class of high-affinity binding sites with a K{sub d} of 30 pM. Further, the binding of C5a retained its sensitivity to guanine nucleotides, implying that the purified receptor contained a guanine nucleotide-binding protein (G protein). SDS/PAGE revealed the presence of three polypeptides with molecular masses of 42, 40, and 36 kDa, which were determined to be the C5a-binding subunit and the {alpha} and {beta} subunits of G{sub i}, respectively. The 36- and 40-kDa polypeptides were identified by immunoblotting and by the ability of pertussis toxin to ADP-ribosylate the 40-kDa molecule. These results confirm their earlier hypothesis that the receptor exists as a complex with a G protein in the presence or absence of C5a. The tight coupling between the receptor and G protein should make possible the identification of the G protein(s) involved in the transduction pathways used by C5a to produce its many biological effects.

  15. Purification of the active C5a receptor from human polymorphonuclear leukocytes as a receptor - Gi complex

    International Nuclear Information System (INIS)

    Rollins, T.E.; Siciliano, S.; Kobayashi, S.; Cianciarulo, D.N.; Bonilla-Argudo, V.; Collier, K.; Springer, M.S.

    1991-01-01

    The authors have isolated, in an active state, the C5a receptor from human polymorphonuclear leukocytes. The purification was achieved in a single step using a C5a affinity column in which the C5a molecule was coupled to the resin through its N terminus. The purified receptor, like the crude solubilized molecule, exhibited a single class of high-affinity binding sites with a K d of 30 pM. Further, the binding of C5a retained its sensitivity to guanine nucleotides, implying that the purified receptor contained a guanine nucleotide-binding protein (G protein). SDS/PAGE revealed the presence of three polypeptides with molecular masses of 42, 40, and 36 kDa, which were determined to be the C5a-binding subunit and the α and β subunits of G i , respectively. The 36- and 40-kDa polypeptides were identified by immunoblotting and by the ability of pertussis toxin to ADP-ribosylate the 40-kDa molecule. These results confirm their earlier hypothesis that the receptor exists as a complex with a G protein in the presence or absence of C5a. The tight coupling between the receptor and G protein should make possible the identification of the G protein(s) involved in the transduction pathways used by C5a to produce its many biological effects

  16. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  17. The LDL receptor.

    Science.gov (United States)

    Goldstein, Joseph L; Brown, Michael S

    2009-04-01

    In this article, the history of the LDL receptor is recounted by its codiscoverers. Their early work on the LDL receptor explained a genetic cause of heart attacks and led to new ways of thinking about cholesterol metabolism. The LDL receptor discovery also introduced three general concepts to cell biology: receptor-mediated endocytosis, receptor recycling, and feedback regulation of receptors. The latter concept provides the mechanism by which statins selectively lower plasma LDL, reducing heart attacks and prolonging life.

  18. Receptor for advanced glycation end product polymorphisms and type 2 diabetes: the CODAM study

    NARCIS (Netherlands)

    Gaens, K.H.; Kallen, C.J.; Greevenboek, van M.M.; Feskens, E.J.M.; Stehouwer, C.D.; Schalkwijk, C.G.

    2008-01-01

    Genetic variation in the receptor for advanced glycation end products (RAGE) gene may alter the expression and function of RAGE and affect disease development and outcome. We investigated whether single nucleotide polymorphisms (SNPs) in RAGE were associated with diabetes and parameters of glucose

  19. Vitamin D receptor polymorphisms and growth until adulthood after very premature birth

    NARCIS (Netherlands)

    Finken, Martijn J J; Schrevel, Marlies; Houwing-Duistermaat, Jeanine J.; Kharagjitsingh, Aan V.; Dekker, Friedo W.; Koeleman, Bobby P.; Roep, Bart O.; Wit, Jan M.

    2016-01-01

    The accretion of bone mass is often impaired in preterm infants, which may contribute to postnatal growth failure. We tested the effects of the vitamin D receptor single-nucleotide polymorphisms (SNPs) c1521g, Fok1, Bsm1, and Taq1 on linear growth up until adulthood in 341 subjects born very

  20. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  1. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  2. PHARMACOGENOMICS OF PROSTAGLANDIN AND LEUKOTRIENE RECEPTORS

    Directory of Open Access Journals (Sweden)

    José Antonio Cornejo-García

    2016-09-01

    Full Text Available Individual genetic background together with environmental effects are thought to be behind many human complex diseases. A number of genetic variants, mainly single nucleotide polymorphisms (SNPs, have been shown to be associated with various pathological and inflammatory conditions, representing potential therapeutic targets. Prostaglandins (PTGs and leukotrienes (LTs are eicosanoids derived from arachidonic acid and related polyunsaturated fatty acids that participate in both normal homeostasis and inflammatory conditions. These bioactive lipid mediators are synthesised through two major multistep enzymatic pathways: PTGs by cyclooxygenase and LTs by 5-lipoxygenase. The main physiological effects of PTGs include vasodilation and vascular leakage (PTGE2; mast cell maturation, eosinophil recruitment and allergic responses (PTGD2; vascular and respiratory smooth muscle contraction (PTGF2, and inhibition of platelet aggregation (PTGI2. LTB4 is mainly involved in neutrophil recruitment, vascular leakage, and epithelial barrier function, whereas cysteinyl LTs (CysLTs (LTC4, LTD4 and LTE4 induce bronchoconstriction and neutrophil extravasation, and also participate in vascular leakage. PTGs and LTs exert their biological functions by binding to cognate receptors, which belong to the seven transmembrane, G protein-coupled receptor superfamily. SNPs in genes encoding these receptors may influence their functionality and have a role in disease susceptibility and drug treatment response. In this review we summarize SNPs in PTGs and LTs receptors and their relevance in human diseases. We also provide information on gene expression. Finally, we speculate on future directions for this topic.

  3. Characterization of D1 dopamine receptors in the central nervous system

    International Nuclear Information System (INIS)

    Hess, E.J.

    1987-01-01

    Several lines of evidence suggest an association of central nervous system dopaminergic systems in the etiology of the schizophrenia. Interest in the role of D 1 dopamine receptors has revived with the advent of selective drugs for this dopamine receptor, particularly the D 1 dopamine receptor antagonists, SCH23390. [ 3 H]SCH23390 represents a superior radioligand for labeling the two-state striatal D 1 dopamine receptor in that its high percent specific binding makes it especially suitable for detailed mechanistic studies of this receptor. Striatal D 1 dopamine receptors have been shown to mediate the stimulation of adenylate cyclase activity via a guanine nucleotide regulatory subunit. Forskolin acts in a synergistic manner with dopamine agonists, guanine nucleotides or sodium fluoride to potentiate the stimulation of rat striatal adenylate cyclase activity mediated by these reagents. By using the aforementioned reagents and the irreversible receptor modifying reagent N-ethoxycarbonyl-2-ethoxy-1,2,-dihydroquinoline, we demonstrated that the D 1 dopamine receptor population in rat striatum is not a stoichiometrically-limiting factor in agonist stimulation of adenylate cyclase activity

  4. The N54-αs Mutant Has Decreased Affinity for βγ and Suggests a Mechanism for Coupling Heterotrimeric G Protein Nucleotide Exchange with Subunit Dissociation.

    Science.gov (United States)

    Cleator, John H; Wells, Christopher A; Dingus, Jane; Kurtz, David T; Hildebrandt, John D

    2018-05-01

    Ser54 of G s α binds guanine nucleotide and Mg 2+ as part of a conserved sequence motif in GTP binding proteins. Mutating the homologous residue in small and heterotrimeric G proteins generates dominant-negative proteins, but by protein-specific mechanisms. For α i/o , this results from persistent binding of α to βγ , whereas for small GTP binding proteins and α s this results from persistent binding to guanine nucleotide exchange factor or receptor. This work examined the role of βγ interactions in mediating the properties of the Ser54-like mutants of G α subunits. Unexpectedly, WT- α s or N54- α s coexpressed with α 1B -adrenergic receptor in human embryonic kidney 293 cells decreased receptor stimulation of IP3 production by a cAMP-independent mechanism, but WT- α s was more effective than the mutant. One explanation for this result would be that α s , like Ser47 α i/o , blocks receptor activation by sequestering βγ ; implying that N54- α S has reduced affinity for βγ since it was less effective at blocking IP3 production. This possibility was more directly supported by the observation that WT- α s was more effective than the mutant in inhibiting βγ activation of phospholipase C β 2. Further, in vitro synthesized N54- α s bound biotinylated- βγ with lower apparent affinity than did WT- α s The Cys54 mutation also decreased βγ binding but less effectively than N54- α s Substitution of the conserved Ser in α o with Cys or Asn increased βγ binding, with the Cys mutant being more effective. This suggests that Ser54 of α s is involved in coupling changes in nucleotide binding with altered subunit interactions, and has important implications for how receptors activate G proteins. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

  5. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

    Science.gov (United States)

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

    2014-07-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  6. Short-range intercellular calcium signaling in bone

    DEFF Research Database (Denmark)

    Jørgensen, Niklas Rye

    2005-01-01

    into biological effects in bone. Intercellular calcium waves are increases in intracellular calcium concentration in single cells, subsequently propagating to adjacent cells, and can be a possible mechanism for the coupling of bone formation to bone resorption. The aim of the present studies was to investigate...... whether bone cells are capable of communicating via intercellular calcium signals, and determine by which mechanisms the cells propagate the signals. First, we found that osteoblastic cells can propagate intercellular calcium transients upon mechanical stimulation, and that there are two principally...... different mechanisms for this propagation. One mechanism involves the secretion of a nucleotide, possibly ATP, acting in an autocrine action to purinergic P2Y2 receptors on the neighboring cells, leading to intracellular IP3 generation and subsequent release of calcium from intracellular stores. The other...

  7. Relationships between Single Nucleotide Polymorphism Markers and Meat Quality Traits of Duroc Breeding Stocks in Korea

    Directory of Open Access Journals (Sweden)

    J. S. Choi

    2016-09-01

    Full Text Available This study was conducted to determine the relationships of five intragenic single nucleotide polymorphism (SNP markers (protein kinase adenosine monophosphate-activated γ3 subunit [PRKAG3], fatty acid synthase [FASN], calpastatin [CAST], high mobility group AT-hook 1 [HMGA1], and melanocortin-4 receptor [MC4R] and meat quality traits of Duroc breeding stocks in Korea. A total of 200 purebred Duroc gilts from 8 sires and 40 dams at 4 pig breeding farms from 2010 to 2011 reaching market weight (110 kg were slaughtered and their carcasses were chilled overnight. Longissimus dorsi muscles were removed from the carcass after 24 h of slaughter and used to determine pork properties including carcass weight, backfat thickness, moisture, intramuscular fat, pH24h, shear force, redness, texture, and fatty acid composition. The PRKAG3, FASN, CAST, and MC4R gene SNPs were significantly associated with the meat quality traits (p<0.003. The meats of PRKAG3 (A 0.024/G 0.976 AA genotype had higher pH, redness and texture than those from PRKAG3 GG genotype. Meats of FASN (C 0.301/A 0.699 AA genotype had higher backfat thickness, texture, stearic acid, oleic acid and polyunsaturated fatty acid than FASN CC genotype. While the carcasses of CAST (A 0.373/G 0.627 AA genotype had thicker backfat, and lower shear force, palmitoleic acid and oleic acid content, they had higher stearic acid content than those from the CAST GG genotype. The MC4R (G 0.208/A 0.792 AA genotype were involved in increasing backfat thickness, carcass weight, moisture and saturated fatty acid content, and decreasing unsaturated fatty acid content in Duroc meat. These results indicated that the five SNP markers tested can be a help to select Duroc breed to improve carcass and meat quality properties in crossbred pigs.

  8. Expression Pattern and Localization Dynamics of Guanine Nucleotide Exchange Factor RIC8 during Mouse Oogenesis.

    Directory of Open Access Journals (Sweden)

    Merly Saare

    Full Text Available Targeting of G proteins to the cell cortex and their activation is one of the triggers of both asymmetric and symmetric cell division. Resistance to inhibitors of cholinesterase 8 (RIC8, a guanine nucleotide exchange factor, activates a certain subgroup of G protein α-subunits in a receptor independent manner. RIC8 controls the asymmetric cell division in Caenorhabditis elegans and Drosophila melanogaster, and symmetric cell division in cultured mammalian cells, where it regulates the mitotic spindle orientation. Although intensely studied in mitosis, the function of RIC8 in mammalian meiosis has remained unknown. Here we demonstrate that the expression and subcellular localization of RIC8 changes profoundly during mouse oogenesis. Immunofluorescence studies revealed that RIC8 expression is dependent on oocyte growth and cell cycle phase. During oocyte growth, RIC8 is abundantly present in cytoplasm of oocytes at primordial, primary and secondary preantral follicle stages. Later, upon oocyte maturation RIC8 also populates the germinal vesicle, its localization becomes cell cycle dependent, and it associates with chromatin and the meiotic spindle. After fertilization, RIC8 protein converges to the pronuclei and is also detectable at high levels in the nucleolus precursor bodies of both maternal and paternal pronucleus. During first cleavage of zygote RIC8 localizes in the mitotic spindle and cell cortex of forming blastomeres. In addition, we demonstrate that RIC8 co-localizes with its interaction partners Gαi1/2:GDP and LGN in meiotic/mitotic spindle, cell cortex and polar bodies of maturing oocytes and zygotes. Downregulation of Ric8 by siRNA leads to interferred translocation of Gαi1/2 to cortical region of maturing oocytes and reduction of its levels. RIC8 is also expressed at high level in female reproductive organs e.g. oviduct. Therefore we suggest a regulatory function for RIC8 in mammalian gametogenesis and fertility.

  9. The guanine nucleotide exchange factor RIC8 regulates conidial germination through Gα proteins in Neurospora crassa.

    Directory of Open Access Journals (Sweden)

    Carla J Eaton

    Full Text Available Heterotrimeric G protein signaling is essential for normal hyphal growth in the filamentous fungus Neurospora crassa. We have previously demonstrated that the non-receptor guanine nucleotide exchange factor RIC8 acts upstream of the Gα proteins GNA-1 and GNA-3 to regulate hyphal extension. Here we demonstrate that regulation of hyphal extension results at least in part, from an important role in control of asexual spore (conidia germination. Loss of GNA-3 leads to a drastic reduction in conidial germination, which is exacerbated in the absence of GNA-1. Mutation of RIC8 leads to a reduction in germination similar to that in the Δgna-1, Δgna-3 double mutant, suggesting that RIC8 regulates conidial germination through both GNA-1 and GNA-3. Support for a more significant role for GNA-3 is indicated by the observation that expression of a GTPase-deficient, constitutively active gna-3 allele in the Δric8 mutant leads to a significant increase in conidial germination. Localization of the three Gα proteins during conidial germination was probed through analysis of cells expressing fluorescently tagged proteins. Functional TagRFP fusions of each of the three Gα subunits were constructed through insertion of TagRFP in a conserved loop region of the Gα subunits. The results demonstrated that GNA-1 localizes to the plasma membrane and vacuoles, and also to septa throughout conidial germination. GNA-2 and GNA-3 localize to both the plasma membrane and vacuoles during early germination, but are then found in intracellular vacuoles later during hyphal outgrowth.

  10. Modulation of nucleotide sensitivity of ATP-sensitive potassium channels by phosphatidylinositol-4-phosphate 5-kinase.

    Science.gov (United States)

    Shyng, S L; Barbieri, A; Gumusboga, A; Cukras, C; Pike, L; Davis, J N; Stahl, P D; Nichols, C G

    2000-01-18

    ATP-sensitive potassium channels (K(ATP) channels) regulate cell excitability in response to metabolic changes. K(ATP) channels are formed as a complex of a sulfonylurea receptor (SURx), a member of the ATP-binding cassette protein family, and an inward rectifier K(+) channel subunit (Kir6.x). Membrane phospholipids, in particular phosphatidylinositol (PI) 4,5-bisphosphate (PIP(2)), activate K(ATP) channels and antagonize ATP inhibition of K(ATP) channels when applied to inside-out membrane patches. To examine the physiological relevance of this regulatory mechanism, we manipulated membrane PIP(2) levels by expressing either the wild-type or an inactive form of PI-4-phosphate 5-kinase (PIP5K) in COSm6 cells and examined the ATP sensitivity of coexpressed K(ATP) channels. Channels from cells expressing the wild-type PIP5K have a 6-fold lower ATP sensitivity (K(1/2), the half maximal inhibitory concentration, approximately 60 microM) than the sensitivities from control cells (K(1/2) approximately 10 microM). An inactive form of the PIP5K had little effect on the K(1/2) of wild-type channels but increased the ATP-sensitivity of a mutant K(ATP) channel that has an intrinsically lower ATP sensitivity (from K(1/2) approximately 450 microM to K(1/2) approximately 100 microM), suggesting a decrease in membrane PIP(2) levels as a consequence of a dominant-negative effect of the inactive PIP5K. These results show that PIP5K activity, which regulates PIP(2) and PI-3,4,5-P(3) levels, is a significant determinant of the physiological nucleotide sensitivity of K(ATP) channels.

  11. Incorporating Single-nucleotide Polymorphisms Into the Lyman Model to Improve Prediction of Radiation Pneumonitis

    Energy Technology Data Exchange (ETDEWEB)

    Tucker, Susan L., E-mail: sltucker@mdanderson.org [Department of Bioinformatics and Computational Biology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Li Minghuan [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Xu Ting; Gomez, Daniel [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Yuan Xianglin [Department of Oncology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Yu Jinming [Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); Liu Zhensheng; Yin Ming; Guan Xiaoxiang; Wang Lie; Wei Qingyi [Department of Epidemiology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Mohan, Radhe [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Vinogradskiy, Yevgeniy [University of Colorado School of Medicine, Aurora, Colorado (United States); Martel, Mary [Department of Radiation Physics, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao Zhongxing [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2013-01-01

    Purpose: To determine whether single-nucleotide polymorphisms (SNPs) in genes associated with DNA repair, cell cycle, transforming growth factor-{beta}, tumor necrosis factor and receptor, folic acid metabolism, and angiogenesis can significantly improve the fit of the Lyman-Kutcher-Burman (LKB) normal-tissue complication probability (NTCP) model of radiation pneumonitis (RP) risk among patients with non-small cell lung cancer (NSCLC). Methods and Materials: Sixteen SNPs from 10 different genes (XRCC1, XRCC3, APEX1, MDM2, TGF{beta}, TNF{alpha}, TNFR, MTHFR, MTRR, and VEGF) were genotyped in 141 NSCLC patients treated with definitive radiation therapy, with or without chemotherapy. The LKB model was used to estimate the risk of severe (grade {>=}3) RP as a function of mean lung dose (MLD), with SNPs and patient smoking status incorporated into the model as dose-modifying factors. Multivariate analyses were performed by adding significant factors to the MLD model in a forward stepwise procedure, with significance assessed using the likelihood-ratio test. Bootstrap analyses were used to assess the reproducibility of results under variations in the data. Results: Five SNPs were selected for inclusion in the multivariate NTCP model based on MLD alone. SNPs associated with an increased risk of severe RP were in genes for TGF{beta}, VEGF, TNF{alpha}, XRCC1 and APEX1. With smoking status included in the multivariate model, the SNPs significantly associated with increased risk of RP were in genes for TGF{beta}, VEGF, and XRCC3. Bootstrap analyses selected a median of 4 SNPs per model fit, with the 6 genes listed above selected most often. Conclusions: This study provides evidence that SNPs can significantly improve the predictive ability of the Lyman MLD model. With a small number of SNPs, it was possible to distinguish cohorts with >50% risk vs <10% risk of RP when they were exposed to high MLDs.

  12. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  13. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  14. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  15. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  16. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  17. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  18. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  19. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  20. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  1. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  2. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  3. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  4. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  5. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  6. Identification of a murine cysteinyl leukotriene receptor by expression in Xenopus laevis oocytes

    DEFF Research Database (Denmark)

    Mollerup, Jens; Jørgensen, Sune T.; Hougaard, Charlotte

    2001-01-01

    We report the identification of an EST encoding a murine cysteinyl leukotriene (mCysLT) receptor. LTD4, LTC4 and LTE4 but not LTB4 or various nucleotides activated Ca2+-evoked Cl- currents in mCysLT1 expressing Xenopus laevis oocytes. The response to LTD4 was blocked by MK-571, reduced by pretrea...... by pretreatment with pertussis toxin (PTX), and was partly dependent on extracellular Ca2+. The identified murine CysLT1 receptor differs from the hCysLT1 receptor with regard to PTX sensitivity, receptor-mediated Ca2+ influx, and antagonist sensitivity....

  7. Functional somatostatin receptors on a rat pancreatic acinar cell line

    International Nuclear Information System (INIS)

    Viguerie, N.; Tahiri-Jouti, N.; Esteve, J.P.; Clerc, P.; Logsdon, C.; Svoboda, M.; Susini, C.; Vaysse, N.; Ribet, A.

    1988-01-01

    Somatostatin receptors from a rat pancreatic acinar cell line, AR4-2J, were characterized biochemically, structurally, and functionally. Binding of 125 I-[Tyr 11 ]Somatostatin to AR4-2J cells was saturable, exhibiting a single class of high-affinity binding sites with a maximal binding capacity of 258 ± 20 fmol/10 6 cells. Somatostatin receptor structure was analyzed by covalently cross-linking 125 I-[Tyr 11 ]somatostatin to its plasma membrane receptors. Gel electrophoresis and autoradiography of cross-linked proteins revealed a peptide containing the somatostatin receptor. Somatostatin inhibited vasoactive intestinal peptide (VIP)-stimulated adenosine 3',5'-cyclic monophosphate (cAMP) formation in a dose-dependent manner. The concentration of somatostatin that caused half-maximal inhibition of cAMP formation was close to the receptor affinity for somatostatin. Pertussis toxin pretreatment of AR4-2J cells prevented somatostatin inhibition of VIP-stimulated cAMP formation as well as somatostatin binding. The authors conclude that AR4-2J cells exhibit functional somatostatin receptors that retain both specificity and affinity of the pancreatic acinar cell somatostatin receptors and act via the pertussis toxin-sensitive guanine nucleotide-binding protein N i to inhibit adenylate cyclase

  8. Guanine nucleotide-dependent, pertussis toxin-insensitive, stimulation of inositol phosphate formation by carbachol in a membrane preparation from astrocytoma cells

    International Nuclear Information System (INIS)

    Hepler, J.R.; Harden, T.K.

    1986-01-01

    Formation of the inositol phosphates (InsP), InsP 3 , InsP 2 , and InsP 1 was increased in a concentration dependent manner (K/sub 0.5/ ∼ 5 μM) by GTPΣS in washed membranes prepared from 3 H-inositol-prelabelled 1321N1 human astrocytoma cells. Both GTPγS and GppNHp stimulated InsP formation by 2-3 fold over control; GTP and GDP were much less efficacious and GMP had no effect. Although the muscarinic cholinergic receptor agonist carbachol had no effect in the absence of guanine nucleotide, in the presence of 10 μM GTPγS, carbachol stimulated (K/sub 0.5/ ∼ 10 μ M) the formation of InsP above the level achieved with GTPγS alone. The effect of carbachol was completely blocked by atropine. The order of potency for a series of nucleotides for stimulation of InsP formation in the presence of 500 μM carbachol was GTPγS > GppNHp > GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate G/sub i/, had no effect on InsP formation in the presence of GTPγS or GTPγS plus carbachol. Histamine and bradykinin also stimulated InsP formation in the presence of GTPγS in washed membranes from 1321N1 cells. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not G/sub i/ is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells

  9. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  10. Luminal nucleotides are tonic inhibitors of renal tubular transport

    DEFF Research Database (Denmark)

    Leipziger, Jens Georg

    2011-01-01

    PURPOSE OF REVIEW: Extracellular ATP is an essential local signaling molecule in all organ systems. In the kidney, purinergic signaling is involved in an array of functions and this review highlights those of relevance for renal tubular transport. RECENT FINDINGS: Purinergic receptors are express...... discovered as an important signaling compartment in which local purinergic signaling determines an inhibitory tone for renal tubular transport. Blocking components of this system leads to tubular hyper-absorption, volume retention and elevated blood pressure.......PURPOSE OF REVIEW: Extracellular ATP is an essential local signaling molecule in all organ systems. In the kidney, purinergic signaling is involved in an array of functions and this review highlights those of relevance for renal tubular transport. RECENT FINDINGS: Purinergic receptors are expressed...... in all renal tubular segments and their stimulation generally leads to transport inhibition. Recent evidence has identified the tubular lumen as a restricted space for purinergic signaling. The concentrations of ATP in the luminal fluids are sufficiently high to inflict a tonic inhibition of renal...

  11. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  12. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  13. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  14. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  15. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  16. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  17. Substrate coated with receptor and labelled ligand for assays

    International Nuclear Information System (INIS)

    1980-01-01

    Improvements in the procedures for assaying ligands are described. The assay consists of a polystyrene tube on which receptors are present for both the ligand to be assayed and a radioactively labelled form of the ligand. The receptors on the bottom portion of the tube are also coated with labelled ligands, thus eliminating the necessity for separate addition of the labelled ligand and sample during an assay. Examples of ligands to which this method is applicable include polypeptides, nucleotides, nucleosides and proteins. Specific examples are given in which the ligand to be assayed is digoxin, the labelled form of the ligand is 3-0-succinyl digoxyigenin tyrosine ( 125 I) and the receptor is digoxin antibody. (U.K.)

  18. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer

    2014-03-01

    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  19. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  20. Transient receptor potential channel polymorphisms are associated with the somatosensory function in neuropathic pain patients.

    Directory of Open Access Journals (Sweden)

    Andreas Binder

    Full Text Available Transient receptor potential channels are important mediators of thermal and mechanical stimuli and play an important role in neuropathic pain. The contribution of hereditary variants in the genes of transient receptor potential channels to neuropathic pain is unknown. We investigated the frequency of transient receptor potential ankyrin 1, transient receptor potential melastin 8 and transient receptor potential vanilloid 1 single nucleotide polymorphisms and their impact on somatosensory abnormalities in neuropathic pain patients. Within the German Research Network on Neuropathic Pain (Deutscher Forscbungsverbund Neuropathischer Schmerz 371 neuropathic pain patients were phenotypically characterized using standardized quantitative sensory testing. Pyrosequencing was employed to determine a total of eleven single nucleotide polymorphisms in transient receptor potential channel genes of the neuropathic pain patients and a cohort of 253 German healthy volunteers. Associations of quantitative sensory testing parameters and single nucleotide polymorphisms between and within groups and subgroups, based on sensory phenotypes, were analyzed. Single nucleotide polymorphisms frequencies did not differ between both the cohorts. However, in neuropathic pain patients transient receptor potential ankyrin 1 710G>A (rs920829, E179K was associated with the presence of paradoxical heat sensation (p = 0.03, and transient receptor potential vanilloid 1 1911A>G (rs8065080, I585V with cold hypoalgesia (p = 0.0035. Two main subgroups characterized by preserved (1 and impaired (2 sensory function were identified. In subgroup 1 transient receptor potential vanilloid 1 1911A>G led to significantly less heat hyperalgesia, pinprick hyperalgesia and mechanical hypaesthesia (p = 0.006, p = 0.005 and pG (rs222747, M315I to cold hypaesthesia (p = 0.002, but there was absence of associations in subgroup 2. In this study we found no evidence that genetic

  1. Forced unbinding of GPR17 ligands from wild type and R255I mutant receptor models through a computational approach

    Directory of Open Access Journals (Sweden)

    Fantucci Piercarlo

    2010-03-01

    Full Text Available Abstract Background GPR17 is a hybrid G-protein-coupled receptor (GPCR activated by two unrelated ligand families, extracellular nucleotides and cysteinyl-leukotrienes (cysteinyl-LTs, and involved in brain damage and repair. Its exploitment as a target for novel neuro-reparative strategies depends on the elucidation of the molecular determinants driving binding of purinergic and leukotrienic ligands. Here, we applied docking and molecular dynamics simulations (MD to analyse the binding and the forced unbinding of two GPR17 ligands (the endogenous purinergic agonist UDP and the leukotriene receptor antagonist pranlukast from both the wild-type (WT receptor and a mutant model, where a basic residue hypothesized to be crucial for nucleotide binding had been mutated (R255I to Ile. Results MD suggested that GPR17 nucleotide binding pocket is enclosed between the helical bundle and extracellular loop (EL 2. The driving interaction involves R255 and the UDP phosphate moiety. To support this hypothesis, steered MD experiments showed that the energy required to unbind UDP is higher for the WT receptor than for R255I. Three potential binding sites for pranlukast where instead found and analysed. In one of its preferential docking conformations, pranlukast tetrazole group is close to R255 and phenyl rings are placed into a subpocket highly conserved among GPCRs. Pulling forces developed to break polar and aromatic interactions of pranlukast were comparable. No differences between the WT receptor and the R255I receptor were found for the unbinding of pranlukast. Conclusions These data thus suggest that, in contrast to which has been hypothesized for nucleotides, the lack of the R255 residue doesn't affect the binding of pranlukast a crucial role for R255 in binding of nucleotides to GPR17. Aromatic interactions are instead likely to play a predominant role in the recognition of pranlukast, suggesting that two different binding subsites are present on GPR17.

  2. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  3. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  4. Receptor-receptor interactions within receptor mosaics. Impact on neuropsychopharmacology.

    Science.gov (United States)

    Fuxe, K; Marcellino, D; Rivera, A; Diaz-Cabiale, Z; Filip, M; Gago, B; Roberts, D C S; Langel, U; Genedani, S; Ferraro, L; de la Calle, A; Narvaez, J; Tanganelli, S; Woods, A; Agnati, L F

    2008-08-01

    Future therapies for diseases associated with altered dopaminergic signaling, including Parkinson's disease, schizophrenia and drug addiction or drug dependence may substantially build on the existence of intramembrane receptor-receptor interactions within dopamine receptor containing receptor mosaics (RM; dimeric or high-order receptor oligomers) where it is believed that the dopamine D(2) receptor may operate as the 'hub receptor' within these complexes. The constitutive adenosine A(2A)/dopamine D(2) RM, located in the dorsal striato-pallidal GABA neurons, are of particular interest in view of the demonstrated antagonistic A(2A)/D(2) interaction within these heteromers; an interaction that led to the suggestion and later demonstration that A(2A) antagonists could be used as novel anti-Parkinsonian drugs. Based on the likely existence of A(2A)/D(2)/mGluR5 RM located both extrasynaptically on striato-pallidal GABA neurons and on cortico-striatal glutamate terminals, multiple receptor-receptor interactions within this RM involving synergism between A(2A)/mGluR5 to counteract D(2) signaling, has led to the proposal of using combined mGluR5 and A(2A) antagonists as a future anti-Parkinsonian treatment. Based on the same RM in the ventral striato-pallidal GABA pathways, novel strategies for the treatment of schizophrenia, building on the idea that A(2A) agonists and/or mGluR5 agonists will help reduce the increased dopaminergic signaling associated with this disease, have been suggested. Such treatment may ensure the proper glutamatergic drive from the mediodorsal thalamic nucleus to the prefrontal cortex, one which is believed to be reduced in schizophrenia due to a dominance of D(2)-like signaling in the ventral striatum. Recently, A(2A) receptors also have been shown to counteract the locomotor and sensitizing actions of cocaine and increases in A(2A) receptors have also been observed in the nucleus accumbens after extended cocaine self-administration, probably

  5. Personal receptor repertoires: olfaction as a model

    Directory of Open Access Journals (Sweden)

    Olender Tsviya

    2012-08-01

    Full Text Available Abstract Background Information on nucleotide diversity along completely sequenced human genomes has increased tremendously over the last few years. This makes it possible to reassess the diversity status of distinct receptor proteins in different human individuals. To this end, we focused on the complete inventory of human olfactory receptor coding regions as a model for personal receptor repertoires. Results By performing data-mining from public and private sources we scored genetic variations in 413 intact OR loci, for which one or more individuals had an intact open reading frame. Using 1000 Genomes Project haplotypes, we identified a total of 4069 full-length polypeptide variants encoded by these OR loci, average of ~10 per locus, constituting a lower limit for the effective human OR repertoire. Each individual is found to harbor as many as 600 OR allelic variants, ~50% higher than the locus count. Because OR neuronal expression is allelically excluded, this has direct effect on smell perception diversity of the species. We further identified 244 OR segregating pseudogenes (SPGs, loci showing both intact and pseudogene forms in the population, twenty-six of which are annotatively “resurrected” from a pseudogene status in the reference genome. Using a custom SNP microarray we validated 150 SPGs in a cohort of 468 individuals, with every individual genome averaging 36 disrupted sequence variations, 15 in homozygote form. Finally, we generated a multi-source compendium of 63 OR loci harboring deletion Copy Number Variations (CNVs. Our combined data suggest that 271 of the 413 intact OR loci (66% are affected by nonfunctional SNPs/indels and/or CNVs. Conclusions These results portray a case of unusually high genetic diversity, and suggest that individual humans have a highly personalized inventory of functional olfactory receptors, a conclusion that might apply to other receptor multigene families.

  6. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  7. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  8. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  9. Acetylcholine receptor antibody

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003576.htm Acetylcholine receptor antibody To use the sharing features on this page, please enable JavaScript. Acetylcholine receptor antibody is a protein found in the blood of ...

  10. Prognostic significance of interleukin-7 receptor-α gene polymorphisms in allogeneic stem-cell transplantation: a confirmatory study

    DEFF Research Database (Denmark)

    Shamim, Zaiba; Ryder, Lars P; Christensen, Ib J

    2011-01-01

    BACKGROUND: Interleukin-7 (IL-7) is a hematopoietic cytokine essential for T-cell development in the thymus and for the maintenance of peripheral T cells. A previous study of single nucleotide polymorphisms in the exons of IL-7 receptor a-chain (IL-7Ra) in a Danish cohort of patients undergoing a...

  11. Interleukin-6-receptor polymorphisms rs12083537, rs2228145, and rs4329505 as predictors of response to tocilizumab in rheumatoid arthritis

    DEFF Research Database (Denmark)

    Enevold, Christian; Baslund, Bo; Linde, Louise

    2014-01-01

    Tocilizumab (TCZ), a monoclonal antibody targeting the human interleukin-6-receptor (IL-6R), is indicated for the treatment of rheumatoid arthritis (RA). We examined whether three IL6R single-nucleotide polymorphisms rs12083537, rs2228145 (formerly rs8192284), and rs4329505 with previously report...

  12. Confirmation of 5p12 as a susceptibility locus for progesterone-receptor- positive, lower grade breast cancer

    NARCIS (Netherlands)

    R.L. Milne (Roger); E.L. Goode (Ellen); M. García-Closas (Montserrat); F.J. Couch (Fergus); G. Severi (Gianluca); R. Hein (Rebecca); Z. Fredericksen (Zachary); N. Malats (Núria); M.P. Zamora (Pilar); J.I.A. Perez (Jose Ignacio Arias); J. Benítez (Javier); T. Dörk (Thilo); P. Schürmann (Peter); J.H. Karstens (Johann); P. Hillemanns (Peter); A. Cox (Angela); I.W. Brock (Ian); K.S. Elliot (Katherine); S.S. Cross (Simon); S. Seal (Sheila); C. Turnbull (Clare); A. Renwick (Anthony); N. Rahman (Nazneen); C-Y. Shen (Chen-Yang); J-C. Yu (Jyh-Cherng); C.-S. Huang (Chiun-Sheng); M.-F. Hou (Ming-Feng); B.G. Nordestgaard (Børge); S.E. Bojesen (Stig); C. Lanng (Charlotte); G.G. Alnæs (Grethe); V. Kristensen (Vessela); A.-L. Børrensen-Dale (Anne-Lise); J.L. Hopper (John); G.S. Dite (Gillian); C. Apicella (Carmel); M.C. Southey (Melissa); D. Lambrechts (Diether); B.T. Yesilyurt (Betül); O.A.M. Floris; K. Leunen; S. Sangrajrang (Suleeporn); V. Gaborieau (Valerie); P. Brennan (Paul); J.D. McKay (James); J. Chang-Claude (Jenny); S. Wang-Gohrke (Shan); P. Radice (Paolo); P. Peterlongo (Paolo); S. Manoukian (Siranoush); M. Barile (Monica); G.G. Giles (Graham); L. Baglietto (Laura); E.M. John (Esther); A. Miron (Alexander); S.J. Chanock (Stephen); J. Lissowska (Jolanta); M.E. Sherman (Mark); J.D. Figueroa (Jonine); N.V. Bogdanova (Natalia); N.N. Antonenkova (Natalia); I.V. Zalutsky (Iosif); Y.I. Rogov (Yuri); P.A. Fasching (Peter); T. Bayer (T.); A.B. Ekici (Arif); M.W. Beckmann (Matthias); H. Brenner (Hermann); H. Müller (Heike); V. Arndt (Volker); C. Stegmaier (Christa); I.L. Andrulis (Irene); J.A. Knight (Julia); G. Glendon (Gord); A.M. Mulligan (Anna Marie); A. Mannermaa (Arto); V. Kataja (Vesa); V-M. Kosma (Veli-Matti); J. Hartikainen (Jaana); A. Meindl (Alfons); J. Heil (Joerg); C.R. Bartram (Claus); R.K. Schmutzler (Rita); G. Thomas (Gilles); R.N. Hoover (Robert); O. Fletcher (Olivia); L.J. Gibson (Lorna); I. dos Santos Silva (Isabel); J. Peto (Julian); S. Nickels (Stefan); D. Flesch-Janys (Dieter); H. Anton-Culver (Hoda); A. Ziogas (Argyrios); E.J. Sawyer (Elinor); I.P. Tomlinson (Ian); M. Kerin (Michael); N. Miller (Nicola); M.K. Schmidt (Marjanka); A. Broeks (Annegien); L.J. van 't Veer (Laura); R.A.E.M. Tollenaar (Rob); P.D.P. Pharoah (Paul); A.M. Dunning (Alison); K.A. Pooley (Karen); F. Marme (Federick); A. Schneeweiss (Andreas); C. Sohn (Christof); B. Burwinkel (Barbara); A. Jakubowska (Anna); J. Lubinski (Jan); K. Jaworska (Katarzyna); K. Durda (Katarzyna); D. Kang (Daehee); K-Y. Yoo (Keun-Young); D-Y. Noh (Dong-Young); S.-H. Ahn (Sei-Hyun); D. Hunter (David); S.E. Hankinson (Susan); P. Kraft (Peter); S. Lindstrom (Stephen); X. Chen (Xiaoqing); J. Beesley (Jonathan); U. Hamann (Ute); V. Harth (Volker); C. Justenhoven (Christina); R. Winqvist (Robert); K. Pykäs (Katri); A. Jukkola-Vuorinen (Arja); M. Grip (Mervi); M.J. Hooning (Maartje); A. Hollestelle (Antoinette); R.A. Oldenburg (Rogier); M.M.A. Tilanus-Linthorst (Madeleine); E.K. Khusnutdinova (Elza); M. Bermisheva (Marina); D. Prokofieva (Darya); A. Farahtdinova (Albina); J.E. Olson (Janet); X. Wang (Xing); M.K. Humphreys (Manjeet); Q. Wang (Qing); G. Chenevix-Trench (Georgia); D.F. Easton (Douglas)

    2011-01-01

    textabstractBackground: The single-nucleotide polymorphism (SNP) 5p12-rs10941679 has been found to be associated with risk of breast cancer, particularly estrogen receptor (ER)-positive disease. We aimed to further explore this association overall, and by tumor histopathology, in the Breast Cancer

  13. Common Variants Near Melanocortin 4 Receptor Are Associated with General and Visceral Adiposity in European- and African-American Youth

    NARCIS (Netherlands)

    Liu, Gaifen; Zhu, Haidong; Lagou, Vasiliki; Gutin, Bernard; Barbeau, Paule; Treiber, Frank A.; Dong, Yanbin; Snieder, Harold

    Objective Recent genome-wide association studies found common variants near the melanocortin 4 receptor gene associated with obesity. This study aimed to assess the influence of the identified single nucleotide polymorphisms rs17782313 and rs17700633 on general and visceral adiposity in European-and

  14. Cooperative ethylene receptor signaling

    OpenAIRE

    Liu, Qian; Wen, Chi-Kuang

    2012-01-01

    The gaseous plant hormone ethylene is perceived by a family of five ethylene receptor members in the dicotyledonous model plant Arabidopsis. Genetic and biochemical studies suggest that the ethylene response is suppressed by ethylene receptor complexes, but the biochemical nature of the receptor signal is unknown. Without appropriate biochemical measures to trace the ethylene receptor signal and quantify the signal strength, the biological significance of the modulation of ethylene responses ...

  15. Characterization and visualization of cholecystokinin receptors in rat brain using [3H]pentagastrin

    International Nuclear Information System (INIS)

    Gaudreau, P.; Quirion, R.; St Pierre, S.; Pert, C.B.

    1983-01-01

    [ 3 H]Pentagastrin binds specifically to an apparent single class of CCK receptors on slide-mounted sections of rat brain (KD . 5.6 nM; Bmax . 36.6 fmol/mg protein). This specific binding is temperature-dependent and regulated by ions and nucleotides. The relative potencies of C-terminal fragments of CCK-8(SO 3 H), benzotript and proglumide in inhibiting specific [ 3 H]pentagastrin binding to CCK brain receptors reinforce the concept of different brain and pancreas CCK receptors. CCK receptors were visualized by using tritium-sensitive LKB film analyzed by computerized densitometry. CCK receptors are highly concentrated in the cortex, dentate gyrus, granular and external plexiform layers of the olfactory bulb, anterior olfactory nuclei, olfactory tubercle, claustrum, accumbens nucleus, some nuclei of the amygdala, thalamus and hypothalamus

  16. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  17. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  18. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  19. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  20. FGF receptor genes and breast cancer susceptibility

    DEFF Research Database (Denmark)

    Agarwal, D; Pineda, S; Michailidou, K

    2014-01-01

    Background:Breast cancer is one of the most common malignancies in women. Genome-wide association studies have identified FGFR2 as a breast cancer susceptibility gene. Common variation in other fibroblast growth factor (FGF) receptors might also modify risk. We tested this hypothesis by studying...... genotyped single-nucleotide polymorphisms (SNPs) and imputed SNPs in FGFR1, FGFR3, FGFR4 and FGFRL1 in the Breast Cancer Association Consortium.Methods:Data were combined from 49 studies, including 53 835 cases and 50 156 controls, of which 89 050 (46 450 cases and 42 600 controls) were of European ancestry......, 12 893 (6269 cases and 6624 controls) of Asian and 2048 (1116 cases and 932 controls) of African ancestry. Associations with risk of breast cancer, overall and by disease sub-type, were assessed using unconditional logistic regression.Results:Little evidence of association with breast cancer risk...

  1. An unusual protein kinase phosphorylates the chemotactic receptor of Dictystelium discoideum

    International Nuclear Information System (INIS)

    Meier, K.; Klein, C.

    1988-01-01

    The authors report the cAMP-dependent phosphorylation of the chemotactic receptor of Dictyostelium discoideum in partially purified plasma membranes. The protein kinase responsible for receptor phosphorylation is associated with this fraction and preferentially phosphorylates the ligand-occupied form of the receptor. 8-Azido[ 32 P]cAMP labeling of the cell surface has shown that the cAMP receptor exists in two forms. A 45-kDa protein is predominant on unstimulated cells. cAMP stimulation results in an increased receptor phosphorylation such that the receptor migrates on NaDodSO 4 /PAGE as a 47-kDa protein. Phosphorylation of the chemotactic receptor is not detected in membrane preparations unless cAMP is added to the incubation mixture. Only under those conditions is the phosphorylated 47-kDa form observed. The requirement for cAMP reflects the fact that the kinase involved preferentially uses the ligand-occupied receptor as a substrate. In vitro phosphorylation of the receptor does not involve tyrosine residues. The enzyme does not appear to be a cAMP- or cGMP-dependent protein kinase nor is it sensitive to guanine nucleotides, Ca 2+ /calmodulin, Ca 2+ /phospholipid, or EGTA. Similarities with the β-adrenergic receptor protein kinase are discussed

  2. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  3. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  4. Fc receptor gamma subunit polymorphisms and systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Al-Ansari, Aliya; Ollier, W.E.; Gonzalez-Gay, Miguel A.; Gul, Ahmet; Inanac, Murat; Ordi, Jose; Teh, Lee-Suan; Hajeer, Ali H.

    2004-01-01

    To investigate the possible association between Fc receptor gamma polymorphisms and systemic lupus erythematosus (SLE). We have investigated the full FcR gamma gene for polymorphisms using polymerase chain reaction (PCR)-single strand confirmational polymorphisms and DNA sequencing .The polymorphisms identified were genotype using PCR-restriction fragment length polymorphism. Systemic lupus erythematosus cases and controls were available from 3 ethnic groups: Turkish, Spanish and Caucasian. The study was conducted in the year 2001 at the Arthritis Research Campaign, Epidemiology Unit, Manchester University Medical School, Manchester, United Kingdom. Five single nucleotide polymorphisms were identified, 2 in the promoter, one in intron 4 and, 2 in the 3'UTR. Four of the 5 single nucleotide polymorphisms (SNPs) were relatively common and investigated in the 3 populations. Allele and genotype frequencies of all 4 investigated SNPs were not statistically different cases and controls. fc receptor gamma gene does not appear to contribute to SLE susceptibility. The identified polymorphisms may be useful in investigating other diseases where receptors containing the FcR gamma subunit contribute to the pathology. (author)

  5. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  6. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  7. Association between single nucleotide polymorphisms of the interleukin-4 gene and atopic dermatitis.

    Science.gov (United States)

    Gharagozlou, Mohammad; Behniafard, Nasrin; Amirzargar, Ali Akbar; Hosseinverdi, Sima; Sotoudeh, Soheila; Farhadi, Elham; Khaledi, Mojdeh; Aryan, Zahra; Moghaddam, Zahra Gholizadeh; Mahmoudi, Maryam; Aghamohammadi, Asghar; Rezaei, Nima

    2015-01-01

    Atopic dermatitis (AD) is an inflammatory skin disease in which both genetic and environmental factors seem to be involved. Several studies investigated the association of certain genetic factors with AD in different ethnic groups, but conflicting data were obtained. This study was performed to check the possible association between single nucleotide polymorphisms (SNPs) of interleukin 4 (IL-4) and the IL-4 receptor α chain (IL-4Rα) and AD in a group of Iranian patients. The allele and genotype frequencies of genes encoding for IL-4 and IL-4Rα were investigated in 89 patients with AD in comparison with 139 healthy controls, using methods based on polymerase chain reaction sequence-specific primers. The most frequent alleles of IL-4 in patients were T at -1098 (P<0.001, odds ratio (OR)=2.35), C at -590 (P<0.001, OR=4.84) and C at -33 (P=0.002, OR=2.08). The most frequent genotypes of IL-4 in patients were TT, CC, and CC at positions -1098 (P<0.001, OR=3.59), -590 (P<0.001, OR=31.25) and -33 (P<0.001, OR=3.46), respectively. We found a significant lower frequency of GT at -1098 GT, TC at -590, and TC at -33 in patients. There were no statistically significant differences in the frequency of alleles and genotypes of IL-4Rα gene at position +1902. A strong positive association was seen between TCC haplotype and AD (68% in patients vs. 23.4% in controls, P<0.001, OR=8.91). We detected a significantly lower frequency of TTC, GCC, and TTT haplotypes (P<0.001, OR=0.02, P<0.001, OR=0.40, P<0.001, OR=0.39, respectively) in patients compared to controls. A significant association between the polymorphisms of the IL-4 gene promoter at positions -1098, -590, and -33 and AD was detected in the Iranian population.

  8. Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramensky Vasily E

    2007-01-01

    Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously

  9. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  10. Assay for identification of heterozygous single-nucleotide polymorphism (Ala67Thr in human poliovirus receptor gene

    Directory of Open Access Journals (Sweden)

    Shyam Sundar Nandi

    2016-01-01

    Results: A new SNP assay for detection of heterozygous Ala67Thr genotype was developed and validated by testing 150 DNA samples. Heterozygous CD155 was detected in 27.33 per cent (41/150 of DNA samples tested by both SNP detection assay and sequencing. Interpretation & conclusions: The SNP detection assay was successfully developed for identification of Ala67Thr polymorphism in human PVR/CD155 gene. The SNP assay will be useful for large scale screening of DNA samples.

  11. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  12. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Science.gov (United States)

    Hepp, Diego; Gonçalves, Gislene Lopes; de Freitas, Thales Renato Ochotorena

    2015-01-01

    The melanocortin 1 receptor (MC1R) is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs) in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC) phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H); C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  13. Prediction of the damage-associated non-synonymous single nucleotide polymorphisms in the human MC1R gene.

    Directory of Open Access Journals (Sweden)

    Diego Hepp

    Full Text Available The melanocortin 1 receptor (MC1R is involved in the control of melanogenesis. Polymorphisms in this gene have been associated with variation in skin and hair color and with elevated risk for the development of melanoma. Here we used 11 computational tools based on different approaches to predict the damage-associated non-synonymous single nucleotide polymorphisms (nsSNPs in the coding region of the human MC1R gene. Among the 92 nsSNPs arranged according to the predictions 62% were classified as damaging in more than five tools. The classification was significantly correlated with the scores of two consensus programs. Alleles associated with the red hair color (RHC phenotype and with the risk of melanoma were examined. The R variants D84E, R142H, R151C, I155T, R160W and D294H were classified as damaging by the majority of the tools while the r variants V60L, V92M and R163Q have been predicted as neutral in most of the programs The combination of the prediction tools results in 14 nsSNPs indicated as the most damaging mutations in MC1R (L48P, R67W, H70Y, P72L, S83P, R151H, S172I, L206P, T242I, G255R, P256S, C273Y, C289R and R306H; C273Y showed to be highly damaging in SIFT, Polyphen-2, MutPred, PANTHER and PROVEAN scores. The computational analysis proved capable of identifying the potentially damaging nsSNPs in MC1R, which are candidates for further laboratory studies of the functional and pharmacological significance of the alterations in the receptor and the phenotypic outcomes.

  14. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  15. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  16. Chromosomal organization of adrenergic receptor genes

    International Nuclear Information System (INIS)

    Yang-Feng, T.L.; Xue, Feiyu; Zhong, Wuwei; Cotecchia, S.; Frielle, T.; Caron, M.G.; Lefkowitz, R.J.; Francke, U.

    1990-01-01

    The adrenergic receptors (ARs) (subtypes α 1 , α 2 , β 1 , and β 2 ) are a prototypic family of guanine nucleotide binding regulatory protein-coupled receptors that mediate the physiological effects of the hormone epinephrine and the neurotransmitter norepinephrine. The authors have previously assigned the genes for β 2 -and α 2 -AR to human chromosomes 5 and 10, respectively. By Southern analysis of somatic cell hybrids and in situ chromosomal hybridization, they have now mapped the α 1 -AR gene to chromosome 5q32→q34, the same position as β 2 -AR, and the β 1 -AR gene to chromosome 10q24→q26, the region where α 2 -AR, is located. In mouse, both α 2 -and β 1 -AR genes were assigned to chromosome 19, and the α 1 -AR locus was localized to chromosome 11. Pulsed field gel electrophoresis has shown that the α 1 -and β 2 -AR genes in humans are within 300 kilobases (kb) and the distance between the α 2 - and β 1 -AR genes is <225 kb. The proximity of these two pairs of AR genes and the sequence similarity that exists among all the ARs strongly suggest that they are evolutionarily related. Moreover, they likely arose from a common ancestral receptor gene and subsequently diverged through gene duplication and chromosomal duplication to perform their distinctive roles in mediation the physiological effects of catecholamines. The AR genes thus provide a paradigm for understanding the evolution of such structurally conserved yet functionally divergent families off receptor molecules

  17. Nucleotide-binding oligomerization domain 2 (NOD2) activation induces apoptosis of human oral squamous cell carcinoma cells.

    Science.gov (United States)

    Yoon, Hyo-Eun; Ahn, Mee-Young; Kwon, Seong-Min; Kim, Dong-Jae; Lee, Jun; Yoon, Jung-Hoon

    2016-04-01

    Microbial Pattern-recognition receptors (PRRs), such as nucleotide-binding oligomerization domains (NODs), are essential for mammalian innate immune response. This study was designed to determine the effect of NOD1 and NOD2 agonist on innate immune responses and antitumor activity in oral squamous cell carcinoma (OSCC) cells. NODs expression was examined by RT-PCR, and IL-8 production by NODs agonist was examined by ELISA. Western blot analysis was performed to determine the MAPK activation in response to their agonist. Cell proliferation was determined by MTT assay. Flow cytometry and Western blot analysis were performed to determine the MDP-induced cell death. The levels of NODs were apparently expressed in OSCC cells. NODs agonist, Tri-DAP and MDP, led to the production of IL-8 and MAPK activation. NOD2 agonist, MDP, inhibited the proliferation of YD-10B cells in a dose-dependent manner. Also, the ratio of Annexin V-positive cells and cleaved PARP was increased by MDP treatment in YD-10B cells, suggesting that MDP-induced cell death in YD-10B cells may be owing to apoptosis. Our results indicate that NODs are functionally expressed in OSCC cells and can trigger innate immune responses. In addition, NOD2 agonist inhibited cell proliferation and induced apoptosis. These findings provide the potential value of MDP as novel candidates for antitumor agents of OSCC. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Role of Nucleotide-Binding Oligomerization Domain-Containing (NOD 2 in Host Defense during Pneumococcal Pneumonia.

    Directory of Open Access Journals (Sweden)

    Tijmen J Hommes

    Full Text Available Streptococcus (S. pneumoniae is the most common causative pathogen in community-acquired pneumonia. Nucleotide-binding oligomerization domain-containing (NOD 2 is a pattern recognition receptor located in the cytosol of myeloid cells that is able to detect peptidoglycan fragments of S. pneumoniae. We here aimed to investigate the role of NOD2 in the host response during pneumococcal pneumonia. Phagocytosis of S. pneumoniae was studied in NOD2 deficient (Nod2-/- and wild-type (Wt alveolar macrophages and neutrophils in vitro. In subsequent in vivo experiments Nod2-/- and Wt mice were inoculated with serotype 2 S. pneumoniae (D39, an isogenic capsule locus deletion mutant (D39Δcps or serotype 3 S. pneumoniae (6303 via the airways, and bacterial growth and dissemination and the lung inflammatory response were evaluated. Nod2-/- alveolar macrophages and blood neutrophils displayed a reduced capacity to internalize pneumococci in vitro. During pneumonia caused by S. pneumoniae D39 Nod2-/- mice were indistinguishable from Wt mice with regard to bacterial loads in lungs and distant organs, lung pathology and neutrophil recruitment. While Nod2-/- and Wt mice also had similar bacterial loads after infection with the more virulent S. pneumoniae 6303 strain, Nod2-/- mice displayed a reduced bacterial clearance of the normally avirulent unencapsulated D39Δcps strain. These results suggest that NOD2 does not contribute to host defense during pneumococcal pneumonia and that the pneumococcal capsule impairs recognition of S. pneumoniae by NOD2.

  19. RINL, guanine nucleotide exchange factor Rab5-subfamily, is involved in the EphA8-degradation pathway with odin.

    Directory of Open Access Journals (Sweden)

    Hiroaki Kajiho

    Full Text Available The Rab family of small guanosine triphosphatases (GTPases plays a vital role in membrane trafficking. Its active GTP-bound state is driven by guanine nucleotide-exchange factors (GEFs. Ras and Rab interactor (or Ras interaction/interference-like (RINL, which contains a conserved VPS9 domain critical for GEF action, was recently identified as a new Rab5 subfamily GEF in vitro. However, its detailed function and interacting molecules have not yet been fully elucidated. Here we found that RINL has GEF activity for the Rab5 subfamily proteins by measuring their GTP-bound forms in cultured cells. We also found that RINL interacts with odin, a member of the ankyrin-repeat and sterile-alpha motif (SAM domain-containing (Anks protein family. In addition, the Eph tyrosine kinase receptor EphA8 formed a ternary complex with both RINL and odin. Interestingly, RINL expression in cultured cells reduced EphA8 levels in a manner dependent on both its GEF activity and interaction with odin. In addition, knockdown of RINL increased EphA8 level in HeLa cells. Our findings suggest that RINL, as a GEF for Rab5 subfamily, is implicated in the EphA8-degradation pathway via its interaction with odin.

  20. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  1. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  2. GABA receptor imaging

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Doo [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2007-04-15

    GABA is primary an inhibitory neurotransmitter that is localized in inhibitory interneurons. GABA is released from presynaptic terminals and functions by binding to GABA receptors. There are two types of GABA receptors, GABA{sub A}-receptor that allows chloride to pass through a ligand gated ion channel and GABA{sub B}-receptor that uses G-proteins for signaling. The GABA{sub A}-receptor has a GABA binding site as well as a benzodiazepine binding sites, which modulate GABA{sub A}-receptor function. Benzodiazepine GABAA receptor imaging can be accomplished by radiolabeling derivates that activates benzodiazepine binding sites. There has been much research on flumazenil (FMZ) labeled with {sup 11}C-FMZ, a benzodiazepine derivate that is a selective, reversible antagonist to GABAA receptors. Recently, {sup 18}F-fluoroflumazenil (FFMZ) has been developed to overcome {sup 11}C's short half-life. {sup 18}F-FFMZ shows high selective affinity and good pharmacodynamics, and is a promising PET agent with better central benzodiazepine receptor imaging capabilities. In an epileptic focus, because the GABA/benzodiazepine receptor amount is decreased, using '1{sup 1}C-FMZ PET instead of {sup 18}F-FDG, PET, restrict the foci better and may also help find lesions better than high resolution MR. GABA{sub A} receptors are widely distributed in the cerebral cortex, and can be used as an viable neuronal marker. Therefore it can be used as a neuronal cell viability marker in cerebral ischemia. Also, GABA-receptors decrease in areas where neuronal plasticity develops, therefore, GABA imaging can be used to evaluate plasticity. Besides these usages, GABA receptors are related with psychological diseases, especially depression and schizophrenia as well as cerebral palsy, a motor-related disorder, so further in-depth studies are needed for these areas.

  3. GABA receptor imaging

    International Nuclear Information System (INIS)

    Lee, Jong Doo

    2007-01-01

    GABA is primary an inhibitory neurotransmitter that is localized in inhibitory interneurons. GABA is released from presynaptic terminals and functions by binding to GABA receptors. There are two types of GABA receptors, GABA A -receptor that allows chloride to pass through a ligand gated ion channel and GABA B -receptor that uses G-proteins for signaling. The GABA A -receptor has a GABA binding site as well as a benzodiazepine binding sites, which modulate GABA A -receptor function. Benzodiazepine GABAA receptor imaging can be accomplished by radiolabeling derivates that activates benzodiazepine binding sites. There has been much research on flumazenil (FMZ) labeled with 11 C-FMZ, a benzodiazepine derivate that is a selective, reversible antagonist to GABAA receptors. Recently, 18 F-fluoroflumazenil (FFMZ) has been developed to overcome 11 C's short half-life. 18 F-FFMZ shows high selective affinity and good pharmacodynamics, and is a promising PET agent with better central benzodiazepine receptor imaging capabilities. In an epileptic focus, because the GABA/benzodiazepine receptor amount is decreased, using '1 1 C-FMZ PET instead of 18 F-FDG, PET, restrict the foci better and may also help find lesions better than high resolution MR. GABA A receptors are widely distributed in the cerebral cortex, and can be used as an viable neuronal marker. Therefore it can be used as a neuronal cell viability marker in cerebral ischemia. Also, GABA-receptors decrease in areas where neuronal plasticity develops, therefore, GABA imaging can be used to evaluate plasticity. Besides these usages, GABA receptors are related with psychological diseases, especially depression and schizophrenia as well as cerebral palsy, a motor-related disorder, so further in-depth studies are needed for these areas

  4. Cloning and expression of a cDNA coding for the human platelet-derived growth factor receptor: Evidence for more than one receptor class

    International Nuclear Information System (INIS)

    Gronwald, R.G.K.; Grant, F.J.; Haldeman, B.A.; Hart, C.E.; O'Hara, P.J.; Hagen, F.S.; Ross, R.; Bowen-Pope, D.F.; Murray, M.J.

    1988-01-01

    The complete nucleotide sequence of a cDNA encoding the human platelet-derived growth factor (PDGF) receptor is presented. The cDNA contains an open reading frame that codes for a protein of 1106 amino acids. Comparison to the mouse PDGF receptor reveals an overall amino acid sequence identity of 86%. This sequence identity rises to 98% in the cytoplasmic split tyrosine kinase domain. RNA blot hybridization analysis of poly(A) + RNA from human dermal fibroblasts detects a major and a minor transcript using the cDNA as a probe. Baby hamster kidney cells, transfected with an expression vector containing the receptor cDNA, express an ∼ 190-kDa cell surface protein that is recognized by an anti-human PDGF receptor antibody. The recombinant PDGF receptor is functional in the transfected baby hamster kidney cells as demonstrated by ligand-induced phosphorylation of the receptor. Binding properties of the recombinant PDGF receptor were also assessed with pure preparations of BB and AB isoforms of PDGF. Unlike human dermal fibroblasts, which bind both isoforms with high affinity, the transfected baby hamster kidney cells bind only the BB isoform of PDGF with high affinity. This observation is consistent with the existence of more than one PDGF receptor class

  5. Structures of Receptor Complexes of a North American H7N2 Influenza Hemagglutinin with a Loop Deletion in the Receptor Binding Site

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hua; Chen, Li-Mei; Carney, Paul J.; Donis, Ruben O.; Stevens, James (CDC)

    2012-02-21

    Human infections with subtype H7 avian influenza viruses have been reported as early as 1979. In 1996, a genetically stable 24-nucleotide deletion emerged in North American H7 influenza virus hemagglutinins, resulting in an eight amino acid deletion in the receptor-binding site. The continuous circulation of these viruses in live bird markets, as well as its documented ability to infect humans, raises the question of how these viruses achieve structural stability and functionality. Here we report a detailed molecular analysis of the receptor binding site of the North American lineage subtype H7N2 virus A/New York/107/2003 (NY107), including complexes with an avian receptor analog (3'-sialyl-N-acetyllactosamine, 3'SLN) and two human receptor analogs (6'-sialyl-N-acetyllactosamine, 6'SLN; sialyllacto-N-tetraose b, LSTb). Structural results suggest a novel mechanism by which residues Arg220 and Arg229 (H3 numbering) are used to compensate for the deletion of the 220-loop and form interactions with the receptor analogs. Glycan microarray results reveal that NY107 maintains an avian-type ({alpha}2-3) receptor binding profile, with only moderate binding to human-type ({alpha}2-6) receptor. Thus despite its dramatically altered receptor binding site, this HA maintains functionality and confirms a need for continued influenza virus surveillance of avian and other animal reservoirs to define their zoonotic potential.

  6. Structures of receptor complexes of a North American H7N2 influenza hemagglutinin with a loop deletion in the receptor binding site.

    Directory of Open Access Journals (Sweden)

    Hua Yang

    2010-09-01

    Full Text Available Human infections with subtype H7 avian influenza viruses have been reported as early as 1979. In 1996, a genetically stable 24-nucleotide deletion emerged in North American H7 influenza virus hemagglutinins, resulting in an eight amino acid deletion in the receptor-binding site. The continuous circulation of these viruses in live bird markets, as well as its documented ability to infect humans, raises the question of how these viruses achieve structural stability and functionality. Here we report a detailed molecular analysis of the receptor binding site of the North American lineage subtype H7N2 virus A/New York/107/2003 (NY107, including complexes with an avian receptor analog (3'-sialyl-N-acetyllactosamine, 3'SLN and two human receptor analogs (6'-sialyl-N-acetyllactosamine, 6'SLN; sialyllacto-N-tetraose b, LSTb. Structural results suggest a novel mechanism by which residues Arg220 and Arg229 (H3 numbering are used to compensate for the deletion of the 220-loop and form interactions with the receptor analogs. Glycan microarray results reveal that NY107 maintains an avian-type (alpha2-3 receptor binding profile, with only moderate binding to human-type (alpha2-6 receptor. Thus despite its dramatically altered receptor binding site, this HA maintains functionality and confirms a need for continued influenza virus surveillance of avian and other animal reservoirs to define their zoonotic potential.

  7. Purification and characterization of the V1 vasopressin receptor from rat liver

    International Nuclear Information System (INIS)

    Fishman, J.B.; Dickey, B.F.; Attisano, C.; Fine, R.E.

    1987-01-01

    The rat liver V1 vasopressin receptor was purified approximately 21,000-fold from rat liver microsomes. The receptor was solubilized from membranes using the zwitterionic detergent CHAPS (3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate). Since the V1 receptor loses its ability to bind ligand when solubilized, the authors devised a liposome reconstitution system to assay vasopressin binding activity during purification. The purified receptor exhibits a K/sub d/ of 6 nm, when, prior to solubilization, the membranes were exposed to 1 μm vasopressin. This resulted in the association of a pertussis-toxin insensitive guanine-nucleotide binding protein with the receptor during most of the purification procedure. The authors are further characterizing the V1-associated G-proteins. In the absence of this association, the receptor has a K/sub d/ of 30 nM. Crosslinking of 125 I-vasopressin to a partially purified preparation of receptor demonstrated that the receptor had a molecular weight of approximately 68,000 under reducing conditions, and 58,000 under non-reducing conditions. The purification procedure may prove useful in purifying a number of small peptide hormone receptors (e.g., bradykinin, angiotensin II) and perhaps their associated G-proteins as well

  8. Glucocorticoid receptor modulators.

    Science.gov (United States)

    Meijer, Onno C; Koorneef, Lisa L; Kroon, Jan

    2018-06-01

    The glucocorticoid hormone cortisol acts throughout the body to support circadian processes and adaptation to stress. The glucocorticoid receptor is the target of cortisol and of synthetic glucocorticoids, which are used widely in the clinic. Both agonism and antagonism of the glucocorticoid receptor may be beneficial in disease, but given the wide expression of the receptor and involvement in various processes, beneficial effects are often accompanied by unwanted side effects. Selective glucocorticoid receptor modulators are ligands that induce a receptor conformation that allows activation of only a subset of downstream signaling pathways. Such molecules thereby combine agonistic and antagonistic properties. Here we discuss the mechanisms underlying selective receptor modulation and their promise in treating diseases in several organ systems where cortisol signaling plays a role. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  9. Guanine nucleotide exchange factor αPIX leads to activation of the Rac 1 GTPase/glycogen phosphorylase pathway in interleukin (IL)-2-stimulated T cells

    DEFF Research Database (Denmark)

    Llavero, Francisco; Urzelai, Bakarne; Osinalde, Nerea

    2015-01-01

    Recently, we have reported that the active form of Rac 1 GTPase binds to the glycogen phosphorylase muscle isoform (PYGM) and modulates its enzymatic activity leading to T cell proliferation. In the lymphoid system, Rac 1 and in general other small GTPases of the Rho family participate...... in the signaling cascades that are activated after engagement of the T cell antigen receptor. However, little is known about the IL-2-dependent Rac 1 activator molecules. For the first time, a signaling pathway leading to the activation of Rac 1/PYGM in response to IL-2-stimulated T cell proliferation is described....... More specifically, αPIX, a known guanine nucleotide exchange factor for the small GTPases of the Rho family, preferentially Rac 1, mediates PYGM activation in Kit 225 T cells stimulated with IL-2. Using directed mutagenesis, phosphorylation of αPIX Rho-GEF serines 225 and 488 is required for activation...

  10. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  11. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  12. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  13. P2X7 receptor activates extracellular signal-regulated kinases ERK1 and ERK2 independently of Ca2+ influx

    DEFF Research Database (Denmark)

    Amstrup, Jan; Novak, Ivana

    2003-01-01

    P2X7 nucleotide receptors modulate a spectrum of cellular events in various cells including epithelia, such as exocrine pancreas. Although the pharmacology and channel properties of the P2X7 receptors have been studied intensively, signal transduction pathways are relatively unknown. In this study...... we applied a heterologous expression system of rat P2X7 receptors in HEK-293 cells. We followed the receptor expression and function using the enhanced green fluorescent protein (EGFP) tag, activation of intracellular proteins and increases in cellular Ca2+. EGFP-P2X7 receptors localized...... to the plasma membrane, clusters within the membrane and intracellularly. Stimulation of P2X7 receptors in HEK-293 cells led to an activation of extracellular signal-regulated kinases ERK1 and ERK2 and this activation was seen after just 1 min of stimulation with ATP. Using C- and N-terminal P2X7-receptor...

  14. Investigation of autism and GABA receptor subunit genes in multiple ethnic groups

    OpenAIRE

    Collins, Ann L.; Ma, Deqiong; Whitehead, Patrice L.; Martin, Eden R.; Wright, Harry H.; Abramson, Ruth K.; Hussman, John P.; Haines, Jonathan L.; Cuccaro, Michael L.; Gilbert, John R.; Pericak-Vance, Margaret A.

    2006-01-01

    Autism is a neurodevelopmental disorder of complex genetics, characterized by impairment in social interaction and communication, as well as repetitive behavior. Multiple lines of evidence, including alterations in levels of GABA and GABA receptors in autistic patients, indicate that the GABAergic system, which is responsible for synaptic inhibition in the adult brain, may be involved in autism. Previous studies in our lab indicated association of noncoding single nucleotide polymorphisms (SN...

  15. Environmental stress, oxytocin receptor gene (OXTR) polymorphism, and mental health following collective stress

    OpenAIRE

    Lucas-Thompson, RG; Holman, EA

    2013-01-01

    We examined whether the oxytocin receptor gene (OXTR) single nucleotide polymorphism (SNP) rs53576 genotype buffers the combined impact of negative social environments (e.g., interpersonal conflict/constraint) and economic stress on post-traumatic stress (PTS) symptoms and impaired daily functioning following collective stress (September 11th terrorist attacks). Saliva was collected by mail and used to genotype 704 respondents. Participants completed Web-based assessments of pre-9/11 mental h...

  16. The pathophysiological functions mediated by D-1 dopamine receptors

    International Nuclear Information System (INIS)

    Goldstein, M.; Kuga, S.; Meller, E.; SHimizu, Y.

    1986-01-01

    This chapter describes some behavioral responses which might be mediated by D 1 and D 2 DA receptors, and the authors discuss their clinical relevance. It was of considerable interest to determine whether a selective D 1 DA antagonist, such as SCH 23390, will induce catalepsy and whether this behavior is mediated by D 1 , or by both D 1 and D 2 DA receptors. Rats were used in the experiments. The authors examined whether the addition of the S 2 antagonist ketanserin affects the displacement of 3 H-Spi by SCH 23390. Induction of self-mutilating biting (SMB) behavior in monkeys with unilateral ventromedial tegmental (VMT) lesions by DA agonists and its prevention by DA antagonists is examined. The authors also discuss the possible relationships between abnormal guanine nucleotide metabolism and dopaminergic neuronal function through the implications in LeschNyhan syndrome and in some mental disorders

  17. Microglia P2Y13 Receptors Prevent Astrocyte Proliferation Mediated by P2Y1 Receptors

    Directory of Open Access Journals (Sweden)

    Clara Quintas

    2018-05-01

    Full Text Available Cerebral inflammation is a common feature of several neurodegenerative diseases that requires a fine interplay between astrocytes and microglia to acquire appropriate phenotypes for an efficient response to neuronal damage. During brain inflammation, ATP is massively released into the extracellular medium and converted into ADP. Both nucleotides acting on P2 receptors, modulate astrogliosis through mechanisms involving microglia-astrocytes communication. In previous studies, primary cultures of astrocytes and co-cultures of astrocytes and microglia were used to investigate the influence of microglia on astroglial proliferation induced by ADPβS, a stable ADP analog. In astrocyte cultures, ADPβS increased cell proliferation through activation of P2Y1 and P2Y12 receptors, an effect abolished in co-cultures (of astrocytes with ∼12.5% microglia. The possibility that the loss of the ADPβS-mediated effect could have been caused by a microglia-induced degradation of ADPβS or by a preferential microglial localization of P2Y1 or P2Y12 receptors was excluded. Since ADPβS also activates P2Y13 receptors, the contribution of microglial P2Y13 receptors to prevent the proliferative effect of ADPβS in co-cultures was investigated. The results obtained indicate that P2Y13 receptors are low expressed in astrocytes and mainly expressed in microglia. Furthermore, in co-cultures, ADPβS induced astroglial proliferation in the presence of the selective P2Y13 antagonist MRS 2211 (3 μM and of the selective P2Y12 antagonist AR-C66096 (0.1 μM, suggesting that activation of microglial P2Y12 and P2Y13 receptors may induce the release of messengers that inhibit astroglial proliferation mediated by P2Y1,12 receptors. In this microglia-astrocyte paracrine communication, P2Y12 receptors exert opposite effects in astroglial proliferation as a result of its cellular localization: cooperating in astrocytes with P2Y1 receptors to directly stimulate proliferation and in

  18. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  19. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  20. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  1. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  2. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  3. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  4. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  5. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  6. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  7. Regulation of ion transport via apical purinergic receptors in intact rabbit airway epithelium

    DEFF Research Database (Denmark)

    Poulsen, Asser Nyander; Klausen, Thomas Levin; Pedersen, Peter Steen

    2005-01-01

    and unidirectional Cl- fluxes decreased significantly. The results suggest that nucleotides released to the airway surface liquid exert an autocrine regulation of epithelial NaCl absorption mainly by inhibiting the amiloride-sensitive epithelial Na+ channel (ENaC) and paracellular anion conductance via a P2Y......We investigated purinergic receptors involved in ion transport regulation in the intact rabbit nasal airway epithelium. Stimulation of apical membrane P2Y receptors with ATP or UTP (200 microM) induced transient increases in short-circuit current (Isc) of 13 and 6% followed by sustained inhibitions...

  8. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  9. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  10. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  11. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  12. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  13. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  14. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  15. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  17. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  18. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  19. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  20. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  1. Activation of Adenylyl Cyclase Causes Stimulation of Adenosine Receptors

    Directory of Open Access Journals (Sweden)

    Thomas Pleli

    2018-03-01

    Full Text Available Background/Aims: Signaling of Gs protein-coupled receptors (GsPCRs is accomplished by stimulation of adenylyl cyclase, causing an increase of the intracellular cAMP concentration, activation of the intracellular cAMP effectors protein kinase A (PKA and Epac, and an efflux of cAMP, the function of which is still unclear. Methods: Activation of adenylyl cyclase by GsPCR agonists or cholera toxin was monitored by measurement of the intracellular cAMP concentration by ELISA, anti-phospho-PKA substrate motif phosphorylation by immunoblotting, and an Epac-FRET assay in the presence and absence of adenosine receptor antagonists or ecto-nucleotide phosphodiesterase/pyrophosphatase2 (eNPP2 inhibitors. The production of AMP from cAMP by recombinant eNPP2 was measured by HPLC. Extracellular adenosine was determined by LC-MS/MS, extracellular ATP by luciferase and LC-MS/MS. The expression of eNPP isoenzymes 1-3 was examined by RT-PCR. The expression of multidrug resistance protein 4 was suppressed by siRNA. Results: Here we show that the activation of GsPCRs and the GsPCRs-independent activation of Gs proteins and adenylyl cyclase by cholera toxin induce stimulation of cell surface adenosine receptors (A2A or A2B adenosine receptors. In PC12 cells stimulation of adenylyl cyclase by GsPCR or cholera toxin caused activation of A2A adenosine receptors by an autocrine signaling pathway involving cAMP efflux through multidrug resistance protein 4 and hydrolysis of released cAMP to AMP by eNPP2. In contrast, in PC3 cells cholera toxin- and GsPCR-induced stimulation of adenylyl cyclase resulted in the activation of A2B adenosine receptors. Conclusion: Our findings show that stimulation of adenylyl cyclase causes a remarkable activation of cell surface adenosine receptors.

  2. Angiotensin type 2 receptors

    DEFF Research Database (Denmark)

    Sumners, Colin; de Kloet, Annette D; Krause, Eric G

    2015-01-01

    In most situations, the angiotensin AT2-receptor (AT2R) mediates physiological actions opposing those mediated by the AT1-receptor (AT1R), including a vasorelaxant effect. Nevertheless, experimental evidence vastly supports that systemic application of AT2R-agonists is blood pressure neutral...

  3. Coupling of g proteins to reconstituted monomers and tetramers of the M2 muscarinic receptor.

    Science.gov (United States)

    Redka, Dar'ya S; Morizumi, Takefumi; Elmslie, Gwendolynne; Paranthaman, Pranavan; Shivnaraine, Rabindra V; Ellis, John; Ernst, Oliver P; Wells, James W

    2014-08-29

    G protein-coupled receptors can be reconstituted as monomers in nanodiscs and as tetramers in liposomes. When reconstituted with G proteins, both forms enable an allosteric interaction between agonists and guanylyl nucleotides. Both forms, therefore, are candidates for the complex that controls signaling at the level of the receptor. To identify the biologically relevant form, reconstituted monomers and tetramers of the purified M2 muscarinic receptor were compared with muscarinic receptors in sarcolemmal membranes for the effect of guanosine 5'-[β,γ-imido]triphosphate (GMP-PNP) on the inhibition of N-[(3)H]methylscopolamine by the agonist oxotremorine-M. With monomers, a stepwise increase in the concentration of GMP-PNP effected a lateral, rightward shift in the semilogarithmic binding profile (i.e. a progressive decrease in the apparent affinity of oxotremorine-M). With tetramers and receptors in sarcolemmal membranes, GMP-PNP effected a vertical, upward shift (i.e. an apparent redistribution of sites from a state of high affinity to one of low affinity with no change in affinity per se). The data were analyzed in terms of a mechanistic scheme based on a ligand-regulated equilibrium between uncoupled and G protein-coupled receptors (the "ternary complex model"). The model predicts a rightward shift in the presence of GMP-PNP and could not account for the effects at tetramers in vesicles or receptors in sarcolemmal membranes. Monomers present a special case of the model in which agonists and guanylyl nucleotides interact within a complex that is both constitutive and stable. The results favor oligomers of the M2 receptor over monomers as the biologically relevant state for coupling to G proteins. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Constitutive overexpression of muscarinic receptors leads to vagal hyperreactivity.

    Directory of Open Access Journals (Sweden)

    Angelo Livolsi

    Full Text Available BACKGROUND: Alterations in muscarinic receptor expression and acetylcholinesterase (AchE activity have been observed in tissues from Sudden Infant Death Syndrome (SIDS. Vagal overactivity has been proposed as a possible cause of SIDS as well as of vasovagal syncopes. The aim of the present study was to seek whether muscarinic receptor overexpression may be the underlying mechanism of vagal hyperreactivity. Rabbits with marked vagal pauses following injection of phenylephrine were selected and crossed to obtain a vagal hyperreactive strain. The density of cardiac muscarinic receptors and acetylcholinesterase (AchE gene expression were assessed. Blood markers of the observed cardiac abnormalities were also sought. METHODOLOGY/PRINCIPAL FINDINGS: Cardiac muscarinic M(2 and M(3 receptors were overexpressed in hyperreactive rabbits compared to control animals (2.3-fold and 2.5-fold, respectively and the severity of the phenylephrine-induced bradycardia was correlated with their densities. A similar overexpression of M(2 receptors was observed in peripheral mononuclear white blood cells, suggesting that cardiac M(2 receptor expression can be inferred with high confidence from measurements in blood cells. Sequencing of the coding fragment of the M(2 receptor gene revealed a single nucleotide mutation in 83% of hyperreactive animals, possibly contributing for the transcript overexpression. Significant increases in AchE expression and activity were also assessed (AchE mRNA amplification ratio of 3.6 versus normal rabbits. This phenomenon might represent a compensatory consequence of muscarinic receptors overexpression. Alterations in M(2 receptor and AchE expression occurred between the 5th and the 7th week of age, a critical period also characterized by a higher mortality rate of hyperreactive rabbits (52% in H rabbits versus 13% in normal rabbits and preceeded the appearance of functional disorders. CONCLUSIONS/SIGNIFICANCE: The results suggest that

  5. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  6. Glutamate receptor agonists

    DEFF Research Database (Denmark)

    Vogensen, Stine Byskov; Greenwood, Jeremy R; Bunch, Lennart

    2011-01-01

    The neurotransmitter (S)-glutamate [(S)-Glu] is responsible for most of the excitatory neurotransmission in the central nervous system. The effect of (S)-Glu is mediated by both ionotropic and metabotropic receptors. Glutamate receptor agonists are generally a-amino acids with one or more...... stereogenic centers due to strict requirements in the agonist binding pocket of the activated state of the receptor. By contrast, there are many examples of achiral competitive antagonists. The present review addresses how stereochemistry affects the activity of glutamate receptor ligands. The review focuses...... mainly on agonists and discusses stereochemical and conformational considerations as well as biostructural knowledge of the agonist binding pockets, which is useful in the design of glutamate receptor agonists. Examples are chosen to demonstrate how stereochemistry not only determines how the agonist...

  7. AMPA receptor ligands

    DEFF Research Database (Denmark)

    Strømgaard, Kristian; Mellor, Ian

    2004-01-01

    Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (AMPAR), subtype of the ionotropic glutamate receptors (IGRs), mediate fast synaptic transmission in the central nervous system (CNS), and are involved in many neurological disorders, as well as being a key player in the f......Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (AMPAR), subtype of the ionotropic glutamate receptors (IGRs), mediate fast synaptic transmission in the central nervous system (CNS), and are involved in many neurological disorders, as well as being a key player...... in the formation of memory. Hence, ligands affecting AMPARs are highly important for the study of the structure and function of this receptor, and in this regard polyamine-based ligands, particularly polyamine toxins, are unique as they selectively block Ca2+ -permeable AMPARs. Indeed, endogenous intracellular...

  8. AmTAR2: Functional characterization of a honeybee tyramine receptor stimulating adenylyl cyclase activity.

    Science.gov (United States)

    Reim, Tina; Balfanz, Sabine; Baumann, Arnd; Blenau, Wolfgang; Thamm, Markus; Scheiner, Ricarda

    2017-01-01

    The biogenic monoamines norepinephrine and epinephrine regulate important physiological functions in vertebrates. Insects such as honeybees do not synthesize these neuroactive substances. Instead, they employ octopamine and tyramine for comparable physiological functions. These biogenic amines activate specific guanine nucleotide-binding (G) protein-coupled receptors (GPCRs). Based on pharmacological data obtained on heterologously expressed receptors, α- and β-adrenergic-like octopamine receptors are better activated by octopamine than by tyramine. Conversely, GPCRs forming the type 1 tyramine receptor clade (synonymous to octopamine/tyramine receptors) are better activated by tyramine than by octopamine. More recently, receptors were characterized which are almost exclusively activated by tyramine, thus forming an independent type 2 tyramine receptor clade. Functionally, type 1 tyramine receptors inhibit adenylyl cyclase activity, leading to a decrease in intracellular cAMP concentration ([cAMP] i ). Type 2 tyramine receptors can mediate Ca 2+ signals or both Ca 2+ signals and effects on [cAMP] i . We here provide evidence that the honeybee tyramine receptor 2 (AmTAR2), when heterologously expressed in flpTM cells, exclusively causes an increase in [cAMP] i . The receptor displays a pronounced preference for tyramine over octopamine. Its activity can be blocked by a series of established antagonists, of which mianserin and yohimbine are most efficient. The functional characterization of two tyramine receptors from the honeybee, AmTAR1 (previously named AmTYR1) and AmTAR2, which respond to tyramine by changing cAMP levels in opposite direction, is an important step towards understanding the actions of tyramine in honeybee behavior and physiology, particularly in comparison to the effects of octopamine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Sex-specific effects of naturally occurring variants in the dopamine receptor D2 locus on insulin secretion and Type 2 diabetes susceptibility

    NARCIS (Netherlands)

    Guigas, B.; Leeuw van Weenen, J.E. de; van Leeuwen, N.; Simonis-Bik, A.M.; Haeften, T.W. van; Nijpels, G.; Houwing-Duistermaat, J.J.; Beekman, M.; Deelen, J.; Havekes, L.M.; Penninx, B.W.J.H.; Vogelzangs, N.; Riet, E. van 't; Dehghan, A.; Hofman, A.; Witteman, J.C.; Uitterlinden, A.G.; Grarup, N.; Jørgensen, T.; Witte, D.R.; Lauritzen, T.; Hansen, T.; Pedersen, O.; Hottenga, J.; Romijn, J.A.; Diamant, M.; Kramer, M.H.H.; Heine, R.J.; Willemsen, G.; Dekker, J.M.; Eekhoff, E.M.; Pijl, H.; Geus, E.J. de; Slagboom, P.E.; Hart, L.M. 't

    2014-01-01

    Aims: Modulation of dopamine receptor D2 (DRD2) activity affects insulin secretion in both rodents and isolated pancreatic β-cells. We hypothesized that single nucleotide polymorphisms in the DRD2/ANKK1 locus may affect susceptibility to Type 2 diabetes in humans. Methods: Four potentially

  10. Structural Determinants at the Interface of the ARC2 and LRR Domains Control the Activation of the NB-LRR Plant Immune Receptors Rx1 and Gpa2

    NARCIS (Netherlands)

    Slootweg, E.J.; Spiridon, L.N.; Roosien, J.; Butterbach, P.B.E.; Pomp, H.; Westerhof, L.B.; Wilbers, R.H.P.; Bakker, E.H.; Bakker, J.; Petrescu, A.J.; Smant, G.; Goverse, A.

    2013-01-01

    Many plant and animal immune receptors have a modular NB-LRR architecture in which a nucleotide-binding switch domain (NB-ARC) is tethered to a leucine-rich repeat sensor domain (LRR). The cooperation between the switch and sensor domains, which regulates the activation of these proteins, is poorly

  11. Coiled-coil domain-dependent homodimerization of intracellular barley immune receptors defines a minimal functional module for triggering cell death

    NARCIS (Netherlands)

    Maekawa, T.; Cheng, W.; Spiridon, L.N.; Töller, A.; Lukasik, E.; Saijo, Y.; Liu, P.; Shen, Q.H.; Micluta, M.A.; Somssich, I.E.; Takken, F.L.W.; Petrescu, A.J.; Chai, J.; Schulze-Lefert, P.

    2011-01-01

    Plants and animals have evolved structurally related innate immune sensors, designated NLRs, to detect intracellular nonself molecules. NLRs are modular, consisting of N-terminal coiled-coil (CC) or TOLL/interleukin-1 receptor (TIR) domains, a central nucleotide-binding (NB) domain, and C-terminal

  12. Polymorphism in interleukin-7 receptor α gene is associated with faster CD4 T-cell recovery after initiation of combination antiretroviral therapy

    DEFF Research Database (Denmark)

    Hartling, Hans J; Thørner, Lise W; Erikstrup, Christian

    2014-01-01

    OBJECTIVES: To investigate single-nucleotide polymorphisms (SNPs) in the gene encoding interleukin-7 receptor α (IL7RA) as predictors for CD4⁺ T-cell change after initiation of combination antiretroviral therapy (cART) in HIV-infected whites. DESIGN: SNPs in IL7RA were determined in the Danish HIV...

  13. Substitution of aspartic acid-686 by histidine or asparagine in the human androgen receptor leads to a functionally inactive protein with altered hormone-binding characteristics

    NARCIS (Netherlands)

    Ris-Stalpers, C.; Trifiro, M. A.; Kuiper, G. G.; Jenster, G.; Romalo, G.; Sai, T.; van Rooij, H. C.; Kaufman, M.; Rosenfield, R. L.; Liao, S.

    1991-01-01

    We have identified two different single nucleotide alterations in codon 686 (GAC; aspartic acid) in exon 4 of the human androgen receptor gene in three unrelated families with the complete form of androgen insensitivity. One mutation (G----C) results in an aspartic acid----histidine substitution

  14. Multiple sclerosis and polymorphisms of innate pattern recognition receptors TLR1-10, NOD1-2, DDX58, and IFIH1

    DEFF Research Database (Denmark)

    Enevold, Christian; Oturai, Annette Bang; Sørensen, Per Soelberg

    2009-01-01

    Genetic factors are critical in multiple sclerosis (MS), and it is conceivable that the pattern recognition receptors of the innate immune system are of pathogenic importance. We therefore developed two novel assays capable of analyzing 42 single-nucleotide polymorphisms in the human genes encoding...

  15. Lipophorin Receptor: The Insect Lipoprotein Receptor

    Indian Academy of Sciences (India)

    IAS Admin

    Director of ... function of the Lp is to deliver lipids throughout the insect body for metabolism ... Lipid is used as a major energy source for development as well as other metabolic .... LpR4 receptor variant was expressed exclusively in the brain and.

  16. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  17. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  18. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  19. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  20. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  1. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  2. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  3. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  4. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  5. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  6. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  7. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  8. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  9. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  10. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  11. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  12. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  13. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  15. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  16. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  17. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  18. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  19. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  20. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  1. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  2. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  3. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  4. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  5. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  6. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  8. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  9. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  10. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  11. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  12. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  13. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  14. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  15. G-Protein Coupled Receptors: Surface Display and Biosensor Technology

    Science.gov (United States)

    McMurchie, Edward; Leifert, Wayne

    Signal transduction by G-protein coupled receptors (GPCRs) underpins a multitude of physiological processes. Ligand recognition by the receptor leads to the activation of a generic molecular switch involving heterotrimeric G-proteins and guanine nucleotides. With growing interest and commercial investment in GPCRs in areas such as drug targets, orphan receptors, high-throughput screening of drugs and biosensors, greater attention will focus on assay development to allow for miniaturization, ultrahigh-throughput and, eventually, microarray/biochip assay formats that will require nanotechnology-based approaches. Stable, robust, cell-free signaling assemblies comprising receptor and appropriate molecular switching components will form the basis of future GPCR/G-protein platforms, which should be able to be adapted to such applications as microarrays and biosensors. This chapter focuses on cell-free GPCR assay nanotechnologies and describes some molecular biological approaches for the construction of more sophisticated, surface-immobilized, homogeneous, functional GPCR sensors. The latter points should greatly extend the range of applications to which technologies based on GPCRs could be applied.

  16. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  17. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  18. Serotonin Receptors in Hippocampus

    Science.gov (United States)

    Berumen, Laura Cristina; Rodríguez, Angelina; Miledi, Ricardo; García-Alcocer, Guadalupe

    2012-01-01

    Serotonin is an ancient molecular signal and a recognized neurotransmitter brainwide distributed with particular presence in hippocampus. Almost all serotonin receptor subtypes are expressed in hippocampus, which implicates an intricate modulating system, considering that they can be localized as autosynaptic, presynaptic, and postsynaptic receptors, even colocalized within the same cell and being target of homo- and heterodimerization. Neurons and glia, including immune cells, integrate a functional network that uses several serotonin receptors to regulate their roles in this particular part of the limbic system. PMID:22629209

  19. A single-nucleotide polymorphism of GRIN1 in heroin and methamphetamine addicts at a rehabilitation sanatorium in Markazi province, Iran

    Directory of Open Access Journals (Sweden)

    Ahmad Hamta

    2017-03-01

    Full Text Available Introduction: Using addictive drugs can change the amount of neurotransmitters, especially dopamine and glutamate. Glutamate has been known to trigger the relapse and tendency toward addictive drugs. The glutamate receptor ionotropic NMDA type subunit 1 (GRIN1 contains the single- nucleotide polymorphism C1001G (rs11146020 and encodes N-methyl-D-aspartic acid (NDMA receptor subunit 1 (NR1. The present study was conducted to investigate the relationship between the rs11146020 polymorphism in GRIN1 and addiction to heroin and methamphetamine. Methods: The present case-control study recruited 90 male heroin and methamphetamine addicts treated with methadone and 100 healthy men. Genomic DNA was extracted from peripheral blood using Iraizol kits. Four pairs of specific primers were designed using AlleleID 7.5, and the T-ARMS PCR was optimized. Results: The genotype distribution of GG, GC and CC was respectively found to be 66%, 31% and 3% in the control group and 58%, 31% and 11% in the patient group. The statistical analysis suggested no significant differences between these two groups. Conclusion: No significant relationships were observed between the C1001G polymorphism in GRIN1 and addiction to heroin and methamphetamine.

  20. Analysis of single nucleotide polymorphisms of CRYGA and CRYGB genes in control population of western Indian origin

    Directory of Open Access Journals (Sweden)

    Kapur Suman

    2009-01-01

    Full Text Available Aim: Polymorphisms in γ-crystallins ( CRYG can serve as markers for lens differentiation and eye disorders leading to cataract. Several investigators have reported the presence of sequence variations within crystallin genes, with or without apparent effects on the function of the proteins both in mice and humans. Delineation of these polymorphic sites may explain the differences observed in the susceptibility to cataract observed among various ethnic groups. An easier Restriction Fragment Length Polymorphism (RFLP-based method has been used to detect the frequency of four single nucleotide polymorphisms (SNPs in CRYGA / CRYGB genes in control subjects of western Indian origin. Materials and Methods: A total of 137 healthy volunteers from western India were studied. Examination was performed to exclude volunteers with any ocular defects. Polymerase chain reaction (PCR-RFLP based method was developed for genotyping of G198A (Intron A, T196C (Exon 3 of CRYGA and T47C (Promoter, G449T (Exon 2 of CRYGB genes. Results: The exonic SNPs in CRYGA and CRYGB were found to have an allele frequency 0.03 and 1.00 for ancestral allele respectively, while frequency of non-coding SNP in CRYGA was 0.72. Allele frequency of T90C of CRYGB varied significantly ( P = 0.02 among different age groups. An in-silico analysis reveals that this sequence variation in CRYGB promoter impacts the binding of two transcription factors, ACE2 (Member of CLB2 cluster and Progesterone Receptor (PR which may impact the expression of CRYGB gene. Conclusions: This study establishes baseline frequency data for four SNPs in CRYGA and CRYGB genes for future case control studies on the role of these SNPs in the genetic basis of cataract.

  1. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.

    Science.gov (United States)

    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli

    2014-01-01

    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  2. Link between D1 and D2 dopamine receptors is reduced in schizophrenia and Huntington diseased brain

    International Nuclear Information System (INIS)

    Seeman, P.; Niznik, H.B.; Guan, H.C.; Booth, G.; Ulpian, C.

    1989-01-01

    Dopamine receptor types D 1 and D 2 can oppose enhance each other's actions for electrical, biochemical, and psychomotor effects. The authors report a D 1 -D 2 interaction in homogenized tissue as revealed by ligand binding. D 2 agonists lowered the binding of [ 3 H]raclopride to D 2 receptors in striatal and anterior pituitary tissues. Pretreating the tissue with the D 1 -selective antagonist SCH 23390 prevented the agonist-induced decrease in [ 3 H]raclopride binding to D 2 sites in the striatum but not in the anterior pituitary, which has no D 1 receptors. Conversely, a dopamine-induced reduction in the binding of [ 3 H]SCH 23390 to D 1 receptors could be prevented by the D 2 -selective antagonist eticlopride. Receptor photolabeling experiments confirmed both these D 1 -D 2 interactions. The blocking effect by SCH 23390 was similar to that produced by a nonhydrolyzable guanine nucleotide analogue, and SCH 23390 reduced the number of agonist-labeled D 2 receptors in the high-affinity state. Thus, the D 1 -D 2 link may be mediated by guanine nucleotide-binding protein components. The link may underlie D 1 -D 2 interactions influencing behavior, since the link was missing in over half the postmortem striata from patients with schizophrenia and Huntington disease (both diseases that show some hyperdopamine signs) but was present in human control, Alzheimer, and Parkinson striata

  3. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents

    Directory of Open Access Journals (Sweden)

    Nur Lisa Zaharan

    2018-04-01

    Full Text Available BackgroundSeveral non-synonymous single-nucleotide polymorphisms (nsSNPs have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA in relation to adiposity parameters among adolescents in Malaysia.MethodsWe examined whether (a PA and (b selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study (n = 1,151. Body mass indices, waist–hip ratio, and percentage body fat (% BF were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C. Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3 rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS. Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model.ResultsPAQ-C scores were associated with % BF (β = −0.44 [95% confidence interval −0.72, −0.16], p = 0.002. The CC genotype of ADRB3 rs4994 (β = −0.16 [−0.28, −0.05], corrected p = 0.01 and AA genotype of MC3R rs3827103 (β = −0.06 [−0.12, −0.00], p = 0.02 were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = −0.05 [−0.10, −0.01], p = 0.02 and combined GRS (β = −0.03 [−0.04, −0.01], p = 0.01 for % BF.ConclusionHigher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention

  4. Non-Synonymous Single-Nucleotide Polymorphisms and Physical Activity Interactions on Adiposity Parameters in Malaysian Adolescents.

    Science.gov (United States)

    Zaharan, Nur Lisa; Muhamad, Nor Hanisah; Jalaludin, Muhammad Yazid; Su, Tin Tin; Mohamed, Zahurin; Mohamed, M N A; A Majid, Hazreen

    2018-01-01

    Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia. We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study ( n  = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model. PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], p  = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected p  = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], p  = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], p  = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], p  = 0.01) for % BF. Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.

  5. G-protein mediates voltage regulation of agonist binding to muscarinic receptors: effects on receptor-Na+ channel interaction

    International Nuclear Information System (INIS)

    Cohen-Armon, M.; Garty, H.; Sokolovsky, M.

    1988-01-01

    The authors previous experiments in membranes prepared from rat heart and brain led them to suggest that the binding of agonist to the muscarinic receptors and to the Na + channels is a coupled event mediated by guanine nucleotide binding protein(s) [G-protein(s)]. These in vitro findings prompted us to employ synaptoneurosomes from brain stem tissue to examine (i) the binding properties of [ 3 H] acetylcholine at resting potential and under depolarization conditions in the absence and presence of pertussis toxin; (ii) the binding of [ 3 H]batrachotoxin to Na + channel(s) in the presence of the muscarinic agonists; and (iii) muscarinically induced 22 Na + uptake in the presence and absence of tetrodotoxin, which blocks Na + channels. The findings indicate that agonist binding to muscarinic receptors is voltage dependent, that this process is mediated by G-protein(s), and that muscarinic agonists induce opening of Na + channels. The latter process persists even after pertussis toxin treatment, indicating that it is not likely to be mediated by pertussis toxin sensitive G-protein(s). The system with its three interacting components-receptor, G-protein, and Na + channel-is such that at resting potential the muscarinic receptor induces opening of Na + channels; this property may provide a possible physiological mechanism for the depolarization stimulus necessary for autoexcitation or repetitive firing in heart or brain tissues

  6. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  7. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  8. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  9. Signaling cross-talk between peroxisome proliferator-activated receptor/retinoid X receptor and estrogen receptor through estrogen response elements.

    Science.gov (United States)

    Keller, H; Givel, F; Perroud, M; Wahli, W

    1995-07-01

    Peroxisome proliferator-activated receptors (PPARs) and retinoid X receptors (RXRs) are nuclear hormone receptors that are activated by fatty acids and 9-cis-retinoic acid, respectively. PPARs and RXRs form heterodimers that activate transcription by binding to PPAR response elements (PPREs) in the promoter of target genes. The PPREs described thus far consist of a direct tandem repeat of the AGGTCA core element with one intervening nucleotide. We show here that the vitellogenin A2 estrogen response element (ERE) can also function as a PPRE and is bound by a PPAR/RXR heterodimer. Although this heterodimer can bind to several other ERE-related palindromic response elements containing AGGTCA half-sites, only the ERE is able to confer transactivation of test reporter plasmids, when the ERE is placed either close to or at a distance from the transcription initiation site. Examination of natural ERE-containing promoters, including the pS2, very-low-density apolipoprotein II and vitellogenin A2 genes, revealed considerable differences in the binding of PPAR/RXR heterodimers to these EREs. In their natural promoter context, these EREs did not allow transcriptional activation by PPARs/RXRs. Analysis of this lack of stimulation of the vitellogenin A2 promoter demonstrated that PPARs/RXRs bind to the ERE but cannot transactivate due to a nonpermissive promoter structure. As a consequence, PPARs/RXRs inhibit transactivation by the estrogen receptor through competition for ERE binding. This is the first example of signaling cross-talk between PPAR/RXR and estrogen receptor.

  10. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  11. Glutamate Receptor Aptamers and ALS

    Science.gov (United States)

    2009-01-01

    considered difficult because such a process uses the one-to-one correspondence of Watson - Crick pairing. In contrast, the transfer of function is...same nucleotides in M1 exhibited no NMIA reactivity. In general, non-reactive nucleotides were thought to be Watson - Crick based- paired. A number of...about 14 rounds of selections, the SELEX was terminated. The DNA pool from the 11th, 12th and 14th rounds were cloned and sequenced. Consensus

  12. Cloning and expression of a rat brain α2B-adrenergic receptor

    International Nuclear Information System (INIS)

    Flordellis, C.S.; Handy, D.E.; Bresnahan, M.R.; Zannis, V.I.; Gavras, H.

    1991-01-01

    The authors isolated a cDNA clone (RBα 2B ) and its homologous gene (GRα 2B ) encoding an α 2B -adrenergic receptor subtype by screening a rat brain cDNA and a rat genomic library. Nucleotide sequence analysis showed that both clones code for a protein of 458 amino acids, which is 87% homologous to the human kidney glycosylated adrenergic receptor (α 2 -C4) and divergent from the rat kidney nonglycosylated α 2B subtype (RNGα 2 ). Transient expression of RBα 2B in COS-7 cells resulted in high-affinity saturable binding for [ 3 H]rauwolscine and a high receptor number in the membranes of transfected COS-7 cells. Pharmacological analysis demonstrated that the expressed receptor bound adrenergic ligands with the following order of potency: rauwolscine > yohimbine > prazosin > oxymetazoline, with a prazosin-to-oxymetazoline K i ratio of 0.34. This profile is characteristic of the α 2B -adrenergic receptor subtype. Blotting analysis of rat brain mRNA gave one major and two minor mRNA species, and hybridization with strand-specific probes showed that both DNA strands of GRα 2B may be transcriptionally active. These findings show that rat brain expresses an α 2B -adrenergic receptor subtype that is structurally different from the rat kidney nonglycosylated α 2B subtype. Thus the rat expresses at least two divergent α 2B -adrenergic receptors

  13. Characterization of beta-adrenergic receptors in synaptic membranes from rat cerebral cortex and cerebellum

    International Nuclear Information System (INIS)

    Lautens, L.

    1986-01-01

    Beta-adrenergic receptor ligand binding sites have been characterized in synaptic membranes from rat cerebral cortex and cerebellum using radioligand binding techniques. The equilibrium and kinetic properties of binding were assessed. The binding sites were non-interacting and exhibited two states of agonist binding which were sensitive to guanyl nucleotide. Synaptic membranes from cerebral cortex contained an equal number of beta 1 - and beta 2 -receptors; membranes from cerebellum possessed more beta 2 -than beta 1 -receptors. Photoaffinity labeling experiments revealed two different beta-adrenergic receptor polypeptides, R 1 and R 2 (and possibly a third, R 3 ) in synaptic membranes. The ratios of incorporation of photoaffinity label into R 1 : 2 were approximately 1:1 (cerebral cortex) and 5:1 (cerebellum). Photoaffinity labeling of R 1 and R 2 was inhibited equally well by both agonist and antagonist in synaptic membranes from cerebellum; whereas agonist was a less potent inhibitor in membranes from cerebral cortex. Both subtypes of beta-adrenergic receptors exhibited the same apparent molecular weight in synaptic membranes from cerebral cortex. The beta-adrenergic receptors in synaptic membranes from cerebral cortex and cerebellum were glycoproteins which exhibited the same apparent molecular weight after exposure to endoglycosidase F. The partial proteolytic digest maps of photoaffinity labeled beta-adrenergic receptors from rat cerebral cortex, cerebellum, lung and heart were compared

  14. An Overview of Pathogen Recognition Receptors for Innate Immunity in Dental Pulp

    Directory of Open Access Journals (Sweden)

    Ji-Hyun Jang

    2015-01-01

    Full Text Available Pathogen recognition receptors (PRRs are a class of germ line-encoded receptors that recognize pathogen-associated molecular patterns (PAMPs. The activation of PRRs is crucial for the initiation of innate immunity, which plays a key role in first-line defense until more specific adaptive immunity is developed. PRRs differ in the signaling cascades and host responses activated by their engagement and in their tissue distribution. Currently identified PRR families are the Toll-like receptors (TLRs, the C-type lectin receptors (CLRs, the nucleotide-binding oligomerization domain-like receptors (NLRs, the retinoic acid-inducible gene-I-like receptors (RLRs, and the AIM2-like receptor (ALR. The environment of the dental pulp is substantially different from that of other tissues of the body. Dental pulp resides in a low compliance root canal system that limits the expansion of pulpal tissues during inflammatory processes. An understanding of the PRRs in dental pulp is important for immunomodulation and hence for developing therapeutic targets in the field of endodontics. Here we comprehensively review recent finding on the PRRs and the mechanisms by which innate immunity is activated. We focus on the PRRs expressed on dental pulp and periapical tissues and their role in dental pulp inflammation.

  15. Clopidogrel (Plavix®), a P2Y(12) receptor antagonist, inhibits bone cell function in vitro and decreases trabecular bone in vivo

    DEFF Research Database (Denmark)

    Syberg, Susanne; Brandao-Burch, Andrea; Patel, Jessal J

    2012-01-01

    Clopidogrel (Plavix®), a selective P2Y(12) receptor antagonist, is widely prescribed to reduce the risk of heart attack and stroke and acts via the inhibition of platelet aggregation. Accumulating evidence now suggests that extracellular nucleotides, signalling through P2 receptors, play...... a significant role in bone, modulating both osteoblast and osteoclast function. In this study, we investigated the effects of clopidogrel treatment on (1) bone cell formation, differentiation and activity in vitro; and, (2) trabecular and cortical bone parameters in vivo. P2Y(12) receptor expression...

  16. Cloning and expression of a human kidney cDNA for an α2-adrenergic receptor subtype

    International Nuclear Information System (INIS)

    Regan, J.W.; Kobilka, T.S.; Yang-Feng, T.L.; Caron, M.G.; Lefkowitz, R.J.; Kobilka, B.K.

    1988-01-01

    An α 2 -adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet α 2 -adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet α 2 -adrenergic receptor and is consistent with the structure of other members of he family of guanine nucleotide-binding protein-coupled receptors. The cDNA was expressed in a mammalian cell line (COS-7), and the α 2 -adrenergic ligand [ 3 H]rauwolscine was bound. Competition curve analysis with a variety of adrenergic ligands suggests that this cDNA clone represents the α 2 B-adrenergic receptor. The gene for this receptor is on human chromosome 4, whereas the gene for the human platelet α 2 -adrenergic receptor (α 2 A) lies on chromosome 10. This ability to express the receptor in mammalian cells, free of other adrenergic receptor subtypes, should help in developing more selective α-adrenergic ligands

  17. Regulation of dopamine D2 receptors in a novel cell line (SUP1)

    International Nuclear Information System (INIS)

    Ivins, K.J.; Luedtke, R.R.; Artymyshyn, R.P.; Molinoff, P.B.

    1991-01-01

    A prolactin-secreting cell line, SUP1, has been established from rat pituitary tumor 7315a. In radioligand binding experiments, the D2 receptor antagonist (S)-(-)-3- 125 I iodo-2-hydroxy-6-methoxy-N-[(1-ethyl-2- pyrrolidinyl)methyl]benzamide ( 125 I IBZM) labeled a single class of sites in homogenates of SUP1 cells (Kd = 0.6 nM; Bmax = 45 fmol/mg of protein). The sites displayed a pharmacological profile consistent with that of D2 receptors. Inhibition of the binding of 125 I IBZM by dopamine was sensitive to GTP, suggesting that D2 receptors in SUP1 cells are coupled to guanine nucleotide-binding protein(s). In the presence of isobutylmethylxanthine, dopamine decreased the level of cAMP accumulation in SUP1 cells. Dopamine also inhibited prolactin secretion from SUP1 cells. Both the inhibition of cAMP accumulation and the inhibition of prolactin secretion were blocked by D2 receptor antagonists, suggesting that these effects of dopamine were mediated by an interaction with D2 receptors. The regulation of D2 receptors in SUP1 cells by D2 receptor agonists was investigated. Exposure of SUP1 cells to dopamine or to the D2 receptor agonist N-propylnorapomorphine led to increased expression of D2 receptors, with no change in the affinity of the receptors for 125 I IBZM. An increase in the density of D2 receptors in SUP1 cells was evident within 7 hr of exposure to dopamine. Spiroperidol, a D2 receptor antagonist, blocked the effect of dopamine on receptor density. These results suggest that exposure of D2 receptors in SUP1 cells to agonists leads to an up-regulation of D2 receptors. Dopamine retained the ability to inhibit cAMP accumulation in SUP1 cells exposed to dopamine for 24 hr, suggesting that D2 receptors in SUP1 cells are not desensitized by prolonged exposure to agonist

  18. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  19. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  20. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  2. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  3. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  4. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  5. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  6. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  7. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  8. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  9. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  10. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

    2009-01-01

    Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

  12. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  13. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  14. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  15. Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

    Science.gov (United States)

    Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

    2014-10-01

    Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

  16. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  17. Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Teruel, J.A.; Inesi, G.

    1988-01-01

    The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

  18. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  19. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    Science.gov (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  20. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.