Directory of Open Access Journals (Sweden)
Bianco Linda
2009-11-01
Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor
Wu, H; Zhang, J; Shi, H
2016-01-01
Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.
Igf2/H19 Imprinting Control Region (ICR: An Insulator or a Position-Dependent Silencer?
Directory of Open Access Journals (Sweden)
Subhasis Banerjee
2001-01-01
Full Text Available The imprinting control region (ICR located far upstream of the H19 gene, in conjunction with enhancers, modulates the transcription of Igf2 and H19 genes in an allele-specific manner. On paternal inheritance, the methylated ICR silences the H19 gene and indirectly facilitates transcription from the distant Igf2 promoter, whereas on the maternal chromosome the unmethylated ICR, together with enhancers, activates transcription of the H19 gene and thereby contributes to the repression of Igf2. This repression of maternal Igf2 has recently been postulated to be due to a chromatin boundary or insulator function of the unmethylated ICR. Central to the insulator model is the site-specific binding of a ubiquitous nuclear factor CTCF which exhibits remarkable flexibility in functioning as transcriptional activator or silencer. We suggest that the ICR positioned close to the enhancers in an episomal context might function as a transcriptional silencer by virtue of interaction of CTCF with its modifiers such as SIN3A and histone deacetylases. Furthermore, a localised folded chromatin structure resulting from juxtaposition of two disparate regulatory sequences (enhancer ICR could be the mechanistic basis of ICR-mediated position-dependent (ICR-promoter transcriptional repression in transgenic Drosophila.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.
Directory of Open Access Journals (Sweden)
Sirjana Devi Shrestha
Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
DEFF Research Database (Denmark)
Nielsen, Troels T; Nielsen, Jørgen E
2013-01-01
Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...
Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan
2012-09-01
The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.
Strategy of gene silencing in cassava for validation of resistance genes
International Nuclear Information System (INIS)
Cortes, Simon; Lopez, Camilo
2010-01-01
Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Mo, Xianchao; Li, Weizhong
2014-05-01
To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.
Duplication and relocation of the functional DPY19L2 gene within low copy repeats
Directory of Open Access Journals (Sweden)
Cheung Joseph
2006-03-01
Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.
Development of a gene silencing DNA vector derived from a broad host range geminivirus
Directory of Open Access Journals (Sweden)
Hancock Leandria C
2009-07-01
Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.
F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function
Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique
2006-01-01
Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria
2007-11-01
The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Simultaneous Silencing of Xylanase Genes in Botrytis cinerea
Directory of Open Access Journals (Sweden)
Néstor García
2017-12-01
Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.
Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique
2007-09-18
Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:
Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.
Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu
2013-05-01
The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.
Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard
2003-04-24
Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G
2000-03-01
Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.
Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.
Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J
2016-01-01
Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.
Directory of Open Access Journals (Sweden)
Gyöngyi Munkácsy
2016-01-01
Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.
Directory of Open Access Journals (Sweden)
Jinhuan Pang
Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C
2011-12-01
Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Isolation and Characterization of Pepper Genes Interacting with the CMV-P1 Helicase Domain.
Directory of Open Access Journals (Sweden)
Yoomi Choi
Full Text Available Cucumber mosaic virus (CMV is a destructive pathogen affecting Capsicum annuum (pepper production. The pepper Cmr1 gene confers resistance to most CMV strains, but is overcome by CMV-P1 in a process dependent on the CMV-P1 RNA1 helicase domain (P1 helicase. Here, to identify host factors involved in CMV-P1 infection in pepper, a yeast two-hybrid library derived from a C. annuum 'Bukang' cDNA library was screened, producing a total of 76 potential clones interacting with the P1 helicase. Beta-galactosidase filter lift assay, PCR screening, and sequencing analysis narrowed the candidates to 10 genes putatively involved in virus infection. The candidate host genes were silenced in Nicotiana benthamiana plants that were then inoculated with CMV-P1 tagged with the green fluorescent protein (GFP. Plants silenced for seven of the genes showed development comparable to N. benthamiana wild type, whereas plants silenced for the other three genes showed developmental defects including stunting and severe distortion. Silencing formate dehydrogenase and calreticulin-3 precursor led to reduced virus accumulation. Formate dehydrogenase-silenced plants showed local infection in inoculated leaves, but not in upper (systemic leaves. In the calreticulin-3 precursor-silenced plants, infection was not observed in either the inoculated or the upper leaves. Our results demonstrate that formate dehydrogenase and calreticulin-3 precursor are required for CMV-P1 infection.
International Nuclear Information System (INIS)
Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.
2012-01-01
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)
2012-05-10
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.
2001-01-01
Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by
MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R
International Nuclear Information System (INIS)
Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun
2016-01-01
Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.
DEFF Research Database (Denmark)
Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M
2002-01-01
Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...
Directory of Open Access Journals (Sweden)
Dashuai Mu
Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.
Kant, Ravi; Dasgupta, Indranil
2017-07-01
Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
Energy Technology Data Exchange (ETDEWEB)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatin immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Directory of Open Access Journals (Sweden)
Tanurdzic Milos
2004-04-01
Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.
Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong
2017-09-26
Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.
Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann
2015-06-01
Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.
Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing
Czech Academy of Sciences Publication Activity Database
Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš
2011-01-01
Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011
Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira
2016-10-13
PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.
Directory of Open Access Journals (Sweden)
Yao Han
Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant
Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong
2015-01-01
MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.
Flexible tools for gene expression and silencing in tomato.
Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre
2009-12-01
As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.
Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L
DEFF Research Database (Denmark)
Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon
2017-01-01
Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...
Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato
Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo
2016-12-01
Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.
Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S
2015-06-01
Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis
Directory of Open Access Journals (Sweden)
Zhimin Zheng
2015-05-01
Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.
Directory of Open Access Journals (Sweden)
Howard Amanda
2005-03-01
Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.
LNA-antisense rivals siRNA for gene silencing
DEFF Research Database (Denmark)
Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan
2004-01-01
Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.
Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A
2016-06-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Sha Lu
Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
[Construction and identification of eukaryotic plasmid pGC-silencer-U6/Neo/GFP/ABCG2].
Yu, Yanping; Zhang, Song; Kong, Weijia
2010-09-01
To construct three short hairpin RNA (shRNA) interference expression plasmid vectors of human ABCG2 gene, to assay the expression of ABCG2 in a human nasopharyngeal carcinoma (NPC) cell line, CEN-2 cell line, and to detect the RNAi effect of shRNA. Targeting ABCG2 gene sequence, three plasmid expression vectors coding for shRNA and a control vector containing random DNA fragment were constructed. The recombinant plasmids were amplified in Ecoli. DH5 and then identified by restriction digestion, PCR and sequencing. The recombinant plasmids were transfected into CEN-2 cells. ABCG2 expression was assayed by real-time quantitative PCR and Western blot. The construction of pGC-silencer-U6/Neo/GFP/ABCG2 was succeed. The shRNA plasmids significantly down-regulated the ABCG2 expression in CEN-2 cells, at both mRNA level and protein level. Recombinant plasmid 1 had the strongest effect compared with plasmids 2 and 3 (P < 0.05), with an inhibition ratio of 75% at the mRNA level and 68% at the protein level. pGC-silencer-U6/Neo/GFP/ABCG2 has been successfully constructed and it can down-regulate ABCG2 expression after transfected into CEN-2 cells, which could help further studies of ABCG2 functions CEN-2 cell line and contribute to the NPC gene therapy.
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Directory of Open Access Journals (Sweden)
Irene Flønes
Full Text Available Biotin-thiamine responsive basal ganglia disease is a severe, but potentially treatable disorder caused by mutations in the SLC19A3 gene. Although the disease is inherited in an autosomal recessive manner, patients with typical phenotypes carrying single heterozygous mutations have been reported. This makes the diagnosis uncertain and may delay treatment.In two siblings with early-onset encephalopathy dystonia and epilepsy, whole-exome sequencing revealed a novel single heterozygous SLC19A3 mutation (c.337T>C. Although Sanger-sequencing and copy-number analysis revealed no other aberrations, RNA-sequencing in brain tissue suggested the second allele was silenced. Whole-genome sequencing resolved the genetic defect by revealing a novel 45,049 bp deletion in the 5'-UTR region of the gene abolishing the promoter. High dose thiamine and biotin therapy was started in the surviving sibling who remains stable. In another patient two novel compound heterozygous SLC19A3 mutations were found. He improved substantially on thiamine and biotin therapy.We show that large genomic deletions occur in the regulatory region of SLC19A3 and should be considered in genetic testing. Moreover, our study highlights the power of whole-genome sequencing as a diagnostic tool for rare genetic disorders across a wide spectrum of mutations including non-coding large genomic rearrangements.
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.
Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M
2017-10-10
The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.
Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy
Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.
2016-01-01
Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199
Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.
Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R
2017-05-01
Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing
Directory of Open Access Journals (Sweden)
Adriana F. Fusaro
2017-10-01
Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.
High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.
Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert
2018-01-01
Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.
Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells
International Nuclear Information System (INIS)
Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian
2004-01-01
Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Directory of Open Access Journals (Sweden)
Zanatta Daniela B
2010-06-01
Full Text Available Abstract Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma and C6 (rat glioma cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet
International Nuclear Information System (INIS)
Merkel, Christian A; Silva Soares, Rafael B da; Carvalho, Anna Carolina V de; Zanatta, Daniela B; Bajgelman, Marcio C; Fratini, Paula; Costanzi-Strauss, Eugenia; Strauss, Bryan E
2010-01-01
Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Directory of Open Access Journals (Sweden)
Tatiana I Novobrantseva
2012-01-01
Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.
Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.
Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E
2010-12-15
N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.
Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.
2004-01-01
RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing
Silencing of copine genes confers common wheat enhanced resistance to powdery mildew.
Zou, Baohong; Ding, Yuan; Liu, He; Hua, Jian
2018-06-01
Powdery mildew, caused by the biotrophic fungal pathogen Blumeria graminis f. sp. tritici (Bgt), is a major threat to the production of wheat (Triticum aestivum). It is of great importance to identify new resistance genes for the generation of Bgt-resistant or Bgt-tolerant wheat varieties. Here, we show that the wheat copine genes TaBON1 and TaBON3 negatively regulate wheat disease resistance to Bgt. Two copies of TaBON1 and three copies of TaBON3, located on chromosomes 6AS, 6BL, 1AL, 1BL and 1DL, respectively, were identified from the current common wheat genome sequences. The expression of TaBON1 and TaBON3 is responsive to both pathogen infection and temperature changes. Knocking down of TaBON1 or TaBON3 by virus-induced gene silencing (VIGS) induces the up-regulation of defence responses in wheat. These TaBON1- or TaBON3-silenced plants exhibit enhanced wheat disease resistance to Bgt, accompanied by greater accumulation of hydrogen peroxide and heightened cell death. In addition, high temperature has little effect on the up-regulation of defence response genes conferred by the silencing of TaBON1 or TaBON3. Our study shows a conserved function of plant copine genes in plant immunity and provides new genetic resources for the improvement of resistance to powdery mildew in wheat. © 2017 BSPP AND JOHN WILEY & SONS LTD.
Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong
2014-01-01
We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893
Directory of Open Access Journals (Sweden)
João Paulo Portela Catani
2016-12-01
Full Text Available Therapeutic strategies that act by eliciting and enhancing antitumor immunity have been clinically validated as an effective treatment modality but may benefit from the induction of both cell death and immune activation as primary stimuli. Using our AdRGD-PG adenovector platform, we show here for the first time that in situ gene transfer of p19Arf and interferon-β (IFNβ in the LLC1 mouse model of lung carcinoma acts as an immunotherapy. Although p19Arf is sufficient to induce cell death, only its pairing with IFNβ significantly induced markers of immunogenic cell death. In situ gene therapy with IFNβ, either alone or in combination with p19Arf, could retard tumor progression, but only the combined treatment was associated with a protective immune response. Specifically in the case of combined intratumoral gene transfer, we identified 167 differentially expressed genes when using microarray to evaluate tumors that were treated in vivo and confirmed the activation of CCL3, CXCL3, IL1α, IL1β, CD274, and OSM, involved in immune response and chemotaxis. Histologic evaluation revealed significant tumor infiltration by neutrophils, whereas functional depletion of granulocytes ablated the antitumor effect of our approach. The association of in situ gene therapy with cisplatin resulted in synergistic elimination of tumor progression. In all, in situ gene transfer with p19Arf and IFNβ acts as an immunotherapy involving recruitment of neutrophils, a desirable but previously untested outcome, and this approach may be allied with chemotherapy, thus providing significant antitumor activity and warranting further development for the treatment of lung carcinoma.
Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C
2012-01-01
RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.
Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar
2017-08-01
This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.
Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.
2011-01-01
Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN
Mei, Yu; Kernodle, Bliss M.; Hill, John H.
2016-01-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311
Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu
2008-11-15
Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.
Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide
Directory of Open Access Journals (Sweden)
Dacheng Liang
2014-12-01
Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.
Identification of epigenetically regulated genes that predict patient outcome in neuroblastoma
International Nuclear Information System (INIS)
Carén, Helena; Djos, Anna; Nethander, Maria; Sjöberg, Rose-Marie; Kogner, Per; Enström, Camilla; Nilsson, Staffan; Martinsson, Tommy
2011-01-01
Epigenetic mechanisms such as DNA methylation and histone modifications are important regulators of gene expression and are frequently involved in silencing tumor suppressor genes. In order to identify genes that are epigenetically regulated in neuroblastoma tumors, we treated four neuroblastoma cell lines with the demethylating agent 5-Aza-2'-deoxycytidine (5-Aza-dC) either separately or in conjunction with the histone deacetylase inhibitor trichostatin A (TSA). Expression was analyzed using whole-genome expression arrays to identify genes activated by the treatment. These data were then combined with data from genome-wide DNA methylation arrays to identify candidate genes silenced in neuroblastoma due to DNA methylation. We present eight genes (KRT19, PRKCDBP, SCNN1A, POU2F2, TGFBI, COL1A2, DHRS3 and DUSP23) that are methylated in neuroblastoma, most of them not previously reported as such, some of which also distinguish between biological subsets of neuroblastoma tumors. Differential methylation was observed for the genes SCNN1A (p < 0.001), PRKCDBP (p < 0.001) and KRT19 (p < 0.01). Among these, the mRNA expression of KRT19 and PRKCDBP was significantly lower in patients that have died from the disease compared with patients with no evidence of disease (fold change -8.3, p = 0.01 for KRT19 and fold change -2.4, p = 0.04 for PRKCDBP). In our study, a low methylation frequency of SCNN1A, PRKCDBP and KRT19 is significantly associated with favorable outcome in neuroblastoma. It is likely that analysis of specific DNA methylation will be one of several methods in future patient therapy stratification protocols for treatment of childhood neuroblastomas
Characterization of a gene from the EDM1-PSACH region of human chromosome 19p
Energy Technology Data Exchange (ETDEWEB)
Lennon, G.G.; Giorgi, D.; Martin, J.R. [Lawrence Livermore National Lab., CA (United States)] [and others
1994-09-01
Genetic linkage mapping has indicated that both multiple epiphyseal dysplasia (EDM1), a dominantly inherited chondrodysplasia, and pseudoachondroplasia (PSACH), a skeletal disorder associated with dwarfism, map to a 2-3 Mb region of human chromosome 19p. We have isolated a partial cDNA from this region using hybrid selection, and report on progress towards the characterization of the genomic structure and transcription of the corresponding gene. Sequence analysis of the cDNA to date indicates that this gene is likely to be expressed within extracellular matrix tissues. Defects in this gene or neighboring gene family members may therefore lead to EDM1, PSACH, or other connective tissue and skeletal disorders.
Directory of Open Access Journals (Sweden)
Amanda Ackley
2013-01-01
Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.
MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense
Directory of Open Access Journals (Sweden)
Sheng-Rui Liu
2017-09-01
Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.
Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert
2017-11-30
Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.
2004-01-01
Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These
Directory of Open Access Journals (Sweden)
Lim Chee Liew
Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.
Dobnik, David; Lazar, Ana; Stare, Tjaša; Gruden, Kristina; Vleeshouwers, Vivianne G.A.A.; Žel, Jana
2016-01-01
<p>Background: Virus-induced gene silencing (VIGS) is an optimal tool for functional analysis of genes in plants, as the viral vector spreads throughout the plant and causes reduced expression of selected gene over the whole plant. Potato (Solanum tuberosum) is one of the most important food crops,
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Silencing of human T-cell leukemia virus type I gene transcription by epigenetic mechanisms
Directory of Open Access Journals (Sweden)
Mueller Nancy
2005-10-01
Full Text Available Abstract Background Human T-cell leukemia virus type I (HTLV-I causes adult T-cell leukemia (ATL after a long latent period. Among accessory genes encoded by HTLV-I, the tax gene is thought to play a central role in oncogenesis. However, Tax expression is disrupted by several mechanims including genetic changes of the tax gene, deletion/hypermethylation of 5'-LTR. To clarify the role of epigenetic changes, we analyzed DNA methylation and histone modification in the whole HTLV-I provirus genome. Results The gag, pol and env genes of HTLV-I provirus were more methylated than pX region, whereas methylation of 5'-LTR was variable and 3'-LTR was not methylated at all. In ATL cell lines, complete DNA methylation of 5'-LTR was associated with transcriptional silencing of viral genes. HTLV-I provirus was more methylated in primary ATL cells than in carrier state, indicating the association with disease progression. In seroconvertors, DNA methylation was already observed in internal sequences of provirus just after seroconversion. Taken together, it is speculated that DNA methylation first occurs in the gag, pol and env regions and then extends in the 5' and 3' directions in vivo, and when 5'-LTR becomes methylated, viral transcription is silenced. Analysis of histone modification in the HTLV-I provirus showed that the methylated provirus was associated with hypoacetylation. However, the tax gene transcript could not be detected in fresh ATL cells regardless of hyperacetylated histone H3 in 5'-LTR. The transcription rapidly recovered after in vitro culture in such ATL cells. Conclusion These results showed that epigenetic changes of provirus facilitated ATL cells to evade host immune system by suppressing viral gene transcription. In addition, this study shows the presence of another reversible mechanism that suppresses the tax gene transcription without DNA methylation and hypoacetylated histone.
Directory of Open Access Journals (Sweden)
Jose C Garcia-Garcia
2009-06-01
Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
DEFF Research Database (Denmark)
Nagasawa, T; Zhang, Q; Raghunath, P N
2006-01-01
To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...
Muhle, Rebecca A; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J; Muhle, Michael E; Fidock, David A
2009-11-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitised erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilising the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var subtelomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronised parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may result from the integrated UpsA promoter being largely silenced by the neighbouring cg6 promoter. Our analyses also revealed that the DownsA 3' untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA-promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyse promoter activity of Group A var genes, which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of var
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T
1993-10-01
A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.
Directory of Open Access Journals (Sweden)
Praveen Guleria
Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Directory of Open Access Journals (Sweden)
Jiangyu Wu
2013-01-01
Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.
Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review
Huang, Weizhe; He, Ziying
2013-01-01
RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498
Directory of Open Access Journals (Sweden)
Fangfang Li
2017-09-01
Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.
Directory of Open Access Journals (Sweden)
Masaki Takahashi
2015-01-01
Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.
Muhle, Rebecca A.; Adjalley, Sophie; Falkard, Brie; Nkrumah, Louis J.; Muhle, Michael E.; Fidock, David A.
2009-01-01
Questions surround the mechanism of mutually exclusive expression by which Plasmodium falciparum mediates activation and silencing of var genes. These encode PfEMP1 proteins, which function as cytoadherent and immunomodulatory molecules at the surface of parasitized erythrocytes. Current evidence suggests that promoter silencing by var introns might play a key role in var gene regulation. To evaluate the impact of cis-acting regulatory regions on var silencing, we generated P. falciparum lines in which luciferase was placed under the control of an UpsA var promoter. By utilizing the Bxb1 integrase system, these reporter cassettes were targeted to a genomic region that was not in apposition to var sub-telomeric domains. This eliminated possible effects from surrounding telomeric elements and removed the variability inherent in episomal systems. Studies with highly synchronized parasites revealed that the UpsA element possessed minimal activity in comparison with a heterologous (hrp3) promoter. This may well result from the integrated UpsA promoter being largely silenced by the neighboring cg6 promoter. Our analyses also revealed that the DownsA 3’ untranslated region further decreased the luciferase activity from both cassettes, whereas the var A intron repressed the UpsA promoter specifically. By applying multivariate analysis over the entire cell cycle, we confirmed the significance of these cis-elements and found the parasite stage to be the major factor regulating UpsA promoter activity. Additionally, we observed that the UpsA promoter was capable of nucleating reversible silencing that spread to a downstream promoter. We believe these studies are the first to analyze promoter activity of Group A var genes which have been implicated in severe malaria, and support the model that var introns can further suppress var expression. These data also suggest an important suppressive role for the DownsA terminator. Our findings imply the existence of multiple levels of
Guleria, Praveen; Yadav, Sudesh Kumar
2013-01-01
Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2014-06-01
Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.
Effect of RNAi p21 gene on uncoupling of EL-4 cells induced by X-irradiation
International Nuclear Information System (INIS)
Ju Guizhi; Yan Fengqin; Fu Shibo; Shen Bo; Sun Shilong; Yang Ying; Li Pengwu
2008-01-01
Objective: To investigate the effect of RNAi p21 gene on uncoupling of EL-4 cells induced by X-irradiation. Methods: Construction of RNAi p21 plasmid of pSileneer3.1-H1 neo-p21 was performed. Lipofectamine transfection assay was used to transfer the p21siBNA into EL-4 cells. Fluorescent staining and flow cytometry (FCM) analysis were employed for measurement of protein expression. Fluorescent staining of propidium iodide (PI) and FCM were used for measurement of potyploid cells. Results: In dose-effect experiment it was found that the expression of P21 protein of EL-4 cells increased significantly 24 h after X- irradiation with different doses compared with sham-inadiated control. In time course experiment it was found that the expression of P21 protein of EL-4 cells increased significantly at 8 h to 72 h after 4.0 Gy X-irradiation compared with sham-irradiated control. The results showed that the number of polyploid cells in EL-4 cells was not changed markedly after X-irradiation with doses of 0.5-6.0 Gy. After RNA interference with p21 gene, the expression of P21 protein of EL-4 cells decreased significantly 24 h and 48 h after 4.0 Gy X-irradiation in transfection of plasmid of pSilencer3.1-H1 neo-p21 compared with transfection of plasmid of pSilencer3.1-H1 nco control. And at the same time, the number of polyploid cells in EL-4 cells was increased significantly in transfection of plasmid of pSilencer3.1-H1 neo-p21 compared with transfection of plasmid of pSilencer3.1-H1 nco control. Conclusions: Uncoupling could be induced by X-irradiation in EL-4 cells following BNAi p21 gene, suggesting that P21 protein may play an important role in uncoupling induced by X-rays. (authors)
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).
Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed
2014-07-01
Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.
DEFF Research Database (Denmark)
Grønlund, Mette; Olsen, Anne; Johansen, Elisabeth
2010-01-01
, the available PEBV-VIGS protocols are inadequate for studying genes involved in the symbiosis with arbuscular mycorrhizal fungi (AMF). Here we describe a PEBV-VIGS protocol suitable for reverse genetics studies in pea of genes involved in the symbiosis with AMF and show its effectiveness in silencing genes...... involved in the early and late stages of AMF symbiosis....
Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Maciej Pietrzak
Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.
Directory of Open Access Journals (Sweden)
Arase Sachiko
2012-03-01
Full Text Available Abstract Background Cytosine methylation is involved in epigenetic control of gene expression in a wide range of organisms. An increasing number of examples indicate that changing the frequency of cytosine methylation in the genome is a feasible tool to engineer novel traits in plants. Although demethylating effects of compounds have been analyzed in human cultured cells in terms of suppressing cancer, their effect in plant cells has not been analyzed extensively. Here, we developed in planta assay systems to detect inhibition of cytosine methylation using plants that contain a transgene transcriptionally silenced by an epigenetic mechanism. Results Seeds of two transgenic plants were used: a petunia line that has been identified as a revertant of the co-suppression of the chalcone synthase-A (CHS-A gene and contains CHS-A transgenes whose transcription is repressed; Nicotiana benthamiana plants that contain the green fluorescent protein (GFP reporter gene whose transcription is repressed through virus-induced transcriptional gene silencing. Seeds of these plants were sown on a medium that contained a demethylating agent, either 5-azacytidine or trichostatin A, and the restoration of the transcriptionally active state of the transgene was detected in seedlings. Using these systems, we found that genistein, a major isoflavonoid compound, inhibits cytosine methylation, thus restoring transgene transcription. Genistein also restored the transcription of an epigenetically silenced endogenous gene in Arabidopsis plants. Conclusions Our assay systems allowed us to assess the inhibition of cytosine methylation, in particular of maintenance of methylation, by compounds in plant cells. These results suggest a novel role of flavonoids in plant cells and that genistein is useful for modifying the epigenetic state of plant genomes.
Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco
An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...
Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao
2015-10-08
Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and
Tang, Wei; Newton, Ronald J; Weidner, Douglas A
2007-01-01
An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.
Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna
2012-11-07
CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively
DEFF Research Database (Denmark)
Kjær, Gabriela Didina Constantin; Grønlund, Mette; Stougaard, Jens
2008-01-01
Virus-induced gene silencing (VIGS) can provide a shortcut to plants with altered expression of specific genes. Here, we report that VIGS of the Nodule inception gene (Nin) can alter the nodulation phenotype and Nin gene expression in Pisum sativum. PsNin was chosen as target because of the disti...
Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C
2013-12-23
Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure
Increasing the amylose content of durum wheat through silencing of the SBEIIa genes
Directory of Open Access Journals (Sweden)
Masci Stefania
2010-07-01
Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.
Zheng, Zhimin
2010-01-06
RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.
Idris, Ali
2010-12-01
A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.
RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice
Directory of Open Access Journals (Sweden)
Jian Liu
2014-01-01
Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.
Effects of gene silencing of CypB on gastric cancer cells.
Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun
2015-04-01
To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
H3K9me-independent gene silencing in fission yeast heterochromatin by Clr5 and histone deacetylases
DEFF Research Database (Denmark)
Hansen, Klavs R; Hazan, Idit; Shanker, Sreenath
2011-01-01
organisms such as fission yeast. In spite of numerous studies, the relative contributions of the various heterochromatic histone marks to the properties of heterochromatin remain largely undefined. Here, we report that silencing of the fission yeast mating-type cassettes, which are located in a well......, our results point to histone deacetylases as prominent repressors of gene expression in fission yeast heterochromatin. These deacetylases can act in concert with, or independently of, the widely studied H3K9me mark to influence gene silencing at heterochromatic loci....
CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs
DEFF Research Database (Denmark)
Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.
2016-01-01
repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...
Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing
Kelleher, Erin S.
2016-01-01
Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614
Directory of Open Access Journals (Sweden)
Johann Lavaud
Full Text Available Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC dependent non-photochemical chlorophyll fluorescence quenching (NPQ is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD into diatoxanthin (DT by the violaxanthin de-epoxidase (VDE, also called DD de-epoxidase (DDE. To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp or long (523 bp antisense (AS fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR. The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms.
Vugrinec, Sascha; Kroth, Peter G.
2012-01-01
Diatoms are a major group of primary producers ubiquitous in all aquatic ecosystems. To protect themselves from photooxidative damage in a fluctuating light climate potentially punctuated with regular excess light exposures, diatoms have developed several photoprotective mechanisms. The xanthophyll cycle (XC) dependent non-photochemical chlorophyll fluorescence quenching (NPQ) is one of the most important photoprotective processes that rapidly regulate photosynthesis in diatoms. NPQ depends on the conversion of diadinoxanthin (DD) into diatoxanthin (DT) by the violaxanthin de-epoxidase (VDE), also called DD de-epoxidase (DDE). To study the role of DDE in controlling NPQ, we generated transformants of P. tricornutum in which the gene (Vde/Dde) encoding for DDE was silenced. RNA interference was induced by genetic transformation of the cells with plasmids containing either short (198 bp) or long (523 bp) antisense (AS) fragments or, alternatively, with a plasmid mediating the expression of a self-complementary hairpin-like construct (inverted repeat, IR). The silencing approaches generated diatom transformants with a phenotype clearly distinguishable from wildtype (WT) cells, i.e. a lower degree as well as slower kinetics of both DD de-epoxidation and NPQ induction. Real-time PCR based quantification of Dde transcripts revealed differences in transcript levels between AS transformants and WT cells but also between AS and IR transformants, suggesting the possible presence of two different gene silencing mediating mechanisms. This was confirmed by the differential effect of the light intensity on the respective silencing efficiency of both types of transformants. The characterization of the transformants strengthened some of the specific features of the XC and NPQ and confirmed the most recent mechanistic model of the DT/NPQ relationship in diatoms. PMID:22629333
Bultreys, Alain; Trombik, Tomasz; Drozak, Anna; Boutry, Marc
2009-09-01
SUMMARY The behaviour of Nicotiana plumbaginifolia plants silenced for the ATP-binding cassette transporter gene NpPDR1 was investigated in response to fungal and oomycete infections. The importance of NpPDR1 in plant defence was demonstrated for two organs in which NpPDR1 is constitutively expressed: the roots and the petal epidermis. The roots of the plantlets of two lines silenced for NpPDR1 expression were clearly more sensitive than those of controls to the fungal pathogens Botrytis cinerea, Fusarium oxysporum sp., F. oxysporum f. sp. nicotianae, F. oxysporum f. sp. melonis and Rhizoctonia solani, as well as to the oomycete pathogen Phytophthora nicotianae race 0. The Ph gene-linked resistance of N. plumbaginifolia to P. nicotianae race 0 was totally ineffective in NpPDR1-silenced lines. In addition, the petals of the NpPDR1-silenced lines were spotted 15%-20% more rapidly by B. cinerea than were the controls. The rapid induction (after 2-4 days) of NpPDR1 expression in N. plumbaginifolia and N. tabacum mature leaves in response to pathogen presence was demonstrated for the first time with fungi and one oomycete: R. solani, F. oxysporum and P. nicotianae. With B. cinerea, such rapid expression was not observed in healthy mature leaves. NpPDR1 expression was not observed during latent infections of B. cinerea in N. plumbaginifolia and N. tabacum, but was induced when conditions facilitated B. cinerea development in leaves, such as leaf ageing or an initial root infection. This work demonstrates the increased sensitivity of NpPDR1-silenced N. plumbaginifolia plants to all of the fungal and oomycete pathogens investigated.
PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.
Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur
2017-07-01
Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Knowles Donald P
2009-11-01
Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.
van der Linde, Karina; Doehlemann, Gunther
2013-01-01
While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.
Directory of Open Access Journals (Sweden)
Yan Liang
2013-11-01
Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.
DEFF Research Database (Denmark)
Riviere, M.P.; Marais, A.; Ponchet, M.
2008-01-01
silenced. Plants lacking extracellular PR-1s were more susceptible than wild-type plants to the oomycete Phytophthora parasitica but displayed unaffected systemic acquired resistance and developmental resistance to this pathogen. Treatment with salicylic acid up-regulates the PR-1g gene, encoding a basic...... protein of the PR-1 family, in PR-1-deficient tobacco, indicating that PR-1 expression may repress that of PR-1g. This shows that acidic PR-1s are dispensable for expression of salicylic acid-dependent acquired resistances against P. parasitica and may reveal a functional overlap in tobacco defence......The class 1 pathogenesis-related (PR) proteins are thought to be involved in plant defence responses, but their molecular functions are unknown. The function of PR-1 was investigated in tobacco by generating stable PR-1a-silenced lines in which other acidic PR-1 genes (PR-1b and PR-1c) were...
Buhrow, Leann M.; Clark, Shawn M.; Loewen, Michele C.
2016-01-01
Background Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which...
Directory of Open Access Journals (Sweden)
Ahmed Y Shanab
Full Text Available Accumulation of the nerve growth factor precursor (proNGF and its receptor p75NTR have been associated with several neurodegenerative diseases in both brain and retina. However, whether proNGF contributes to microvascular degeneration remain unexplored. This study seeks to investigate the mechanism by which proNGF/p75NTR induce endothelial cell (EC death and development of acellular capillaries, a surrogate marker of retinal ischemia. Stable overexpression of the cleavage-resistant proNGF and molecular silencing of p75NTR were utilized in human retinal EC and rat retinas in vivo. Stable overexpression of proNGF decreased NGF levels and induced retinal vascular cell death evident by 1.9-fold increase in acellular capillaries and activation of JNK and cleaved-PARP that were mitigated by p75NTRshRNA. In vitro, overexpression of proNGF did not alter TNF-α level, reduced NGF, however induced EC apoptosis evident by activation of JNK and p38 MAPK, cleaved-PARP. Silencing p75NTR using siRNA restored expression of NGF and TrkA activation and prevented EC apoptosis. Treatment of EC with human-mutant proNGF induced apoptosis that coincided with marked protein interaction and nuclear translocation of p75NTR and the neurotrophin receptor interacting factor. These effects were abolished by a selective p75NTR antagonist. Therefore, targeting p75NTR represents a potential therapeutic strategy for diseases associated with aberrant expression of proNGF.
Virus-induced gene silencing in Medicago truncatula and Lathyrus odorata
DEFF Research Database (Denmark)
Grønlund, Mette; Kjær, Gabriela Didina Constantin; Piednoir, Elodie
2008-01-01
Virus-induced gene silencing (VIGS) has become an important reverse genetics tool for functional genomics. VIGS vectors based on Pea early browning virus (PEBV, genus Tobravirus) and Bean pod mottle virus (genus Comovirus) are available for the legume species Pisum sativum and Glycine max, respec...
The Clinical Implications of Methylated p15 and p73 Genes in Adult Acute Lymphoblastic Leukemia
International Nuclear Information System (INIS)
ABD EL-HAMID, Th.M.; SHERISHER, M.A.; MOSSALLAM, Gh.I.
2010-01-01
Aberrant methylation of promoter associated CpG islands is an epigenetic modification of DNA which is associated with gene silencing. It plays an important role in the leukemia pathogenesis. This phenomenon is frequently observed in acute lymphoblastic leukemia (ALL) and results in the functional inactivation of its associated genes. The aim of this study is to investigate the frequency and the prognostic impact of p15 and p73 genes methylation in adult acute lymphoblastic leukemia patients. Patients and Methods: Methylation-specific polymerase chain reaction (PCR) was used to analyze methylation of the p15 and p73 genes in 51 newly diagnosed adult ALL patients. Results: The methylation frequencies of p15 and p73 genes at diagnosis were 41.2% and 27.5% respectively, while concomitant methylation was detected in 14% of the patients. Concomitant methylation of p15 and p73 genes was associated with significant lower rate of CR compared to patients without methylation (57% versus 90%), p=0.008. Overall survival (OS) was not affected by p15 methylation, but was poorer with p73 methylation and the difference was near significant (p=0.059). For patients without meyhylation, the survival benefit was significant when compared to patients with p15, p73 or both genes methylation (p=0.047). The leukemia free survival was not affected by the methylation status of single gene p15 or p73, but tended to be worse in patients with methylated p15, p73 or both genes when compared to patients without methylation (p= 0.08). Conclusion: Aberrant p73 promoter methylation is a potential prognostic factor in adult ALL patients. P15 methylation is frequent in Egyptian adult ALL patients, its concomitant methylation with p73 is of poor prognostic significance. Identification of these molecular targets improve risk assessment and selection of appropriate therapy.
Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia
Directory of Open Access Journals (Sweden)
Sateesh Krishnamurthy
2012-01-01
Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.
Directory of Open Access Journals (Sweden)
Paul McVeigh
2014-09-01
Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control
Maneekarn, Niwat; Khamrin, Pattara; Chan-it, Wisoot; Peerakome, Supatra; Sukchai, Sujin; Pringprao, Kidsadagon; Ushijima, Hiroshi
2006-01-01
Among 175 fecal specimens collected from diarrheic piglets during a surveillance of porcine rotavirus (PoRV) strains in Chiang Mai, Thailand, 39 (22.3%) were positive for group A rotaviruses. Of these, 33.3% (13 of 39) belonged to G3P[19], which was a rare P genotype seldom reported. Interestingly, their VP4 nucleotide sequences were most closely related to human P[19] strains (Mc323 and Mc345) isolated in 1989 from the same geographical area where these PoRV strains were isolated. These P[19] PoRV strains were also closely related to another human P[19] strain (RMC321), isolated from India in 1990. The VP4 sequence identities with human P[19] were 95.4% to 97.4%, while those to a porcine P[19] strain (4F) were only 87.6 to 89.1%. Phylogenetic analysis of the VP4 gene revealed that PoRV P[19] strains clustered with human P[19] strains in a monophyletic branch separated from strain 4F. Analysis of the VP7 gene confirmed that these strains belonged to the G3 genotype and shared 97.7% to 98.3% nucleotide identities with other G3 PoRV strains circulating in the regions. This close genetic relationship was also reflected in the phylogenetic analysis of their VP7 genes. Altogether, the findings provided peculiar evidence that supported the porcine origin of VP4 genes of Mc323 and Mc345 human rotaviruses. PMID:16988014
Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira
2013-01-30
Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the
Foda, Bardees M.; Singh, Upinder
2015-01-01
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683
Foda, Bardees M; Singh, Upinder
2015-08-21
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5'-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Shirley Lam
Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these
Evolving chromosomes and gene regulatory networks
Indian Academy of Sciences (India)
Aswin
Genes under H NS control can be. (a) regulated by H NS. (b) regulated by H NS and StpA. Because backup by StpA is partial. Page 19. Gene expression level. H NS regulated xenogenes. Other genes. Page 20 ... recollect: H&NS silences highl transcribable genes. Gene expression level unilateral. Other genes epistatic ...
Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S
2006-11-01
Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.
International Nuclear Information System (INIS)
Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup
2015-01-01
RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)
Anthony, Kim; More, Abhijit; Zhang, Xiaoliu
2014-01-01
Recent work has shown that the combinatorial use of multiple TALE activators can selectively activate certain cellular genes in inaccessible chromatin regions. In this study, we aimed to interrogate the activation potential of TALEs upon transcriptionally silenced immune genes in the context of non-immune cells. We designed a unique strategy, in which a single TALE fused to the TATA-box binding protein (TBP-TALE) is coupled with multiple VP64-TALE activators. We found that our strategy is significantly more potent than multiple TALE activators alone in activating expression of IL-2 and GM-CSF in diverse cell origins in which both genes are otherwise completely silenced. Chromatin analysis revealed that the gene activation was due in part to displacement of a distinctly positioned nucleosome. These studies provide a novel epigenetic mechanism for artificial gene induction and have important implications for targeted cancer immunotherapy, DNA vaccine development, as well as rational design of TALE activators.
Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique
2015-10-02
Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Guillaume Jannot
2016-12-01
Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.
Manhães, Ana Marcia E de A; de Oliveira, Marcos V V; Shan, Libo
2015-01-01
Several VIGS protocols have been established for high-throughput functional genomic screens as it bypasses the time-consuming and laborious process of generation of transgenic plants. The silencing efficiency in this approach is largely hindered by a technically demanding step in which the first pair of newly emerged true leaves at the 2-week-old stage are infiltrated with a needleless syringe. To further optimize VIGS efficiency and achieve rapid inoculation for a large-scale functional genomic study, here we describe a protocol of an efficient VIGS assay in Arabidopsis using Agrobacterium-mediated rubbing infection. The Agrobacterium inoculation is performed by simply rubbing the leaves with Filter Agent Celite(®) 545. The highly efficient and uniform silencing effect was indicated by the development of a visibly albino phenotype due to silencing of the Cloroplastos alterados 1 (CLA1) gene in the newly emerged leaves. In addition, the albino phenotype could be observed in stems and flowers, indicating its potential application for gene functional studies in the late vegetative development and flowering stages.
Directory of Open Access Journals (Sweden)
Changho Eun
Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.
Sequence Ready Characterization of the Pericentromeric Region of 19p12
Energy Technology Data Exchange (ETDEWEB)
Evan E. Eichler
2006-08-31
Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy to generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence
Directory of Open Access Journals (Sweden)
Arthur K Tugume
Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in
Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun
2016-01-01
ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors
Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping
2016-11-15
Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate
Broderick, Shaun R.; Jones, Michelle L.
2013-01-01
Virus-induced gene silencing (VIGS) is used to down-regulate endogenous plant genes. VIGS efficiency depends on viral proliferation and systemic movement throughout the plant. Although tobacco rattle virus (TRV)-based VIGS has been successfully used in petunia (Petunia × hybrida), the protocol has not been thoroughly optimized for efficient and uniform gene down-regulation in this species. Therefore, we evaluated six parameters that improved VIGS in petunia. Inoculation of mechanically wounde...
Directory of Open Access Journals (Sweden)
de Souza Emanuel M
2009-03-01
(IDC, and this difference was statistically significant (p = 0.0002. Conclusion ADAM33 gene silencing may be related to the discohesive histological appearance of ILCs. We suggest that ADAM33 promoter methylation may be a useful molecular marker for differentiating ILC and IDC.
International Nuclear Information System (INIS)
Seniski, Gerusa G; Zanata, Silvio M; Costa, Fabrício F; Klassen, Giseli; Camargo, Anamaria A; Ierardi, Daniela F; Ramos, Edneia AS; Grochoski, Mariana; Ribeiro, Enilze SF; Cavalli, Iglenir J; Pedrosa, Fabio O; Souza, Emanuel M de
2009-01-01
statistically significant (p = 0.0002). ADAM33 gene silencing may be related to the discohesive histological appearance of ILCs. We suggest that ADAM33 promoter methylation may be a useful molecular marker for differentiating ILC and IDC
Stability of RNA silencing-based traits after virus infection
DEFF Research Database (Denmark)
Jørgensen, Bodil; Albrechtsen, Merete
2007-01-01
with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...
Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar
2018-02-01
Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.
The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.
Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C
2007-09-18
Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.
Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming
2016-02-01
Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Liyang Chen
2015-11-01
Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.
Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer
International Nuclear Information System (INIS)
Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia
2002-01-01
Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation
Efficient transformation and artificial miRNA gene silencing in Lemna minor.
Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R
2015-01-01
Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Hydrogel-Assisted Antisense LNA Gapmer Delivery for In Situ Gene Silencing in Spinal Cord Injury
DEFF Research Database (Denmark)
Moreno, Pedro M.D.; Ferreira, Ana R.; Salvador, Daniela
2018-01-01
)-modified AON gapmers in combination with a fibrin hydrogel bridging material to induce gene silencing in situ at a SCI lesion site. LNA gapmers were effectively developed against two promising gene targets aiming at enhancing axonal regeneration—RhoA and GSK3β. The fibrin-matrix-assisted AON delivery system......After spinal cord injury (SCI), nerve regeneration is severely hampered due to the establishment of a highly inhibitory microenvironment at the injury site, through the contribution of multiple factors. The potential of antisense oligonucleotides (AONs) to modify gene expression at different levels...
Silencing of a Germin-Like Gene in Nicotiana attenuata Improves Performance of Native Herbivores1[W
Lou, Yonggen; Baldwin, Ian T.
2006-01-01
Germins and germin-like proteins (GLPs) are known to function in pathogen resistance, but their involvement in defense against insect herbivores is poorly understood. In the native tobacco Nicotiana attenuata, attack from the specialist herbivore Manduca sexta or elicitation by adding larval oral secretions (OS) to wounds up-regulates transcripts of a GLP. To understand the function of this gene, which occurs as a single copy, we cloned the full-length NaGLP and silenced its expression in N. attenuata by expressing a 250-bp fragment in an antisense orientation with an Agrobacterium-based transformation system and by virus-induced gene silencing (VIGS). Homozygous lines harboring a single insert and VIGS plants had significantly reduced constitutive (measured in roots) and elicited NaGLP transcript levels (in leaves). Silencing NaGLP improved M. sexta larval performance and Tupiocoris notatus preference, two native herbivores of N. attenuata. Silencing NaGLP also attenuated the OS-induced hydrogen peroxide (H2O2), diterpene glycosides, and trypsin proteinase inhibitor responses, which may explain the observed susceptibility of antisense or VIGS plants to herbivore attack and increased nicotine contents, but did not influence the OS-elicited jasmonate and salicylate bursts, or the release of the volatile organic compounds (limonene, cis-α-bergamotene, and germacrene-A) that function as an indirect defense. This suggests that NaGLP is involved in H2O2 production and might also be related to ethylene production and/or perception, which in turn influences the defense responses of N. attenuata via H2O2 and ethylene-signaling pathways. PMID:16461381
Directory of Open Access Journals (Sweden)
Kittipong Rattanaporn
2011-08-01
Full Text Available Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin, CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA domain of human capillary morphogenesis 2 (CMG2, an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG. We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS: p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI, with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.
Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A
2011-01-01
Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.
siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.
Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio
2008-09-18
Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.
Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.
Directory of Open Access Journals (Sweden)
Stella Marie Reamon-Buettner
Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.
Directory of Open Access Journals (Sweden)
Li Xiao Hui
2015-09-01
Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.
International Nuclear Information System (INIS)
Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad
2014-01-01
Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer
International Nuclear Information System (INIS)
Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei
2012-01-01
Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.
The molecular basis for stability of heterochromatin-mediated silencing in mammals.
Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard
2009-11-04
The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
The molecular basis for stability of heterochromatin-mediated silencing in mammals
Directory of Open Access Journals (Sweden)
Hiragami-Hamada Kyoko
2009-11-01
Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping
2018-02-19
Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.
International Nuclear Information System (INIS)
Igarashi, Aki; Yamagata, Kousuke; Sugai, Tomokazu; Takahashi, Yukari; Sugawara, Emiko; Tamura, Akihiro; Yaegashi, Hajime; Yamagishi, Noriko; Takahashi, Tsubasa; Isogai, Masamichi; Takahashi, Hideki; Yoshikawa, Nobuyuki
2009-01-01
Apple latent spherical virus (ALSV) vectors were evaluated for virus-induced gene silencing (VIGS) of endogenous genes among a broad range of plant species. ALSV vectors carrying partial sequences of a subunit of magnesium chelatase (SU) and phytoene desaturase (PDS) genes induced highly uniform knockout phenotypes typical of SU and PDS inhibition on model plants such as tobacco and Arabidopsis thaliana, and economically important crops such as tomato, legume, and cucurbit species. The silencing phenotypes persisted throughout plant growth in these plants. In addition, ALSV vectors could be successfully used to silence a meristem gene, proliferating cell nuclear antigen and disease resistant N gene in tobacco and RCY1 gene in A. thaliana. As ALSV infects most host plants symptomlessly and effectively induces stable VIGS for long periods, the ALSV vector is a valuable tool to determine the functions of interested genes among a broad range of plant species.
Epigenetic silencing of CYP24 in the tumor microenvironment
Johnson, Candace S.; Chung, Ivy; Trump, Donald L.
2010-01-01
Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059
International Nuclear Information System (INIS)
Moskalev, Evgeny A; Pötz, Oliver; Joos, Thomas O; Hoheisel, Jörg D; Luckert, Katrin; Vorobjev, Ivan A; Mastitsky, Sergey E; Gladkikh, Aleena A; Stephan, Achim; Schrenk, Marita; Kaplanov, Kamil D; Kalashnikova, Olga B
2012-01-01
The Wnt/β-catenin signalling is aberrantly activated in primary B cell chronic lymphocytic leukaemia (CLL). Epigenetic silencing of pathway inhibitor genes may be a mechanism for its activation. In this study, we investigated systematically and quantitatively the methylation status of 12 Wnt/β-catenin pathway inhibitor genes – CDH1, DACT1, DKK1, DKK2, DKK3, DKK4, SFRP1, SFRP2, SFRP3, SFRP4, SFRP5 and WIF1 – in the cell lines EHEB and MEC-1 as well as patient samples. Quantification of DNA methylation was performed by means of bisulphite pyrosequencing and confirmed by bisulphite Sanger sequencing. Gene expression was analysed by qPCR using GAPDH as internal control. E-cadherin and β-catenin protein quantification was carried out by microsphere-based immunoassays. Methylation differences observed between the patient and control groups were tested using generalised least squares models. For 10 genes, a higher methylation level was observed in tumour material. Only DKK4 exhibited similarly high methylation levels in both tumour and normal specimens, while DACT1 was always essentially unmethylated. However, also for these inhibitors, treatment of cells with the demethylating agent 5-aza-2´-deoxycytidine resulted in an induction of their expression, as shown by quantitative PCR, suggesting an indirect epigenetic control of activity. While the degree of demethylation and its transcriptional consequences differed between the genes, there was an overall high correlation of demethylation and increased activity. Protein expression studies revealed that no constitutive Wnt/β-catenin signalling occurred in the cell lines, which is in discrepancy with results from primary CLL. However, treatment with 5-aza-2´-deoxycytidine caused accumulation of β-catenin. Simultaneously, E-cadherin expression was strongly induced, leading to the formation of a complex with β-catenin and thus demonstrating its epigenetically regulated inhibition effect. The results suggest an
Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.
Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan
2018-04-06
The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.
Titration and hysteresis in epigenetic chromatin silencing
International Nuclear Information System (INIS)
Dayarian, Adel; Sengupta, Anirvan M
2013-01-01
Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)
Histone Methylation and Epigenetic Silencing in Breast Cancer
National Research Council Canada - National Science Library
Simon, Jeffrey A; Lange, Carol A
2008-01-01
.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...
BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS
Directory of Open Access Journals (Sweden)
Omarov R.T.
2012-08-01
Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of
International Nuclear Information System (INIS)
Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.
2012-01-01
Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin
Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.
Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J
2017-11-21
Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.
Reactivation of CDX2 in Gastric Cancer as Mark for Gene Silencing Memory
International Nuclear Information System (INIS)
Kameoka, Yuri; Kitazawa, Riko; Ariasu, Kanazu; Tachibana, Ryosuke; Mizuno, Yosuke; Haraguchi, Ryuma; Kitazawa, Sohei
2015-01-01
To explore the epigenetic mechanism that reactivates CDX2 (a homeobox transcription factor that serves as a tumor-suppressor gene) in intestinal-type gastric cancer during cancer progression, we examined the methylation status of the CDX2 gene promoter and the expression pattern of methyl-CpG binding protein-2 (MeCP2). From archives of the pathology records of surgically excised advanced stomach cancer cases in the Department of Molecular Pathology, Ehime University in a past decate (n=265), 10 cases of intestinal-type tubular adenocarcinoma, well-differentiated type (wel) with minor poorly-differentiated adenocarcinoma (por) components were selected. The expression pattern of CDX2, MUC2 and MeCP2 in these 10 cases was analyzed by immunohistochemistry. The cancerous and non-cancerous areas were selectively obtained by microdissection, and the methylation status of the CDX2 promoter of each area was assessed by methylation-specific polymerase chain reaction (MSP). In all 10 cases, CDX2 expression was clearly observed in the nucleus of the non-cancerous background of the intestinal metaplasic area, where the unmethylation pattern of the CDX2 gene promoter prevailed with reduced MeCP2 expression. In this metaplastic area, CDX2 expression was co-localized with its target gene, MUC2. CDX2 expression then disappeared from the deep invasive wel area. Reflecting the reduced CDX2 expression, microdissected samples from all the wel areas showed hypermethylation of the CDX2 gene promoter by MSP, with prominent MeCP2 expression. Interestingly, while hypermethylation of the CDX2 gene promoter was maintained in the por area in 8 of the 10 cases, CDX2 expression was restored in por areas where MeCP2 expression was markedly and selectively reduced. The other two cases, however, showed a constant MeCP2 expression level comparable to the surrounding deep invasive wel area with negative CDX2 expression. Therefore, gene silencing by hypermethylation may be overcome by the reduction of
Buhrow, Leann M; Clark, Shawn M; Loewen, Michele C
2016-01-01
Virus-induced gene silencing (VIGS) has become an emerging technology for the rapid, efficient functional genomic screening of monocot and dicot species. The barley stripe mosaic virus (BSMV) has been described as an effective VIGS vehicle for the evaluation of genes involved in wheat and barley phytopathogenesis; however, these studies have been obscured by BSMV-induced phenotypes and defense responses. The utility of BSMV VIGS may be improved using a BSMV genetic background which is more tolerable to the host plant especially upon secondary infection of highly aggressive, necrotrophic pathogens such as Fusarium graminearum. BSMV-induced VIGS in Triticum aestivum (bread wheat) cv. 'Fielder' was assessed for the study of wheat genes putatively related to Fusarium Head Blight (FHB), the necrotrophism of wheat and other cereals by F. graminearum. Due to the lack of 'Fielder' spike viability and increased accumulation of Fusarium-derived deoxynivalenol contamination upon co-infection of BSMV and FHB, an attenuated BSMV construct was generated by the addition of a glycine-rich, C-terminal peptide to the BSMV γ b protein. This attenuated BSMV effectively silenced target wheat genes while limiting disease severity, deoxynivalenol contamination, and yield loss upon Fusarium co-infection compared to the original BSMV construct. The attenuated BSMV-infected tissue exhibited reduced abscisic, jasmonic, and salicylic acid defense phytohormone accumulation upon secondary Fusarium infection. Finally, the attenuated BSMV was used to investigate the role of the salicylic acid-responsive pathogenesis-related 1 in response to FHB. The use of an attenuated BSMV may be advantageous in characterizing wheat genes involved in phytopathogenesis, including Fusarium necrotrophism, where minimal viral background effects on defense are required. Additionally, the attenuated BSMV elicits reduced defense hormone accumulation, suggesting that this genotype may have applications for the
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.
Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.
Directory of Open Access Journals (Sweden)
Tingxiu Xiang
Full Text Available Breast cancer (BrCa is a complex disease driven by aberrant gene alterations and environmental factors. Recent studies reveal that abnormal epigenetic gene regulation also plays an important role in its pathogenesis. Ubiquitin carboxyl- terminal esterase L1 (UCHL1 is a tumor suppressor silenced by promoter methylation in multiple cancers, but its role and alterations in breast tumorigenesis remain unclear.We found that UCHL1 was frequently downregulated or silenced in breast cancer cell lines and tumor tissues, but readily expressed in normal breast tissues and mammary epithelial cells. Promoter methylation of UCHL1 was detected in 9 of 10 breast cancer cell lines (90% and 53 of 66 (80% primary tumors, but rarely in normal breast tissues, which was statistically correlated with advanced clinical stage and progesterone receptor status. Pharmacologic demethylation reactivated UCHL1 expression along with concomitant promoter demethylation. Ectopic expression of UCHL1 significantly suppressed the colony formation and proliferation of breast tumor cells, through inducing G0/G1 cell cycle arrest and apoptosis. Subcellular localization study showed that UCHL1 increased cytoplasmic abundance of p53. We further found that UCHL1 induced p53 accumulation and reduced MDM2 protein level, and subsequently upregulated the expression of p21, as well as cleavage of caspase3 and PARP, but not in catalytic mutant UCHL1 C90S-expressed cells.UCHL1 exerts its tumor suppressive functions by inducing G0/G1cell cycle arrest and apoptosis in breast tumorigenesis, requiring its deubiquitinase activity. Its frequent silencing by promoter CpG methylation may serve as a potential tumor marker for breast cancer.
Clinical comparison of overlapping deletions of 19p13.3.
Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A
2013-05-01
We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.
Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano
2013-09-01
An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.
Directory of Open Access Journals (Sweden)
Thibaut Josse
2007-09-01
Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.
DEFF Research Database (Denmark)
Pacak, Andrzej; Geisler, Katrin; Jørgensen, Bodil
2010-01-01
-expressed genes we wanted to explore the potential of BSMV for silencing genes in root tissues. Furthermore, the newly completed genome sequence of the emerging cereal model species Brachypodium distachyon as well as the increasing amount of EST sequence information available for oat (Avena species) have created...
Directory of Open Access Journals (Sweden)
Qiong Jia
Full Text Available Diamond-Blackfan anemia (DBA is a rare inherited bone marrow failure syndrome that is characterized by pure red-cell aplasia and associated physical deformities. It has been proven that defects of ribosomal proteins can lead to this disease and that RPS19 is the most frequently mutated gene in DBA patients. Previous studies suggest that p53-dependent genes and pathways play important roles in RPS19-deficient embryos. However, whether there are other vital factors linked to DBA has not been fully clarified. In this study, we compared the whole genome RNA-Seq data of zebrafish embryos injected with RPS19 morpholino (RPS19 MO, RPS19 and p53 morpholino simultaneously (RPS19+p53 MO and control morpholino (control. We found that genes enriched in the functions of hematological systems, nervous system development and skeletal and muscular disorders had significant differential expression in RPS19 MO embryos compared with controls. Co-inhibition of p53 partially alleviates the abnormalities for RPS19-deficient embryos. However, the hematopoietic genes, which were down-regulated significantly in RPS19 MO embryos, were not completely recovered by the co-inhibition of p53. Furthermore, we identified the genome-wide p53-dependent and -independent genes and pathways. These results indicate that not only p53 family members but also other factors have important impacts on RPS19-deficient embryos. The detection of potential pathogenic genes and pathways provides us a new paradigm for future research on DBA, which is a systematic and complex hereditary disease.
Cernilogar, Filippo M.
2013-06-13
Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis
Directory of Open Access Journals (Sweden)
Rita Marta
2014-10-01
Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.
Directory of Open Access Journals (Sweden)
Philippe Lashermes
2016-09-01
Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Zhou, Li; Chen, Zhifei; Wang, Feifei; Yang, Xiuqun; Zhang, Biliang
2013-04-01
A non-viral siRNA carrier composed of mono-methoxy-poly (3-hydroxybutyrate-co-4-hydroxybutyrate)-block-polyethylene glycol-block-linear polyethyleneimine (mP3/4HB-b-PEG-b-lPEI) was synthesized using 1800 Da linear polyethyleneimine and evaluated for siRNA delivery. Our study demonstrated that siRNA could be efficiently combined with mP3/4HB-b-PEG-b-lPEI (mAG) co-polymer and was protected from nuclease degradation. The combined siRNA were released from the complexes easily under heparin competition. The particle size of the mAG/siRNA complexes was 158 nm, with a ζ-potential of around 28 mV. Atomic force microscopy images displayed spherical and homogeneously distributed complexes. The mAG block co-polymer displayed low cytotoxicity and efficient cellular uptake of Cy3-siRNA in A549 cells by flow cytometry and confocal microscopy. In vitro transfection efficiency of the block co-polymer was assessed using siRNA against luciferase in cultured A549-Luc, HeLa-Luc, HLF-Luc, A375-Luc and MCF-7-Luc cells. A higher transfection efficiency and lower cytotoxicity was obtained by mAG block co-polymer in five cell lines. Furthermore, a remarkable improvement in luciferase gene silencing efficiency of the mAG complex (up to 90-95%) over that of Lipofectamine™ 2000 (70-82%) was observed in HLF-Luc and A375-Luc cells. Additionally, a mAG/p65-siRNA complex also showed a better capability than Lipofectamine™ 2000/p65-siRNA complex to drastically reduce the p65 mRNA level down to 10-16% in HeLa, U251 and HUVEC cells at an N/P ratio of 70. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli
2013-07-01
Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Weld, R; Heinemann, J; Eady, C
2001-03-01
The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells from Agrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP activity during the first 4 weeks of culture. Multiple T-DNA copies of the gfp gene were detected in 10 of 17 proto-calluses lacking visible GFP activity. The remaining 7 cell lines contained no gfp sequences. Our results confirm that transiently expressed T-DNAs can be lost during growth of somatic cells and demonstrate that transiently expressing cells frequently integrate multiple T-DNAs that become silenced. In cells competent for DNA uptake, cell death and gene silencing were more important barriers to the recovery of stably expressing transformants than lack of T-DNA integration.
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz
2018-04-15
Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Beck, Markus; Strand, Michael R.
2003-01-01
The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes
Cui, Hongguang; Wang, Aiming
2017-03-01
RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.
Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik
2013-05-01
AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.
Onyilo, Francis; Tusiime, Geoffrey; Tripathi, Jaindra N; Chen, Li-Hung; Falk, Bryce; Stergiopoulos, Ioannis; Tushemereirwe, Wilberforce; Kubiriba, Jerome; Tripathi, Leena
2018-01-01
Pseudocercospora fijiensis , causal agent of the black Sigatoka disease (BSD) of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB). This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG) could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.
Directory of Open Access Journals (Sweden)
Francis Onyilo
2018-03-01
Full Text Available Pseudocercospora fijiensis, causal agent of the black Sigatoka disease (BSD of Musa spp., has spread globally since its discovery in Fiji 1963 to all the banana and plantain growing areas across the globe. It is becoming the most damaging and economically important disease of this crop. The identification and characterization of genes that regulate infection processes and pathogenicity in P. fijiensis will provide important knowledge for the development of disease-resistant cultivars. In many fungal plant pathogens, the Fus3 and Slt2 are reported to be essential for pathogenicity. Fus3 regulates filamentous-invasion pathways including the formation of infection structures, sporulation, virulence, and invasive and filamentous growth, whereas Slt2 is involved in the cell-wall integrity pathway, virulence, invasive growth, and colonization in host tissues. Here, we used RNAi-mediated gene silencing to investigate the role of the Slt2 and Fus3 homologs in P. fijiensis in pathogen invasiveness, growth and pathogenicity. The PfSlt2 and PfFus3 silenced P. fijiensis transformants showed significantly lower gene expression and reduced virulence, invasive growth, and lower biomass in infected leaf tissues of East African Highland Banana (EAHB. This study suggests that Slt2 and Fus3 MAPK signaling pathways play important roles in plant infection and pathogenic growth of fungal pathogens. The silencing of these vital fungal genes through host-induced gene silencing (HIG could be an alternative strategy for developing transgenic banana and plantain resistant to BSD.
Directory of Open Access Journals (Sweden)
Wen Zhang
Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of
Directory of Open Access Journals (Sweden)
Lehto Kirsi
2011-04-01
Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S
Zheng, S.J.; Snoeren, T.A.L.; Hogewoning, S.W.; Loon, van J.J.A.; Dicke, M.
2010-01-01
Optical plant characteristics are important cues to plant-feeding insects. In this article, we demonstrate for the first time that silencing the phytoene desaturase (PDS) gene, encoding a key enzyme in plant carotenoid biosynthesis, affects insect oviposition site selection behaviour. Virus-induced
Elevated expression of H19 and Igf2 in the female mouse eye.
Directory of Open Access Journals (Sweden)
Björn Reinius
Full Text Available The catalogue of genes expressed at different levels in the two sexes is growing, and the mechanisms underlying sex differences in regulation of the mammalian transcriptomes are being explored. Here we report that the expression of the imprinted non-protein-coding maternally expressed gene H19 was female-biased specifically in the female mouse eye (1.9-fold, p = 3.0E-6 while not being sex-biased in other somatic tissues. The female-to-male expression fold-change of H19 fell in the range expected from an effect of biallelic versus monoallelic expression. Recently, the possibility of sex-specific parent-of-origin allelic expression has been debated. This led us to hypothesize that H19 might express biallelically in the female mouse eye, thus escape its silencing imprint on the paternal allele specifically in this tissue. We therefore performed a sex-specific imprinting assay of H19 in female and male eye derived from a cross between Mus musculus and Mus spretus. However, this analysis demonstrated that H19 was exclusively expressed from the maternal gene copy, disproving the escape hypothesis. Instead, this supports that the female-biased expression of H19 is the result of upregulation of the single maternal. Furthermore, if H19 would have been expressed from both gene copies in the female eye, an associated downregulation of Insulin-like growth factor 2 (Igf2 was expected, since H19 and Igf2 compete for a common enhancer element located in the H19/Igf2 imprinted domain. On the contrary we found that also Igf2 was significantly upregulated in its expression in the female eye (1.2-fold, p = 6.1E-3, in further agreement with the conclusion that H19 is monoallelically elevated in females. The female-biased expression of H19 and Igf2 specifically in the eye may contribute to our understanding of sex differences in normal as well as abnormal eye physiology and processes.
Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David
2014-01-01
Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370
Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects
International Nuclear Information System (INIS)
Huang, Shang-Lang; Chao, Chuck C.-K.
2015-01-01
A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug
Silencing of Taxol-Sensitizer Genes in Cancer Cells: Lack of Sensitization Effects
Energy Technology Data Exchange (ETDEWEB)
Huang, Shang-Lang [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Chao, Chuck C.-K., E-mail: cckchao@mail.cgu.edu.tw [Department of Biochemistry and Molecular Biology, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Graduate Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan (China); Department of Medical Research and Development, Chang Gung Memorial Hospital, Taoyuan 333, Taiwan (China)
2015-06-16
A previous genome-wide screening analysis identified a panel of genes that sensitize the human non-small-cell lung carcinoma cell line NCI-H1155 to taxol. However, whether the identified genes sensitize other cancer cells to taxol has not been examined. Here, we silenced the taxol-sensitizer genes identified (acrbp, atp6v0d2, fgd4, hs6st2, psma6, and tubgcp2) in nine other cancer cell types (including lung, cervical, ovarian, and hepatocellular carcinoma cell lines) that showed reduced cell viability in the presence of a sub-lethal concentration of taxol. Surprisingly, none of the genes studied increased sensitivity to taxol in the tested panel of cell lines. As observed in H1155 cells, SKOV3 cells displayed induction of five of the six genes studied in response to a cell killing dose of taxol. The other cell types were much less responsive to taxol. Notably, four of the five inducible taxol-sensitizer genes tested (acrbp, atp6v0d2, psma6, and tubgcp2) were upregulated in a taxol-resistant ovarian cancer cell line. These results indicate that the previously identified taxol-sensitizer loci are not conserved genetic targets involved in inhibiting cell proliferation in response to taxol. Our findings also suggest that regulation of taxol-sensitizer genes by taxol may be critical for acquired cell resistance to the drug.
Conifers have a unique small RNA silencing signature
Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.
2008-01-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing; Zhu, Jian-Kang
2010-01-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje
2010-01-25
Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Michelle F. Valentine
2017-05-01
Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.
Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.
2017-01-01
Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898
Deletion of an X-inactivation boundary disrupts adjacent gene silencing.
Directory of Open Access Journals (Sweden)
Lindsay M Horvath
2013-11-01
Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.
Kaufmann, Markus; Schuffenhauer, Ansgar; Fruh, Isabelle; Klein, Jessica; Thiemeyer, Anke; Rigo, Pierre; Gomez-Mancilla, Baltazar; Heidinger-Millot, Valerie; Bouwmeester, Tewis; Schopfer, Ulrich; Mueller, Matthias; Fodor, Barna D; Cobos-Correa, Amanda
2015-10-01
Fragile X syndrome (FXS) is the most common form of inherited mental retardation, and it is caused in most of cases by epigenetic silencing of the Fmr1 gene. Today, no specific therapy exists for FXS, and current treatments are only directed to improve behavioral symptoms. Neuronal progenitors derived from FXS patient induced pluripotent stem cells (iPSCs) represent a unique model to study the disease and develop assays for large-scale drug discovery screens since they conserve the Fmr1 gene silenced within the disease context. We have established a high-content imaging assay to run a large-scale phenotypic screen aimed to identify compounds that reactivate the silenced Fmr1 gene. A set of 50,000 compounds was tested, including modulators of several epigenetic targets. We describe an integrated drug discovery model comprising iPSC generation, culture scale-up, and quality control and screening with a very sensitive high-content imaging assay assisted by single-cell image analysis and multiparametric data analysis based on machine learning algorithms. The screening identified several compounds that induced a weak expression of fragile X mental retardation protein (FMRP) and thus sets the basis for further large-scale screens to find candidate drugs or targets tackling the underlying mechanism of FXS with potential for therapeutic intervention. © 2015 Society for Laboratory Automation and Screening.
International Nuclear Information System (INIS)
Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.
2012-01-01
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.
Small RNA-Mediated Epigenetic Myostatin Silencing
Directory of Open Access Journals (Sweden)
Thomas C Roberts
2012-01-01
Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.
Directory of Open Access Journals (Sweden)
Barra Viviana
2012-02-01
Full Text Available Abstract Background Aneuploidy has been acknowledged as a major source of genomic instability in cancer, and it is often considered the result of chromosome segregation errors including those caused by defects in genes controlling the mitotic spindle assembly, centrosome duplication and cell-cycle checkpoints. Aneuploidy and chromosomal instability has been also correlated with epigenetic alteration, however the molecular basis of this correlation is poorly understood. Results To address the functional connection existing between epigenetic changes and aneuploidy, we used RNA-interference to silence the DNMT1 gene, encoding for a highly conserved member of the DNA methyl-transferases. DNMT1 depletion slowed down proliferation of near-diploid human tumor cells (HCT116 and triggered G1 arrest in primary human fibroblasts (IMR90, by inducing p53 stabilization and, in turn, p21waf1 transactivation. Remarkably, p53 increase was not caused by DNA damage and was not observed after p14-ARF post-transcriptional silencing. Interestingly, DNMT1 silenced cells with p53 or p14-ARF depleted did not arrest in G1 but, instead, underwent DNA hypomethylation and became aneuploid. Conclusion Our results suggest that DNMT1 depletion triggers a p14ARF/p53 dependent cell cycle arrest to counteract the aneuploidy induced by changes in DNA methylation.
Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.
2014-01-01
SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185
SETD1A modulates cell cycle progression through a miRNA network that regulates p53 target genes
Tajima, Ken; Yae, Toshifumi; Javaid, Sarah; Tam, Oliver; Comaills, Valentine; Morris, Robert; Wittner, Ben S.; Liu, Mingzhu; Engstrom, Amanda; Takahashi, Fumiyuki; Black, Joshua C.; Ramaswamy, Sridhar; Shioda, Toshihiro; Hammell, Molly; Haber, Daniel A.
2015-01-01
Expression of the p53-inducible antiproliferative gene BTG2 is suppressed in many cancers in the absence of inactivating gene mutations, suggesting alternative mechanisms of silencing. Using a shRNA screen targeting 43 histone lysine methyltransferases (KMTs), we show that SETD1A suppresses BTG2 expression through its induction of several BTG2-targeting miRNAs. This indirect but highly specific mechanism, by which a chromatin regulator that mediates transcriptional activating marks can lead t...
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing
2010-05-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
Jiang, Yousheng; Husain, Mansourah; Qi, Zhitao; Bird, Steve; Wang, Tiehui
2015-08-01
Interleukin (IL)-23 is a heterodimeric IL-12 family cytokine composed of a p19 α-chain, linked to a p40 β-chain that is shared with IL-12. IL-23 is distinguished functionally from IL-12 by its ability to induce the production of IL-17, and differentiation of Th17 cells in mammals. Three isoforms of p40 (p40a, p40b and p40c) have been found in some 3R teleosts. Salmonids also possess three p40 isoforms (p40b1, p40b2 and p40c) although p40a is missing, and two copies (paralogues) of p40b are present that have presumably been retained following the 4R duplication in this fish lineage. Teleost p19 has been discovered recently in zebrafish, but to date there is limited information on expression and modulation of this molecule. In this report we have cloned two p19 paralogues (p19a and p19b) in salmonids, suggesting that a salmonid can possess six potential IL-23 isoforms. Whilst Atlantic salmon has two active p19 genes, the rainbow trout p19b gene may have been pseudogenized. The salmonid p19 translations share moderate identities (22.8-29.9%) to zebrafish and mammalian p19 molecules, but their identity was supported by structural features, a conserved 4 exon/3 intron gene organisation, and phylogenetic tree analysis. The active salmonid p19 genes are highly expressed in blood and gonad. Bacterial (Yersinia ruckeri) and viral infection in rainbow trout induces the expression of p19a, suggesting pathogen-specific induction of IL-23 isoforms. Trout p19a expression was also induced by PAMPs (poly IC and peptidoglycan) and the proinflammatory cytokine IL-1β in primary head kidney macrophages. These data may indicate diverse functional roles of trout IL-23 isoforms in regulating the immune response in fish. Copyright © 2015 Elsevier Ltd. All rights reserved.
Arsenic inhibits hedgehog signaling during P19 cell differentiation
Energy Technology Data Exchange (ETDEWEB)
Liu, Jui Tung [Environmental Toxicology Program, Clemson University, 132 Long Hall, Clemson, SC 29634 (United States); Bain, Lisa J., E-mail: lbain@clemson.edu [Environmental Toxicology Program, Clemson University, 132 Long Hall, Clemson, SC 29634 (United States); Department of Biological Sciences, Clemson University, 132 Long Hall, Clemson, SC 29634 (United States)
2014-12-15
Arsenic is a toxicant found in ground water around the world, and human exposure mainly comes from drinking water or from crops grown in areas containing arsenic in soils or water. Epidemiological studies have shown that arsenic exposure during development decreased intellectual function, reduced birth weight, and altered locomotor activity, while in vitro studies have shown that arsenite decreased muscle and neuronal cell differentiation. The sonic hedgehog (Shh) signaling pathway plays an important role during the differentiation of both neurons and skeletal muscle. The purpose of this study was to investigate whether arsenic can disrupt Shh signaling in P19 mouse embryonic stem cells, leading to changes muscle and neuronal cell differentiation. P19 embryonic stem cells were exposed to 0, 0.25, or 0.5 μM of sodium arsenite for up to 9 days during cell differentiation. We found that arsenite exposure significantly reduced transcript levels of genes in the Shh pathway in both a time and dose-dependent manner. This included the Shh ligand, which was decreased 2- to 3-fold, the Gli2 transcription factor, which was decreased 2- to 3-fold, and its downstream target gene Ascl1, which was decreased 5-fold. GLI2 protein levels and transcriptional activity were also reduced. However, arsenic did not alter GLI2 primary cilium accumulation or nuclear translocation. Moreover, additional extracellular SHH rescued the inhibitory effects of arsenic on cellular differentiation due to an increase in GLI binding activity. Taken together, we conclude that arsenic exposure affected Shh signaling, ultimately decreasing the expression of the Gli2 transcription factor. These results suggest a mechanism by which arsenic disrupts cell differentiation. - Highlights: • Arsenic exposure decreases sonic hedgehog pathway-related gene expression. • Arsenic decreases GLI2 protein levels and transcriptional activity in P19 cells. • Arsenic exposure does not alter the levels of SHH
Czech Academy of Sciences Publication Activity Database
Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš
2003-01-01
Roč. 133, č. 3 (2003), s. 1240-1250 ISSN 0032-0889 R&D Projects: GA ČR GA521/01/0037; GA ČR GP521/01/P042 Institutional research plan: CEZ:AV0Z5004920 Keywords : tobacco * gene silencing * transgenic plant Subject RIV: BO - Biophysics Impact factor: 5.634, year: 2003
RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.
Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing
2014-04-01
Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.
Energy Technology Data Exchange (ETDEWEB)
Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)
2012-09-10
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.
2008-02-01
and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic
Synthesis and Gene Silencing Properties of siRNAs Containing Terminal Amide Linkages
Directory of Open Access Journals (Sweden)
Maria Gaglione
2014-01-01
Full Text Available The active components of the RNAi are 21 nucleotides long dsRNAs containing a 2 nucleotide overhang at the 3′ end, carrying 5′-phosphate and 3′-hydroxyl groups (siRNAs. Structural analysis revealed that the siRNA is functionally bound at both ends to RISC. Terminal modifications are considered with interest as the introduction of chemical moieties interferes with the 3′ overhang recognition by the PAZ domain and the 5′-phosphate recognition by the MID and PIWI domains of RISC. Herein, we report the synthesis of modified siRNAs containing terminal amide linkages by introducing hydroxyethylglycine PNA (hegPNA moieties at 5′, and at 3′ positions and on both terminals. Results of gene silencing studies highlight that some of these modifications are compatible with the RNAi machinery and markedly increase the resistance to serum-derived nucleases even after 24 h of incubation. Molecular docking simulations were attained to give at atomistic level a clearer picture of the effect of the most performing modifications on the interactions with the human Argonaute 2 PAZ, MID, and PIWI domains. This study adds another piece to the puzzle of the heterogeneous chemical modifications that can be attained to enhance the silencing efficiency of siRNAs.
Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio
2013-01-01
.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Jaeger, de L.; Springer, J.; Wolbert, E.J.H.; Martens, D.E.; Eggink, G.; Wijffels, R.H.
2017-01-01
<p>In this study, stearoyl-ACP desaturase (SAD), the enzyme that converts stearic acid into oleic acid, is silenced by artificial microRNA in the green microalga Chlamydomonas reinhardtii. Two different constructs, which target different positions on the mRNA of stearoyl-ACP desaturase, were tested.
Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.
2011-01-01
In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347
Transcriptional Silencing of Retroviral Vectors
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M.; Pedersen, F.S.
1996-01-01
. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...
Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis
2018-01-01
The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.
Directory of Open Access Journals (Sweden)
Yixiang Han
Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.
Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S
2016-05-01
RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.
van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther
2011-01-01
Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng
2018-01-01
The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Simultaneous silencing of two arginine decarboxylase genes alters development in Arabidopsis
Directory of Open Access Journals (Sweden)
Diana eSánchez-Rangel
2016-03-01
Full Text Available Polyamines (PAs are small aliphatic polycations that are found ubiquitously in all organisms. In plants, PAs are involved in diverse biological processes such as growth, development, and stress responses. In Arabidopsis thaliana, the arginine decarboxylase enzymes (ADC1 and 2 catalyze the first step of PA biosynthesis. For a better understanding of PA biological functions, mutants in PA biosynthesis have been generated; however, the double adc1/adc2 mutant is not viable in A. thaliana. In this study, we generated non-lethal A. thaliana lines through an artificial microRNA that simultaneously silenced the two ADC genes (amiR:ADC. The generated transgenic lines (amiR:ADC-L1 and -L2 showed reduced AtADC1 and AtADC2 transcript levels. For further analyses the amiR:ADC-L2 line was selected. We found that the amiR:ADC-L2 line showed a significant decrease of their PA levels. The co-silencing revealed a stunted growth in A. thaliana seedlings, plantlets and delay in its flowering rate; these phenotypes were reverted with PA treatment. In addition, amiR:ADC-L2 plants displayed two seed phenotypes, such as yellow and brownish seeds. The yellow mutant seeds were smaller than adc1, adc2 mutants and wild type seeds; however, the brownish were the smallest seeds with arrested embryos at the torpedo stage. These data reinforce the importance of PA homeostasis in the plant development processes.
Directory of Open Access Journals (Sweden)
Rebecca A Nebel
Full Text Available Microcephaly and macrocephaly are overrepresented in individuals with autism and are thought to be disease-related risk factors or endophenotypes. Analysis of DNA microarray results from a family with a low functioning autistic child determined that the proband and two additional unaffected family members who carry a rare inherited 760 kb duplication of unknown clinical significance at 19p13.12 are macrocephalic. Consideration alongside overlapping deletion and duplication events in the literature provides support for a strong relationship between gene dosage at this locus and head size, with losses and gains associated with microcephaly (p=1.11x10(-11 and macrocephaly (p=2.47x10(-11, respectively. Data support A kinase anchor protein 8 and 8-like (AKAP8 and AKAP8L as candidate genes involved in regulation of head growth, an interesting finding given previous work implicating the AKAP gene family in autism. Towards determination of which of AKAP8 and AKAP8L may be involved in the modulation of head size and risk for disease, we analyzed exome sequencing data for 693 autism families (2591 individuals where head circumference data were available. No predicted loss of function variants were observed, precluding insights into relationship to head size, but highlighting strong evolutionary conservation. Taken together, findings support the idea that gene dosage at 19p13.12, and AKAP8 and/or AKAP8L in particular, play an important role in modulation of head size and may contribute to autism risk. Exome sequencing of the family also identified a rare inherited variant predicted to disrupt splicing of TPTE / PTEN2, a PTEN homologue, which may likewise contribute to both macrocephaly and autism risk.
Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing
Directory of Open Access Journals (Sweden)
Elisabeth H. Vollmann
2017-06-01
Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.
Directory of Open Access Journals (Sweden)
Ran Ao
2017-07-01
Full Text Available Background/Aims: This paper aims to explore the effects of pyruvate kinase (PK M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC LS-147T and SW620 cells. Methods: CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative real-time polymerase chain reaction (qRT-PCR and then assigned into the blank (no transfection, PKM2-shRNA (transfection with shRNA and empty plasmid (transfection with empty plasmid groups. Immunofluorescence was applied to detect PKM2 protein expression. qRT-PCR and Western blotting were conducted to assess mRNA and protein expression of PKM2, p53 and p21. The cell counting kit-8 (CCK-8 assay was used to assess cell proliferation. Flow cytometry was used to assess the cell cycle and apoptosis rate, and a senescence-associated β-galactosidase staining kit was used to assess cell senescence. Results: PKM2 exhibited high mRNA expression among CRC LS-147T and SW620 cells with remarkable protein expression noted in the cytoplasm and nucleus. The PKM2-shRNA group exhibited reduced PKM2 mRNA and protein expression, whereas p53 and p21 expression was increased compared with the blank and empty plasmid groups. Cell proliferation in PKM2-shRNA cells decreased significantly compared with the blank group and empty plasmid groups. The PKM2-shRNA group exhibited more cells in the G1 phase and fewer cells in the G2/M phase compared with the blank and empty plasmid groups. In addition, the PKM2-shRNA group exhibited significantly increased apoptosis rates and β-galactosidase activity compared with the blank and empty plasmid groups. Conclusion: Our study demonstrates that PKM2 gene silencing suppresses proliferation and promotes apoptosis in LS-147T and SW620 cells.
International Nuclear Information System (INIS)
Wang, Kai-Hung; Lin, Cuei-Jyuan; Liu, Chou-Jen; Liu, Dai-Wei; Huang, Rui-Lan; Ding, Dah-Ching; Weng, Ching-Feng; Chu, Tang-Yuan
2015-01-01
Epigenetic remodeling of cell adhesion genes is a common phenomenon in cancer invasion. This study aims to investigate global methylation of cell adhesion genes in cervical carcinogenesis and to apply them in early detection of cancer from cervical scraping. Genome-wide methylation array was performed on an investigation cohort, including 16 cervical intraepithelial neoplasia 3 (CIN3) and 20 cervical cancers (CA) versus 12 each of normal, inflammation and CIN1 as controls. Twelve members of clustered proto-cadherin (PCDH) genes were collectively methylated and silenced, which were validated in cancer cells of the cervix, endometrium, liver, head and neck, breast, and lung. In an independent cohort including 107 controls, 66 CIN1, 85 CIN2/3, and 38 CA, methylated PCDHA4 and PCDHA13 were detected in 2.8%, 24.2%, 52.9%, and 84.2% (P < 10 −25 ), and 2.8%, 24.2%, 50.6%, and 94.7% (P < 10 −29 ), respectively. In diagnosis of CIN2 or more severe lesion of the cervix, a combination test of methylated PCDHA4 or PCDHA13 from cervical scraping had a sensitivity, specificity, positive predictive value, and negative predictive value of 74.8%, 80.3%, 73%, and 81.8%, respectively. Testing of this combination from cervical scraping is equally sensitive but more specific than human papillomavirus (HPV) test in diagnosis of CIN2 or more severe lesions. The study disclosed a collective methylation of PCDH genes in cancer of cervix and other sites. At least two of them can be promising diagnostic markers for cervical cancer noninferior to HPV
Mutations in ash1 and trx enhance P-element-dependent silencing in Drosophila melanogaster.
McCracken, Allen; Locke, John
2016-08-01
In Drosophila melanogaster, the mini-w(+) transgene in Pci is normally expressed throughout the adult eye; however, when other P or KP elements are present, a variegated-eye phenotype results, indicating random w(+) silencing during development called P-element-dependent silencing (PDS). Mutant Su(var)205 and Su(var)3-7 alleles act as haplo-suppressors/triplo-enhancers of this variegated phenotype, indicating that these heterochromatic modifiers act dose dependently in PDS. Previously, we recovered a spontaneous mutation of P{lacW}ci(Dplac) called P{lacW}ci(DplacE1) (E1) that variegated in the absence of P elements, presumably due to the insertion of an adjacent gypsy element. From a screen for genetic modifiers of E1 variegation, we describe here the isolation of five mutations in ash1 and three in trx that enhance the E1 variegated phenotype in a dose-dependent and cumulative manner. These mutant alleles enhance PDS at E1, and in E1/P{lacW}ci(Dplac), but suppress position effect variegation (PEV) at In(1)w(m)(4). This opposite action is consistent with a model where ASH1 and TRX mark transcriptionally active chromatin domains. If ASH1 or TRX function is lost or reduced, heterochromatin can spread into these domains creating a sink that diverts heterochromatic proteins from other variegating locations, which then may express a suppressed phenotype.
Directory of Open Access Journals (Sweden)
Barik Sailen
2001-12-01
Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.
Callard, G V; Tchoudakova, A V; Kishida, M; Wood, E
2001-12-01
Teleost fish are characterized by exceptionally high levels of brain estrogen biosynthesis when compared to the brains of other vertebrates or to the ovaries of the same fish. Goldfish (Carassius auratus) and zebrafish (Danio rerio) have utility as complementary models for understanding the molecular basis and functional significance of exaggerated neural estrogen biosynthesis. Multiple cytochrome P450 aromatase (P450arom) cDNAs that derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (P450aromB>A) and ovary (P450aromA>B) and have a different developmental program (B>A) and response to estrogen upregulation (B only). As measured by increased P450aromB mRNA, a functional estrogen response system is first detected 24-48 h post-fertilization (hpf), consistent with the onset of estrogen receptor (ER) expression (alpha, beta, and gamma). The 5'-flanking region of the cyp19b gene has a TATA box, two estrogen response elements (EREs), an ERE half-site (ERE1/2), a nerve growth factor inducible-B protein (NGFI-B)/Nur77 responsive element (NBRE) binding site, and a sequence identical to the zebrafish GATA-2 gene neural specific enhancer. The cyp19a promoter region has TATA and CAAT boxes, a steroidogenic factor-1 (SF-1) binding site, and two aryl hydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) binding motifs. Both genes have multiple potential SRY/SOX binding sites (16 and 8 in cyp19b and cyp19a, respectively). Luciferase reporters have basal promoter activity in GH3 cells, but differences (a>b) are opposite to fish pituitary (b>a). When microinjected into fertilized zebrafish eggs, a cyp19b promoter-driven green fluorescent protein (GFP) reporter (but not cyp19a) is expressed in neurons of 30-48 hpf embryos, most prominently in retinal ganglion cells (RGCs) and their projections to optic tectum. Further studies are required to identify functionally relevant cis-elements and cellular factors, and to determine the
Directory of Open Access Journals (Sweden)
Satoshi Iizuka
Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.
Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo
2015-03-01
The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.
Directory of Open Access Journals (Sweden)
Bushuai Zhong
Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.
Directory of Open Access Journals (Sweden)
Jialin Song
2016-08-01
Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.
Auranen, M; Nieminen, T; Majuri, S; Vanhala, R; Peltonen, L; Järvelä, I
2000-05-01
The role of genetic factors in the etiology of the autistic spectrum of disorders has clearly been demonstrated. Ten chromosomal regions, on chromosomes 1p, 4p, 6q, 7q, 13q, 15q, 16p, 17q, 19q and 22q have potentially been linked to autism.1-8 We have analyzed these chromosomal regions in a total of 17 multiplex families with autism originating from the isolated Finnish population by pairwise linkage analysis and sib-pair analysis. Mild evidence for putative contribution was found only with the 1p chromosomal region in the susceptibility to autism. Our data suggest that additional gene loci exist for autism which will be detectable in and even restricted to the isolated Finnish population.
LncRNA H19 and Target Gene-mediated Cleft Palate Induced by TCDD.
Gao, Li Yun; Zhang, Feng Quan; Zhao, Wei Hui; Han, Guang Liang; Wang, Xiao; Li, Qiang; Gao, Shan Shan; Wu, Wei Dong
2017-09-01
This study investigated the role of long non-coding RNAs (lncRNAs) in the development of the palatal tissues. Cleft palates in mice were induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Expression levels of long non-coding RNA H19 (lncRNA H19) and insulin-like growth factor 2 (IGF2) gene were measured by quantitative real-time polymerase chain reaction (qRT-PCR). The rate of occurrence of cleft palate was found to be 100% by TCDD exposure, and TCDD could cause short upper limb, cerebral fissure, webbed neck, and short neck. The expression levels of lncRNA H19 and IGF2 gene specifically showed embryo age-related differences on E13, E14, and E15 in the palatal tissues. The expression levels of lncRNA H19 and IGF2 gene showed an inverse relationship on E13, E14, and E15. These findings demonstrated that lncRNA H19 and IGF2 can mediate the development of mouse cleft palate. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Directory of Open Access Journals (Sweden)
Rosa Lozano-Durán
2013-03-01
Full Text Available The development of high-throughput technologies allows for evaluating gene expression at the whole-genome level. Together with proteomic and metabolomic studies, these analyses have resulted in the identification of plant genes whose function or expression is altered as a consequence of pathogen attacks. Members of the Tomato yellow leaf curl virus (TYLCV complex are among the most important pathogens impairing production of agricultural crops worldwide. To understand how these geminiviruses subjugate plant defenses, and to devise counter-measures, it is essential to identify the host genes affected by infection and to determine their role in susceptible and resistant plants. We have used a reverse genetics approach based on Tobacco rattle virus-induced gene silencing (TRV-VIGS to uncover genes involved in viral infection of susceptible plants, and to identify genes underlying virus resistance. To identify host genes with a role in geminivirus infection, we have engineered a Nicotiana benthamiana line, coined 2IRGFP, which over-expresses GFP upon virus infection. With this system, we have achieved an accurate description of the dynamics of virus replication in space and time. Upon silencing selected N. benthamiana genes previously shown to be related to host response to geminivirus infection, we have identified eighteen genes involved in a wide array of cellular processes. Plant genes involved in geminivirus resistance were studied by comparing two tomato lines: one resistant (R, the other susceptible (S to the virus. Sixty-nine genes preferentially expressed in R tomatoes were identified by screening cDNA libraries from infected and uninfected R and S genotypes. Out of the 25 genes studied so far, the silencing of five led to the total collapse of resistance, suggesting their involvement in the resistance gene network. This review of our results indicates that TRV-VIGS is an exquisite reverse genetics tool that may provide new insights into the
Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai
2012-10-05
The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.
Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E
2013-11-01
Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.
Early function of the Abutilon mosaic virus AC2 gene as a replication brake.
Krenz, Björn; Deuschle, Kathrin; Deigner, Tobias; Unseld, Sigrid; Kepp, Gabi; Wege, Christina; Kleinow, Tatjana; Jeske, Holger
2015-04-01
The C2/AC2 genes of monopartite/bipartite geminiviruses of the genera Begomovirus and Curtovirus encode important pathogenicity factors with multiple functions described so far. A novel function of Abutilon mosaic virus (AbMV) AC2 as a replication brake is described, utilizing transgenic plants with dimeric inserts of DNA B or with a reporter construct to express green fluorescent protein (GFP). Their replicational release upon AbMV superinfection or the individual and combined expression of epitope-tagged AbMV AC1, AC2, and AC3 was studied. In addition, the effects were compared in the presence and in the absence of an unrelated tombusvirus suppressor of silencing (P19). The results show that AC2 suppresses replication reproducibly in all assays and that AC3 counteracts this effect. Examination of the topoisomer distribution of supercoiled DNA, which indicates changes in the viral minichromosome structure, did not support any influence of AC2 on transcriptional gene silencing and DNA methylation. The geminiviral AC2 protein has been detected here for the first time in plants. The experiments revealed an extremely low level of AC2, which was slightly increased if constructs with an intron and a hemagglutinin (HA) tag in addition to P19 expression were used. AbMV AC2 properties are discussed with reference to those of other geminiviruses with respect to charge, modification, and size in order to delimit possible reasons for the different behaviors. The (A)C2 genes encode a key pathogenicity factor of begomoviruses and curtoviruses in the plant virus family Geminiviridae. This factor has been implicated in the resistance breaking observed in agricultural cotton production. AC2 is a multifunctional protein involved in transcriptional control, gene silencing, and regulation of basal biosynthesis. Here, a new function of Abutilon mosaic virus AC2 in replication control is added as a feature of this protein in viral multiplication, providing a novel finding on
The Mechanism of the Silencing of a Transgene, NCED3‐LUC, in Arabidopsis Thaliana
Zhao, Junsong
2011-06-20
The Arabidopsis thaliana NCED3‐LUC transgenic line was constructed by several groups to study the regulatory network of the NCED3 gene, the protein of which catalyzes the rate‐limiting step of ABA biosynthesis under drought. The transgenic luciferase gene is expressed when the plants encounter drought stress. Intriguingly, this transgenic luciferase gene is silenced after propagation for several generations. To determine the mechanism of this gene silencing, we used a forward genetics approach. The seeds of NCED3‐LUC (referred as the ‘wild type’) were mutagenized by ethane methyl sulfonate (EMS). One mutant line, denoted as #73, with recovered luciferase activity was selected for further study. Analysis of the methylation status by bisulfite sequencing revealed that the transgenic NCED3 promoter in the #73 mutant had less methylation than the wild type. Demethylation was also evident for the endogenous NCED3 promoter and retrotransposon AtSN1 in the #73 mutant. The phenotype of #73 mutant includes small size, rapid dehydration rate, altered morphology, and a thin epicuticular wax layer. By use of map‐based cloning, the region containing the mutated gene was delimited to a contig of two BAC clones, F11F19 and F9C22, on chromosome 2. Our results indicate that NCED3‐LUC gene silencing results from hypermethylation of its promoter region, but additional study is required to determine the exact position of the mutated gene and to fully understand the mechanism of NCED3‐LUC silencing. 4 ACKNOWLEDGEMENTS I would like to take this opportunity to thank my committee chair, Professor Jian‐Kang Zhu, who is also the supervisor of my master’s thesis, for his guidance throughout the course of this research. I also would like to thank my committee members, Professor Liming Xiong and Professor Samir Hamdan, for their patience and support in reviewing my thesis. My appreciation also goes to Dr. Zhenyu Wang for taking time to teach me basic experimental skills and
Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito
2018-07-01
Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.
Esteller, M; Risques, R A; Toyota, M; Capella, G; Moreno, V; Peinado, M A; Baylin, S B; Herman, J G
2001-06-15
Defects in DNA repair may be responsible for the genesis of mutations in key genes in cancer cells. The tumor suppressor gene p53 is commonly mutated in human cancer by missense point mutations, most of them G:C to A:T transitions. A recognized cause for this type of change is spontaneous deamination of the methylcytosine. However, the persistence of a premutagenic O(6)-methylguanine can also be invoked. This last lesion is removed in the normal cell by the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT). In many tumor types, epigenetic silencing of MGMT by promoter hypermethylation has been demonstrated and linked to the appearance of G to A mutations in the K-ras oncogene in colorectal tumors. To study the relevance of defective MGMT function by aberrant methylation in relation to the presence of p53 mutations, we studied 314 colorectal tumors for MGMT promoter hypermethylation and p53 mutational spectrum. Inactivation of MGMT by aberrant methylation was associated with the appearance of G:C to A:T transition mutations at p53 (Fischer's exact test, two-tailed; P = 0.01). Overall, MGMT methylated tumors displayed p53 transition mutations in 43 of 126 (34%) cases, whereas MGMT unmethylated tumors only showed G:C to A:T changes in 37 of 188 (19%) tumors. A more striking association was found in G:C to A:T transitions in non-CpG dinucleotides; 71% (12 of 17) of the total non-CpG transition mutations in p53 were observed in MGMT aberrantly methylated tumors (Fischer's exact test, two-tailed; P = 0.008). Our data suggest that epigenetic silencing of MGMT by promoter hypermethylation may lead to G:C to A:T transition mutations in p53.
Lecke, Sheila B; Morsch, Débora M; Spritzer, Poli M
2011-11-01
In polycystic ovary syndrome (PCOS), hypertension has been linked to androgen excess and insulin resistance. Aromatase, an enzyme encoded by the CYP19 gene, affects androgen metabolism and estrogen synthesis, influencing the androgen to estrogen balance. We characterized CYP19 gene expression in subcutaneous adipose tissue of women with PCOS and normal controls and evaluated the association between subcutaneous fat CYP19 mRNA, circulating hormone levels, and blood pressure. This case-control study was carried out with 31 PCOS patients and 27 BMI-matched normotensive non-hirsute women with regular cycles. Participants underwent anthropometric measurements, collection of blood samples, and adipose tissue biopsy (28 PCOS and 19 controls). Hypertension was defined as systolic blood pressure ≥ 130 mmHg and/or diastolic blood pressure ≥ 85 mmHg. PCOS patients were divided into normotensive and hypertensive. Main outcome measures were serum estrogen and androgen levels, estrogen-to-androgen ratio, and CYP19 gene expression in subcutaneous fat. Subcutaneous CYP19 mRNA was higher in hypertensive PCOS than in control and normotensive PCOS women (p = 0.014). Estrogen-to-androgen ratio was lower in hypertensive PCOS than controls (p androgen ratio ≤ 0.06 (median for the three groups) was observed in 91% of hypertensive PCOS women, vs. 37% and 61% in the control and normotensive PCOS groups (p = 0.011). CYP19 gene expression in subcutaneous fat of PCOS patient correlated positively with systolic (p = 0.006) and diastolic blood pressure (p = 0.009). Androgen excess and hyperinsulinemia may play a role in the molecular mechanisms that activate aromatase mRNA transcription in abdominal fat tissue. Copyright © 2011 Elsevier Inc. All rights reserved.
Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells
Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X
2009-01-01
Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...
Surface functionalisation of PLGA nanoparticles for gene silencing
DEFF Research Database (Denmark)
Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob
2010-01-01
. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....
International Nuclear Information System (INIS)
Zhuo, Lili; Gong, Jie; Yang, Rong; Sheng, Yanhui; Zhou, Lei; Kong, Xiangqing; Cao, Kejiang
2009-01-01
Cyclin L2 (CCNL2) is a novel member of the cyclin gene family. In a previous study, we demonstrated that CCNL2 expression was upregulated in ventricular septum tissues from patients with ventricular septal defect compared to healthy controls. In the present study, we established a stable CCNL2-overexpressing P19 cell line that can differentiate to myocardial cells when treated with 1% dimethyl sulfoxide (DMSO). Our data showed that stable CCNL2-overexpressing P19 cells were less differentiated after treatment with 1% DMSO and that expression of myocardial cell differentiation-related genes (such as cardiac actin, GATA4, Mef2C, Nkx2.5, and BNP) were reduced compared to vector-only transfected P19. Moreover, P19 cells overexpressing the CCNL2 gene had a reduced growth rate and a remarkably decreased S phase. We also found that these cells underwent apoptosis, as detected by two different apoptosis assays. The anti-apoptotic Bcl-2 protein was also downregulated in these cells. In addition, real-time PCR analysis revealed that expression of Wnt and β-catenin was suppressed and GSK3β was induced in the CCNL2-overexpressing P19 cells. These data suggest that overexpression of CCNL2 inhibited proliferation and differentiation of mouse embryonic carcinoma P19 cells and induced them to undergo apoptosis, possibly through the Wnt signal transduction pathway.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...
DEFF Research Database (Denmark)
Gomes, Maria João; Kennedy, Patrick J; Martins, Susana
2017-01-01
AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...
RNA silencing is required for Arabidopsis defence against Verticillium wilt disease
Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.
2009-01-01
RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,
Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T
2014-12-01
Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.
Singh, N K; Eliash, N; Stein, I; Kamer, Y; Ilia, Z; Rafaeli, A; Soroker, V
2016-04-01
The ectoparasitic mite Varroa destructor is one of the major threats to apiculture. Using a behavioural choice bioassay, we determined that phoretic mites were more successful in reaching a bee than reproductive mites, suggesting an energy trade-off between reproduction and host selection. We used both chemo-ecological and molecular strategies to identify the regulation of the olfactory machinery of Varroa and its association with reproduction. We focused on transcription regulation. Using primers designed to the conserved DNA binding region of transcription factors, we identified a gene transcript in V. destructor homologous to the pheromone receptor transcription factor (PRTF) gene of Pediculus humanus corporis. Quantitative PCR (qPCR) revealed that this PRTF-like gene transcript is expressed in the forelegs at higher levels than in the body devoid of forelegs. Subsequent comparative qPCR analysis showed that transcript expression was significantly higher in the phoretic as compared to the reproductive stage. Electrophysiological and behavioural studies revealed a reduction in the sensitivity of PRTF RNA interference-silenced mites to bee headspace, consistent with a reduction in the mites' ability to reach a host. In addition, vitellogenin expression was stimulated in PRTF-silenced mites to similar levels as found in reproductive mites. These data shed light upon the regulatory mechanism of host chemosensing in V. destructor. © 2016 The Royal Entomological Society.
International Nuclear Information System (INIS)
Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang
2006-01-01
HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties
Directory of Open Access Journals (Sweden)
Huijuan Zhang
2016-08-01
Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.
DEFF Research Database (Denmark)
Søndergaard, Katia Dupret
The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...
DEFF Research Database (Denmark)
Bjerling, Pernilla; Ekwall, Karl; Egel, Richard
2004-01-01
The mating-type region of the fission yeast Schizosaccharomyces pombe comprises three loci: mat1, mat2-P and mat3-M. mat1 is expressed and determines the mating type of the cell. mat2-P and mat3-M are two storage cassettes located in a 17 kb heterochromatic region with features identical to those...... of mammalian heterochromatin. Mutations in the swi6+, clr1+, clr2+, clr3+, clr4+ and clr6+ genes were obtained in screens for factors necessary for silencing the mat2-P-mat3-M region. swi6+ encodes a chromodomain protein, clr3+ and clr6+ histone deacetylases, and clr4+ a histone methyltransferase. Here, we...
PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.
Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong
2017-02-01
Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
ZFPIP/Zfp462 is involved in P19 cell pluripotency and in their neuronal fate
International Nuclear Information System (INIS)
Masse, Julie; Piquet-Pellorce, Claire; Viet, Justine; Guerrier, Daniel; Pellerin, Isabelle; Deschamps, Stephane
2011-01-01
The nuclear zinc finger protein ZFPIP/Zfp462 is an important factor involved in cell division during the early embryonic development of vertebrates. In pluripotent P19 cells, ZFPIP/Zfp462 takes part in cell proliferation, likely via its role in maintaining chromatin structure. To further define the function of ZFPIP/Zfp462 in the mechanisms of pluripotency and cell differentiation, we constructed a stable P19 cell line in which ZFPIP/Zfp462 knockdown is inducible. We report that ZFPIP/Zfp462 was vital for mitosis and self-renewal in pluripotent P19 cells. Its depletion induced substantial decreases in the expression of the pluripotency genes Nanog, Oct4 and Sox2 and was associated with the transient expression of specific neuronal differentiation markers. We also demonstrated that ZFPIP/Zfp462 expression appears to be unnecessary after neuronal differentiation is induced in P19 cells. Taken together, our results strongly suggest that ZFPIP/Zfp462 is a key chromatin factor involved in maintaining P19 pluripotency and in the early mechanisms of neural differentiation but that it is dispensable in differentiated P19 cells.
Decreasing erucic acid level by RNAi-mediated silencing of fatty ...
African Journals Online (AJOL)
To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...
Identification of the interleukin 4 receptor alpha gene as a direct target for p73.
Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi
2003-12-01
p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.
Ma, J; Su, H; Yu, B; Guo, T; Gong, Z; Qi, J; Zhao, X; Du, J
2018-01-05
To investigate the effect of CXCL12 gene silencing on proliferation,invasion, angiogenesis and the relationship of MAPK/PI3K/AP-1 signaling pathway in colon cancer cells. RT-PCR and Western-blot were used to detect the expression of CXCL12 mRNA and protein in four colon cancer cell lines. Human colon cancer cells were transfected with CXCL12 siRNA carrying by Lipofectamine 2000. The expression of CXCL12 protein was confirmed by immunoblotting. WST-1, invasion and angiogenesis assay were used to examine the effect on proliferation, invasion and angiogenesis in colon cancer cells after CXCL12 siRNA silence, respectively. The phosphorylation of MAPK/PI3K/AP-1 protein levels was detected by Western blotting in CXCL12 siRNA suppression DLD-1 cell. CXCL12 mRNA and proteins were only expressed in DLD-1 colon cancer cell lines. CXCL12 siRNA were transfected into DLD-1 cells, the expression CXCL12 proteins was significantly inhibited (P colon cancer cell. The silencing CXCL12 gene significantly inhibits the proliferation, invasion and angiogenesis ability of some types colon carcinoma cells through down-regulation of MAPK/PI3K/AP-1 signaling pathway.
International Nuclear Information System (INIS)
Meng, Qingzhen; Jia, Zhuqing; Wang, Weiping; Li, Binhong; Ma, Kangtao; Zhou, Chunyan
2011-01-01
Highlights: → Id1 was upregulated during the cardiac differentiation process of P19CL6 cells. → Id1 upregulated expression of cardiac specific genes Gata4, α-MHC and ISL1. → Id1 promoted proliferation of P19CL6 cells. → Overexpression of Id1 increased activity of TOP flash. → Wnt3a or LiCl treatment promoted Id1 expression in P19CL6 cells. -- Abstract: The inhibitor of DNA binding (Id) family of genes encodes negative regulators of basic helix-loop-helix transcription factors and has been implicated in such diverse cellular processes as differentiation, proliferation, apoptosis and migration. Id knockout mouse embryos display multiple cardiac defects but the specific role of Id1 in cardiac differentiation is unclear. In the present study, we investigated the function of Id1 in DMSO-induced P19CL6 cells, a widely-accepted cell model of cardiac differentiation. We found that Id1 was upregulated during the cardiac differentiation of P19CL6 cells. The expression of cardiac specific marker genes, Gata4, α-MHC and ISL1, was upregulated in P19CL6 cells stably transfected with Id1 (P19CL6-Id1) during cardiac differentiation. The overexpression of Id1 reduced the number of cells in G1 phase and increased the cell population in G2, M and S phases, while knockdown of Id1 increased the number of cells in G1 phase from 48.6 ± 2.51% to 62.2 ± 1.52% at day 0 of cardiac induction, and from 52.5 ± 3.41% to 63.7 ± 1.02% at day 3 after cardiac induction, indicating that Id1 promoted proliferation of P19CL6 cells. Luciferase assays showed that the activity of TOP flash was higher in P19CL6-Id1 cells than wildtype P19CL6 cells, while Id1 expression was also upregulated in P19CL6 cells treated with Wnt3a or LiCl. This indicates that there may be positive feedback between Id1 and Wnt signaling which plays an important role in cardiac differentiation.
Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie
2016-04-15
Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Tospovirus : induction and suppression of RNA silencing
Hedil, Marcio
2016-01-01
<p>While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,
Maekawa, Toshio; Kim, Seungjoon; Nakai, Daisuke; Makino, Chieko; Takagi, Tsuyoshi; Ogura, Hiroo; Yamada, Kazuyuki; Chatton, Bruno; Ishii, Shunsuke
2010-01-01
Many symptoms induced by isolation rearing of rodents may be relevant to neuropsychiatric disorders, including depression. However, identities of transcription factors that regulate gene expression in response to chronic social isolation stress remain elusive. The transcription factor ATF-7 is structurally related to ATF-2, which is activated by various stresses, including inflammatory cytokines. Here, we report that Atf-7-deficient mice exhibit abnormal behaviours and increased 5-HT receptor 5B (Htr5b) mRNA levels in the dorsal raphe nuclei. ATF-7 silences the transcription of Htr5B by directly binding to its 5′-regulatory region, and mediates histone H3-K9 trimethylation via interaction with the ESET histone methyltransferase. Isolation-reared wild-type (WT) mice exhibit abnormal behaviours that resemble those of Atf-7-deficient mice. Upon social isolation stress, ATF-7 in the dorsal raphe nucleus is phosphorylated via p38 and is released from the Htr5b promoter, leading to the upregulation of Htr5b. Thus, ATF-7 may have a critical role in gene expression induced by social isolation stress. PMID:19893493
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Directory of Open Access Journals (Sweden)
Nabil Killiny
Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Energy Technology Data Exchange (ETDEWEB)
Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)
2012-10-05
Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.
DEFF Research Database (Denmark)
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria
2016-01-01
/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...
A novel large deletion of the ICR1 region including H19 and putative enhancer elements.
Fryssira, Helen; Amenta, Stella; Kanber, Deniz; Sofocleous, Christalena; Lykopoulou, Evangelia; Kanaka-Gantenbein, Christina; Cerrato, Flavia; Lüdecke, Hermann-Josef; Bens, Susanne; Riccio, Andrea; Buiting, Karin
2015-05-06
Beckwith-Wiedemann syndrome (BWS) is a rare pediatric overgrowth disorder with a variable clinical phenotype caused by deregulation affecting imprinted genes in the chromosomal region 11p15. Alterations of the imprinting control region 1 (ICR1) at the IGF2/H19 locus resulting in biallelic expression of IGF2 and biallelic silencing of H19 account for approximately 10% of patients with BWS. The majority of these patients have epimutations of the ICR1 without detectable DNA sequence changes. Only a few patients were found to have deletions. Most of these deletions are small affecting different parts of the ICR1 differentially methylated region (ICR1-DMR) removing target sequences for CTCF. Only a very few deletions reported so far include the H19 gene in addition to the CTCF binding sites. None of these deletions include IGF2. A male patient was born with hypotonia, facial dysmorphisms and hypoglycemia suggestive of Beckwith-Wiedemann syndrome. Using methylation-specific (MS)-MLPA (Multiplex ligation-dependent probe amplification) we have identified a maternally inherited large deletion of the ICR1 region in a patient and his mother. The deletion results in a variable clinical expression with a classical BWS in the mother and a more severe presentation of BWS in her son. By genome-wide SNP array analysis the deletion was found to span ~100 kb genomic DNA including the ICR1DMR, H19, two adjacent non-imprinted genes and two of three predicted enhancer elements downstream to H19. Methylation analysis by deep bisulfite next generation sequencing revealed hypermethylation of the maternal allele at the IGF2 locus in both, mother and child, although IGF2 is not affected by the deletion. We here report on a novel large familial deletion of the ICR1 region in a BWS family. Due to the deletion of the ICR1-DMR CTCF binding cannot take place and the residual enhancer elements have access to the IGF2 promoters. The aberrant methylation (hypermethylation) of the maternal IGF2
Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki
2017-06-01
Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.
Wang, Tianming; Yang, Hongsheng; Zhao, Huan; Chen, Muyan; Wang, Bing
2011-11-01
The sea cucumber, Apostichopus japonicus, undergoes aestivation to improve survival during periods of high-temperature. During aestivation, the metabolic rate is depressed to reduce the consumption of reserved energy. We evaluated the role of epigenetic modification on global gene silencing during metabolic rate depression in the sea cucumber. We compared the expression of epigenetic modifiers in active and aestivating sea cucumbers. The expression of three genes involved in DNA methylation and chromatin remodeling (DNA (cytosine-5)-methyltransferase 1, Methyl-CpG-binding domain protein 2), and Chromodomain-helicase-DNA-binding protein 5) was significantly higher during aestivation (Days 20 and 40). Similarly, we observed an increase in the expression of genes involved in histone acetylation (Histone deacetylase 3) and Histone-binding protein RBBP4) during the early (Days 5 and 10) and late phases (Days 20 and 40) of aestivation. There was no change in the expression of KAT2B, a histone acetyltransferase. However, the expression of histone methylation associated modifiers (Histone-arginine methyltransferase CARMER and Histone-lysine N-methyltransferase MLL5) was significantly higher after 5 d in the aestivating group. The results suggest that the expression of epigenetic modifiers involved in DNA methylation, chromatin remodeling, histone acetylation, and histone methylation is upregulated during aestivation. We hypothesize that these changes regulate global gene silencing during aestivation in A. japonicus.
Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu
2005-07-20
Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.
Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui
2018-06-13
Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.
Directory of Open Access Journals (Sweden)
Elisa Giorgetti
2016-09-01
Full Text Available Spinal and bulbar muscular atrophy (SBMA, a progressive degenerative disorder, is caused by a CAG/glutamine expansion in the androgen receptor (polyQ AR. Recent studies demonstrate that skeletal muscle is an important site of toxicity that contributes to the SBMA phenotype. Here, we sought to identify critical pathways altered in muscle that underlie disease manifestations in AR113Q mice. This led to the unanticipated identification of gene expression changes affecting regulators of carbohydrate metabolism, similar to those triggered by denervation. AR113Q muscle exhibits diminished glycolysis, altered mitochondria, and an impaired response to exercise. Strikingly, the expression of genes regulating muscle energy metabolism is rescued following peripheral polyQ AR gene silencing by antisense oligonucleotides (ASO, a therapeutic strategy that alleviates disease. Our data establish the occurrence of a metabolic imbalance in SBMA muscle triggered by peripheral expression of the polyQ AR and indicate that alterations in energy utilization contribute to non-neuronal disease manifestations.
Anti-viral RNA silencing: do we look like plants ?
Directory of Open Access Journals (Sweden)
Lecellier Charles-Henri
2006-01-01
Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
International Nuclear Information System (INIS)
Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo
2013-01-01
Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer
Pompey, Justine M; Foda, Bardees; Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
Directory of Open Access Journals (Sweden)
Justine M Pompey
Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
Yuan, Bifeng; Zhang, Jing; Wang, Hongxia; Xiong, Lei; Cai, Qian; Wang, Tina; Jacobsen, Steven; Pradhan, Sriharsa; Wang, Yinsheng
2011-01-01
Thiopurines including 6-thioguanine (SG), 6-mercaptopurine and azathioprine are effective anticancer agents with remarkable success in clinical practice, especially in effective treatment of acute lymphoblastic leukemia (ALL). SG is understood to act as a DNA hypomethylating agent in ALL cells, however, the underlying mechanism leading to global cytosine demethylation remains unclear. Here we report that SG treatment results in reactivation of epigenetically silenced genes in T leukemia cells...
Directory of Open Access Journals (Sweden)
Kai Yan
2017-06-01
Full Text Available Background/Amis: Long non-coding RNAs (lncRNAs, a novel class of transcripts, have been shown to play critical roles in diverse cellular biological processes, including tumorigenesis. Small nucleolar RNA host gene 6 (SNHG6 regulates various biological processes in cancer cells. However, the biological role of SNHG6 in gastric cancer still remains to be explored. The aim of this study is to investigate the characteristic of the SNHG6 in gastric cancer. Methods: Quantitative real-time polymerase chain reaction (qRT-PCR was used to measure the expression of SNHG6 in gastric cancer tissues and cell lines. MTT assays, colony formation assays were used to determine the impact of SNHG6 on tumorigenesis . Flow cytometric analysis of cell cycle and apoptosis was performed to measure the effect of SNHG6 on cell cycle and apoptosis rate. Transwell assay was performed to measure the effect of SNHG6 on cell migration. Western blotting and immunofuorescence were utilized to examine the effect of SNHG6 on epithelial-mesenchymal transition (EMT of GC cells. Chromatin immunoprecipitation (ChIP, RNA immunoprecipitation (RIP, RNA-pulldown and luciferase reporter assays were employed to dissect molecular mechanisms. Results: In this study, we revealed that SNHG6 was overexpressed in gastric cancer tissues and cell lines. High expression levels of SNHG6 wereassociated with invasion depth, lymph node metastasis, distant metastasis and tumor/node/metastasis (TNM stage, and predicted poor prognosis. Loss-of-function assays revealed that silenced SNHG6 obviously inhibited gastric cancer cell growth, weakened cell migration capacity and suppressed the EMT processes of gastric cancer cells. Additionally, ChIP, RIP, RNA-pulldown and luciferase reporter assays evidenced that SNHG6 could epigenetically silenced p27 and could competitively sponging miR-101-3p thereby regulating zinc finger E-box-binding homeobox 1 (ZEB1. Conclusion: In summary, our findings demonstrated that
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
Directory of Open Access Journals (Sweden)
Carlos R. Morales
2014-01-01
Full Text Available Heterozygous mutations in the UBIAD1 gene cause Schnyder corneal dystrophy characterized by abnormal cholesterol and phospholipid deposits in the cornea. Ubiad1 protein was recently identified as Golgi prenyltransferase responsible for biosynthesis of vitamin K2 and CoQ10, a key protein in the mitochondrial electron transport chain. Our study shows that silencing UBIAD1 in cultured human hepatocellular carcinoma cells causes dramatic morphological changes and cholesterol storage in the mitochondria, emphasizing an important role of UBIAD1 in mitochondrial function.
Ceruti, Julieta M; Scassa, María E; Marazita, Mariela C; Carcagno, Abel C; Sirkin, Pablo F; Cánepa, Eduardo T
2009-06-01
p19INK4d promotes survival of several cell lines after UV irradiation due to enhanced DNA repair, independently of CDK4 inhibition. To further understand the action of p19INK4d in the cellular response to DNA damage, we aimed to elucidate whether this novel regulator plays a role only in mechanisms triggered by UV or participates in diverse mechanisms initiated by different genotoxics. We found that p19INK4d is induced in cells injured with cisplatin or beta-amyloid peptide as robustly as with UV. The mentioned genotoxics transcriptionally activate p19INK4d expression as demonstrated by run-on assay without influencing its mRNA stability and with partial requirement of protein synthesis. It is not currently known whether DNA damage-inducible genes are turned on by the DNA damage itself or by the consequences of that damage. Experiments carried out in cells transfected with distinct damaged DNA structures revealed that the damage itself is not responsible for the observed up-regulation. It is also not known whether the increased expression of DNA-damage-inducible genes is related to immediate protective responses such as DNA repair or to more delayed responses such as cell cycle arrest or apoptosis. We found that ectopic expression of p19INK4d improves DNA repair ability and protects neuroblastoma cells from apoptosis caused by cisplatin or beta-amyloid peptide. Using clonal cell lines where p19INK4d levels can be modified at will, we show that p19INK4d expression correlates with increased survival and clonogenicity. The results presented here, prompted us to suggest that p19INK4d displays an important role in an early stage of cellular DNA damage response.
Expression of P. falciparum var Genes Involves Exchange of the Histone Variant H2A.Z at the Promoter
Petter, Michaela; Lee, Chin Chin; Byrne, Timothy J.; Boysen, Katja E.; Volz, Jennifer; Ralph, Stuart A.; Cowman, Alan F.; Brown, Graham V.; Duffy, Michael F.
2011-01-01
Plasmodium falciparum employs antigenic variation to evade the human immune response by switching the expression of different variant surface antigens encoded by the var gene family. Epigenetic mechanisms including histone modifications and sub-nuclear compartmentalization contribute to transcriptional regulation in the malaria parasite, in particular to control antigenic variation. Another mechanism of epigenetic control is the exchange of canonical histones with alternative variants to generate functionally specialized chromatin domains. Here we demonstrate that the alternative histone PfH2A.Z is associated with the epigenetic regulation of var genes. In many eukaryotic organisms the histone variant H2A.Z mediates an open chromatin structure at promoters and facilitates diverse levels of regulation, including transcriptional activation. Throughout the asexual, intraerythrocytic lifecycle of P. falciparum we found that the P. falciparum ortholog of H2A.Z (PfH2A.Z) colocalizes with histone modifications that are characteristic of transcriptionally-permissive euchromatin, but not with markers of heterochromatin. Consistent with this finding, antibodies to PfH2A.Z co-precipitate the permissive modification H3K4me3. By chromatin-immunoprecipitation we show that PfH2A.Z is enriched in nucleosomes around the transcription start site (TSS) in both transcriptionally active and silent stage-specific genes. In var genes, however, PfH2A.Z is enriched at the TSS only during active transcription in ring stage parasites. Thus, in contrast to other genes, temporal var gene regulation involves histone variant exchange at promoter nucleosomes. Sir2 histone deacetylases are important for var gene silencing and their yeast ortholog antagonises H2A.Z function in subtelomeric yeast genes. In immature P. falciparum parasites lacking Sir2A or Sir2B high var transcription levels correlate with enrichment of PfH2A.Z at the TSS. As Sir2A knock out parasites mature the var genes are
Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu
2016-11-01
Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.
Melkina, Olga E; Goryanin, Ignatiy I; Zavilgelsky, Gennadii B
2016-11-01
The antirestriction proteins ArdA ColIb-P9, Arn T4 and Ocr T7 specifically inhibit type I and type IV restriction enzymes and belong to the family of DNA-mimic proteins because their three-dimensional structure is similar to the double-helical B-form DNA. It is proposed that the DNA-mimic proteins are able to bind nucleoid protein H-NS and alleviate H-NS-silencing of the transcription of bacterial genes. Escherichia coli lux biosensors were constructed by inserting H-NS-dependent promoters into a vector, thereby placing each fragment upstream of the promoterless Photorhabdus luminescens luxCDABE operon. It was demonstrated that the DNA-mimic proteins ArdA, Arn and Ocr activate the transcription of H-NS-dependent promoters of the lux operon of marine luminescent bacteria (mesophilic Aliivibrio fischeri and psychrophilic Aliivibrio logei), and the dps gene from E. coli. It was also demonstrated that the ArdA antirestriction protein, the genes of which are located on transmissive plasmids ColIb-P9, R64, PK101, decreases levels of H-NS silencing of the PluxC promoter during conjugation in the recipient bacteria. Copyright © 2016 Elsevier GmbH. All rights reserved.
The dynamics and efficacy of antiviral RNA silencing: A model study
Directory of Open Access Journals (Sweden)
Hogeweg Paulien
2008-03-01
Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.
[Familial febrile convulsions is supposed to link to human chromosome 19p13.3].
Qi, Y; Lü, J; Wu, X
2001-01-10
To localize the familial febrile convulsion (FC) genes on human chromosomes. For 63 FC pedigrees, tetranucleotide repeat markers D19S253 D19S395 and D19S591 on the short arm of chromosome 19, as well as dinucleotide repeat markers D8S84 and D8S85 on the long arm of chromosome 8 were genotyped. Transmission disequilibrium test (TDT) and Lod score calculation were carried out. The data were processed by PPAP software package. All the alleles in every locus of FC probands and normal controls were in Hardy-Weinburg balance. Transmission disequilibrium was found on D8S84, D19S395 and D19S591 in FC families. chi(2) values were 4.0, 5.124 and 7.364 separately. Each P value was < 0.05, and significantly meaningful. The two-point Lod scores between D8S84 and FC, D8S85 and FC, D19S253 and FC, D19S395 and FC, D19S591 and FC are 0.00002, 0.000017, 0.58, 1.53 and 1.42 respectively. The multi-point Lod score among markers on chromosome 8q and FC was 0.88, while Lod score among markers on chromosome 19p and FC reached 2.78. The results by both the non-parameter (TDT) and parameter (Lod score) methods were consistant on a whole. FC is linked with chromosome region 19p13.3, but not with chromosome 8q.
Potential proteins targeted by let-7f-5p in HeLa cells.
Wang, Yu; Chen, Xiujuan; Zhang, Yi; Song, Jiandong
2017-07-24
MicroRNAs are a class of small, endogenous, non-coding RNAs mediating posttranscriptional gene silencing. The current authors hypothesized that let-7f-5p is likely involved in cell invasion and proliferation by regulating the expression of target genes. The current study combined let-7f-5p with iTRAQ to assess its effect on gene expression in HeLa cells. Results indicated that 164 proteins were expressed at different levels in HeLa cells overexpressing let-7f-5p and negative controls and that 172 proteins were expressed at different levels in let-7f-5p-silenced HeLa cells and negative controls. Results indicated that let-7f-5p may suppress insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1) in HeLa cells.
Directory of Open Access Journals (Sweden)
Kentaro Tsukamoto
Full Text Available Botulinum neurotoxins produced by Clostridium botulinum cause flaccid paralysis by inhibiting neurotransmitter release at peripheral nerve terminals. Previously, we found that neurons derived from the murine P19 embryonal carcinoma cell line exhibited high sensitivity to botulinum neurotoxin type C. In order to prove the utility of P19 cells for the study of the intracellular mechanism of botulinum neurotoxins, ganglioside-knockout neurons were generated by deletion of the gene encoding beta-1,4 N-acetylgalactosaminyltransferase 1 in P19 cells using the clustered regularly interspaced short palindromic repeats combined with Cas9 (CRISPR/Cas9 system. By using this system, knockout cells could be generated more easily than with previous methods. The sensitivity of the generated beta-1,4 N-acetylgalactosaminyltransferase 1-depleted P19 neurons to botulinum neurotoxin type C was decreased considerably, and the exogenous addition of the gangliosides GD1a, GD1b, and GT1b restored the susceptibility of P19 cells to botulinum neurotoxin type C. In particular, addition of a mixture of these three ganglioside more effectively recovered the sensitivity of knockout cells compared to independent addition of GD1a, GD1b, or GT1b. Consequently, the genome-edited P19 cells generated by the CRISPR/Cas9 system were useful for identifying and defining the intracellular molecules involved in the toxic action of botulinum neurotoxins.
Claudin-1 is a p63 target gene with a crucial role in epithelial development.
Directory of Open Access Journals (Sweden)
Teresa Lopardo
2008-07-01
Full Text Available The epidermis of the skin is a self-renewing, stratified epithelium that functions as the interface between the human body and the outer environment, and acts as a barrier to water loss. Components of intercellular junctions, such as Claudins, are critical to maintain tissue integrity and water retention. p63 is a transcription factor essential for proliferation of stem cells and for stratification in epithelia, mutated in human hereditary syndromes characterized by ectodermal dysplasia. Both p63 and Claudin-1 null mice die within few hours from birth due to dehydration from severe skin abnormalities. These observations suggested the possibility that these two genes might be linked in one regulatory pathway with p63 possibly regulating Claudin-1 expression. Here we show that silencing of DeltaNp63 in primary mouse keratinocytes results in a marked down-regulation of Claudin-1 expression (-80%. DeltaNp63alpha binds in vivo to the Claudin-1 promoter and activates both the endogenous Claudin-1 gene and a reporter vector containing a -1.4 Kb promoter fragment of the Claudin-1 gene. Accordingly, Claudin-1 expression was absent in the skin of E15.5 p63 null mice and natural p63 mutant proteins, specifically those found in Ankyloblepharon-Ectodermal dysplasia-Clefting (AEC patients, were indeed altered in their capacity to regulate Claudin-1 transcription. This correlates with deficient Claudin-1 expression in the epidermis of an AEC patient carrying the I537T p63 mutation. Notably, AEC patients display skin fragility similar to what observed in the epidermis of Claudin-1 and p63 null mice. These findings reinforce the hypothesis that these two genes might be linked in a common regulatory pathway and that Claudin-1 may is an important p63 target gene involved in the pathogenesis of ectodermal dysplasias.
Directory of Open Access Journals (Sweden)
Monika Mahajan
Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless
Puthumana, Jayesh; Kim, Bo-Mi; Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Jung, Jee-Hyun; Kim, Il-Chan; Hwang, Un-Ki; Lee, Jae-Seong
2017-06-01
The CYP2 genes are the largest and most diverse cytochrome P450 (CYP) subfamily in vertebrates. We have identified nine co-localized CYP2 genes (∼55kb) in a new cluster in the genome of the highly resilient ecotoxicological fish model Kryptolebias marmoratus. Molecular characterization, temporal and tissue-specific expression pattern, and response to xenobiotics of these genes were examined. The CYP2 gene clusters were characterized and designated CYP2N22-23, CYP2AD12, and CYP2P16-20. Gene synteny analysis confirmed that the cluster in K. marmoratus is similar to that found in other teleost fishes, including zebrafish. A gene duplication event with diverged catalytic function was observed in CYP2AD12. Moreover, a high level of divergence in expression was observed among the co-localized genes. Phylogeny of the cluster suggested an orthologous relationship with similar genes in zebrafish and Japanese medaka. Gene expression analysis showed that CYP2P19 and CYP2N20 were consecutively expressed throughout embryonic development, whereas CYP2P18 was expressed in all adult tissues, suggesting that members of each CYP2 gene family have different physiological roles even though they are located in the same cluster. Among endocrine-disrupting chemicals (EDCs), benzo[α]pyrene (B[α]P) induced expression of CYP2N23, bisphenol A (BPA) induced CYP2P18 and CYP2P19, and 4-octylphenol (OP) induced CYP2AD12, but there was no significant response to 4-nonylphenol (NP), implying differential catalytic roles of the enzyme. In this paper, we identify and characterize a CYP2 gene cluster in the mangrove killifish K. marmoratus with differing catalytic roles toward EDCs. Our findings provide insights on the roles of nine co-localized CYP2 genes and their catalytic functions for better understanding of chemical-biological interactions in fish. Copyright © 2017 Elsevier B.V. All rights reserved.
Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J.; Li, Qiyuan; Delgado, Melissa K.; Lee, Janet M.; Aittomaki, Kristiina; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker
2016-01-01
A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10−20), ER-negative BC (P=1.1 × 10−13), BRCA1-associated BC (P=7.7 × 10−16) and triple negative BC (P-diff=2 × 10−5). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10...
H Ferritin Gene Silencing in a Human Metastatic Melanoma Cell Line: A Proteomic Analysis
DEFF Research Database (Denmark)
Di Sanzo, Maddalena; Gaspari, Marco; Misaggi, Roberta
2011-01-01
Ferritin, the major intracellular iron-storage protein, is made of 24 subunits of two types, H and L. Besides regulating intracellular iron homeostasis, it has been found that ferritin, in particular the H subunit (FHC), is involved in different biological events such as cell differentiation...... and pathologic states (i.e., neurodegeneration and cancer). This study is aimed at investigating the whole-cell proteome of FHC-expressing and sh-RNA-silenced human metastatic melanoma cells (MM07(m)) in the attempt to identify and classify the highest number of proteins directly or indirectly controlled...... of H ferritin signaling pathways and lend support to the hypothesis that specific targeting of this gene might be an attractive and potentially effective strategy for the management of metastatic melanoma....
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.
Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G
2011-04-29
RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.
Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover
Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.
2011-01-01
RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178
Directory of Open Access Journals (Sweden)
Yusuke Ohnishi
Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense
Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian
2012-02-01
Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.
Cheng, Jin; Ding, Qian; Wang, Jia; Deng, Lin; Yang, Lu; Tao, Lei; Lei, Haihong; Lu, Shaoping
2016-01-01
Heart disease is one of the deadliest diseases causing mortality due to the limited regenerative capability of highly differentiated cardiomyocytes. Stem cell-based therapy in tissue engineering is one of the most exciting and rapidly growing areas and raises promising prospects for cardiac repair. In this study, we have synthesized FITC-mesoporous silica nanoparticles (FMSNs) based on a sol-gel method (known as Stöber's method) as a drug delivery platform to transport 5-azacytidine in P19 embryonic carcinoma stem cells. The surfactant CTAB is utilized as a liquid crystal template to self-aggregate into micelles, resulting in the synthesis of MSNs. Based on the cell viability assay, treatment with FMSNs + 5-azacytidine resulted in much more significant inhibition of the proliferation than 5-azacytidine alone. To study the mechanism, we have tested the differentiation genes and cardiac marker genes in P19 cells and found that these genes have been up-regulated in P19 embryonic carcinoma stem cells treated with FMSNs + 5-azacytidine + poly(allylamine hydrochloride) (PAH), with the changes of histone modifications on the regulatory region. In conclusion, with FMSNs as drug delivery platforms, 5-azacytidine can be more efficiently delivered into stem cells and can be used to monitor and track the transfection process in situ to clarify their effects on stem cell functions and the differentiation process, which can serve as a promising tool in tissue engineering and other biomedical fields.
Directory of Open Access Journals (Sweden)
Marianna Feretzaki
2016-03-01
Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.
Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium
International Nuclear Information System (INIS)
Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max
2009-01-01
Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.
Basquin, Denis; Spierer, Anne; Begeot, Flora; Koryakov, Dmitry E; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion
2014-01-01
Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3-7 protein in Drosophila ovaries. We present evidences that Su(var)3-7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3-7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3-7 is required for genome integrity. Females homozygous for Su(var)3-7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3-7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3-7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3-7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3-7 and piwi or aubergine controls important developmental processes independently of transposon silencing.
Amplified genes may be overexpressed, unchanged, or downregulated in cervical cancer cell lines.
Directory of Open Access Journals (Sweden)
Oscar Vazquez-Mena
Full Text Available Several copy number-altered regions (CNAs have been identified in the genome of cervical cancer, notably, amplifications of 3q and 5p. However, the contribution of copy-number alterations to cervical carcinogenesis is unresolved because genome-wide there exists a lack of correlation between copy-number alterations and gene expression. In this study, we investigated whether CNAs in the cell lines CaLo, CaSki, HeLa, and SiHa were associated with changes in gene expression. On average, 19.2% of the cell-line genomes had CNAs. However, only 2.4% comprised minimal recurrent regions (MRRs common to all the cell lines. Whereas 3q had limited common gains (13%, 5p was entirely duplicated recurrently. Genome-wide, only 15.6% of genes located in CNAs changed gene expression; in contrast, the rate in MRRs was up to 3 times this. Chr 5p was confirmed entirely amplified by FISH; however, maximum 33.5% of the explored genes in 5p were deregulated. In 3q, this rate was 13.4%. Even in 3q26, which had 5 MRRs and 38.7% recurrently gained SNPs, the rate was only 15.1%. Interestingly, up to 19% of deregulated genes in 5p and 73% in 3q26 were downregulated, suggesting additional factors were involved in gene repression. The deregulated genes in 3q and 5p occurred in clusters, suggesting local chromatin factors may also influence gene expression. In regions amplified discontinuously, downregulated genes increased steadily as the number of amplified SNPs increased (p<0.01, Spearman's correlation. Therefore, partial gene amplification may function in silencing gene expression. Additional genes in 1q, 3q and 5p could be involved in cervical carcinogenesis, specifically in apoptosis. These include PARP1 in 1q, TNFSF10 and ECT2 in 3q and CLPTM1L, AHRR, PDCD6, and DAP in 5p. Overall, gene expression and copy-number profiles reveal factors other than gene dosage, like epigenetic or chromatin domains, may influence gene expression within the entirely amplified genome
Zhang, Changsong; Li, Ke; Wei, Lixin; Li, Zhengyou; Yu, Ping; Teng, Lijuan; Wu, Kusheng; Zhu, Jin
2007-01-01
Background Aberrant promoter methylation is an important mechanism for gene silencing. Aims To evaluate the promoter methylation status of p300 gene in patients with oesophageal squamous cell carcinoma (OSCC). Methods The methylation status of p300 promoter was analysed by methylation‐specific PCR (MSP) in 50 OSCC tissues and the matching non‐cancerous tissues. Oesophageal cancer cell lines (ECa‐109 and TE‐10) were treated with the demethylation agent 5‐aza‐2′‐deoxycytidine (5‐Aza‐CdR), and p300 mRNA expression was detected by RT‐PCR. Results p300 methylation was found in 42% (21/50) of the OSCC tissues, but in only 20% (10/50) of the corresponding non‐cancerous tissues (p = 0.017). In OSCC samples, 65% of those with deep tumour invasion (adventitia) and 63% samples with metastasis revealed p300 promoter methylation (p<0.05). p300 mRNA expression was observed in 19.0% (4/21) of methylated tumours and 58.6% (17/29) of unmethylated tumours (p = 0.005). In addition, p300 mRNA expression was observed in 40% (4/10) of methylated non‐neoplastic tissues and 87.5% (35/40) of unmethylated non‐tumours (p = 0.001). The demethylation caused by 5‐Aza‐CdR increased the p300 mRNA expression levels in oesophageal cancer cell lines. Conclusions p300 transcription silenced by promoter hypermethylation could play a role in the pathogenesis of oesophageal squamous cell carcinoma. PMID:17965222
RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.
Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo
2016-12-01
Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.
Directory of Open Access Journals (Sweden)
Paolo Kunderfranco
2010-05-01
Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.
Energy Technology Data Exchange (ETDEWEB)
Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)
2016-08-15
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
International Nuclear Information System (INIS)
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-01-01
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
Directory of Open Access Journals (Sweden)
Zhang Jun
2010-11-01
Full Text Available Abstract Background To identify new and useful candidate biomarkers in head and neck squamous cell carcinoma (HNSCC, we performed a genome-wide survey and found that Myelin and lymphocyte-associated protein (MAL was a gene that was markedly down-regulated in HNSCC. Hence, we investigated the mechanism of MAL silencing and the effects of MAL on the proliferation, invasion, and apoptotic potential in HNSCC. Results MAL was significantly down-regulated in 91.7% of HNSCC specimens at the mRNA level as compared with adjacent normal tissues (P = 0.0004. Moreover, the relative transcript levels of the MAL gene were remarkably decreased by five-fold in nine HNSCC cell lines as compared with normal head and neck epithelium cells. MAL gene expression was restored in 44%, 67%, and 89% in HNSCC cell lines treated with TSA, 5-Aza-dC, and TSA plus 5-Aza-dC, respectively. Furthermore, bisulfate-treated DNA sequencing demonstrated that the two CpG islands (that is, M1 and M2 located in MAL promoter region were completely methylated in the HNSCC cell lines (CpG methylated ratio was more than 90%, and only one CpG island (that is, M1 was partially methylated in HNSCC tissues (CpG methylated ratio between 20% and 90%. A significant reduction in cell proliferation and a change in the cell cycle profile were also observed in MAL transfectants. Matrigel assay demonstrated that the invasiveness of HNSCC cells significantly decreased. A significant increase in the population of apoptotic cells was observed in MAL transfected cells. The exogenous expression of the MAL gene suppressed malignant phenotypes, while the cell death induced by MAL gene transfer was a result of apoptosis as demonstrated by the induction of cleavage of the poly (that is, ADP-ribose polymerase. Additionally, tumor growth was suppressed in cells expressing MAL as compared with cells not expressing MAL. Conclusion Our data suggest that the epigenetic inactivation of MAL, as a candidate tumor
Wang, Dong; Fan, Yuhong; Zhang, Jianjun
2013-01-01
Inhibition of neurite growth, which is in large part mediated by the Nogo-66 receptor, affects neural regeneration following bone marrow mesenchymal stem cell transplantation. The tissue engineering scaffold poly(D,L-lactide-co-glycolic acid) has good histocompatibility and can promote the growth of regenerating nerve fibers. The present study used small interfering RNA to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells and Schwann cells, which were subsequently transplanted with poly(D,L-lactide-co-glycolic acid) into the spinal cord lesion regions in rats. Simultaneously, rats treated with scaffold only were taken as the control group. Hematoxylin-eosin staining and immunohistochemistry revealed that at 4 weeks after transplantation, rats had good motor function of the hind limb after treatment with Nogo-66 receptor gene-silenced cells plus the poly(D,L-lactide-co-glycolic acid) scaffold compared with rats treated with scaffold only, and the number of bone marrow mesenchymal stem cells and neuron-like cells was also increased. At 8 weeks after transplantation, horseradish peroxidase tracing and transmission electron microscopy showed a large number of unmyelinated and myelinated nerve fibers, as well as intact regenerating axonal myelin sheath following spinal cord hemisection injury. These experimental findings indicate that transplantation of Nogo-66 receptor gene-silenced bone marrow mesenchymal stem cells and Schwann cells plus a poly(D,L-lactide-co-glycolic acid) scaffold can significantly enhance axonal regeneration of spinal cord neurons and improve motor function of the extremities in rats following spinal cord injury. PMID:25206713
Polycomb complexes and silencing mechanisms
DEFF Research Database (Denmark)
Lund, Anders H; van Lohuizen, Maarten
2004-01-01
Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....
Bhagat, Rahul; Kumar, Sandeep Sriram; Vaderhobli, Shilpa; Premalata, Chennagiri S; Pallavi, Venkateshaiah Reddihalli; Ramesh, Gawari; Krishnamoorthy, Lakshmi
2014-09-01
Silencing of tumor suppressor and tumor-related genes by promoter hypermethylation is one of the major events in ovarian carcinogenesis. In this study, we analyzed aberrant promoter methylation of p16 and RAR-β genes in 134 epithelial ovarian carcinomas (EOCs), 23 low malignant potential (LMP) tumors, 26 benign cystadenomas, and 15 normal ovarian tissues. Methylation was investigated by methylation-specific PCR (MSP), and the results were confirmed by bisulfite DNA sequencing. Relative gene expression of p16 and RAR-β was done using quantitative reverse transcriptase PCR (qRT-PCR) on 51 EOC cases, 9 LMP tumors, and 7 benign cystadenomas with 5 normal ovarian tissues. Aberrant methylation for p16 and RAR-β was present in 43 % (58/134) and 31 % (41/134) in carcinoma cases, 22 % (05/23) and 52 % (12/23) in LMP tumors, and 42 % (11/26) and 69 % (18/26) in benign cystadenomas. No methylation was observed in any of the normal ovarian tissues. The mRNA expression level of p16 and RAR-β was significantly downregulated in EOC and LMP tumors than the corresponding normal tissues whereas the expression level was normal in benign cystadenomas for p16 and slightly reduced for RAR-β. A significant correlation of p16 promoter methylation was observed with reduced gene expression in EOC. For RAR-β, no significant correlation was observed between promoter methylation and gene expression. Our results suggest that epigenetic alterations of p16 and RAR-β have an important role in ovarian carcinogenesis and that mechanism along with methylation plays a significant role in downregulation of RAR-β gene in ovarian cancer.
The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens
International Nuclear Information System (INIS)
Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki
2004-01-01
Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms
The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.
Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki
2004-03-01
Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.
Prader-Willi Syndrome due to an Unbalanced de novo Translocation t(15;19)(q12;p13.3).
Dang, Vy; Surampalli, Abhilasha; Manzardo, Ann M; Youn, Stephanie; Butler, Merlin G; Gold, June-Anne; Kimonis, Virginia E
2016-01-01
Prader-Willi syndrome (PWS) is a complex, multisystem genetic disorder characterized by endocrine, neurologic, and behavioral abnormalities. We report the first case of an unbalanced de novo reciprocal translocation of chromosomes 15 and 19, 45,XY,-15,der(19)t(15;19)(q12;p13.3), resulting in monosomy for the PWS critical chromosome region. Our patient had several typical features of PWS including infantile hypotonia, a poor suck and feeding difficulties, tantrums, skin picking, compulsions, small hands and feet, and food seeking, but not hypopigmentation, a micropenis, cryptorchidism or obesity as common findings seen in PWS at the time of examination at 6 years of age. He had seizures noted from 1 to 3 years of age and marked cognitive delay. High-resolution SNP microarray analysis identified an atypical PWS type I deletion in chromosome 15 involving the proximal breakpoint BP1. The deletion extended beyond the GABRB3 gene but was proximal to the usual distal breakpoint (BP3) within the 15q11q13 region, and GABRA5, GABRG3, and OCA2 genes were intact. No deletion of band 19p13.3 was detected; therefore, the patient was not at an increased risk of tumors from the Peutz-Jeghers syndrome associated with a deletion of the STK11 gene. © 2016 S. Karger AG, Basel.
Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin
2017-12-01
The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Bady, Pierre; Sciuscio, Davide; Diserens, Annie-Claire; Bloch, Jocelyne; van den Bent, Martin J; Marosi, Christine; Dietrich, Pierre-Yves; Weller, Michael; Mariani, Luigi; Heppner, Frank L; Mcdonald, David R; Lacombe, Denis; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika E
2012-10-01
The methylation status of the O(6)-methylguanine-DNA methyltransferase (MGMT) gene is an important predictive biomarker for benefit from alkylating agent therapy in glioblastoma. Recent studies in anaplastic glioma suggest a prognostic value for MGMT methylation. Investigation of pathogenetic and epigenetic features of this intriguingly distinct behavior requires accurate MGMT classification to assess high throughput molecular databases. Promoter methylation-mediated gene silencing is strongly dependent on the location of the methylated CpGs, complicating classification. Using the HumanMethylation450 (HM-450K) BeadChip interrogating 176 CpGs annotated for the MGMT gene, with 14 located in the promoter, two distinct regions in the CpG island of the promoter were identified with high importance for gene silencing and outcome prediction. A logistic regression model (MGMT-STP27) comprising probes cg12434587 [corrected] and cg12981137 provided good classification properties and prognostic value (kappa = 0.85; log-rank p CIMP) positive tumors was found in glioblastomas from The Cancer Genome Atlas than in low grade and anaplastic glioma cohorts, while in CIMP-negative gliomas MGMT was classified as methylated in approximately 50 % regardless of tumor grade. The proposed MGMT-STP27 prediction model allows mining of datasets derived on the HM-450K or HM-27K BeadChip to explore effects of distinct epigenetic context of MGMT methylation suspected to modulate treatment resistance in different tumor types.
Lawrenson, Kate; Kar, Siddhartha; McCue, Karen; Kuchenbaeker, Karoline; Michailidou, Kyriaki; Tyrer, Jonathan; Beesley, Jonathan; Ramus, Susan J.; Li, Qiyuan; Delgado, Melissa K.; Lee, Janet M.; Aittomäki, Kristiina; Andrulis, Irene L.; Anton-Culver, Hoda; Arndt, Volker; Arun, Banu K.; Arver, Brita; Bandera, Elisa V.; Barile, Monica; Barkardottir, Rosa B.; Barrowdale, Daniel; Beckmann, Matthias W.; Benitez, Javier; Berchuck, Andrew; Bisogna, Maria; Bjorge, Line; Blomqvist, Carl; Blot, William; Bogdanova, Natalia; Bojesen, Anders; Bojesen, Stig E.; Bolla, Manjeet K.; Bonanni, Bernardo; Børresen-Dale, Anne-Lise; Brauch, Hiltrud; Brennan, Paul; Brenner, Hermann; Bruinsma, Fiona; Brunet, Joan; Buhari, Shaik Ahmad; Burwinkel, Barbara; Butzow, Ralf; Buys, Saundra S.; Cai, Qiuyin; Caldes, Trinidad; Campbell, Ian; Canniotto, Rikki; Chang-Claude, Jenny; Chiquette, Jocelyne; Choi, Ji-Yeob; Claes, Kathleen B. M.; Collonge-Rame, Marie- Agnès; Damette, Alexandre; Barouk-Simonet, Emmanuelle; Bonnet, Françoise; Bubien, Virginie; Sevenet, Nicolas; Longy, Michel; Berthet, Pascaline; Vaur, Dominique; Castera, Laurent; Ferrer, Sandra Fert; Bignon, Yves-Jean; Uhrhammer, Nancy; Coron, Fanny; Faivre, Laurence; Baurand, Amandine; Jacquot, Caroline; Bertolone, Geoffrey; Lizard, Sarab; Leroux, Dominique; Dreyfus, Hélène; Rebischung, Christine; Peysselon, Magalie; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Adenis, Claude; Vénat-Bouvet, Laurence; Léone, Mélanie; Boutry-Kryza, Nadia; Calender, Alain; Giraud, Sophie; Verny-Pierre, Carole; Lasset, Christine; Bonadona, Valérie; Barjhoux, Laure; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Remenieras, Audrey; Coupier, Isabelle; Pujol, Pascal; Sokolowska, Johanna; Bronner, Myriam; Delnatte, Capucine; Bézieau, Stéphane; Mari, Véronique; Gauthier-Villars, Marion; Buecher, Bruno; Rouleau, Etienne; Golmard, Lisa; Moncoutier, Virginie; Belotti, Muriel; de Pauw, Antoine; Elan, Camille; Fourme, Emmanuelle; Birot, Anne-Marie; Saule, Claire; Laurent, Maïté; Houdayer, Claude; Lesueur, Fabienne; Mebirouk, Noura; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Warcoin, Mathilde; Prieur, Fabienne; Lebrun, Marine; Kientz, Caroline; Muller, Danièle; Fricker, Jean-Pierre; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Mortemousque, Isabelle; Bressac-de-Paillerets, Brigitte; Caron, Olivier; Guillaud-Bataille, Marine; Cook, Linda S.; Cox, Angela; Cramer, Daniel W.; Cross, Simon S.; Cybulski, Cezary; Czene, Kamila; Daly, Mary B.; Damiola, Francesca; Dansonka-Mieszkowska, Agnieszka; Darabi, Hatef; Dennis, Joe; Devilee, Peter; Diez, Orland; Doherty, Jennifer A.; Domchek, Susan M.; Dorfling, Cecilia M.; Dörk, Thilo; Dumont, Martine; Ehrencrona, Hans; Ejlertsen, Bent; Ellis, Steve; Gregory, Helen; Miedzybrodzka, Zosia; Morrison, Patrick J.; Donaldson, Alan; Rogers, Mark T.; Kennedy, M. John; Porteous, Mary E.; Brady, Angela; Barwell, Julian; Foo, Claire; Lalloo, Fiona; Side, Lucy E.; Eason, Jacqueline; Henderson, Alex; Walker, Lisa; Cook, Jackie; Snape, Katie; Murray, Alex; McCann, Emma; Engel, Christoph; Lee, Eunjung; Evans, D. Gareth; Fasching, Peter A.; Feliubadalo, Lidia; Figueroa, Jonine; Flesch-Janys, Dieter; Fletcher, Olivia; Flyger, Henrik; Foretova, Lenka; Fostira, Florentia; Foulkes, William D.; Fridley, Brooke L.; Friedman, Eitan; Frost, Debra; Gambino, Gaetana; Ganz, Patricia A.; Garber, Judy; García-Closas, Montserrat; Gentry-Maharaj, Aleksandra; Ghoussaini, Maya; Giles, Graham G.; Glasspool, Rosalind; Godwin, Andrew K.; Goldberg, Mark S.; Goldgar, David E.; González-Neira, Anna; Goode, Ellen L.; Goodman, Marc T.; Greene, Mark H.; Gronwald, Jacek; Guénel, Pascal; Haiman, Christopher A.; Hall, Per; Hallberg, Emily; Hamann, Ute; Hansen, Thomas V. O.; Harrington, Patricia A.; Hartman, Mikael; Hassan, Norhashimah; Healey, Sue; Rookus, M. A.; van Leeuwen, F. E.; van der Kolk, L. E.; Schmidt, M. K.; Russell, N. S.; de Lange, J. L.; Wijnands, R.; Collée, J. M.; Hooning, M. J.; Seynaeve, C.; van Deurzen, C. H. M.; Obdeijn, I. M.; van Asperen, C. J.; Tollenaar, R. A. E. M.; van Cronenburg, T. C. T. E. F.; Kets, C. M.; Ausems, M. G. E. M.; van der Pol, C. C.; van Os, T. A. M.; Waisfisz, Q.; Meijers-Heijboer, H. E. J.; Gómez-Garcia, E. B.; Oosterwijk, J. C.; Mourits, M. J.; de Bock, G. H.; Vasen, H. F.; Siesling, S.; Verloop, J.; Overbeek, L. I. H.; Heitz, Florian; Herzog, Josef; Høgdall, Estrid; Høgdall, Claus K.; Hogervorst, Frans B. L.; Hollestelle, Antoinette; Hopper, John L.; Hulick, Peter J.; Huzarski, Tomasz; Imyanitov, Evgeny N.; Fox, Stephen; Kirk, Judy; Lindeman, Geoff; Price, Melanie; Bowtell, David; deFazio, Anna; Webb, Penny; Isaacs, Claudine; Ito, Hidemi; Jakubowska, Anna; Janavicius, Ramunas; Jensen, Allan; John, Esther M.; Johnson, Nichola; Kabisch, Maria; Kang, Daehee; Kapuscinski, Miroslav; Karlan, Beth Y.; Khan, Sofia; Kiemeney, Lambertus A.; Kjaer, Susanne Kruger; Knight, Julia A.; Konstantopoulou, Irene; Kosma, Veli-Matti; Kristensen, Vessela; Kupryjanczyk, Jolanta; Kwong, Ava; de la Hoya, Miguel; Laitman, Yael; Lambrechts, Diether; Le, Nhu; De Leeneer, Kim; Lester, Jenny; Levine, Douglas A.; Li, Jingmei; Lindblom, Annika; Long, Jirong; Lophatananon, Artitaya; Loud, Jennifer T.; Lu, Karen; Lubinski, Jan; Mannermaa, Arto; Manoukian, Siranoush; Le Marchand, Loic; Margolin, Sara; Marme, Frederik; Massuger, Leon F. A. G.; Matsuo, Keitaro; Mazoyer, Sylvie; McGuffog, Lesley; McLean, Catriona; McNeish, Iain; Meindl, Alfons; Menon, Usha; Mensenkamp, Arjen R.; Milne, Roger L.; Montagna, Marco; Moysich, Kirsten B.; Muir, Kenneth; Mulligan, Anna Marie; Nathanson, Katherine L.; Ness, Roberta B.; Neuhausen, Susan L.; Nevanlinna, Heli; Nord, Silje; Nussbaum, Robert L.; Odunsi, Kunle; Offit, Kenneth; Olah, Edith; Olopade, Olufunmilayo I.; Olson, Janet E.; Olswold, Curtis; O'Malley, David; Orlow, Irene; Orr, Nick; Osorio, Ana; Park, Sue Kyung; Pearce, Celeste L.; Pejovic, Tanja; Peterlongo, Paolo; Pfeiler, Georg; Phelan, Catherine M.; Poole, Elizabeth M.; Pylkäs, Katri; Radice, Paolo; Rantala, Johanna; Rashid, Muhammad Usman; Rennert, Gad; Rhenius, Valerie; Rhiem, Kerstin; Risch, Harvey A.; Rodriguez, Gus; Rossing, Mary Anne; Rudolph, Anja; Salvesen, Helga B.; Sangrajrang, Suleeporn; Sawyer, Elinor J.; Schildkraut, Joellen M.; Schmidt, Marjanka K.; Schmutzler, Rita K.; Sellers, Thomas A.; Seynaeve, Caroline; Shah, Mitul; Shen, Chen-Yang; Shu, Xiao-Ou; Sieh, Weiva; Singer, Christian F.; Sinilnikova, Olga M.; Slager, Susan; Song, Honglin; Soucy, Penny; Southey, Melissa C.; Stenmark-Askmalm, Marie; Stoppa-Lyonnet, Dominique; Sutter, Christian; Swerdlow, Anthony; Tchatchou, Sandrine; Teixeira, Manuel R.; Teo, Soo H.; Terry, Kathryn L.; Terry, Mary Beth; Thomassen, Mads; Tibiletti, Maria Grazia; Tihomirova, Laima; Tognazzo, Silvia; Toland, Amanda Ewart; Tomlinson, Ian; Torres, Diana; Truong, Thérèse; Tseng, Chiu-chen; Tung, Nadine; Tworoger, Shelley S.; Vachon, Celine; van den Ouweland, Ans M. W.; van Doorn, Helena C.; van Rensburg, Elizabeth J.; Van't Veer, Laura J.; Vanderstichele, Adriaan; Vergote, Ignace; Vijai, Joseph; Wang, Qin; Wang-Gohrke, Shan; Weitzel, Jeffrey N.; Wentzensen, Nicolas; Whittemore, Alice S.; Wildiers, Hans; Winqvist, Robert; Wu, Anna H.; Yannoukakos, Drakoulis; Yoon, Sook-Yee; Yu, Jyh-Cherng; Zheng, Wei; Zheng, Ying; Khanna, Kum Kum; Simard, Jacques; Monteiro, Alvaro N.; French, Juliet D.; Couch, Fergus J.; Freedman, Matthew L.; Easton, Douglas F.; Dunning, Alison M.; Pharoah, Paul D.; Edwards, Stacey L.; Chenevix-Trench, Georgia; Antoniou, Antonis C.; Gayther, Simon A.
2016-01-01
A locus at 19p13 is associated with breast cancer (BC) and ovarian cancer (OC) risk. Here we analyse 438 SNPs in this region in 46,451 BC and 15,438 OC cases, 15,252 BRCA1 mutation carriers and 73,444 controls and identify 13 candidate causal SNPs associated with serous OC (P=9.2 × 10−20), ER-negative BC (P=1.1 × 10−13), BRCA1-associated BC (P=7.7 × 10−16) and triple negative BC (P-diff=2 × 10−5). Genotype-gene expression associations are identified for candidate target genes ANKLE1 (P=2 × 10−3) and ABHD8 (P<2 × 10−3). Chromosome conformation capture identifies interactions between four candidate SNPs and ABHD8, and luciferase assays indicate six risk alleles increased transactivation of the ADHD8 promoter. Targeted deletion of a region containing risk SNP rs56069439 in a putative enhancer induces ANKLE1 downregulation; and mRNA stability assays indicate functional effects for an ANKLE1 3′-UTR SNP. Altogether, these data suggest that multiple SNPs at 19p13 regulate ABHD8 and perhaps ANKLE1 expression, and indicate common mechanisms underlying breast and ovarian cancer risk. PMID:27601076
H-ferritin-regulated microRNAs modulate gene expression in K562 cells.
Directory of Open Access Journals (Sweden)
Flavia Biamonte
Full Text Available In a previous study, we showed that the silencing of the heavy subunit (FHC offerritin, the central iron storage molecule in the cell, is accompanied by a modification in global gene expression. In this work, we explored whether different FHC amounts might modulate miRNA expression levels in K562 cells and studied the impact of miRNAs in gene expression profile modifications. To this aim, we performed a miRNA-mRNA integrative analysis in K562 silenced for FHC (K562shFHC comparing it with K562 transduced with scrambled RNA (K562shRNA. Four miRNAs, namely hsa-let-7g, hsa-let-7f, hsa-let-7i and hsa-miR-125b, were significantly up-regulated in silenced cells. The remarkable down-regulation of these miRNAs, following FHC expression rescue, supports a specific relation between FHC silencing and miRNA-modulation. The integration of target predictions with miRNA and gene expression profiles led to the identification of a regulatory network which includes the miRNAs up-regulated by FHC silencing, as well as91 down-regulated putative target genes. These genes were further classified in 9 networks; the highest scoring network, "Cell Death and Survival, Hematological System Development and Function, Hematopoiesis", is composed by 18 focus molecules including RAF1 and ERK1/2. We confirmed that, following FHC silencing, ERK1/2 phosphorylation is severely impaired and that RAF1 mRNA is significantly down-regulated. Taken all together, our data indicate that, in our experimental model, FHC silencing may affect RAF1/pERK1/2 levels through the modulation of a specific set of miRNAs and add new insights in to the relationship among iron homeostasis and miRNAs.
Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.
Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui
2017-01-01
A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.
Manipulation of Auxin Response Factor 19 affects seed size in the woody perennial Jatropha curcas
Sun, Yanwei; Wang, Chunming; Wang, Ning; Jiang, Xiyuan; Mao, Huizhu; Zhu, Changxiang; Wen, Fujiang; Wang, Xianghua; Lu, Zhijun; Yue, Genhua; Xu, Zengfu; Ye, Jian
2017-01-01
Seed size is a major determinant of seed yield but few is known about the genetics controlling of seed size in plants. Phytohormones cytokinin and brassinosteroid were known to be involved in the regulation of herbaceous plant seed development. Here we identified a homolog of Auxin Response Factor 19 (JcARF19) from a woody plant Jatropha curcas and genetically demonstrated its functions in controlling seed size and seed yield. Through Virus Induced Gene Silencing (VIGS), we found that JcARF19 was a positive upstream modulator in auxin signaling and may control plant organ size in J. curcas. Importantly, transgenic overexpression of JcARF19 significantly increased seed size and seed yield in plants Arabidopsis thaliana and J. curcas, indicating the importance of auxin pathway in seed yield controlling in dicot plants. Transcripts analysis indicated that ectopic expression of JcARF19 in J. curcas upregulated auxin responsive genes encoding essential regulators in cell differentiation and cytoskeletal dynamics of seed development. Our data suggested the potential of improving seed traits by precisely engineering auxin signaling in woody perennial plants. PMID:28102350
Directory of Open Access Journals (Sweden)
Yu Hong
2007-02-01
Full Text Available Abstract Background Despite several effective treatment options available for prostate cancer, it remains the second leading cause of cancer death in American men. Thus, there is a great need for new treatments to improve outcomes. One such strategy is to eliminate cancer through the expression of cytotoxic genes specifically in prostate cells by gene therapy vectored delivery. To prevent systemic toxicity, tissue- and/or cancer-specific gene expression is required. However, the use of tissue- or cancer-specific promoters to target transgene expression has been hampered by their weak activity. Results To address this issue, we have developed a regulation strategy that includes feedback amplification of gene expression along with a differentially suppressible tetracycline regulated expression system (DiSTRES. By differentially suppressing expression of the tetracycline-regulated transcriptional activator (tTA and silencer (tTS genes based on the cell origin, this leads to the activation and silencing of the TRE promoter, respectively. In vitro transduction of LNCaP cells with Ad/GFPDiSTRES lead to GFP expression levels that were over 30-fold higher than Ad/CMV-GFP. Furthermore, Ad/FasL-GFPDiSTRES demonstrated cytotoxic effects in prostate cancer cells known to be resistant to Fas-mediated apoptosis. Conclusion Prostate-specific regulation from the DiSTRES system, therefore, serves as a promising new regulation strategy for future applications in the field of cancer gene therapy and gene therapy as a whole.
Directory of Open Access Journals (Sweden)
Zhaoxu Lu
Full Text Available Mercury (Hg is a well-recognized environmental pollutant known by its toxicity of development and neurotoxicity, which results in adverse health outcomes. However, the mechanisms underlying the teratogenic effects of Hg are not well understood. Imprinting genes are emerging regulators for fetal development subjecting to environmental pollutants impacts. In this study, we examined the association between preconceptional Hg exposure and the alteration of DNA methylation of imprinting genes H19, Meg3, and Peg3 in human sperm DNA.A total of 616 men, aged from 22 to 59, were recruited from Reproductive Medicine Clinic of Maternal and Child Care Service Center and the Urologic Surgery Clinic of Shanxi Academy of Medical Sciences during April 2015 and March 2016. Demographic information was collected through questionnaires. Urine was collected and urinary Hg concentrations were measured using a fully-automatic double-channel hydride generation atomic fluorescence spectrometer. Methylation of imprinting genes H19, Meg3 and Peg3 of sperm DNA from 242 participants were examined by bisulfite pyrosequencing. Spearman's rank and multivariate regression analysis were used for correlation analysis between sperm DNA methylation status of imprinting genes and urinary Hg levels.The median concentration of Hg for 616 participants was 9.14μg/l (IQR: 5.56-12.52 μg/l; ranging 0.16-71.35μg/l. A total of 42.7% of the participants are beyond normal level for non-occupational exposure according to the criterion of Hg poisoning (≥10 μg/L. Spearman's rank analysis indicated a negative correlation between urinary Hg concentrations and average DNA methylation levels of imprinted genes H19 (rs = -0.346, p <0.05, but there was no such a correlation for Peg3 and Meg3. Further, we analyzed the correlation between methylation level at individual CpG site of H19 and urinary Hg level. The results showed a negative correlation between urinary Hg concentrations and three out of
The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA
Directory of Open Access Journals (Sweden)
Logan M. Decker
2017-04-01
Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.
DEFF Research Database (Denmark)
Dupret, Katia
2018-01-01
static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...
Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla
2015-11-01
Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine
Tchoudakova, A; Kishida, M; Wood, E; Callard, G V
2001-11-01
Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b>a) and ovary (a>b) and have a different developmental program (b>a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5'-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene approximately 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) -30, two estrogen responsive elements (EREs; nt -351 and -211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at -286, which includes another ERE half-site. Also present were a sequence at nt -399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5'-flanking region ( approximately 1.0 kb) of the cyp19a gene had TATA (nt -48) and CAAT (nt -71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt -265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a>b) did not reflect expression in fish pituitary in vivo (b>a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30-48 h post-fertilization (hpf), most
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Laura Mejía-Teniente
2015-11-01
Full Text Available Germin-like proteins (GLPs are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Mejía-Teniente, Laura; Joaquin-Ramos, Ahuizolt de Jesús; Torres-Pacheco, Irineo; Rivera-Bustamante, Rafael F; Guevara-Olvera, Lorenzo; Rico-García, Enrique; Guevara-Gonzalez, Ramon G
2015-11-25
Germin-like proteins (GLPs) are encoded by a family of genes found in all plants, and in terms of function, the GLPs are implicated in the response of plants to biotic and abiotic stresses. CchGLP is a gene encoding a GLP identified in a geminivirus-resistant Capsicum chinense Jacq accession named BG-3821, and it is important in geminivirus resistance when transferred to susceptible tobacco in transgenic experiments. To characterize the role of this GLP in geminivirus resistance in the original accession from which this gene was identified, this work aimed at demonstrating the possible role of CchGLP in resistance to geminiviruses in Capsicum chinense Jacq. BG-3821. Virus-induced gene silencing studies using a geminiviral vector based in PHYVV component A, displaying that silencing of CchGLP in accession BG-3821, increased susceptibility to geminivirus single and mixed infections. These results suggested that CchGLP is an important factor for geminivirus resistance in C. chinense BG-3821 accession.
Genetically heterogeneous glioblastoma recurring with disappearance of 1p/19q losses: case report.
Ito, Motokazu; Wakabayashi, Toshihiko; Natsume, Atsushi; Hatano, Hisashi; Fujii, Masazumi; Yoshida, Jun
2007-07-01
Intratumor heterogeneity is of great importance in many clinical aspects of glioma biology, including tumor grading, therapeutic response, and recurrence. Modifications in the genetic features of a specific primary tumor recurring after chemo- and radiotherapy are poorly understood. We report a recurrent glioblastoma case exhibiting loss of heterozygosity (LOH) on chromosome 10q, while the primary tumor exhibited heterogeneity in the LOH status of 1p, 19q, and 10q. To determine the relationship between such modifications and heterogeneous chemosensitivity, primary cultured cells heterogeneously showing 1p/19q/10q losses were established from a surgical specimen of oligoastrocytoma and were treated with chemotherapeutic agents. A 46-year-old woman with a 1-month history of headache and visual disturbances presented to our institution. A right temporoparietal craniotomy and gross total resection were performed. The pathological diagnosis was glioblastoma multiforme with oligodendroglial components. Whereas LOH on 10q was identified at all tumor sites, only the oligodendroglial components exhibited LOH on 1p and 19q. The tumor recurred 6 months after postoperative chemotherapy using interferon-beta and ranimustine, as well as a course of fractionated external-beam radiotherapy (total dose, 60 Gy). Gene analysis revealed no 1p/19q allelic losses but only 10q LOH. Intratumor heterogeneity might be explained by the presence of more than one subclone in the primary tumor. Here, the tumor cells exhibiting 1p/19q LOH with high chemosensitivity might have been killed by the adjuvant therapy and those exhibiting 10q LOH with chemoresistance recurred. This study and our preliminary laboratory findings might suggest an approach to brain tumor physiology, diagnosis, and therapy.
Bazot, Quentin; Paschos, Kostas; Allday, Martin J
2018-04-01
Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This
Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo
2017-08-15
Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.
Dubois, A E J; Pagliarani, G; Brouwer, R M; Kollen, B J; Dragsted, L O; Eriksen, F D; Callesen, O; Gilissen, L J W J; Krens, F A; Visser, R G F; Smulders, M J M; Vlieg-Boerstra, B J; Flokstra-de Blok, B J; van de Weg, W E
2015-11-01
Genetic modification of allergenic foods such as apple has the potential to reduce their clinical allergenicity, but this has never been studied by oral challenges in allergic individuals. We performed oral food challenges in 21 apple-allergic individuals with Elstar apples which had undergone gene silencing of the major allergen of apple, Mal d 1, by RNA interference. Downregulation of Mal d 1 gene expression in the apples was verified by qRT-PCR. Clinical responses to the genetically modified apples were compared to those seen with the wild-type Elstar using a visual analogue scale (VAS). Gene silencing produced two genetically modified apple lines expressing Mal d 1.02 and other Mal d 1 gene mRNA levels which were extensively downregulated, that is only 0.1-16.4% (e-DR1) and 0.2-9.9% (e-DR2) of those of the wild-type Elstar, respectively. Challenges with these downregulated apple lines produced significantly less intense maximal symptoms to the first dose (Vmax1) than with Elstar (Vmax1 Elstar 3.0 mm vs 0.0 mm for e-DR1, P = 0.017 and 0.0 mm for e-DR2, P = 0.043), as well as significantly less intense mean symptoms per dose (meanV/d) than with Elstar (meanV/d Elstar 2.2 mm vs 0.2 mm for e-DR1, P = 0.017 and 0.0 mm for e-DR2, P = 0.043). Only one subject (5%) remained symptom-free when challenged with the Elstar apple, whereas 43% did so with e-DR1 and 63% with e-DR2. These data show that mRNA silencing of Mal d 1 results in a marked reduction of Mal d 1 gene expression in the fruit and reduction of symptoms when these apples are ingested by allergic subjects. Approximately half of the subjects developed no symptoms whatsoever, and virtually all subjects wished to consume the apple again in the future. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Castillo, Andres; Wang, Lu; Koriyama, Chihaya; Eizuru, Yoshito; Jordan, King; Akiba, Suminori
2014-10-01
Previous studies have reported the detection of a truncated E1 mRNA generated from HPV-18 in HeLa cells. Although it is unclear whether a truncated E1 protein could function as a replicative helicase for viral replication, it would still retain binding sites for potential interactions with different host cell proteins. Furthermore, in this study, we found evidence in support of expression of full-length HPV-18 E1 mRNA in HeLa cells. To determine whether interactions between E1 and cellular proteins play an important role in cellular processes other than viral replication, genome-wide expression profiles of HPV-18 positive HeLa cells were compared before and after the siRNA knockdown of E1 expression. Differential expression and gene set enrichment analysis uncovered four functionally related sets of genes implicated in host defence mechanisms against viral infection. These included the toll-like receptor, interferon and apoptosis pathways, along with the antiviral interferon-stimulated gene set. In addition, we found that the transcriptional coactivator E1A-binding protein p300 (EP300) was downregulated, which is interesting given that EP300 is thought to be required for the transcription of HPV-18 genes in HeLa cells. The observed changes in gene expression produced via the silencing of HPV-18 E1 expression in HeLa cells indicate that in addition to its well-known role in viral replication, the E1 protein may also play an important role in mitigating the host's ability to defend against viral infection.
Agbemabiese, Chantal Ama; Nakagomi, Toyoko; Gauchan, Punita; Sherchand, Jeevan Bahadur; Pandey, Basu Dev; Cunliffe, Nigel A; Nakagomi, Osamu
2017-10-01
A rare G26 Rotavirus A strain RVA/Human-wt/NPL/07N1760/2007/G26P[19] was detected in a child hospitalised for acute diarrhoea in Kathmandu, Nepal. The complete genome of 07N1760 was determined in order to explore its evolutionary history as well as examine its relationship to a Vietnamese strain RVA/Human-wt/VNM/30378/2009/G26P[19], the only G26 strain whose complete genotype constellation is known. The genotype constellation of 07N1760 was G26-P[19]-I12-R1-C1-M1-A8-N1-T1-E1-H1, a unique constellation identical to that of the Vietnamese 30378 except the VP6 gene. Phylogenetic analysis revealed that both strains were unrelated at the lineage level despite their similar genotype constellation. The I12 VP6 gene of 07N1760 was highly divergent from the six currently deposited I12 sequences in the GenBank. Except for its NSP2 gene, the remaining genes of 07N1760 shared lineages with porcine and porcine-like human RVA genes. The NSP2 gene belonged to a human RVA N1 lineage which was distinct from typical porcine and porcine-like human lineages. In conclusion, the Nepali G26P[19] strain 07N1760 was a porcine RVA strain which derived an NSP2 gene from a human Wa-like RVA strain by intra-genotype reassortment probably after transmission to the human host. Copyright © 2017 Elsevier B.V. All rights reserved.
Prader-Willi syndrome due to an unbalanced de novo translocation [t(15;19)(q12;p13.3)
Dang, Vy; Surampalli, Abhilasha; Manzardo, Ann M; Youn, Stephanie; Butler, Merlin G; Gold, June-Anne; Kimonis, Virginia
2018-01-01
Background and Aims Prader-Willi syndrome (PWS) is a complex, multisystem genetic disorder characterized by endocrine, neurologic and behavioral abnormalities. We report the first case of an unbalanced de-novo reciprocal translocation of chromosome 15 and 19: 45,XY,-15, der (19)t(15;19)(q12;p13.3) resulting in monosomy for the PWS chromosome critical region. We performed high resolution SNP microarray to characterize the breakpoints. Case report Our patient had several typical features for PWS including infantile hypotonia, a poor suck and feeding difficulties, tantrums, skin picking, compulsions, small hands and feet and food seeking but not hypopigmentation, a micropenis, cryptorchidism or obesity as common findings seen in PWS at the time of examination at 6 years of age. He had seizures noted from 1 to 3 years of age and marked cognitive delay. Results High resolution SNP microarray analysis identified an atypical PWS Type I deletion of chromosome 15 involving proximal breakpoint BP1. The deletion extended beyond the GABRB3 gene but was proximal to the usual distal breakpoint (BP3) within the 15q11-q13 region and GABRA5, GABRG3 and OCA2 genes were intact. Conclusion We report a case with atypical features for PWS associated with an unbalanced de-novo reciprocal translocation resulting in monosomy for the 15q11.1–15q12 with intact GABRA5, GABRG3 and OCA2 genes. No deletion of 19p13.3 band was detected therefore the patient was not at an increased risk of tumors from Peutz-Jeghers syndrome associated with a deletion of the STK11 gene. PMID:27894106
Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus
2018-05-01
Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Begeot, Flora; Koryakov, Dmitry E.; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion
2014-01-01
Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3–7 protein in Drosophila ovaries. We present evidences that Su(var)3–7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3–7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3–7 is required for genome integrity. Females homozygous for Su(var)3–7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3–7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3–7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3–7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3–7 and piwi or aubergine controls important developmental processes independently of transposon silencing. PMID:24820312
Marie Nimier, au cœur du silence
Directory of Open Access Journals (Sweden)
Joëlle Papillon
2012-01-01
Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Directory of Open Access Journals (Sweden)
Simona Kamenšek
2015-06-01
Full Text Available Colicins are plasmid-encoded narrow spectrum antibiotics that are synthesized by strains of Escherichia coli and govern intraspecies competition. In a previous report, we demonstrated that the global transcriptional factor IscR, co dependently with the master regulator of the DNA damage response, LexA, delays induction of the pore forming colicin genes after SOS induction. Here we show that IscR is not involved in the regulation of nuclease colicins, but that the AsnC protein is. We report that AsnC, in concert with LexA, is the key controller of the temporal induction of the DNA degrading colicin E8 gene (cea8, after DNA damage. We demonstrate that a large AsnC nucleosome-like structure, in conjunction with two LexA molecules, prevent cea8 transcription initiation and that AsnC binding activity is directly modulated by L asparagine. We show that L-asparagine is an environmental factor that has a marked impact on cea8 promoter regulation. Our results show that AsnC also modulates the expression of several other DNase and RNase colicin genes but does not substantially affect pore-forming colicin K gene expression. We propose that selection pressure has "chosen" highly conserved regulators to control colicin expression in E. coli strains, enabling similar colicin gene silencing among bacteria upon exchange of colicinogenic plasmids.
The mapping of novel genes to human chromosome 19
Energy Technology Data Exchange (ETDEWEB)
Buenaventura, J.M. [Sarah Lawrence College, Bronxville, NY (United States)
1994-12-01
The principle goal of our laboratory is the discovery of new genes on human chromosome 19. One of the strategies to achieve this goal is through the use of cDNA clones known as {open_quotes}expressed sequence tags{close_quotes} (ESTs). ESTs, short segments of sequence from a cDNA clone that correspond to the mRNA, occur as unique regions in the genome and, therefore, can be used as markers for specific positions. In collaboration with researchers from Genethon in France, fifteen cDNA clones from a normalized human infant brain cDNA library were tested and determined to map to chromosome 19. A verification procedure is then followed to confirm assignment to chromosome 19. First, primers for each cDNA clone are developed and then amplified by polymerase chain reaction from genomic DNA. Next, a {sup 32}P-radiolabeled probe is made by polymerase chain reaction for each clone and then hybridized against filters containing an LLNL chromosome 19-specific cosmid library to find putative locations on the chromosome. The location is then verified by running a polymerase chain reactions from the positive cosmids. With the Browser database at LLNL, additional information about the positive cosmids can be found. Through use of the BLAST database at the National Library of Medicine, homologous sequences to the clones can be found. Among the fifteen cDNA clones received from Genethon, all have been amplified by polymerase chain reaction. Three have turned out as repetitive elements in the genome. Ten have been mapped to specific locations on chromosome 19. Putative locations have been found for the remaining two clones and thus verification testing will proceed.
Directory of Open Access Journals (Sweden)
Ivyna Pau Ni Bong
2016-11-01
Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.
Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah
2016-01-01
Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828
International Nuclear Information System (INIS)
Sakitani, Kosuke; Hirata, Yoshihiro; Hikiba, Yohko; Hayakawa, Yoku; Ihara, Sozaburo; Suzuki, Hirobumi; Suzuki, Nobumi; Serizawa, Takako; Kinoshita, Hiroto; Sakamoto, Kei; Nakagawa, Hayato; Tateishi, Keisuke; Maeda, Shin; Ikenoue, Tsuneo; Kawazu, Shoji; Koike, Kazuhiko
2015-01-01
Although some molecularly targeted drugs for colorectal cancer are used clinically and contribute to a better prognosis, the current median survival of advanced colorectal cancer patients is not sufficient. Autophagy, a basic cell survival mechanism mediated by recycling of cellular amino acids, plays an important role in cancer. Recently, autophagy has been highlighted as a promising new molecular target. The unfolded protein response (UPR) reportedly act in complementary fashion with autophagy in intestinal homeostasis. However, the roles of UPR in colon cancer under autophagic inhibition remain to be elucidated. We aim to clarify the inhibitory effect of autophagy on colon cancer. We crossed K19 CreERT and Atg5 flox/flox mice to generate Atg5 flox/flox /K19 CreERT mice. Atg5 flox/flox /K19 CreERT mice were first treated with azoxymethane/dextran sodium sulfate and then injected with tamoxifen to inhibit autophagy in CK19-positive epithelial cells. To examine the anti-cancer mechanisms of autophagic inhibition, we used colon cancer cell lines harboring different p53 gene statuses, as well as small interfering RNAs (siRNAs) targeting Atg5 and immunoglobulin heavy-chain binding protein (BiP), a chaperone to aid folding of unfolded proteins. Colon tumors in Atg5 flox/flox /K19 CreERT mice showed loss of autophagic activity and decreased tumor size (the total tumor diameter was 28.1 mm in the control and 20.7 mm in Atg5 flox/flox /K19 CreERT mice, p = 0.036). We found that p53 and UPR/endoplasmic reticulum (ER) stress-related proteins, such as cleaved caspase 3, and CAAT/enhancer-binding protein homologous protein, are up-regulated in colon tumors of Atg5 flox/flox /K19 CreERT mice. Although Atg5 and BiP silencing, respectively, increased apoptosis in p53 wild type cells, Atg5 silencing alone did not show the same effect on apoptosis in p53 mutant cells. However, co-transfection of Atg5 and BiP siRNAs led to increased apoptosis in p53 mutant cells. Blocking autophagy
Directory of Open Access Journals (Sweden)
Liu X
2016-04-01
Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial
Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.
Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni
2015-12-02
Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Oishi, Motoi; Sumitani, Shogo; Nagasaki, Yukio; Bronich, Tatiana K.; Kabanov, Alexander V.; Boska, Michael D.
2009-01-01
The pH-responsive PEGylated nanogels composed of the cross-linked poly[2-(N,N-diethylamino)ethyl methacrylate]-co-poly(2,2,2-trifluoroethyl methacrylate) gel core showed a remarkable on-off regulation of 19 F magnetic resonance signal intensity (T 2 values) as well as signal-to-noise ratios in response to extracellular pH 6.5 of tumor environment under 19 F magnetic resonance spectroscopic imaging (MRS/I), demonstrating the utility of the PEGylated nanogels as solid tumor-specific 19 F MRI/S nanoprobes. (author)
International Nuclear Information System (INIS)
Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong
2005-01-01
Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K
2017-01-01
The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.
Directory of Open Access Journals (Sweden)
Anup K Kundu
Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.
Capasso, Stefania; Alessio, Nicola; Di Bernardo, Giovanni; Cipollaro, Marilena; Melone, Mariarosa Ab; Peluso, Gianfranco; Giordano, Antonio; Galderisi, Umberto
2014-01-01
Bone marrow adipose tissue (BMAT) is different from fat found elsewhere in the body, and only recently have some of its functions been investigated. BMAT may regulate bone marrow stem cell niche and plays a role in energy storage and thermogenesis. BMAT may be involved also in obesity and osteoporosis onset. Given the paramount functions of BMAT, we decided to better clarify the human bone marrow adipogenesis by analyzing the role of the retinoblastoma gene family, which are key players in cell cycle regulation. Our data provide evidence that the inactivation of RB1 or RB2/P130 in uncommitted bone marrow stromal cells (BMSC) facilitates the first steps of adipogenesis. In cultures with silenced RB1 or RB2/P130, we observed an increase of clones with adipogenic potential and a higher percentage of cells accumulating lipid droplets. Nevertheless, the absence of RB1 or RB2/P130 impaired the terminal adipocyte differentiation and gave rise to dysregulated adipose cells, with alteration in lipid uptake and release. For the first time, we evidenced that RB2/P130 plays a role in bone marrow adipogenesis. Our data suggest that while the inactivation of retinoblastoma proteins may delay the onset of last cell division and allow more BMSC to be committed to adipocyte, it did not allow a permanent cell cycle exit, which is a prerequisite for adipocyte terminal maturation.
Frequent epigenetic inactivation of Wnt antagonist genes in breast cancer
Suzuki, H; Toyota, M; Caraway, H; Gabrielson, E; Ohmura, T; Fujikane, T; Nishikawa, N; Sogabe, Y; Nojima, M; Sonoda, T; Mori, M; Hirata, K; Imai, K; Shinomura, Y; Baylin, S B; Tokino, T
2008-01-01
Although mutation of APC or CTNNB1 (β-catenin) is rare in breast cancer, activation of Wnt signalling is nonetheless thought to play an important role in breast tumorigenesis, and epigenetic silencing of Wnt antagonist genes, including the secreted frizzled-related protein (SFRP) and Dickkopf (DKK) families, has been observed in various tumours. In breast cancer, frequent methylation and silencing of SFRP1 was recently documented; however, altered expression of other Wnt antagonist genes is largely unknown. In the present study, we found frequent methylation of SFRP family genes in breast cancer cell lines (SFRP1, 7 out of 11, 64%; SFRP2, 11 out of 11, 100%; SFRP5, 10 out of 11, 91%) and primary breast tumours (SFRP1, 31 out of 78, 40%; SFRP2, 60 out of 78, 77%; SFRP5, 55 out of 78, 71%). We also observed methylation of DKK1, although less frequently, in cell lines (3 out of 11, 27%) and primary tumours (15 out of 78, 19%). Breast cancer cell lines express various Wnt ligands, and overexpression of SFRPs inhibited cancer cell growth. In addition, overexpression of a β-catenin mutant and depletion of SFRP1 using small interfering RNA synergistically upregulated transcriptional activity of T-cell factor/lymphocyte enhancer factor. Our results confirm the frequent methylation and silencing of Wnt antagonist genes in breast cancer, and suggest that their loss of function contributes to activation of Wnt signalling in breast carcinogenesis. PMID:18283316
A Tobacco rattle virus (TRV) based virus-induced gene silencing (VIGS) assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of Enoyl-CoA reductase (GhECR) in pathogen defense. Amino acid sequence al...
Directory of Open Access Journals (Sweden)
Olivier J Becherel
2013-04-01
Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.
DEFF Research Database (Denmark)
Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin
2012-01-01
to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...
DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.
Directory of Open Access Journals (Sweden)
Sizolwenkosi Mlotshwa
2008-03-01
Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.
"Listening Silence" and Its Discursive Effects
Applebaum, Barbara
2016-01-01
While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…
Directory of Open Access Journals (Sweden)
Yujing YIN
2017-12-01
Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.
Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter
2017-01-01
The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.
Identification and characterization of two RNA silencing suppressors encoded by ophioviruses
Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura
2017-01-01
<p>Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the
Directory of Open Access Journals (Sweden)
Vijayalakshmi H Nagaraj
Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.
Directory of Open Access Journals (Sweden)
Mahmoud Kandeel
Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.
Zhang, Changsong; Ling, Yang; Zhang, Chenghui; Xu, Yun; Gao, Lu; Li, Rong; Zhu, Jing; Fan, Lieying; Wei, Lixin
2012-01-01
Background: To evaluate the promoter methylation status of RECK gene and mRNA expression in patients with hepatocellular carcinoma (HCC). Methods: We analyzed RECK methylation by MSP, and RECK mRNA by real-time PCR in 74 HCC. The liver cell lines (7721, Chang and Hep-G2) were treated with 5-Aza-CdR and TSA. Results: RECK mRNA were lower in HCC tissues (Mean -∆Ct = -3.29) than that in Non-Hcc tissues (Mean -∆Ct = -2.42). Expression of RECK was elevated in only 24 (32.43%) of the 74 HCC patients but decreased (-∆∆Ct=0.5) (Mean -∆∆Ct = -1.75) than those with demethylation (∆MI<0.5) (Mean -∆∆Ct = 0.05), and there is a decreased tendency for RECK mRNA in HCC patients with promoter hypermethylation (p = 0.002). There was a significantly correlation found between RECK mRNA and poor survival after surgery. After treated by 5-Aza-CdR and TSA, we found that RECK mRNA induced different changes in 7721, Chang and Hep-G2 cells. And RECK demethylation also induced by epigenetic inhibitors. Conclusion: The results suggested that the hypermethylation may lead to promoter silencing of RECK mRNA and associated with poor survival in HCC. PMID:22419890
CSIR Research Space (South Africa)
Fossey, A
2009-06-01
Full Text Available in forestry breeding. Keywords Gene regulation; chromatin; histone code hyporthesis; RNA silencing; post transcriptional gene silencing; forestry. Introduction to epigenetic phenomena Most living organisms share a vast amount of genetic information... (Rapp and Wendel, 2005). Epigenetic phenomena pervade all aspects of cell proliferation and plant development and are often in conflict with Mendelian models of genetics (Grant-Downton and Dickinson, 2005). A key element in many epigenetic effects...
Directory of Open Access Journals (Sweden)
María José Benítez-Galeano
2015-07-01
Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.
Carcagno, Abel L; Marazita, Mariela C; Ogara, María F; Ceruti, Julieta M; Sonzogni, Silvina V; Scassa, María E; Giono, Luciana E; Cánepa, Eduardo T
2011-01-01
A central aspect of development and disease is the control of cell proliferation through regulation of the mitotic cycle. Cell cycle progression and directionality requires an appropriate balance of positive and negative regulators whose expression must fluctuate in a coordinated manner. p19INK4d, a member of the INK4 family of CDK inhibitors, has a unique feature that distinguishes it from the remaining INK4 and makes it a likely candidate for contributing to the directionality of the cell cycle. p19INK4d mRNA and protein levels accumulate periodically during the cell cycle under normal conditions, a feature reminiscent of cyclins. In this paper, we demonstrate that p19INK4d is transcriptionally regulated by E2F1 through two response elements present in the p19INK4d promoter. Ablation of this regulation reduced p19 levels and restricted its expression during the cell cycle, reflecting the contribution of a transcriptional effect of E2F1 on p19 periodicity. The induction of p19INK4d is delayed during the cell cycle compared to that of cyclin E, temporally separating the induction of these proliferative and antiproliferative target genes. Specific inhibition of the E2F1-p19INK4d pathway using triplex-forming oligonucleotides that block E2F1 binding on p19 promoter, stimulated cell proliferation and increased the fraction of cells in S phase. The results described here support a model of normal cell cycle progression in which, following phosphorylation of pRb, free E2F induces cyclin E, among other target genes. Once cyclinE/CDK2 takes over as the cell cycle driving kinase activity, the induction of p19 mediated by E2F1 leads to inhibition of the CDK4,6-containing complexes, bringing the G1 phase to an end. This regulatory mechanism constitutes a new negative feedback loop that terminates the G1 phase proliferative signal, contributing to the proper coordination of the cell cycle and provides an additional mechanism to limit E2F activity.
Directory of Open Access Journals (Sweden)
Abel L Carcagno
Full Text Available BACKGROUND: A central aspect of development and disease is the control of cell proliferation through regulation of the mitotic cycle. Cell cycle progression and directionality requires an appropriate balance of positive and negative regulators whose expression must fluctuate in a coordinated manner. p19INK4d, a member of the INK4 family of CDK inhibitors, has a unique feature that distinguishes it from the remaining INK4 and makes it a likely candidate for contributing to the directionality of the cell cycle. p19INK4d mRNA and protein levels accumulate periodically during the cell cycle under normal conditions, a feature reminiscent of cyclins. METHODOLOGY/PRINCIPAL FINDINGS: In this paper, we demonstrate that p19INK4d is transcriptionally regulated by E2F1 through two response elements present in the p19INK4d promoter. Ablation of this regulation reduced p19 levels and restricted its expression during the cell cycle, reflecting the contribution of a transcriptional effect of E2F1 on p19 periodicity. The induction of p19INK4d is delayed during the cell cycle compared to that of cyclin E, temporally separating the induction of these proliferative and antiproliferative target genes. Specific inhibition of the E2F1-p19INK4d pathway using triplex-forming oligonucleotides that block E2F1 binding on p19 promoter, stimulated cell proliferation and increased the fraction of cells in S phase. CONCLUSIONS/SIGNIFICANCE: The results described here support a model of normal cell cycle progression in which, following phosphorylation of pRb, free E2F induces cyclin E, among other target genes. Once cyclinE/CDK2 takes over as the cell cycle driving kinase activity, the induction of p19 mediated by E2F1 leads to inhibition of the CDK4,6-containing complexes, bringing the G1 phase to an end. This regulatory mechanism constitutes a new negative feedback loop that terminates the G1 phase proliferative signal, contributing to the proper coordination of the cell
E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.
Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2010-06-01
Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.
Directory of Open Access Journals (Sweden)
Papacchioli Velia
2006-06-01
Full Text Available Abstract Background Potato is a major staple food, and modification of its provitamin content is a possible means for alleviating nutritional deficiencies. beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein, antheraxanthin, violaxanthin, and of xanthophyll esters. None of these carotenoids have provitamin A activity. Results We silenced the first dedicated step in the beta-epsilon- branch of carotenoid biosynthesis, lycopene epsilon cyclase (LCY-e, by introducing, via Agrobacterium-mediated transformation, an antisense fragment of this gene under the control of the patatin promoter. Real Time measurements confirmed the tuber-specific silencing of Lcy-e. Antisense tubers showed significant increases in beta-beta-carotenoid levels, with beta-carotene showing the maximum increase (up to 14-fold. Total carotenoids increased up to 2.5-fold. These changes were not accompanied by a decrease in lutein, suggesting that LCY-e is not rate-limiting for lutein accumulation. Tuber-specific changes in expression of several genes in the pathway were observed. Conclusion The data suggest that epsilon-cyclization of lycopene is a key regulatory step in potato tuber carotenogenesis. Upon tuber-specific silencing of the corresponding gene, beta-beta-carotenoid and total carotenoid levels are increased, and expression of several other genes in the pathway is modified.
Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.
Directory of Open Access Journals (Sweden)
Huai-Juan Xiao
2014-05-01
Full Text Available Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.. The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF, and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper.
Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.
Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui
2014-01-01
Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Hinrichsen, Inga; Kemp, Matthias; Peveling-Oberhag, Jan; Passmann, Sandra; Plotz, Guido; Zeuzem, Stefan; Brieger, Angela
2014-01-01
Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC) specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV). However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR) genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16) in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Promoter methylation of MLH1, PMS2, MSH2 and p16 is a phenomenon of advanced-stage HCCs.
Directory of Open Access Journals (Sweden)
Inga Hinrichsen
Full Text Available Epigenetic silencing of tumour suppressor genes has been observed in various cancers. Looking at hepatocellular carcinoma (HCC specific protein silencing was previously demonstrated to be associated with the Hepatitis C virus (HCV. However, the proposed HCV dependent promoter methylation of DNA mismatch repair (MMR genes and thereby enhanced progression of hepatocarcinogenesis has been the subject of controversial discussion. We investigated promoter methylation pattern of the MMR genes MLH1, MSH2 and PMS2 as well as the cyclin-dependent kinase inhibitor 2A gene (p16 in 61 well characterized patients with HCCs associated with HCV, Hepatitis B virus infection or alcoholic liver disease. DNA was isolated from formalin-fixed, paraffin-embedded tumour and non-tumour adjacent tissue and analysed by methylation-specific PCR. Moreover, microsatellite analysis was performed in tissues showing methylation in MMR gene promoters. Our data demonstrated that promoter methylation of MLH1, MSH2, PMS2 and p16 is present among all considered HCCs. Hereby, promoter silencing was detectable more frequently in advanced-stage HCCs than in low-stage ones. However, there was no significant correlation between aberrant DNA methylation of MMR genes or p16 and HCV infection in related HCC specimens. In summary, we show that promoter methylation of essential MMR genes and p16 is detectable in HCCs most dominantly in pT3 stage tumour cases. Since loss of MMR proteins was previously described to be not only responsible for tumour development but also for chemotherapy resistance, the knowledge of mechanisms jointly responsible for HCC progression might enable significant improvement of individual HCC therapy in the future.
Cloning and functional analysis of succinate dehydrogenase gene PsSDHA in Phytophthora sojae.
Pan, Yuemin; Ye, Tao; Gao, Zhimou
2017-07-01
Succinate dehydrogenase (SDH) is one of the key enzymes of the tricarboxylic acid cycle (TCA cycle) and a proven target of fungicides for true fungi. To explore the roles of the SDHA gene in Phytophthora sojae, we first cloned PsSDHA to construct the PsSDHA silenced expression vector pHAM34-PsSDHA, and then utilized PEG to mediate the P. sojae protoplast transformation experiment. Through transformation screening, we obtained the silenced mutants A1 and A3, which have significant suppressive effect. Further study showed that the hyphae of the silenced mutant strains were shorter and more bifurcated; the growth of the silenced mutants was clearly inhibited in 10% V8 agar medium containing sodium chloride (NaCl), hydrogen peroxide (H 2 O 2 ) or Congo Red, respectively. The pathogenicity of the silenced mutants was significantly reduced compared with the wild-type strain and the mock. The results could help us better to understand the position and function of SDH in P. sojae and provide a proven target of fungicides for the oomycete. Copyright © 2017. Published by Elsevier Ltd.
Concurrent growth rate and transcript analyses reveal essential gene stringency in Escherichia coli.
Directory of Open Access Journals (Sweden)
Shan Goh
Full Text Available BACKGROUND: Genes essential for bacterial growth are of particular scientific interest. Many putative essential genes have been identified or predicted in several species, however, little is known about gene expression requirement stringency, which may be an important aspect of bacterial physiology and likely a determining factor in drug target development. METHODOLOGY/PRINCIPAL FINDINGS: Working from the premise that essential genes differ in absolute requirement for growth, we describe silencing of putative essential genes in E. coli to obtain a titration of declining growth rates and transcript levels by using antisense peptide nucleic acids (PNA and expressed antisense RNA. The relationship between mRNA decline and growth rate decline reflects the degree of essentiality, or stringency, of an essential gene, which is here defined by the minimum transcript level for a 50% reduction in growth rate (MTL(50. When applied to four growth essential genes, both RNA silencing methods resulted in MTL(50 values that reveal acpP as the most stringently required of the four genes examined, with ftsZ the next most stringently required. The established antibacterial targets murA and fabI were less stringently required. CONCLUSIONS: RNA silencing can reveal stringent requirements for gene expression with respect to growth. This method may be used to validate existing essential genes and to quantify drug target requirement.
Naumenko, V S; Osipova, D V; Tsybko, A S
2010-01-01
Selective 5-HT(1A) receptor silencer (Freud-1) is known to be one of the main factors for transcriptional regulation of brain serotonin 5-HT(1A) receptor. However, there is a lack of data on implication of Freud-1 in the mechanisms underlying genetically determined and experimentally altered 5-HT(1A) receptor system state in vivo. In the present study we have found a difference in the 5-HT(1A) gene expression in the midbrain of AKR and CBA inbred mouse strains. At the same time no distinction in Freud-1 expression was observed. We have revealed 90.3% of homology between mouse and rat 5-HT(1A) receptor DRE-element, whereas there was no difference in DRE-element sequence between AKR and CBA mice. This indicates the absence of differences in Freud-1 binding site in these mouse strains. In the model of 5-HT(1A) receptor desensitization produced by chronic 5-HT(1A) receptor agonist administration, a significant reduction of 5-HT(1A) receptor gene expression together with considerable increase of Freud-1 expression were found. These data allow us to conclude that the selective silencer of 5-HT(1A) receptor, Freud-1, is involved in the compensatory mechanisms that modulate the functional state of brain serotonin system, although it is not the only factor for 5-HT(1A) receptor transcriptional regulation.
Visceral adipose tissue macrophage-targeted TACE silencing to treat obesity-induced type 2 diabetes.
Yong, Seok-Beom; Song, Yoonsung; Kim, Yong-Hee
2017-12-01
Obesity is an increasingly prevalent global health problem. Due to its close relations with metabolic diseases and cancer, new therapeutic approaches for treating obesity and obesity-induced metabolic diseases are required. Visceral white adipose tissue (WAT) has been closely associated with obesity-induced inflammation and adipose tissue macrophages (ATMs) are responsible for obesity-induced inflammation by releasing inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6. TNF-α converting enzyme (TACE) is a transmembrane enzyme that induces the enzymatic cleavage and release of inflammatory cytokines. In this study, we developed a nonviral gene delivery system consisting of an oligopeptide (ATS-9R) that can selectively target visceral ATMs. In here we shows visceral adipose tissue-dominant inflammatory gene over-expressions in obese mouse and our strategy enabled the preferential delivery of therapeutic genes to visceral ATMs and successfully achieved ATM-targeted gene silencing. Finally, ATS-9R-mediated TACE gene silencing in visceral ATMs alleviated visceral fat inflammation and improved type 2 diabetes by reducing whole body inflammation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Pizzichini Daniele
2007-03-01
Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.
Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.
Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N
2018-02-01
Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Bardhan, Kankana; Paschall, Amy V; Yang, Dafeng; Chen, May R; Simon, Priscilla S; Bhutia, Yangzom D; Martin, Pamela M; Thangaraju, Muthusamy; Browning, Darren D; Ganapathy, Vadivel; Heaton, Christopher M; Gu, Keni; Lee, Jeffrey R; Liu, Kebin
2015-07-01
Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A have been the subject of extensive studies; however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wild-type mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoter to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoter to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer, and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. ©2015 American Association for Cancer Research.
Bardhan, Kankana; Paschall, Amy V.; Yang, Dafeng; Chen, May R.; Simon, Priscilla S.; Bhutia, Yangzom; Martin, Pamela M.; Thangaraju, Muthusamy; Browning, Darren D.; Ganapathy, Vadivel; Heaton, Christopher M.; Gu, Keni; Lee, Jeffrey R.; Liu, Kebin
2015-01-01
Short-chain fatty acids, metabolites produced by colonic microbiota from fermentation of dietary fiber, act as anti-inflammatory agents in the intestinal tract to suppress proinflammatory diseases. GPR109A is the receptor for short-chain fatty acids. The functions of GPR109A has been the subject of extensive studies, however, the molecular mechanisms underlying GPR109A expression is largely unknown. We show that GPR109A is highly expressed in normal human colon tissues, but is silenced in human colon carcinoma cells. The GPR109A promoter DNA is methylated in human colon carcinoma. Strikingly, we observed that IFNγ, a cytokine secreted by activated T cells, activates GPR109A transcription without altering its promoter DNA methylation. Colon carcinoma grows significantly faster in IFNγ-deficient mice than in wildtype mice in an orthotopic colon cancer mouse model. A positive correlation was observed between GPR109A protein level and tumor-infiltrating T cells in human colon carcinoma specimens, and IFNγ expression level is higher in human colon carcinoma tissues than in normal colon tissues. We further demonstrated that IFNγ rapidly activates pSTAT1 that binds to the promoter of p300 to activate its transcription. p300 then binds to the GPR109A promoters to induce H3K18 hyperacetylation, resulting in chromatin remodeling in the methylated GPR109A promoter. The IFNγ-activated pSTAT1 then directly binds to the methylated but hyperacetylated GPR109 promoters to activate its transcription. Overall, our data indicate that GPR109A acts as a tumor suppressor in colon cancer and the host immune system might use IFNγ to counteract DNA methylation-mediated GPR109A silencing as a mechanism to suppress tumor development. PMID:25735954
Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit
2009-08-01
Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.
Yamaguti, Paulo Marcio; Neves, Francisco de Assis Rocha; Hotton, Dominique; Bardet, Claire; de La Dure-Molla, Muriel; Castro, Luiz Claudio; Scher, Maria do Carmo; Barbosa, Maristela Estevão; Ditsch, Christophe; Fricain, Jean-Christophe; de La Faille, Renaud; Figueres, Marie-Lucile; Vargas-Poussou, Rosa; Houillier, Pascal; Chaussain, Catherine; Babajko, Sylvie; Berdal, Ariane; Acevedo, Ana Carolina
2017-01-01
Amelogenesis imperfecta (AI) is a group of genetic diseases characterised by tooth enamel defects. AI was recently described in patients with familial hypercalciuria and hypomagnesaemia with nephrocalcinosis (FHHNC) caused by CLDN16 mutations. In the kidney, claudin-16 interacts with claudin-19 to control the paracellular passage of calcium and magnesium. FHHNC can be linked to mutations in both genes. Claudin-16 was shown to be expressed during amelogenesis; however, no data are available on claudin-19. Moreover, the enamel phenotype of patients with CLDN19 mutations has never been described. In this study, we describe the clinical and genetic features of nine patients with FHHNC carrying CLDN19 mutations and the claudin-19 expression profile in rat ameloblasts. Six FHHNC Brazilian patients were subjected to mutational analysis. Three additional French patients were recruited for orodental characterisation. The expression profile of claudin-19 was evaluated by RT-qPCR and immunofluorescence using enamel epithelium from rat incisors. All patients presented AI at different degrees of severity. Two new likely pathogenic variations in CLDN19 were found: p.Arg200Gln and p.Leu90Arg. RT-qPCR revealed low Cldn19 expression in ameloblasts. Confocal analysis indicated that claudin-19 was immunolocalised at the distal poles of secretory and maturing ameloblasts. For the first time, it was demonstrated that AI is associated with FHHNC in patients carrying CLDN19 mutations. The data suggest claudin-19 as an additional determinant in enamel formation. Indeed, the coexistence of hypoplastic and hypomineralised AI in the patients was consistent with claudin-19 expression in both secretory and maturation stages. Additional indirect systemic effects cannot be excluded. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
Directory of Open Access Journals (Sweden)
Leopold F Fröhlich
Full Text Available The lack of knowledge about molecular pathology of uterine sarcomas with a representation of 3-7% of all malignant uterine tumors prevents the establishment of effective therapy protocols. Here, we explored advanced therapeutic options to the previously discovered antitumorigenic effects of the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA by combined treatment with the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL/Apo-2L. In addition, we investigated the uterine sarcoma cell lines, MES-SA and ESS-1, regarding the underlying molecular mechanisms of SAHA and TRAIL-induced apoptosis and their resistance towards TRAIL. Compared to single SAHA or TRAIL treatment, the combination of SAHA with TRAIL led to complete cell death of both tumor cell lines after 24 to 48 hours. In contrast to single SAHA treatment, apoptosis occured faster and was more pronounced in ESS-1 cells than in MES-SA cells. Induction of SAHA- and TRAIL-induced apoptosis was accompanied by upregulation of the intrinsic apoptotic pathway via reduction of mitochondrial membrane potential, caspase-3, -6, and -7 activation, and PARP cleavage, but was also found to be partially caspase-independent. Apoptosis resistance was caused by reduced expression of caspase-8 and DR 4/TRAIL-R1 in ESS-1 and MES-SA cells, respectively, due to epigenetic silencing by DNA hypermethylation of gene promoter sequences. Treatment with the demethylating agent 5-Aza-2'-deoxycytidine or gene transfer therefore restored gene expression and increased the sensitivity of both cell lines against TRAIL-induced apoptosis. Our data provide evidence that deregulation of epigenetic silencing by histone acetylation and DNA hypermethylation might play a fundamental role in the origin of uterine sarcomas. Therefore, tumor growth might be efficiently overcome by a cytotoxic combinatorial treatment of HDAC inhibitors with TRAIL.
Indian Academy of Sciences (India)
Srimath
a gene in the opposite orientation in a cultured plant cell line and observed that the ..... started emerging in early 1990s from the work carried out by the. It is believed that ... cause human diseases such as cervical cancer, hepatitis, measles.
Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T
2016-02-24
There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.
Directory of Open Access Journals (Sweden)
Minami Mazda
Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.
Liu, Yanling; Zhang, Yujuan; Zheng, Xiufen; Zhang, Xusheng; Wang, Hongmei; Li, Qin; Yuan, Keng; Zhou, Nanjing; Yu, Yanrong; Song, Na; Fu, Jiamin; Min, Weiping
2016-05-31
Indoleamine 2,3-dioxygenase 2 (IDO2) is a newly discovered enzyme that catalyzes the initial and rate-limiting step in the degradation of tryptophan. As a homologous protein of IDO1, IDO2 plays an inhibitory role in T cell proliferation, and it is essential for regulatory T cell (Treg) generation in healthy conditions. Little is known about the immune-independent functions of IDO2 relevant to its specific contributions to physiology and pathophysiology in cancer cells. The purpose of this study was to assess the impact of IDO2 gene silencing as a way to inhibit B16-BL6 cancer cells in a murine model. Here, for the first time, we show that knockdown of IDO2 using small interfering RNA (siRNA) inhibits cancer cell proliferation, arrests cell cycle in G1, induces greater cell apoptosis, and reduces cell migration in vitro. Knockdown of IDO2 decreased the generation of nicotinamide adenine dinucleotide (NAD+) while increasing the generation of reactive oxygen species (ROS). We further demonstrate that cell apoptosis, induced by IDO2 downregulation, can be weakened by addition of exogenous NAD+, suggesting a novel mechanism by which IDO2 promotes tumor growth through its metabolite product NAD+. In addition to in vitro findings, we also demonstrate that IDO2 silencing in tumor cells using short hairpin RNA (shRNA) delayed tumor formation and arrested tumor growth in vivo. In conclusion, this study demonstrates a new non-immune-associated mechanism of IDO2 in vitro and IDO2 expression in B16-BL6 cells contributes to cancer development and progression. Our research provides evidence of a novel target for gene silencing that has the potential to enhance cancer therapy.
Directory of Open Access Journals (Sweden)
Satoru Noguchi
2014-01-01
Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
Directory of Open Access Journals (Sweden)
Luciano Marcondes Godoy
1999-01-01
Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.
Voice and silence in organizations
Directory of Open Access Journals (Sweden)
Moaşa, H.
2011-01-01
Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.
Ge, Lin-Quan; Jiang, Yi-Ping; Xia, Ting; Song, Qi-Sheng; Stanley, David; Kuai, Peng; Lu, Xiu-Li; Yang, Guo-Qing; Wu, Jin-Cai
2015-07-17
The brown planthopper (BPH), Nilaparvata lugens, sugar transporter gene 6 (Nlst6) is a facilitative glucose/fructose transporter (often called a passive carrier) expressed in midgut that mediates sugar transport from the midgut lumen to hemolymph. The influence of down regulating expression of sugar transporter genes on insect growth, development, and fecundity is unknown. Nonetheless, it is reasonable to suspect that transporter-mediated uptake of dietary sugar is essential to the biology of phloem-feeding insects. Based on this reasoning, we posed the hypothesis that silencing, or reducing expression, of a BPH sugar transporter gene would be deleterious to the insects. To test our hypothesis, we examined the effects of Nlst6 knockdown on BPH biology. Reducing expression of Nlst6 led to profound effects on BPHs. It significantly prolonged the pre-oviposition period, shortened the oviposition period, decreased the number of eggs deposited and reduced body weight, compared to controls. Nlst6 knockdown also significantly decreased fat body and ovarian (particularly vitellogenin) protein content as well as vitellogenin gene expression. Experimental BPHs accumulated less fat body glucose compared to controls. We infer that Nlst6 acts in BPH growth and fecundity, and has potential as a novel target gene for control of phloem-feeding pest insects.
Small silencing RNAs: an expanding universe.
Ghildiyal, Megha; Zamore, Phillip D
2009-02-01
Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.
The Ebola virus VP35 protein is a suppressor of RNA silencing
Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.
2007-01-01
RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is
Regulation of the activity of the promoter of RNA-induced silencing, C3PO.
Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne
2017-09-01
RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.
LENUS (Irish Health Repository)
Murphy, Therese M
2011-01-01
Aberrant DNA methylation has been implicated as a key survival mechanism in cancer, whereby promoter hypermethylation silences genes essential for many cellular processes including apoptosis. Limited data is available on the methylation profile of apoptotic genes in prostate cancer (CaP). The aim of this study was to profile methylation of apoptotic-related genes in CaP using denaturing high performance liquid chromatography (DHPLC).
Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.
Bandaranayake, Pradeepa C G; Yoder, John I
2013-05-01
Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene
International Nuclear Information System (INIS)
Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S
2010-01-01
Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials
File list: Unc.PSC.50.AllAg.P19 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Unc.PSC.50.AllAg.P19 mm9 Unclassified Pluripotent stem cell P19 SRX1098121,SRX10981...20,SRX1098122,SRX1098124,SRX1098123,SRX1098125 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.PSC.50.AllAg.P19.bed ...
File list: Unc.PSC.05.AllAg.P19 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Unc.PSC.05.AllAg.P19 mm9 Unclassified Pluripotent stem cell P19 SRX1098120,SRX10981...23,SRX1098121,SRX1098122,SRX1098125,SRX1098124 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.PSC.05.AllAg.P19.bed ...
File list: Unc.PSC.20.AllAg.P19 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Unc.PSC.20.AllAg.P19 mm9 Unclassified Pluripotent stem cell P19 SRX1098121,SRX10981...20,SRX1098123,SRX1098122,SRX1098124,SRX1098125 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.PSC.20.AllAg.P19.bed ...
File list: Unc.PSC.10.AllAg.P19 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Unc.PSC.10.AllAg.P19 mm9 Unclassified Pluripotent stem cell P19 SRX1098120,SRX10981...21,SRX1098122,SRX1098124,SRX1098123,SRX1098125 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/assembled/Unc.PSC.10.AllAg.P19.bed ...
Directory of Open Access Journals (Sweden)
Mehdi Aghamohammadi
2017-04-01
Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.
Gonzalez-Rodriguez, Pablo; Cantu, Jessica; O'Neil, Derek; Seferovic, Maxim D; Goodspeed, Danielle M; Suter, Melissa A; Aagaard, Kjersti M
2016-05-01
The H19/IGF2 imprinted loci have attracted recent attention because of their role in cellular differentiation and proliferation, heritable gene regulation, and in utero or early postnatal growth and development. Expression from the imprinted H19/IGF2 locus involves a complex interplay of 3 means of epigenetic regulation: proper establishment of DNA methylation, promoter occupancy of CTCF, and expression of microRNA-675. We have demonstrated previously in a multigenerational rat model of intrauterine growth restriction the epigenetic heritability of adult metabolic syndrome in a F2 generation. We have further demonstrated abrogation of the F2 adult metabolic syndrome phenotype with essential nutrient supplementation of intermediates along the 1-carbon pathway and shown that alterations in the metabolome precede the adult onset of metabolic syndrome. The upstream molecular and epigenomic mediators underlying these observations, however, have yet to be elucidated fully. In the current study, we sought to characterize the impact of the intrauterine growth-restricted lineage and essential nutrient supplementation on both levels and molecular mediators of H19 and IGF2 gene expression in the F2 generation. F2 intrauterine growth-restricted and sham lineages were obtained by exposing P1 (grandmaternal) pregnant dams to bilateral uterine artery ligation or sham surgery at gestational day 19.5. F1 pups were allocated to the essential nutrient supplemented or control diet at postnatal day 21, and bred at 6-7 weeks of age. Hepatic tissues from the resultant F2 offspring at birth and at weaning (day 21) were obtained. Bisulfite modification and sequencing was employed for methylation analysis. H19 and IGF2 expression was measured by quantitative polymerase chain reaction. Promoter occupancy was quantified by the use of chromatin immunoprecipitation, or ChIP, against CTCF insulator proteins. Growth-restricted F2 on control diet demonstrated significant down-regulation in H19
Gong, Youhui; Li, Ting; Zhang, Lee; Gao, Xiwu; Liu, Nannan
2013-01-01
The expression of some insect P450 genes can be induced by both exogenous and endogenous compounds and there is evidence to suggest that multiple constitutively overexpressed P450 genes are co-responsible for the development of resistance to permethrin in resistant mosquitoes. This study characterized the permethrin induction profiles of P450 genes known to be constitutively overexpressed in resistant mosquitoes, Culex quinquefasciatus. The gene expression in 7 of the 19 P450 genes CYP325K3v1, CYP4D42v2, CYP9J45, (CYP) CPIJ000926, CYP325G4, CYP4C38, CYP4H40 in the HAmCqG8 strain, increased more than 2-fold after exposure to permethrin at an LC50 concentration (10 ppm) compared to their acetone treated counterpart; no significant differences in the expression of these P450 genes in susceptible S-Lab mosquitoes were observed after permethrin treatment. Eleven of the fourteen P450 genes overexpressed in the MAmCqG6 strain, CYP9M10, CYP6Z12, CYP9J33, CYP9J43, CYP9J34, CYP306A1, CYP6Z15, CYP9J45, CYPPAL1, CYP4C52v1, CYP9J39, were also induced more than doubled after exposure to an LC50 (0.7 ppm) dose of permethrin. No significant induction in P450 gene expression was observed in the susceptible S-Lab mosquitoes after permethrin treatment except for CYP6Z15 and CYP9J39, suggesting that permethrin induction of these two P450 genes are common to both susceptible and resistant mosquitoes while the induction of the others are specific to insecticide resistant mosquitoes. These results demonstrate that multiple P450 genes are co-up-regulated in insecticide resistant mosquitoes through both constitutive overexpression and induction mechanisms, providing additional support for their involvement in the detoxification of insecticides and the development of insecticide resistance.
Han, Jeonghoon; Kim, Duck-Hyun; Kim, Hui-Su; Nelson, David R; Lee, Jae-Seong
2017-09-01
Cytochrome P450s (CYPs) are enzymes with a heme-binding domain that are found in all living organisms. CYP enzymes have important roles associated with detoxification of xenobiotics and endogenous compounds (e.g. steroids, fatty acids, and hormones). Although CYP enzymes have been reported in several invertebrates, including insects, little is known about copepod CYPs. Here, we identified the entire repertoire of CYP genes (n=52) from whole genome and transcriptome sequences of the benthic copepod Tigriopus japonicus, including a tandem duplication (CYP3026A3, CYP3026A4, CYP3026A5), and examined patterns of gene expression over various developmental stages and in response to benzo[α]pyrene (B[α]P) exposure. Through phylogenetic analysis, the 52 T. japonicus CYP genes were assigned to five distinct clans: CYP2 (22 genes), CYP3 (19 genes), CYP4 (two genes), CYP20 (one gene), and mitochondrial (eight genes). Developmental stage and gender-specific expression patterns of the 52 T. japonicus CYPs were analyzed. CYP3022A1 was constitutively expressed during all developmental stages. CYP genes in clans 2 and 3 were induced in response to B[α]P, suggesting that these differentially modulated CYP transcripts are likely involved in defense against exposure to B[α]P and other pollutants. This study enhances our understanding of the repertoire of CYP genes in copepods and of their potential role in development and detoxification in copepods. Copyright © 2017 Elsevier Inc. All rights reserved.
Ombuds’ corner: Employee silence
Vincent Vuillemin
2013-01-01
Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct. For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...
Chen, J W; Wang, L; Pang, X F; Pan, Q H
2006-04-01
Genetic analysis and fine mapping of a resistance gene against brown planthopper (BPH) biotype 2 in rice was performed using two F(2) populations derived from two crosses between a resistant indica cultivar (cv.), AS20-1, and two susceptible japonica cvs., Aichi Asahi and Lijiangxintuanheigu. Insect resistance was evaluated using F(1) plants and the two F(2) populations. The results showed that a single recessive gene, tentatively designated as bph19(t), conditioned the resistance in AS20-1. A linkage analysis, mainly employing microsatellite markers, was carried out in the two F(2) populations through bulked segregant analysis and recessive class analysis (RCA), in combination with bioinformatics analysis (BIA). The resistance gene locus bph19(t) was finely mapped to a region of about 1.0 cM on the short arm of chromosome 3, flanked by markers RM6308 and RM3134, where one known marker RM1022, and four new markers, b1, b2, b3 and b4, developed in the present study were co-segregating with the locus. To physically map this locus, the bph19(t)-linked markers were landed on bacterial artificial chromosome or P1 artificial chromosome clones of the reference cv., Nipponbare, released by the International Rice Genome Sequencing Project. Sequence information of these clones was used to construct a physical map of the bph19(t) locus, in silico, by BIA. The bph19(t) locus was physically defined to an interval of about 60 kb. The detailed genetic and physical maps of the bph19(t) locus will facilitate marker-assisted gene pyramiding and cloning.
Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu
2008-08-01
The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Directory of Open Access Journals (Sweden)
Neeraj K. Dubey
2017-09-01
Full Text Available RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp. are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma: transient expression using Tobacco rattle virus (TRV:pma as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill. plants harboring a hairpin construct (pBINPLUS35:pma. siRNA-mediated transgene-silencing (20–24 nt was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes.
Directory of Open Access Journals (Sweden)
Thomas Wurster
Full Text Available BACKGROUND: Human Parvovirus B19 (PVB19 has been associated with myocarditis putative due to endothelial infection. Whether PVB19 infects endothelial cells and causes a modification of endothelial function and inflammation and, thus, disturbance of microcirculation has not been elucidated and could not be visualized so far. METHODS AND FINDINGS: To examine the PVB19-induced endothelial modification, we used green fluorescent protein (GFP color reporter gene in the non-structural segment 1 (NS1 of PVB19. NS1-GFP-PVB19 or GFP plasmid as control were transfected in an endothelial-like cell line (ECV304. The endothelial surface expression of intercellular-adhesion molecule-1 (CD54/ICAM-1 and extracellular matrix metalloproteinase inducer (EMMPRIN/CD147 were evaluated by flow cytometry after NS-1-GFP or control-GFP transfection. To evaluate platelet adhesion on NS-1 transfected ECs, we performed a dynamic adhesion assay (flow chamber. NS-1 transfection causes endothelial activation and enhanced expression of ICAM-1 (CD54: mean ± standard deviation: NS1-GFP vs. control-GFP: 85.3 ± 11.2 vs. 61.6 ± 8.1; P<0.05 and induces endothelial expression of EMMPRIN/CD147 (CD147: mean ± SEM: NS1-GFP vs. control-GFP: 114 ± 15.3 vs. 80 ± 0.91; P<0.05 compared to control-GFP transfected cells. Dynamic adhesion assays showed that adhesion of platelets is significantly enhanced on NS1 transfected ECs when compared to control-GFP (P<0.05. The transfection of ECs was verified simultaneously through flow cytometry, immunofluorescence microscopy and polymerase chain reaction (PCR analysis. CONCLUSIONS: GFP color reporter gene shows transfection of ECs and may help to visualize NS1-PVB19 induced endothelial activation and platelet adhesion as well as an enhanced monocyte adhesion directly, providing in vitro evidence of possible microcirculatory dysfunction in PVB19-induced myocarditis and, thus, myocardial tissue damage.
Directory of Open Access Journals (Sweden)
Ruilin Wang
Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.
Millenson, Michael L
2003-01-01
Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.
Suppression of Arabidopsis genes by terminator-less transgene constructs
Transgene-mediated gene silencing is an important biotechnological and research tool. There are several RNAi-mediated techniques available for silencing genes in plants. The basis of all these techniques is to generate double stranded RNA precursors in the cell, which are recognized by the cellula...
Matarazzo, Valery; Muscatelli, Françoise
2013-01-01
Genomic imprinting is a normal process of epigenetic regulation leading some autosomal genes to be expressed from one parental allele only, the other parental allele being silenced. The reasons why this mechanism has been selected throughout evolution are not clear; however, expression dosage is critical for imprinted genes. There is a paradox between the fact that genomic imprinting is a robust mechanism controlling the expression of specific genes and the fact that this mechanism is based on epigenetic regulation that, per se, should present some flexibility. The robustness has been well studied, revealing the epigenetic modifications at the imprinted locus, but the flexibility has been poorly investigated. Prader-Willi syndrome is the best-studied disease involving imprinted genes caused by the absence of expression of paternally inherited alleles of genes located in the human 15q11-q13 region. Until now, the silencing of the maternally inherited alleles was like a dogma. Rieusset et al. showed that in absence of the paternal Ndn allele, in Ndn +m/-p mice, the maternal Ndn allele is expressed at an extremely low level with a high degree of non-genetic heterogeneity. In about 50% of these mutant mice, this stochastic expression reduces birth lethality and severity of the breathing deficiency, correlated with a reduction in the loss of serotonergic neurons. Furthermore, using several mouse models, they reveal a competition between non-imprinted Ndn promoters, which results in monoallelic (paternal or maternal) Ndn expression, suggesting that Ndn monoallelic expression occurs in the absence of imprinting regulation. Importantly, specific expression of the maternal NDN allele is also detected in post-mortem brain samples of PWS individuals. Here, similar expression of the Magel2 maternal allele is reported in Magel2 +m/-p mice, suggesting that this loss of imprinting can be extended to other PWS genes. These data reveal an unexpected epigenetic flexibility of PWS
Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.
Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand
2011-05-01
There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.
Beutin, Lothar; Delannoy, Sabine
2015-01-01
Enterohemorrhagic Escherichia coli (EHEC) O121:H19 belong to a specific clonal type distinct from other classical EHEC and major enteropathogenic E. coli groups and is regarded as one of the major EHEC serogroups involved in severe infections in humans. Sequencing of the fliC genes associated with the flagellar antigen H19 (fliCH19) revealed the genetic diversity of the fliCH19 gene sequences in E. coli. A cluster analysis of 12 fliCH19 sequences, 4 from O121 and 8 from non-O121 E. coli strains, revealed five different genotypes. All O121:H19 strains fell into one cluster, whereas a second cluster was formed by five non-O121:H19 strains. Cluster 1 and cluster 2 strains differ by 27 single nucleotide exchanges in their fliCH19 genes (98.5% homology). Based on allele discrimination of the fliCH19 genes, a real-time PCR test was designed for specific identification of EHEC O121:H19. The O121 fliCH19 PCR tested negative in 73 E. coli H19 strains that belonged to serogroups other than O121, including 28 different O groups, O-nontypeable H19, and O-rough:H19 strains. The O121 fliCH19 PCR reacted with all 16 tested O121:H19 strains and 1 O-rough:H19 strain which was positive for the O121 wzx gene. A cross-reaction was observed only with E. coli H32 strains which share sequence similarities in the target region of the O121 fliCH19 PCR. The combined use of O-antigen genotyping (O121 wzx) and the detection of O121 fliCH19 allele type contributes to improving the identification and molecular serotyping of EHEC O121:H19 motile and nonmotile strains and variants of these strains lacking stx genes. PMID:25862232
Renouard, Sullivan; Tribalatc, Marie-Aude; Lamblin, Frederic; Mongelard, Gaëlle; Fliniaux, Ophélie; Corbin, Cyrielle; Marosevic, Djurdjica; Pilard, Serge; Demailly, Hervé; Gutierrez, Laurent; Hano, Christophe; Mesnard, François; Lainé, Eric
2014-09-15
RNAi technology was applied to down regulate LuPLR1 gene expression in flax (Linum usitatissimum L.) seeds. This gene encodes a pinoresinol lariciresinol reductase responsible for the synthesis of (+)-secoisolariciresinol diglucoside (SDG), the major lignan accumulated in the seed coat. If flax lignans biological properties and health benefits are well documented their roles in planta remain unclear. This loss of function strategy was developed to better understand the implication of the PLR1 enzyme in the lignan biosynthetic pathway and to provide new insights on the functions of these compounds. RNAi plants generated exhibited LuPLR1 gene silencing as demonstrated by quantitative RT-PCR experiments and the failed to accumulate SDG. The accumulation of pinoresinol the substrate of the PLR1 enzyme under its diglucosylated form (PDG) was increased in transgenic seeds but did not compensate the overall loss of SDG. The monolignol flux was also deviated through the synthesis of 8-5' linked neolignans dehydrodiconiferyl alcohol glucoside (DCG) and dihydro-dehydrodiconiferyl alcohol glucoside (DDCG) which were observed for the first time in flax seeds. Copyright © 2014 Elsevier GmbH. All rights reserved.
Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching
2013-06-01
The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nicoletta Marchesi
2018-01-01
Full Text Available RNA-binding protein dysregulation and altered expression of proteins involved in the autophagy/proteasome pathway play a role in many neurodegenerative disease onset/progression, including age-related macular degeneration (AMD. HuR/ELAVL1 is a master regulator of gene expression in human physiopathology. In ARPE-19 cells exposed to the proteasomal inhibitor MG132, HuR positively affects at posttranscriptional level p62 expression, a stress response gene involved in protein aggregate clearance with a role in AMD. Here, we studied the early effects of the proautophagy AICAR + MG132 cotreatment on the HuR-p62 pathway. We treated ARPE-19 cells with Erk1/2, AMPK, p38MAPK, PKC, and JNK kinase inhibitors in the presence of AICAR + MG132 and evaluated HuR localization/phosphorylation and p62 expression. Two-hour AICAR + MG132 induces both HuR cytoplasmic translocation and threonine phosphorylation via the Erk1/2 pathway. In these conditions, p62 mRNA is loaded on polysomes and its translation in de novo protein is favored. Additionally, for the first time, we report that JNK can phosphorylate HuR, however, without modulating its localization. Our study supports HuR’s role as an upstream regulator of p62 expression in ARPE-19 cells, helps to understand better the early events in response to a proautophagy stimulus, and suggests that modulation of the autophagy-regulating kinases as potential therapeutic targets for AMD may be relevant.
Expression study of CYP19A1 gene in a cohort of Iranian leiomyoma patients
Directory of Open Access Journals (Sweden)
Leila Emrahi
2018-07-01
Full Text Available Background: CYP19A1 gene encodes aromatase, a microsomal key enzyme that catalyzes the synthesis of estrogens from androgens. Accumulating evidence has revealed that aromatase plays an important role in the pathogenesis of leiomyoma through increasing local concentration of estrogens. In this study, we examined the levels of CYP19A1 mRNA to determine the impact of aromatase overexpression in uterine leiomyoma growth. Subjects and methods: Tissues were obtained via myomectomy or hysterectomy from 30 patients. Total RNA was extracted and cDNA was synthesized from each frozen sample. Using SYBR Green dye, Real-time PCR assay was performed by sequence-specific primers. Relative mRNA expression was normalized to the mean of the Ct values determined for HPRT1. Gene expression ratio in each sample was determined relative to the mean ΔCt value of tumor-free margin samples. Results: PCR efficiencies for amplification reactions of HPRT1, and CYP19A genes were calculated as 0.93 and 0.96, respectively. Regression coefficients (R for standard curves were above 0.90. The obtained data revealed that the mean fold increase of CYP19A1 gene expression in leiomyoma samples relative to normal samples was 3.551 (95% CI: 0.04–6.64, S.E., 0.29–5.35. Conclusions: Our results were in accordance with previous studies and imply that up-regulation of CYP19A1 is correlated with the pathogenesis of leiomyoma tumors. We also observed that expression level of CYP19A1 was not linked to the tumor size or localization. It can be concluded that; up-regulation of aromatase is a key factor in the initiation of tumor development as well as tumor growth. Keywords: Leiomyoma, CYP19A1, Real-time PCR, Gene expression study
Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels
Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...
In trans silencing properties of a tobacco transgene locus depend on its epigenetic state
Czech Academy of Sciences Publication Activity Database
Fojtová, Miloslava; Van Houdt, H.; Depicker, A.; Kovařík, Aleš
2004-01-01
Roč. 26, č. 3 (2004), s. 147 ISSN 0137-5881. [Congress of the Federation of European Societies of Plant Biology /14./. 23.08.2004-27.08.2004, Cracow] Keywords : plant transgenes * gene expression * silencing Subject RIV: BO - Biophysics
Energy Technology Data Exchange (ETDEWEB)
Hanson, A L; Kraner, H W; Shroy, R E; Jones, K W [Brookhaven National Lab., Upton, NY (USA)
1984-08-01
The fluorine contents of National Bureau of Standards (NBS) Standard Reference Materials (SRM) 91, opal glass; 120b, phosphate rock; and 2671a, freeze-dried urine; have been measured using the /sup 19/F(p,p'..gamma..)/sup 19/F reaction at a proton energy of 3.1 MeV. The results are in good agreement with the values certified by the NBS.
Silencing effect of shRNA expression vectors with stem length of 21 ...
African Journals Online (AJOL)
Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...
How Silent is the Right to Silence?
Directory of Open Access Journals (Sweden)
Katherine Biber
2012-11-01
Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.
Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing
Directory of Open Access Journals (Sweden)
Chantelle Ahlenstiel
2015-01-01
Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.
Directory of Open Access Journals (Sweden)
Susheela Kushwaha
Full Text Available The trehalose metabolic enzymes have been considered as potential targets for drug or vaccine in several organisms such as Mycobacterium, plant nematodes, insects and fungi due to crucial role of sugar trehalose in embryogenesis, glucose uptake and protection from stress. Trehalose-6-phosphate phosphatase (TPP is one of the enzymes of trehalose biosynthesis that has not been reported in mammals. Silencing of tpp gene in Caenorhabditis elegans revealed an indispensable functional role of TPP in nematodes.In the present study, functional role of B. malayi tpp gene was investigated by siRNA mediated silencing which further validated this enzyme to be a putative antifilarial drug target. The silencing of tpp gene in adult female B. malayi brought about severe phenotypic deformities in the intrauterine stages such as distortion and embryonic development arrest. The motility of the parasites was significantly reduced and the microfilarial production as well as their in vitro release from the female worms was also drastically abridged. A majority of the microfilariae released in to the culture medium were found dead. B. malayi infective larvae which underwent tpp gene silencing showed 84.9% reduced adult worm establishment after inoculation into the peritoneal cavity of naïve jirds.The present findings suggest that B. malayi TPP plays an important role in the female worm embryogenesis, infectivity of the larvae and parasite viability. TPP enzyme of B. malayi therefore has the potential to be exploited as an antifilarial drug target.
Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame
2014-04-20
A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.
Directory of Open Access Journals (Sweden)
Ana Neves-Costa
2009-12-01
Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.
Miller, E. N.; Jarboe, L. R.; Yomano, L. P.; York, S. W.; Shanmugam, K. T.; Ingram, L. O.
2009-01-01
Low concentrations of furfural are formed as a side product during the dilute acid hydrolysis of hemicellulose. Growth is inhibited by exposure to furfural but resumes after the complete reduction of furfural to the less toxic furfuryl alcohol. Growth-based selection was used to isolate a furfural-resistant mutant of ethanologenic Escherichia coli LY180, designated strain EMFR9. Based on mRNA expression levels in the parent and mutant in response to furfural challenge, genes encoding 12 oxidoreductases were found to vary by more than twofold (eight were higher in EMFR9; four were higher in the parent). All 12 genes were cloned. When expressed from plasmids, none of the eight genes in the first group increased furfural tolerance in the parent (LY180). Expression of three of the silenced genes (yqhD, dkgA, and yqfA) in EMFR9 was found to decrease furfural tolerance compared to that in the parent. Purified enzymes encoded by yqhD and dkgA were shown to have NADPH-dependent furfural reductase activity. Both exhibited low Km values for NADPH (8 μM and 23 μM, respectively), similar to those of biosynthetic reactions. Furfural reductase activity was not associated with yqfA. Deleting yqhD and dkgA in the parent (LY180) increased furfural tolerance, but not to the same extent observed in the mutant EMFR9. Together, these results suggest that the process of reducing furfural by using an enzyme with a low Km for NADPH rather than a direct inhibitory action is the primary cause for growth inhibition by low concentrations of furfural. PMID:19429550
Directory of Open Access Journals (Sweden)
Cheng-Cao Sun
2017-12-01
Full Text Available Long noncoding RNAs (lncRNAs are emerging as important regulators during tumorigenesis by serving as competing endogenous RNAs (ceRNAs. In this study, the qRT-PCR results indicated that the lncRNA protein disulfide isomerase family A member 3 pseudogene 1 (PDIA3P was overexpressed in oral squamous cell carcinoma (OSCC and decreased the survival rate of OSCC patients. CCK-8 and clonal colony formation assays were used to detect the effects of PDIA3P on proliferation. Results revealed that silencing PDIA3P by small interfering RNA (siRNA inhibited OSCC cell proliferation and repressed tumor growth and reduced the expression of proliferation antigen Ki-67 in vivo. Furthermore, the interaction between PDIA3P and miRNAs was then analyzed by qRT-PCR and luciferase reporter gene assay. We found that PDIA3P negatively regulated miR-185-5p in OSCC cells. Simultaneously, we found that silencing PDIA3P by siRNA suppressed proliferation via miR-185-5p in OSCC cells. Moreover, silencing PDIA3P by siRNA inhibited CCND2 protein (no influence on mRNA levels expression via miR-185-5p in OSCC cells, and CCND2 facilitated cell proliferation of SCC4 and SCC15 cells induced by sh-PDIA3P#1. Therefore, our study demonstrated that PDIA3P may be a therapeutic target for the treatment of OSCC.
Directory of Open Access Journals (Sweden)
Noreen F Rizvi
Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.
Directory of Open Access Journals (Sweden)
Hitoshi Suzuki
Full Text Available BACKGROUND: Alternative splicing, which produces multiple mRNAs from a single gene, occurs in most human genes and contributes to protein diversity. Many alternative isoforms are expressed in a spatio-temporal manner, and function in diverse processes, including in the neural system. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of the present study was to comprehensively investigate neural-splicing using P19 cells. GeneChip Exon Array analysis was performed using total RNAs purified from cells during neuronal cell differentiation. To efficiently and readily extract the alternative exon candidates, 9 filtering conditions were prepared, yielding 262 candidate exons (236 genes. Semiquantitative RT-PCR results in 30 randomly selected candidates suggested that 87% of the candidates were differentially alternatively spliced in neuronal cells compared to undifferentiated cells. Gene ontology and pathway analyses suggested that many of the candidate genes were associated with neural events. Together with 66 genes whose functions in neural cells or organs were reported previously, 47 candidate genes were found to be linked to 189 events in the gene-level profile of neural differentiation. By text-mining for the alternative isoform, distinct functions of the isoforms of 9 candidate genes indicated by the result of Exon Array were confirmed. CONCLUSIONS/SIGNIFICANCE: Alternative exons were successfully extracted. Results from the informatics analyses suggested that neural events were primarily governed by genes whose expression was increased and whose transcripts were differentially alternatively spliced in the neuronal cells. In addition to known functions in neural cells or organs, the uninvestigated alternative splicing events of 11 genes among 47 candidate genes suggested that cell cycle events are also potentially important. These genes may help researchers to differentiate the roles of alternative splicing in cell differentiation and cell
International Nuclear Information System (INIS)
Liu Xiaoqun; Qiao Tiankui
2014-01-01
Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)
Zhang, Z W; Ma, G J; Zhao, J; Markell, S G; Qi, L L
2017-01-01
A new downy mildew resistance gene, Pl 19 , was identified from wild Helianthus annuus accession PI 435414, introduced to confection sunflower, and genetically mapped to linkage group 4 of the sunflower genome. Wild Helianthus annuus accession PI 435414 exhibited resistance to downy mildew, which is one of the most destructive diseases to sunflower production globally. Evaluation of the 140 BC 1 F 2:3 families derived from the cross of CMS CONFSCLB1 and PI 435414 against Plasmopara halstedii race 734 revealed that a single dominant gene controls downy mildew resistance in the population. Bulked segregant analysis conducted in the BC 1 F 2 population with 860 simple sequence repeat (SSR) markers indicated that the resistance derived from wild H. annuus was associated with SSR markers located on linkage group (LG) 4 of the sunflower genome. To map and tag this resistance locus, designated Pl 19 , 140 BC 1 F 2 individuals were used to construct a linkage map of the gene region. Two SSR markers, ORS963 and HT298, were linked to Pl 19 within a distance of 4.7 cM. After screening 27 additional single nucleotide polymorphism (SNP) markers previously mapped to this region, two flanking SNP markers, NSA_003564 and NSA_006089, were identified as surrounding the Pl 19 gene at a distance of 0.6 cM from each side. Genetic analysis indicated that Pl 19 is different from Pl 17 , which had previously been mapped to LG4, but is closely linked to Pl 17 . This new gene is highly effective against the most predominant and virulent races of P. halstedii currently identified in North America and is the first downy mildew resistance gene that has been transferred to confection sunflower. The selected resistant germplasm derived from homozygous BC 2 F 3 progeny provides a novel gene for use in confection sunflower breeding programs.
Directory of Open Access Journals (Sweden)
Robyn P Hickerson
2013-01-01
Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.
Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen
2017-11-24
To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.
Höfer, Peter; Schosser, Alexandra; Calati, Raffaella; Serretti, Alessandro; Massat, Isabelle; Kocabas, Neslihan Aygun; Konstantinidis, Anastasios; Linotte, Sylvie; Mendlewicz, Julien; Souery, Daniel; Zohar, Joseph; Juven-Wetzler, Alzbeta; Montgomery, Stuart; Kasper, Siegfried
2013-08-01
Recently published data have reported associations between cytochrome P450 metabolizer status and suicidality. The aim of our study was to investigate the role of genetic polymorphisms of the cytochrome P450 genes on suicide risk and/or a personal history of suicide attempts. Two hundred forty-three major depressive disorder patients were collected in the context of a European multicentre resistant depression study and treated with antidepressants at adequate doses for at least 4 weeks. Suicidality was assessed using the Mini International Neuropsychiatric Interview and the Hamilton Rating Scale for Depression (HAM-D). Treatment response was defined as HAM-D ≤ 17 and remission as HAM-D ≤ 7 after 4 weeks of treatment with antidepressants at adequate dose. Genotyping was performed for all relevant variations of the CYP1A2 gene (*1A, *1F, *1C, *1 J, *1 K), the CYP2C9 gene (*2, *3), the CYP2C19 gene (*2, *17) and the CYP2D6 gene (*3, *4, *5, *6, *9, *19, *XN). No association between both suicide risk and personal history of suicide attempts, and the above mentioned metabolic profiles were found after multiple testing corrections. In conclusion, the investigated cytochrome gene polymorphisms do not seem to be associated with suicide risk and/or a personal history of suicide attempts, though methodological and sample size limitations do not allow definitive conclusions.
Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla
2017-11-01
Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly
Coolen, M.W.; Stirzaker, C.; Song, J.Z.; Statham, A.L.; Kassir, Z.; Moreno, C.S.; Young, A.N.; Varma, V.; Speed, T.P.; Cowley, M.; Lacaze, P.; Kaplan, W.; Robinson, M.D.; Clark, S. J.
2010-01-01
Silencing of individual genes can occur by genetic and epigenetic processes during carcinogenesis, but the underlying mechanisms remain unclear. By creating an integrated prostate cancer epigenome map using tiling arrays, we show that contiguous regions of gene suppression commonly occur through
Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju
2016-01-01
This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.
Judicial review of administrative silence
Directory of Open Access Journals (Sweden)
Radošević Ratko S.
2015-01-01
Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.
Durability of timber silencers at Wairakei geothermal steam field
Energy Technology Data Exchange (ETDEWEB)
Hedley, M E
1979-02-01
After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.
Human Parvovirus B19 in childhood acute lymphoblastic leukaemia in basrah
International Nuclear Information System (INIS)
Ibrahem, W.N.; Hasony, H.J.; Hassan, J.G.
2014-01-01
Objective: To investigate the association of human parvovirus B19 infection with the onset of acute lymphoblastic leukaemia and its effect on TEL-AML-1 fusion gene and the presence of mutant P53. Methods: The case-control study was conducted at Basrah Hospital for Paediatrics and Gynaecology, Basrah, Iraq, from May 2009 to April 2010. A total of 100 blood samples were collected from 40 newly diagnosed cases and 60 healthy children to serve as control matched by age and gender. Human parvovirus B19-IgG and anti-P53 antibody were detected by enzyme-linked immunosorbent assay and TEL-AML-1 fusion gene was detected by reverse transcriptase-polymerase chain reaction on extracted ribonucleic acid from fresh blood samples using specified primers. SPSS 15 was used for statistical analysis. Results: A higher proportion of human parvovirus B19-positive cases was found in leukaemic patients (n=19; 47.5%) compared to 12 (20%) in the control group (p<0.05). There was significant association between Tel-Amyl-1 translocation and human parvovirus-B19 infection as 10 (71.4%) of TEL-AML-1 translocation-positive cases had human parvovirus-B19 IgG. On the other hand, there was no association between such infections and P53 gene mutation in the patients. Conclusion: Human parvovirus-B19 infection is common in the population, with higher prevalence among leukaemic patients with significant association between human parvovirus-B19 and TEL-AML-1 fusion gene in patients of acute lymphoblastic leukaemia. (author)
Directory of Open Access Journals (Sweden)
Kishor Duwadi
Full Text Available Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10 were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER, suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves.
PfSETvs methylation of histone H3K36 represses virulence genes in Plasmodium falciparum
DEFF Research Database (Denmark)
Jiang, Lubin; Mu, Jianbing; Zhang, Qingfeng
2013-01-01
The variant antigen Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1), which is expressed on the surface of P. falciparum-infected red blood cells, is a critical virulence factor for malaria. Each parasite has 60 antigenically distinct var genes that each code for a different PfEMP1...... parasite nuclei and their expression as proteins on the surface of individual infected red blood cells. PfSETvs-dependent H3K36me3 is present along the entire gene body, including the transcription start site, to silence var genes. With low occupancy of PfSETvs at both the transcription start site of var...... protein. During infection the clonal parasite population expresses only one gene at a time before switching to the expression of a new variant antigen as an immune-evasion mechanism to avoid the host antibody response. The mechanism by which 59 of the 60 var genes are silenced remains largely unknown...
Wang, Sheng-Chang; Ho, Ing-Kang; Tsou, Hsiao-Hui; Liu, Sheng-Wen; Hsiao, Chin-Fu; Chen, Chia-Hui; Tan, Happy Kuy-Lok; Lin, Linen; Wu, Chi-Shin; Su, Lien-Wen; Huang, Chieh-Liang; Yang, Yi-Hong; Liu, Ming-Lun; Lin, Keh-Ming; Liu, Shu Chih; Wu, Hsiao-Yu; Kuo, Hsiang-Wei; Chen, Andrew C H; Chang, Yao-Sheng; Liu, Yu-Li
2013-10-01
Abstract Methadone maintenance therapy is an established treatment for heroin dependence. This study tested the influence of functional genetic polymorphisms in CYP2C19 gene encoding a CYP450 enzyme that contributes to methadone metabolism on treatment dose, plasma concentration, and side effects of methadone. Two single nucleotide polymorphisms (SNPs), rs4986893 (exon 4) and rs4244285 (exon 5), were selected and genotyped in 366 patients receiving methadone maintenance therapy in Taiwan. The steady-state plasma concentrations of both methadone and its EDDP metabolite enantiomers were measured. SNP rs4244285 allele was significantly associated with the corrected QT interval (QTc) change in the electrocardiogram (p=0.021), and the Treatment Emergent Symptom Scale (TESS) total score (p=0.021) in patients who continued using heroin, as demonstrated with a positive urine opiate test. Using the gene dose (GD) models where the CYP2C19 SNPs were clustered into poor (0 GD) versus intermediate (1 GD) and extensive (2 GD) metabolizers, we found that the extensive metabolizers required a higher dose of methadone (p=0.035), and showed a lower plasma R-methadone/methadone dose ratio (p=0.007) in urine opiate test negative patients, as well as a greater QTc change (p=0.008) and higher total scores of TESS (p=0.018) in urine opiate test positive patients, than poor metabolizers. These results in a large study sample from Taiwan suggest that the gene dose of CYP2C19 may potentially serve as an indicator for the plasma R-methadone/methadone dose ratio and cardiac side effect in patients receiving methadone maintenance therapy. Further studies of pharmacogenetic variation in methadone pharmacokinetics and pharmacodynamics are warranted in different world populations.
Association between genes on chromosome 19p13.2 and panic disorder
DEFF Research Database (Denmark)
Gregersen, Noomi; Buttenschøn, Henriette Nørmølle; Hedemand, Anne
2016-01-01
.2 as a candidate region. To further investigate this chromosomal region for association with PD, we analysed eight single nucleotide polymorphisms (SNPs) in three candidate genes - small-nuclear RNA activating complex, polypeptide 2 (SNAPC2), mitogen-activated protein kinase kinase 7 (MAP2K7) and leucine......-rich repeat containing 8 family, member E (LRRC8E) - these genes have previously been directly or indirectly implicated in other mental disorders. A total of 511 patients with PD and 1029 healthy control individuals from the Faroe Islands, Denmark and Germany were included in the current study. SNPs covering...... the gene region of SNAPC2, MAP2K7 and LRRC8E were genotyped and tested for association with PD. In the Faroese cohort, rs7788 within SNAPC2 was significantly associated with PD, whereas rs3745383 within LRRC8E was nominally associated. No association was observed between the analysed SNPs and PD...
International Nuclear Information System (INIS)
Xue, Xiaofeng; Liu, Fei; Han, Ye; Li, Pu; Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting; Zhi, Qiaoming; Zhao, Hong
2014-01-01
Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer
Energy Technology Data Exchange (ETDEWEB)
Xue, Xiaofeng [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Liu, Fei [Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Han, Ye [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Li, Pu [Shanghai Key Laboratory of Gastric Neoplasms, Shanghai Institute of Digestive Surgery, Department of Surgery, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhi, Qiaoming, E-mail: strexboy@163.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhao, Hong, E-mail: zhaohong600@sina.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China)
2014-07-25
Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer.
Murphy, Shawn P; Holtz, Renae; Lewandowski, Nicole; Tomasi, Thomas B; Fuji, Hiroshi
2002-09-15
MHC class II (Ia) Ag expression is inversely correlated with tumorigenicity and directly correlated with immunogenicity in clones of the mouse L1210 lymphoma (1 ). Understanding the mechanisms by which class II Ag expression is regulated in L1210 lymphoma may facilitate the development of immunotherapeutic approaches for the treatment of some types of lymphoma and leukemia. This study demonstrates that the variation in MHC class II Ag expression among clones of L1210 lymphoma is due to differences in the expression of the class II transactivator (CIITA). Analysis of stable hybrids suggests that CIITA expression is repressed by a dominant mechanism in class II-negative L1210 clones. DNA-alkylating agents such as ethyl methanesulfonate and the chemotherapeutic drug melphalan activate CIITA and class II expression in class II negative L1210 cells, and this effect appears to be restricted to transformed cell lines derived from the early stages of B cell ontogeny. Transient transfection assays demonstrated that the CIITA type III promoter is active in class II(-) L1210 cells, despite the fact that the endogenous gene is not expressed, which suggests that these cells have all of the transacting factors necessary for CIITA transcription. An inverse correlation between methylation of the CIITA transcriptional regulatory region and CIITA expression was observed among L1210 clones. Furthermore, 5-azacytidine treatment activated CIITA expression in class II-negative L1210 cells. Collectively, our results suggest that 1) CIITA gene expression is repressed in class II(-) L1210 cells by methylation of the CIITA upstream regulatory region, and 2) treatment with DNA-alkylating agents overcomes methylation-based silencing of the CIITA gene in L1210 cells.